WorldWideScience

Sample records for mucosal immune barrier

  1. HIV enteropathy and aging: gastrointestinal immunity, mucosal epithelial barrier, and microbial translocation.

    Science.gov (United States)

    Wang, Hongyin; Kotler, Donald P

    2014-07-01

    Despite decreases in morbidity and mortality as a result of antiretroviral therapy, gastrointestinal dysfunction remains common in HIV infection. Treated patients are at risk for complications of 'premature' aging, such as cardiovascular disease, osteopenia, neurocognitive decline, malignancies, and frailty. This review summarizes recent observations in this field. Mucosal CD4 lymphocytes, especially Th17 cells, are depleted in acute HIV and simian immune deficiency virus (SIV) infections, although other cell types also are affected. Reconstitution during therapy often is incomplete, especially in mucosa. Mucosal barrier function is affected by both HIV infection and aging and includes paracellular transport via tight junctions and uptake through areas of apoptosis; other factors may affect systemic antigen exposure. The resultant microbial translocation is associated with systemic immune activation in HIV and SIV infections. There is evidence of immune activation and microbial translocation in the elderly. The immune phenotypes of immunosenescence in HIV infection and aging appear similar. There are several targets for intervention; blockage of residual mucosal virus replication, preventing antigen uptake, modulating the microbiome, improving T cell recovery, combining therapies aimed at mucosal integrity, augmenting mucosal immunity, and managing traditional risk factors for premature aging in the general population. Aging may interact with HIV enteropathy to enhance microbial translocation and immune activation.

  2. Mucosal immunity to poliovirus.

    Science.gov (United States)

    Ogra, Pearay L; Okayasu, Hiromasa; Czerkinsky, Cecil; Sutter, Roland W

    2011-10-01

    The Global Polio Eradication Initiative (GPEI) currently based on use of oral poliovirus vaccine (OPV) has identified suboptimal immunogenicity of this vaccine as a major impediment to eradication, with a failure to induce protection against paralytic poliomyelitis in certain population segments in some parts of the world. The Mucosal Immunity and Poliovirus Vaccines: Impact on Wild Poliovirus Infection, Transmission and Vaccine Failure conference was organized to obtain a better understanding of the current status of global control of poliomyelitis and identify approaches to improve the immune responsiveness and effectiveness of the orally administered poliovirus vaccines in order to accelerate the global eradication of paralytic poliomyelitis.

  3. The Immune System Bridges the Gut Microbiota with Systemic Energy Homeostasis: Focus on TLRs, Mucosal Barrier, and SCFAs.

    Science.gov (United States)

    Spiljar, Martina; Merkler, Doron; Trajkovski, Mirko

    2017-01-01

    The gut microbiota is essential for the development and regulation of the immune system and the metabolism of the host. Germ-free animals have altered immunity with increased susceptibility to immunologic diseases and show metabolic alterations. Here, we focus on two of the major immune-mediated microbiota-influenced components that signal far beyond their local environment. First, the activation or suppression of the toll-like receptors (TLRs) by microbial signals can dictate the tone of the immune response, and they are implicated in regulation of the energy homeostasis. Second, we discuss the intestinal mucosal surface is an immunologic component that protects the host from pathogenic invasion, is tightly regulated with regard to its permeability and can influence the systemic energy balance. The short chain fatty acids are a group of molecules that can both modulate the intestinal barrier and escape the gut to influence systemic health. As modulators of the immune response, the microbiota-derived signals influence functions of distant organs and can change susceptibility to metabolic diseases.

  4. Antimicrobial peptides in the female reproductive tract: a critical component of the mucosal immune barrier with physiological and clinical implications.

    Science.gov (United States)

    Yarbrough, Victoria L; Winkle, Sean; Herbst-Kralovetz, Melissa M

    2015-01-01

    At the interface of the external environment and the mucosal surface of the female reproductive tract (FRT) lies a first-line defense against pathogen invasion that includes antimicrobial peptides (AMP). Comprised of a unique class of multifunctional, amphipathic molecules, AMP employ a wide range of functions to limit microbial invasion and replication within host cells as well as independently modulate the immune system, dampen inflammation and maintain tissue homeostasis. The role of AMP in barrier defense at the level of the skin and gut has received much attention as of late. Given the far reaching implications for women's health, maternal and fetal morbidity and mortality, and sexually transmissible and polymicrobial diseases, we herein review the distribution and function of key AMP throughout the female reproductive mucosa and assess their role as an essential immunological barrier to microbial invasion throughout the reproductive cycle of a woman's lifetime. A comprehensive search in PubMed/Medline was conducted related to AMP general structure, function, signaling, expression, distribution and barrier function of AMP in the FRT, hormone regulation of AMP, the microbiome of the FRT, and AMP in relation to implantation, pregnancy, fertility, pelvic inflammatory disease, complications of pregnancy and assisted reproductive technology. AMP are amphipathic peptides that target microbes for destruction and have been conserved throughout all living organisms. In the FRT, several major classes of AMP are expressed constitutively and others are inducible at the mucosal epithelium and by immune cells. AMP expression is also under the influence of sex hormones, varying throughout the menstrual cycle, and dependent on the vaginal microbiome. AMP can prevent infection with sexually transmissible and opportunistic pathogens of the female reproductive tissues, although emerging understanding of vaginal dysbiosis suggests induction of a unique AMP profile with increased

  5. Interplay among gut microbiota, intestinal mucosal barrier and enteric neuro-immune system: a common path to neurodegenerative diseases?

    Science.gov (United States)

    Pellegrini, Carolina; Antonioli, Luca; Colucci, Rocchina; Blandizzi, Corrado; Fornai, Matteo

    2018-05-24

    Neurological diseases, such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS) and multiple sclerosis, are often associated with functional gastrointestinal disorders. These gastrointestinal disturbances may occur at all stages of the neurodegenerative diseases, to such an extent that they are now considered an integral part of their clinical picture. Several lines of evidence support the contention that, in central neurodegenerative diseases, changes in gut microbiota and enteric neuro-immune system alterations could contribute to gastrointesinal dysfunctions as well as initiation and upward spreading of the neurologic disorder. The present review has been intended to provide a comprehensive overview of the available knowledge on the role played by enteric microbiota, mucosal immune system and enteric nervous system, considered as an integrated network, in the pathophysiology of the main neurological diseases known to be associated with intestinal disturbances. In addition, based on current human and pre-clinical evidence, our intent was to critically discuss whether changes in the dynamic interplay between gut microbiota, intestinal epithelial barrier and enteric neuro-immune system are a consequence of the central neurodegeneration or might represent the starting point of the neurodegenerative process. Special attention has been paid also to discuss whether alterations of the enteric bacterial-neuro-immune network could represent a common path driving the onset of the main neurodegenerative diseases, even though each disease displays its own distinct clinical features.

  6. Eosinophils in mucosal immune responses

    Science.gov (United States)

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  7. The Mucosal Immune System of Teleost Fish

    Directory of Open Access Journals (Sweden)

    Irene Salinas

    2015-08-01

    Full Text Available Teleost fish possess an adaptive immune system associated with each of their mucosal body surfaces. Evidence obtained from mucosal vaccination and mucosal infection studies reveal that adaptive immune responses take place at the different mucosal surfaces of teleost. The main mucosa-associated lymphoid tissues (MALT of teleosts are the gut-associated lymphoid tissue (GALT, skin-associated lymphoid tissue (SALT, the gill-associated lymphoid tissue (GIALT and the recently discovered nasopharynx-associated lymphoid tissue (NALT. Teleost MALT includes diffuse B cells and T cells with specific phenotypes different from their systemic counterparts that have co-evolved to defend the microbe-rich mucosal environment. Both B and T cells respond to mucosal infection or vaccination. Specific antibody responses can be measured in the gills, gut and skin mucosal secretions of teleost fish following mucosal infection or vaccination. Rainbow trout studies have shown that IgT antibodies and IgT+ B cells are the predominant B cell subset in all MALT and respond in a compartmentalized manner to mucosal infection. Our current knowledge on adaptive immunity in teleosts is limited compared to the mammalian literature. New research tools and in vivo models are currently being developed in order to help reveal the great intricacy of teleost mucosal adaptive immunity and help improve mucosal vaccination protocols for use in aquaculture.

  8. Roles of Mucosal Immunity against Mycobacterium tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Wu Li

    2012-01-01

    Full Text Available Mycobacterium tuberculosis (Mtb, the causative agent of tuberculosis (TB, is one of the world's leading infectious causes of morbidity and mortality. As a mucosal-transmitted pathogen, Mtb infects humans and animals mainly through the mucosal tissue of the respiratory tract. Apart from providing a physical barrier against the invasion of pathogen, the major function of the respiratory mucosa may be to serve as the inductive sites to initiate mucosal immune responses and sequentially provide the first line of defense for the host to defend against this pathogen. A large body of studies in the animals and humans have demonstrated that the mucosal immune system, rather than the systemic immune system, plays fundamental roles in the host’s defense against Mtb infection. Therefore, the development of new vaccines and novel delivery routes capable of directly inducing respiratory mucosal immunity is emphasized for achieving enhanced protection from Mtb infection. In this paper, we outline the current state of knowledge regarding the mucosal immunity against Mtb infection, including the development of TB vaccines, and respiratory delivery routes to enhance mucosal immunity are discussed.

  9. Effect of glutamine-enriched nutritional support on intestinal mucosal barrier function, MMP-2, MMP-9 and immune function in patients with advanced gastric cancer during perioperative chemotherapy.

    Science.gov (United States)

    Wang, Juan; Li, Yanfen; Qi, Yuanling

    2017-09-01

    We studied the effects of glutamine-enriched nutritional support on intestinal mucosal barrier, matrix metalloproteinase (MMP)-2, MMP-9 and immune function during perioperative chemotherapy in patients with advanced gastric cancer. The study was conducted on 94 patients with advanced gastric cancer admitted from April 2015 to March 2016. They were randomly divided into observation and control groups, n=47. Control group was given basic nutritional support whereas glutamine-enriched nutritional support was given to patients in observation group. High-performance liquid chromatography was used to measure lactulose and mannitol ratio in urine (L/M) and ELISA was used to measure D-lactate levels before chemotherapy and in the 1st, 2nd and 3rd cycle of chemotherapy. Immunoglobulin level was detected by immune turbidimetry assay, T lymphocyte subsets were determined by flow cytometry after 3 cycles of chemotherapy, MMP-2 and MMP-9 of patients were compared between the two groups. The serious adverse reactions incidence (grade and IV) of patients were observed. To evaluate the life quality of patients, QLQ-C30 was used after 6 months. The levels of L/M and D-lactate in both groups after the first cycle of chemotherapy were significantly higher than that before chemotherapy; they began to decline after the second or third cycle, but were still significantly higher than the levels before chemotherapy (pgroups after 1st, 2nd, 3rd cycle after chemotherapy, L/M and D-lactate levels of patients in the observation group were significantly lower than in the control group (pgroup was significantly lower than control group (pgroup were significantly higher than control group (pnutritional support can effectively protect the intestinal mucosal barrier function in patients with advanced gastric cancer in their perioperative chemotherapy, improve the level of MMP-2 and MMP-9 in patients with advanced gastric cancer, enhance their immune function, reduce the incidence of adverse

  10. Inside the mucosal immune system.

    Directory of Open Access Journals (Sweden)

    Jerry R McGhee

    Full Text Available An intricate network of innate and immune cells and their derived mediators function in unison to protect us from toxic elements and infectious microbial diseases that are encountered in our environment. This vast network operates efficiently by use of a single cell epithelium in, for example, the gastrointestinal (GI and upper respiratory (UR tracts, fortified by adjoining cells and lymphoid tissues that protect its integrity. Perturbations certainly occur, sometimes resulting in inflammatory diseases or infections that can be debilitating and life threatening. For example, allergies in the eyes, skin, nose, and the UR or digestive tracts are common. Likewise, genetic background and environmental microbial encounters can lead to inflammatory bowel diseases (IBDs. This mucosal immune system (MIS in both health and disease is currently under intense investigation worldwide by scientists with diverse expertise and interests. Despite this activity, there are numerous questions remaining that will require detailed answers in order to use the MIS to our advantage. In this issue of PLOS Biology, a research article describes a multi-scale in vivo systems approach to determine precisely how the gut epithelium responds to an inflammatory cytokine, tumor necrosis factor-alpha (TNF-α, given by the intravenous route. This article reveals a previously unknown pathway in which several cell types and their secreted mediators work in unison to prevent epithelial cell death in the mouse small intestine. The results of this interesting study illustrate how in vivo systems biology approaches can be used to unravel the complex mechanisms used to protect the host from its environment.

  11. Mucosal immunity to pathogenic intestinal bacteria.

    Science.gov (United States)

    Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

    2016-03-01

    The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

  12. Multiscale modeling of mucosal immune responses

    Science.gov (United States)

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  13. Multiscale modeling of mucosal immune responses.

    Science.gov (United States)

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  14. Mucosal vaccines: recent progress in understanding the natural barriers.

    Science.gov (United States)

    Borges, Olga; Lebre, Filipa; Bento, Dulce; Borchard, Gerrit; Junginger, Hans E

    2010-02-01

    It has long been known that protection against pathogens invading the organism via mucosal surfaces correlates better with the presence of specific antibodies in local secretions than with serum antibodies. The most effective way to induce mucosal immunity is to administer antigens directly to the mucosal surface. The development of vaccines for mucosal application requires antigen delivery systems and immunopotentiators that efficiently facilitate the presentation of the antigen to the mucosal immune system. This review provides an overview of the events within mucosal tissues that lead to protective mucosal immune responses. The understanding of those biological mechanisms, together with knowledge of the technology of vaccines and adjuvants, provides guidance on important technical aspects of mucosal vaccine design. Not being exhaustive, this review also provides information related to modern adjuvants, including polymeric delivery systems and immunopotentiators.

  15. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  16. Mucosal Ecological Network of Epithelium and Immune Cells for Gut Homeostasis and Tissue Healing.

    Science.gov (United States)

    Kurashima, Yosuke; Kiyono, Hiroshi

    2017-04-26

    The intestinal epithelial barrier includes columnar epithelial, Paneth, goblet, enteroendocrine, and tuft cells as well as other cell populations, all of which contribute properties essential for gastrointestinal homeostasis. The intestinal mucosa is covered by mucin, which contains antimicrobial peptides and secretory IgA and prevents luminal bacteria, fungi, and viruses from stimulating intestinal immune responses. Conversely, the transport of luminal microorganisms-mediated by M, dendritic, and goblet cells-into intestinal tissues facilitates the harmonization of active and quiescent mucosal immune responses. The bacterial population within gut-associated lymphoid tissues creates the intratissue cohabitations for harmonized mucosal immunity. Intermolecular and intercellular communication among epithelial, immune, and mesenchymal cells creates an environment conducive for epithelial regeneration and mucosal healing. This review summarizes the so-called intestinal mucosal ecological network-the complex but vital molecular and cellular interactions of epithelial mesenchymal cells, immune cells, and commensal microbiota that achieve intestinal homeostasis, regeneration, and healing.

  17. Evidence for a common mucosal immune system in the pig.

    Science.gov (United States)

    Wilson, Heather L; Obradovic, Milan R

    2015-07-01

    The majority of lymphocytes activated at mucosal sites receive instructions to home back to the local mucosa, but a portion also seed distal mucosa sites. By seeding distal sites with antigen-specific effector or memory lymphocytes, the foundation is laid for the animal's mucosal immune system to respond with a secondary response should to this antigen be encountered at this site in the future. The common mucosal immune system has been studied quite extensively in rodent models but less so in large animal models such as the pig. Reasons for this paucity of reported induction of the common mucosal immune system in this species may be that distal mucosal sites were examined but no induction was observed and therefore it was not reported. However, we suspect that the majority of investigators simply did not sample distal mucosal sites and therefore there is little evidence of immune response induction in the literature. It is our hope that more pig immunologists and infectious disease experts who perform mucosal immunizations or inoculations on pigs will sample distal mucosal sites and report their findings, whether results are positive or negative. In this review, we highlight papers that show that immunization/inoculation using one route triggers mucosal immune system induction locally, systemically, and within at least one distal mucosal site. Only by understanding whether immunizations at one site triggers immunity throughout the common mucosal immune system can we rationally develop vaccines for the pig, and through these works we can gather evidence about the mucosal immune system that may be extrapolated to other livestock species or humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Mucosal immunity and B cells in teleosts: effect of vaccination and stress.

    Directory of Open Access Journals (Sweden)

    David eParra

    2015-07-01

    Full Text Available Fish are subjected to several insults from the environment, which may endanger animal survival. Mucosal surfaces are the first line of defense against those threats and they act as a physical barrier to protect the animal but also function as immunologically active tissues. Thus, four mucosal-associated lymphoid tissues have been described in fish, which lead the immune responses in gut, skin, gills and nose. Humoral and cellular immunity, as well as its regulation and the factors that influence the response in these mucosal lymphoid tissues is still not well known in most of fish species. Mucosal B-lymphocytes and immunoglobulins (Igs are one of the key players in the immune response after vaccination. Recent findings about IgT in trout have delimited the compartmentalization of immune response in systemic and mucosal. The existence of IgT as a specialized mucosa Ig gives us the opportunity of measuring mucosal specific responses after vaccination, a fact that was not possible until recently in most of the fish species. Vaccination process is influenced by several factors, being stress one of the main stimuli determining the success of the vaccine. Thus, one of the major goals in a vaccination process is to avoid possible situations of stress, which might interfere with fish immune performance. However, the interaction between immune and neuroendocrine systems at mucosal tissues is still unknown. In this review we will summarized the latest findings about B-lymphocytes and immunoglobulins in mucosal immunity and the effect of stress and vaccines on B cell response at mucosal sites. It is important to point out that a small number of studies have been published regarding mucosal stress and very few about the influence of stress over mucosal B-lymphocytes.

  19. The postnatal development of the mucosal immune system and mucosal tolerance in domestic animals

    OpenAIRE

    Bailey , Mick; Haverson , Karin

    2006-01-01

    International audience; The mucosal immune system is exposed to a range of antigens associated with pathogens, to which it must mount active immune responses. However, it is also exposed to a large number of harmless antigens associated with food and with commensal microbial flora, to which expression of active, inflammatory immune responses to these antigens is undesirable. The mucosal immune system must contain machinery capable of evaluating the antigens to which it is exposed and mounting...

  20. Impact of exogenous lipase supplementation on growth, intestinal function, mucosal immune and physical barrier, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2016-08-01

    This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.

  1. Physiology and immunology of mucosal barriers in catfish (Ictalurus spp.)

    Science.gov (United States)

    The mucosal barriers of catfish (Ictalurus spp.) constitute the first line of defense against pathogen invasion while simultaneously carrying out a diverse array of other critical physiological processes, including nutrient adsorption, osmoregulation, waste excretion, and environmental sensing. Catf...

  2. Brain-gut axis and mucosal immunity: a perspective on mucosal psychoneuroimmunology.

    LENUS (Irish Health Repository)

    Shanahan, F

    2012-02-03

    The role of the brain-gut axis has traditionally been investigated in relation to intestinal motility, secretion, and vascularity. More recently, the concept of brain-gut dialogue has extended to the relationship between the nervous system and mucosal immune function. There is compelling evidence for a reciprocal or bi-directional communication between the immune system and the neuroendocrine system. This is mediated, in part, by shared ligands (chemical messengers) and receptors that are common to the immune and nervous systems. Although the concept of psychoneuroimmunology and neuroimmune cross-talk has been studied primarily in the context of the systemic immune system, it is likely to have special significance in the gut. The mucosal immune system is anatomically, functionally, and operationally distinct from the systemic immune system and is subject to independent regulatory signals. Furthermore, the intestinal mucosal immune system operates in a local milieu that depends on a dense innervation for its integrity, with juxtaposition of neuroendocrine cells and mucosal immune cells. An overview of evidence for the biologic plausibility of a brain-gut-immune axis is presented and its potential relevance to mucosal inflammatory disorders is discussed.

  3. Intestinal dendritic cells in the regulation of mucosal immunity

    DEFF Research Database (Denmark)

    Bekiaris, Vasileios; Persson, Emma K.; Agace, William Winston

    2014-01-01

    immune cells within the mucosa must suitably respond to maintain intestinal integrity, while also providing the ability to mount effective immune responses to potential pathogens. Dendritic cells (DCs) are sentinel immune cells that play a central role in the initiation and differentiation of adaptive....... The recognition that dietary nutrients and microbial communities in the intestine influence both mucosal and systemic immune cell development and function as well as immune-mediated disease has led to an explosion of literature in mucosal immunology in recent years and a growing interest in the functionality...

  4. Mucosal Immune Regulation in Early Infancy: Monitoring and Intervention

    NARCIS (Netherlands)

    J. Hol (Jeroen)

    2011-01-01

    textabstractThe mucosal immune system of infants is dependent on the maintenance of mucosal homeostasis. Homeostasis results from the interaction between the mucosa and exogenous factors such as dietar and microbial agents. Induction and maintenance of homeostasis is a highly regluated system that

  5. Mucosal innate immune cells regulate both gut homeostasis and intestinal inflammation.

    Science.gov (United States)

    Kurashima, Yosuke; Goto, Yoshiyuki; Kiyono, Hiroshi

    2013-12-01

    Continuous exposure of intestinal mucosal surfaces to diverse microorganisms and their metabolites reflects the biological necessity for a multifaceted, integrated epithelial and immune cell-mediated regulatory system. The development and function of the host cells responsible for the barrier function of the intestinal surface (e.g., M cells, Paneth cells, goblet cells, and columnar epithelial cells) are strictly regulated through both positive and negative stimulation by the luminal microbiota. Stimulation by damage-associated molecular patterns and commensal bacteria-derived microbe-associated molecular patterns provokes the assembly of inflammasomes, which are involved in maintaining the integrity of the intestinal epithelium. Mucosal immune cells located beneath the epithelium play critical roles in regulating both the mucosal barrier and the relative composition of the luminal microbiota. Innate lymphoid cells and mast cells, in particular, orchestrate the mucosal regulatory system to create a mutually beneficial environment for both the host and the microbiota. Disruption of mucosal homeostasis causes intestinal inflammation such as that seen in inflammatory bowel disease. Here, we review the recent research on the biological interplay among the luminal microbiota, epithelial cells, and mucosal innate immune cells in both healthy and pathological conditions. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The Mucosal Immune System and Its Regulation by Autophagy.

    Science.gov (United States)

    Kabat, Agnieszka M; Pott, Johanna; Maloy, Kevin J

    2016-01-01

    The gastrointestinal tract presents a unique challenge to the mucosal immune system, which has to constantly monitor the vast surface for the presence of pathogens, while at the same time maintaining tolerance to beneficial or innocuous antigens. In the intestinal mucosa, specialized innate and adaptive immune components participate in directing appropriate immune responses toward these diverse challenges. Recent studies provide compelling evidence that the process of autophagy influences several aspects of mucosal immune responses. Initially described as a "self-eating" survival pathway that enables nutrient recycling during starvation, autophagy has now been connected to multiple cellular responses, including several aspects of immunity. Initial links between autophagy and host immunity came from the observations that autophagy can target intracellular bacteria for degradation. However, subsequent studies indicated that autophagy plays a much broader role in immune responses, as it can impact antigen processing, thymic selection, lymphocyte homeostasis, and the regulation of immunoglobulin and cytokine secretion. In this review, we provide a comprehensive overview of mucosal immune cells and discuss how autophagy influences many aspects of their physiology and function. We focus on cell type-specific roles of autophagy in the gut, with a particular emphasis on the effects of autophagy on the intestinal T cell compartment. We also provide a perspective on how manipulation of autophagy may potentially be used to treat mucosal inflammatory disorders.

  7. Mucosal Immune Regulation in Early Infancy: Monitoring and Intervention

    OpenAIRE

    Hol, Jeroen

    2011-01-01

    textabstractThe mucosal immune system of infants is dependent on the maintenance of mucosal homeostasis. Homeostasis results from the interaction between the mucosa and exogenous factors such as dietar and microbial agents. Induction and maintenance of homeostasis is a highly regluated system that involves different cell types. If homeostasis is lost this may lead to disease, including allergy and chronic intestinal inflammation. In this thesis we observed whether loss of homeostasis leading ...

  8. Intestinal stromal cells in mucosal immunity and homeostasis.

    Science.gov (United States)

    Owens, B M J; Simmons, A

    2013-03-01

    A growing body of evidence suggests that non-hematopoietic stromal cells of the intestine have multiple roles in immune responses and inflammation at this mucosal site. Despite this, many still consider gut stromal cells as passive structural entities, with past research focused heavily on their roles in fibrosis, tumor progression, and wound healing, rather than their contributions to immune function. In this review, we discuss our current knowledge of stromal cells in intestinal immunity, highlighting the many immunological axes in which stromal cells have a functional role. We also consider emerging data that broaden the potential scope of their contribution to immunity in the gut and argue that these so-called "non-immune" cells are reclassified in light of their diverse contributions to intestinal innate immunity and the maintenance of mucosal homeostasis.

  9. Characterization of the Probiotic Yeast Saccharomyces boulardii in the Healthy Mucosal Immune System.

    Science.gov (United States)

    Hudson, Lauren E; McDermott, Courtney D; Stewart, Taryn P; Hudson, William H; Rios, Daniel; Fasken, Milo B; Corbett, Anita H; Lamb, Tracey J

    2016-01-01

    The probiotic yeast Saccharomyces boulardii has been shown to ameliorate disease severity in the context of many infectious and inflammatory conditions. However, use of S. boulardii as a prophylactic agent or therapeutic delivery vector would require delivery of S. boulardii to a healthy, uninflamed intestine. In contrast to inflamed mucosal tissue, the diverse microbiota, intact epithelial barrier, and fewer inflammatory immune cells within the healthy intestine may all limit the degree to which S. boulardii contacts and influences the host mucosal immune system. Understanding the nature of these interactions is crucial for application of S. boulardii as a prophylactic agent or therapeutic delivery vehicle. In this study, we explore both intrinsic and immunomodulatory properties of S. boulardii in the healthy mucosal immune system. Genomic sequencing and morphological analysis of S. boulardii reveals changes in cell wall components compared to non-probiotic S. cerevisiae that may partially account for probiotic functions of S. boulardii. Flow cytometry and immunohistochemistry demonstrate limited S. boulardii association with murine Peyer's patches. We also show that although S. boulardii induces a systemic humoral immune response, this response is small in magnitude and not directed against S. boulardii itself. RNA-seq of the draining mesenteric lymph nodes indicates that even repeated administration of S. boulardii induces few transcriptional changes in the healthy intestine. Together these data strongly suggest that interaction between S. boulardii and the mucosal immune system in the healthy intestine is limited, with important implications for future work examining S. boulardii as a prophylactic agent and therapeutic delivery vehicle.

  10. Effects of synbiotics on intestinal mucosal barrier in rat model

    Directory of Open Access Journals (Sweden)

    Zhigang Xue

    2017-06-01

    Conclusions: Probiotics can improve the concentration of colonic probiotics, while synbiotics can improve probiotics concentration and mucosa thickness in colon, decrease L/M ratio and bacterial translocation. Synbiotics shows more protective effects on intestinal mucosal barrier in rats after cecectomy and gastrostomy and the intervention of specific antibiotics.

  11. Dual oxidase in mucosal immunity and host-microbe homeostasis.

    Science.gov (United States)

    Bae, Yun Soo; Choi, Myoung Kwon; Lee, Won-Jae

    2010-07-01

    Mucosal epithelia are in direct contact with microbes, which range from beneficial symbionts to pathogens. Accordingly, hosts must have a conflicting strategy to combat pathogens efficiently while tolerating symbionts. Recent progress has revealed that dual oxidase (DUOX) plays a key role in mucosal immunity in organisms that range from flies to humans. Information from the genetic model of Drosophila has advanced our understanding of the regulatory mechanism of DUOX and its role in mucosal immunity. Further investigations of DUOX regulation in response to symbiotic or non-symbiotic bacteria and the in vivo consequences in host physiology will give a novel insight into the microbe-controlling system of the mucosa. Copyright 2010 Elsevier Ltd. All rights reserved.

  12. Mucosal immunity in the female genital tract, HIV/AIDS.

    Science.gov (United States)

    Reis Machado, Juliana; da Silva, Marcos Vinícius; Cavellani, Camila Lourencini; dos Reis, Marlene Antônia; Monteiro, Maria Luiza Gonçalves dos Reis; Teixeira, Vicente de Paula Antunes; Miranda Corrêa, Rosana Rosa

    2014-01-01

    Mucosal immunity consists of innate and adaptive immune responses which can be influenced by systemic immunity. Despite having been the subject of intensive studies, it is not fully elucidated what exactly occurs after HIV contact with the female genital tract mucosa. The sexual route is the main route of HIV transmission, with an increased risk of infection in women compared to men. Several characteristics of the female genital tract make it suitable for inoculation, establishment of infection, and systemic spread of the virus, which causes local changes that may favor the development of infections by other pathogens, often called sexually transmitted diseases (STDs). The relationship of these STDs with HIV infection has been widely studied. Here we review the characteristics of mucosal immunity of the female genital tract, its alterations due to HIV/AIDS, and the characteristics of coinfections between HIV/AIDS and the most prevalent STDs.

  13. Influence of bedding type on mucosal immune responses.

    Science.gov (United States)

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  14. Characterization of the Probiotic Yeast Saccharomyces boulardii in the Healthy Mucosal Immune System.

    Directory of Open Access Journals (Sweden)

    Lauren E Hudson

    Full Text Available The probiotic yeast Saccharomyces boulardii has been shown to ameliorate disease severity in the context of many infectious and inflammatory conditions. However, use of S. boulardii as a prophylactic agent or therapeutic delivery vector would require delivery of S. boulardii to a healthy, uninflamed intestine. In contrast to inflamed mucosal tissue, the diverse microbiota, intact epithelial barrier, and fewer inflammatory immune cells within the healthy intestine may all limit the degree to which S. boulardii contacts and influences the host mucosal immune system. Understanding the nature of these interactions is crucial for application of S. boulardii as a prophylactic agent or therapeutic delivery vehicle. In this study, we explore both intrinsic and immunomodulatory properties of S. boulardii in the healthy mucosal immune system. Genomic sequencing and morphological analysis of S. boulardii reveals changes in cell wall components compared to non-probiotic S. cerevisiae that may partially account for probiotic functions of S. boulardii. Flow cytometry and immunohistochemistry demonstrate limited S. boulardii association with murine Peyer's patches. We also show that although S. boulardii induces a systemic humoral immune response, this response is small in magnitude and not directed against S. boulardii itself. RNA-seq of the draining mesenteric lymph nodes indicates that even repeated administration of S. boulardii induces few transcriptional changes in the healthy intestine. Together these data strongly suggest that interaction between S. boulardii and the mucosal immune system in the healthy intestine is limited, with important implications for future work examining S. boulardii as a prophylactic agent and therapeutic delivery vehicle.

  15. Mucosal immunization using proteoliposome and cochleate structures from Neisseria meningitidis serogroup B induce mucosal and systemic responses.

    Science.gov (United States)

    Campo, Judith Del; Zayas, Caridad; Romeu, Belkis; Acevedo, Reinaldo; González, Elizabeth; Bracho, Gustavo; Cuello, Maribel; Cabrera, Osmir; Balboa, Julio; Lastre, Miriam

    2009-12-01

    Most pathogens either invade the body or establish infection in mucosal tissues and represent an enormous challenge for vaccine development by the absence of good mucosal adjuvants. A proteoliposome-derived adjuvant from Neisseria meningitidis serogroup B (AFPL1, Adjuvant Finlay Proteoliposome 1) and its derived cochleate form (Co, AFCo1) contain multiple pathogen-associated molecular patterns as immunopotentiators, and can also serve as delivery systems to elicit a Th1-type immune response. The present studies demonstrate the ability of AFPL1and AFCo1 to induce mucosal and systemic immune responses by different mucosal immunizations routes and significant adjuvant activity for antibody responses of both structures: a microparticle and a nanoparticle with a heterologous antigen. Therefore, we used female mice immunized by intragastric, intravaginal, intranasal or intramuscular routes with both structures alone or incorporated with ovalbumin (OVA). High levels of specific IgG antibody were detected in all sera and in vaginal washes, but specific IgA antibody in external secretions was only detected in mucosally immunized mice. Furthermore, antigen specific IgG1 and IgG2a isotypes were all induced. AFPL1 and AFCo1 are capable of inducing IFN-gamma responses, and chemokine secretions, like MIP-1alpha and MIP-1beta. However, AFCo1 is a better alternative to induce immune responses at mucosal level. Even when we use a heterologous antigen, the AFCo1 response was better than with AFPL1 in inducing mucosal and systemic immune responses. These results support the use of AFCo1 as a potent Th1 inducing adjuvant particularly suitable for mucosal immunization.

  16. Immunity and Tolerance Induced by Intestinal Mucosal Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Julio Aliberti

    2016-01-01

    Full Text Available Dendritic cells present in the digestive tract are constantly exposed to environmental antigens, commensal flora, and invading pathogens. Under steady-state conditions, these cells have high tolerogenic potential, triggering differentiation of regulatory T cells to protect the host from unwanted proinflammatory immune responses to innocuous antigens or commensals. On the other hand, these cells must discriminate between commensal flora and invading pathogens and mount powerful immune response against pathogens. A potential result of unbalanced tolerogenic versus proinflammatory responses mediated by dendritic cells is associated with chronic inflammatory conditions, such as Crohn’s disease, ulcerative colitis, food allergies, and celiac disease. Herein, we review the dendritic cell population involved in mediating tolerance and immunity in mucosal surfaces, the progress in unveiling their development in vivo, and factors that can influence their functions.

  17. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  18. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    Science.gov (United States)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  19. Hericium erinaceus polysaccharide facilitates restoration of injured intestinal mucosal immunity in Muscovy duck reovirus-infected Muscovy ducklings.

    Science.gov (United States)

    Wu, Yijian; Jiang, Huihui; Zhu, Erpeng; Li, Jian; Wang, Quanxi; Zhou, Wuduo; Qin, Tao; Wu, Xiaoping; Wu, Baocheng; Huang, Yifan

    2018-02-01

    To elucidate the effect of Hericium erinaceus polysaccharide (HEP) on the intestinal mucosal immunity in normal and Muscovy duck reovirus (MDRV)-infected Muscovy ducklings, 1-day-old healthy Muscovy ducklings were pretreated with 0.2g/L HEP and/or following by MDRV infection in this study, duodenal samples were respectively collected at 1, 3, 6, 10, 15 and 21day post-infection, tissue sections were prepared for observation of morphological structure and determination of intestinal parameters (villus height/crypt depth ratio, villus surface area) as well as counts of intraepithelial lymphocytes (IELs), goblet cells, mast cells. Additionally, dynamics of secretory immunoglobin A (sIgA), interferon-γ (IFN-γ) and interleukin-4 (IL-4) productions in intestinal mucosa were measured with radioimmunoassay. Results showed that HEP significantly improved intestinal morphological structure and related indexes, and significantly inhibited the reduction of intestinal mucosal IELs, goblet cells and mast cells caused by MDRV infection. Furthermore, HEP significantly increased the secretion of sIgA, IFN-γ and IL-4 to enhance intestinal mucosal immune functions. Our findings indicate that HEP treatment can effectively repair MDRV-caused injures of small intestinal mucosal immune barrier, and improve mucosal immune function in sick Muscovy ducklings, which will provide valuable help for further application of HEP in prevention and treatment of MDRV infection. Copyright © 2017. Published by Elsevier B.V.

  20. Interleukin-22-producing innate immune cells: new players in mucosal immunity and tissue repair?

    NARCIS (Netherlands)

    Vivier, Eric; Spits, Hergen; Cupedo, Tom

    2009-01-01

    Mucosal tissues, lying at the interface with the external environment, are constantly challenged by microbial, physical and chemical assaults. To provide the necessary immune defence to such challenges, lymph nodes and Peyer's patches are formed in utero in response to inductive signals from

  1. Human immunodeficiency virus-associated disruption of mucosal barriers and its role in HIV transmission and pathogenesis of HIV/AIDS disease

    Science.gov (United States)

    Tugizov, Sharof

    2016-01-01

    Abstract Oral, intestinal and genital mucosal epithelia have a barrier function to prevent paracellular penetration by viral, bacterial and other pathogens, including human immunodeficiency virus (HIV). HIV can overcome these barriers by disrupting the tight and adherens junctions of mucosal epithelia. HIV-associated disruption of epithelial junctions may also facilitate paracellular penetration and dissemination of other viral pathogens. This review focuses on possible molecular mechanisms of HIV-associated disruption of mucosal epithelial junctions and its role in HIV transmission and pathogenesis of HIV and acquired immune deficiency syndrome (AIDS). PMID:27583187

  2. Mucosal pathobiology and molecular signature of epithelial barrier dysfunction in the small intestine in irritable bowel syndrome.

    Science.gov (United States)

    González-Castro, Ana M; Martínez, Cristina; Salvo-Romero, Eloísa; Fortea, Marina; Pardo-Camacho, Cristina; Pérez-Berezo, Teresa; Alonso-Cotoner, Carmen; Santos, Javier; Vicario, María

    2017-01-01

    Irritable bowel syndrome (IBS) is one of the most prevalent gastrointestinal disorders in developed countries. Its etiology remains unknown; however, a common finding, regardless of IBS subtype, is the presence of altered intestinal barrier. In fact, signaling and location of cell-to-cell adhesion proteins, in connection with increased immune activity, seem abnormal in the intestinal epithelium of IBS patients. Despite that most research is performed on distal segments of the intestine, altered permeability has been reported in both, the small and the large bowel of all IBS subtypes. The small intestine carries out digestion and nutrient absorption and is also the site where the majority of immune responses to luminal antigens takes place. In fact, the upper intestine is more exposed to environmental antigens than the colon and is also a site of symptom generation. Recent studies have revealed small intestinal structural alterations of the epithelial barrier and mucosal immune activation in association with intestinal dysfunction, suggesting the commitment of the intestine as a whole in the pathogenesis of IBS. This review summarizes the most recent findings on mucosal barrier alterations and its relationship to symptoms arising from the small intestine in IBS, including epithelial structural abnormalities, mucosal immune activation, and microbial dysbiosis, further supporting the hypothesis of an organic origin of IBS. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  3. Serum and mucosal immune responses to an inactivated influenza virus vaccine induced by epidermal powder immunization.

    Science.gov (United States)

    Chen, D; Periwal, S B; Larrivee, K; Zuleger, C; Erickson, C A; Endres, R L; Payne, L G

    2001-09-01

    Both circulating and mucosal antibodies are considered important for protection against infection by influenza virus in humans and animals. However, current inactivated vaccines administered by intramuscular injection using a syringe and needle elicit primarily circulating antibodies. In this study, we report that epidermal powder immunization (EPI) via a unique powder delivery system elicits both serum and mucosal antibodies to an inactivated influenza virus vaccine. Serum antibody responses to influenza vaccine following EPI were enhanced by codelivery of cholera toxin (CT), a synthetic oligodeoxynucleotide containing immunostimulatory CpG motifs (CpG DNA), or the combination of these two adjuvants. In addition, secretory immunoglobulin A (sIgA) antibodies were detected in the saliva and mucosal lavages of the small intestine, trachea, and vaginal tract, although the titers were much lower than the IgG titers. The local origin of the sIgA antibodies was further shown by measuring antibodies released from cultured tracheal and small intestinal fragments and by detecting antigen-specific IgA-secreting cells in the lamina propria using ELISPOT assays. EPI with a single dose of influenza vaccine containing CT or CT and CpG DNA conferred complete protection against lethal challenges with an influenza virus isolated 30 years ago, whereas a prime and boost immunizations were required for protection in the absence of an adjuvant. The ability to elicit augmented circulating antibody and mucosal antibody responses makes EPI a promising alternative to needle injection for administering vaccines against influenza and other diseases.

  4. Mucosal immune response in broilers following vaccination with inactivated influenza and recombinant Bacillus subtilis

    Science.gov (United States)

    Mucosal and systemic immunity were observed in broilers vaccinated with mannosylated chitosan adjuvated (MCA) inactivated A/Turkey/Virginia/158512/2002 (H7N2) and administered with and without recombinant Bacillus subtilis to elicit heterologous influenza strain protection. Previously, mucosal immu...

  5. Developmental Profiles of Mucosal Immunity in Pre-school Children

    Directory of Open Access Journals (Sweden)

    Patricia Ewing

    2010-01-01

    Full Text Available This study investigated the effect of attending pre-school on mucosal immunity. Children 3.5 to 5 years of age who attended pre-school were observed for a 10 month period. Demographic information was collected on previous childcare experiences, the home environment and clinical information relating to the child and the family. A daily illness log was kept for each child. A multivariate longitudinal analysis of the relation between immunoglobulins in saliva and age, gender, childcare experience, pre-school exposure, number of siblings, environmental tobacco smoke (ETS, atopy and hospitalisation was conducted. There was a positive association of higher IgA levels with the winter season and with children being older than 4 years (<.001, having attended childcare prior to commencing pre-school (<.05, and having been exposed to ETS at home (<.05. Lower IgA levels were associated with being atopic (<.05. Higher IgG levels were associated with exposure to ETS (<.001, while lower levels were associated to having atopy. Higher IgM levels were associated with previous childcare experience (<.01 whilst having been hospitalised was associated with having low salivary IgM levels (<.01. Lagged analyses demonstrated that immunological parameters were affected by the number of respiratory infections in the preceding 2 months.

  6. Mucosal Immune Regulation in Intestinal Disease. The role of bacterial products, food components and drugs

    NARCIS (Netherlands)

    Bol-Schoenmakers, M.

    2009-01-01

    The challenge of the mucosal gut associated immune system is to remain unresponsive to food products and commensal microbiota, while mounting an appropriate immune response towards pathogens. This implicates the necessity of tight immune regulation within the gut associated lymphoid tissue (GALT).

  7. Role of intestinal mucosal barrier in the development and progression of nonalcoholic fatty liver disease

    Directory of Open Access Journals (Sweden)

    ZHANG Yuanyuan

    2016-12-01

    Full Text Available The incidence of non-alcoholic fatty liver disease (NAFLD has been increasing year by year in China. Intestinal mucosa is the largest organ for bacterial storage, and intestinal mucosal barrier includes biological barrier, mechanical barrier, immunological barrier, and chemical barrier. This article investigates the important role of intestinal mucosal barrier function in the pathogenesis of NAFLD. As for the intestinal biological barrier, abnormalities in gut microbiota occur earlier than obesity and other metabolic disorders; small intestinal bacterial overgrowth may affect energy metabolism, promote insulin resistance, and get involved in the pathogenesis of NAFLD; regulation of gut microbiota has a certain clinical effect in the treatment of NAFLD. Intestinal mechanical barrier impairment increases the mucosal permeability and is associated with intestinal dysbacteriosis. The changes in intestinal immunological barrier may be associated with obesity, metabolic disorders, and liver inflammation. The changes in intestinal chemical barrier can inhibit the synthesis and secretion of very low-density lipoprotein and low-density lipoprotein in hepatocytes and may result in triglyceride deposition in the liver. It is pointed out that the research on intestinal mucosal barrier function provides promising prospects for the prevention and treatment of NAFLD.

  8. Divergence of gut permeability and mucosal immune gene expression in two gluten-associated conditions: celiac disease and gluten sensitivity

    Directory of Open Access Journals (Sweden)

    Esposito Pasquale

    2011-03-01

    Full Text Available Abstract Background Celiac disease (CD is an autoimmune enteropathy triggered by the ingestion of gluten. Gluten-sensitive individuals (GS cannot tolerate gluten and may develop gastrointestinal symptoms similar to those in CD, but the overall clinical picture is generally less severe and is not accompanied by the concurrence of tissue transglutaminase autoantibodies or autoimmune comorbidities. By studying and comparing mucosal expression of genes associated with intestinal barrier function, as well as innate and adaptive immunity in CD compared with GS, we sought to better understand the similarities and differences between these two gluten-associated disorders. Methods CD, GS and healthy, gluten-tolerant individuals were enrolled in this study. Intestinal permeability was evaluated using a lactulose and mannitol probe, and mucosal biopsy specimens were collected to study the expression of genes involved in barrier function and immunity. Results Unlike CD, GS is not associated with increased intestinal permeability. In fact, this was significantly reduced in GS compared with controls (P = 0.0308, paralleled by significantly increased expression of claudin (CLDN 4 (P = 0.0286. Relative to controls, adaptive immunity markers interleukin (IL-6 (P = 0.0124 and IL-21 (P = 0.0572 were expressed at higher levels in CD but not in GS, while expression of the innate immunity marker Toll-like receptor (TLR 2 was increased in GS but not in CD (P = 0.0295. Finally, expression of the T-regulatory cell marker FOXP3 was significantly reduced in GS relative to controls (P = 0.0325 and CD patients (P = 0.0293. Conclusions This study shows that the two gluten-associated disorders, CD and GS, are different clinical entities, and it contributes to the characterization of GS as a condition associated with prevalent gluten-induced activation of innate, rather than adaptive, immune responses in the absence of detectable changes in mucosal barrier function.

  9. Retinaldehyde dehydrogenase 2 as a molecular adjuvant for enhancement of mucosal immunity during DNA vaccination.

    Science.gov (United States)

    Holechek, Susan A; McAfee, Megan S; Nieves, Lizbeth M; Guzman, Vanessa P; Manhas, Kavita; Fouts, Timothy; Bagley, Kenneth; Blattman, Joseph N

    2016-11-04

    In order for vaccines to induce efficacious immune responses against mucosally transmitted pathogens, such as HIV-1, activated lymphocytes must efficiently migrate to and enter targeted mucosal sites. We have previously shown that all-trans retinoic acid (ATRA) can be used as a vaccine adjuvant to enhance mucosal CD8 + T cell responses during vaccination and improve protection against mucosal viral challenge. However, the ATRA formulation is incompatible with most recombinant vaccines, and the teratogenic potential of ATRA at high doses limits its usage in many clinical settings. We hypothesized that increasing in vivo production of retinoic acid (RA) during vaccination with a DNA vector expressing retinaldehyde dehydrogenase 2 (RALDH2), the rate-limiting enzyme in RA biosynthesis, could similarly provide enhanced programming of mucosal homing to T cell responses while avoiding teratogenic effects. Administration of a RALDH2- expressing plasmid during immunization with a HIVgag DNA vaccine resulted in increased systemic and mucosal CD8 + T cell numbers with an increase in both effector and central memory T cells. Moreover, mice that received RALDH2 plasmid during DNA vaccination were more resistant to intravaginal challenge with a recombinant vaccinia virus expressing the same HIVgag antigen (VACVgag). Thus, RALDH2 can be used as an alternative adjuvant to ATRA during DNA vaccination leading to an increase in both systemic and mucosal T cell immunity and better protection from viral infection at mucosal sites. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Intestinal barrier: A gentlemen's agreement between microbiota and immunity.

    Science.gov (United States)

    Caricilli, Andrea Moro; Castoldi, Angela; Câmara, Niels Olsen Saraiva

    2014-02-15

    Our body is colonized by more than a hundred trillion commensals, represented by viruses, bacteria and fungi. This complex interaction has shown that the microbiome system contributes to the host's adaptation to its environment, providing genes and functionality that give flexibility of diet and modulate the immune system in order not to reject these symbionts. In the intestine, specifically, the microbiota helps developing organ structures, participates of the metabolism of nutrients and induces immunity. Certain components of the microbiota have been shown to trigger inflammatory responses, whereas others, anti-inflammatory responses. The diversity and the composition of the microbiota, thus, play a key role in the maintenance of intestinal homeostasis and explain partially the link between intestinal microbiota changes and gut-related disorders in humans. Tight junction proteins are key molecules for determination of the paracellular permeability. In the context of intestinal inflammatory diseases, the intestinal barrier is compromised, and decreased expression and differential distribution of tight junction proteins is observed. It is still unclear what is the nature of the luminal or mucosal factors that affect the tight junction proteins function, but the modulation of the immune cells found in the intestinal lamina propria is hypothesized as having a role in this modulation. In this review, we provide an overview of the current understanding of the interaction of the gut microbiota with the immune system in the development and maintenance of the intestinal barrier.

  11. Influencing mucosal homeostasis and immune responsiveness : The impact of nutrition and pharmaceuticals

    NARCIS (Netherlands)

    van't Land, Belinda; Schijf, Marcel A.; Martin, Rocio; Garssen, Johan; van Bleek, Grada M.

    Both nutrition and orally ingested drugs pass the gastrointestinal mucosa and may affect the balance between the mucosal immune system and microbial community herein, i.e. affecting composition of the microbial community as well as the status of local immune system that controls microbial

  12. Chimeric plant virus particles administered nasally or orally induce systemic and mucosal immune responses in mice

    DEFF Research Database (Denmark)

    Brennan, F.R.; Bellaby, T.; Helliwell, S.M.

    1999-01-01

    The humoral immune responses to the D2 peptide of fibronectin-binding protein B (FnBP) of Staphylococcus aureus, expressed on the plant virus cowpea mosaic virus (CPMV), were evaluated after mucosal delivery to mice. Intranasal immunization of these chimeric virus particles (CVPs), either alone...

  13. Mucosal and systemic immune modulation by Trichuris trichiura in a self-infected individual

    DEFF Research Database (Denmark)

    Dige, Anders Kirch; Rasmussen, Tue Kruse; Nejsum, Peter

    2017-01-01

    Helminthic therapy of immune-mediated diseases has gained attention in recent years, but we know little of how helminths modulate human immunity. In this study, we investigated how self-infection with Trichuris (T.) trichiura in an adult man without intestinal disease affected mucosal and systemic...

  14. Enhancement of mucosal immune responses by chimeric influenza HA/SHIV virus-like particles

    International Nuclear Information System (INIS)

    Guo Lizheng; Lu Xiaoyan; Kang, S.-M.; Chen Changyi; Compans, Richard W.; Yao Qizhi

    2003-01-01

    To enhance mucosal immune responses using simian/human immunodeficiency virus-like particles (SHIV VLPs), we have produced novel phenotypically mixed chimeric influenza HA/SHIV VLPs and used them to immunize C57BL/6J mice intranasally. Antibody and cytotoxic T-cell (CTL) responses as well as cytokine production in both systemic and mucosal sites were compared after immunization with SHIV VLPs or chimeric HA/SHIV VLPs. By using enzyme-linked immunosorbent assay (ELISA), the levels of serum IgG and mucosal IgA to the HIV envelope protein (Env) were found to be highest in the group immunized with chimeric HA/SHIV VLPs. Furthermore, the highest titer of serum neutralizing antibody against HIV Env was found with the group immunized with chimeric HA/SHIV VLPs. Analysis of the IgG1/IgG2a ratio indicated that a T H 1-oriented immune response resulted from these VLP immunizations. HA/SHIV VLP-immunized mice also showed significantly higher CTL responses than those observed in SHIV VLP-immunized mice. Moreover, a MHC class I restricted T-cell activation ELISPOT assay showed a mixed type of T H 1/T H 2 cytokines in the HA/SHIV VLP-immunized mice, indicating that the chimeric VLPs can enhance both humoral and cellular immune responses to the HIV Env protein at multiple mucosal and systemic sites. The results indicate that incorporation of influenza HA into heterotypic VLPs may be highly effective for targeting vaccines to mucosal surfaces

  15. Dietary N-Carbamylglutamate Supplementation Boosts Intestinal Mucosal Immunity in Escherichia coli Challenged Piglets.

    Directory of Open Access Journals (Sweden)

    Fengrui Zhang

    Full Text Available N-carbamylglutamate (NCG has been shown to enhance performance in neonatal piglets. However, few studies have demonstrated the effect of NCG on the intestinal mucosal barrier. This study was conducted to determine the effects of dietary NCG supplementation on intestinal mucosal immunity in neonatal piglets after an Escherichia coli (E. coli challenge. New-born piglets (4 d old were assigned randomly to one of four treatments (n = 7, including (I sham challenge, (II sham challenge +50 mg/kg NCG, (III E. coli challenge, and (IV E. coli challenge +50 mg/kg NCG. On d 8, pigs in the E. coli challenge groups (III and IV were orally challenged with 5 mL of E. coli K88 (10(8 CFU/mL, whereas pigs in the sham challenge groups (I and II were orally dosed with an equal volume of water. On d 13, all piglets were sacrificed, and samples were collected and examined. The results show that average daily gain in the E. coli challenged piglets (III and IV was decreased (PE.coli<0.05. However, it tended to be higher in the NCG treated piglets (II and IV. Ileum secretory IgA, as well as IFN-γ, IL-2, IL-4 and IL-10 in ileal homogenates, were increased in E. coli challenged piglets (III and IV. Similarly, ileum SIgA and IL-10 levels, and CD4(+ percentage in NCG treated piglets (II and IV were higher than no-NCG treated piglets (PNCG<0.05. However, the IL-2 level was only decreased in the piglets of E. coli challenge + NCG group (IV compared with E. coli challenge group (III (P<0.05. No change in the IL-2 level of the sham challenged piglets (III was observed. In conclusion, dietary NCG supplementation has some beneficial effects on intestinal mucosal immunity in E. coli challenged piglets, which might be associated with stimulated lymphocyte proliferation and cytokine synthesis. Our findings have an important implication that NCG may be used to reduce diarrhea in neonatal piglets.

  16. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization.

    Science.gov (United States)

    Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y

    2008-12-01

    Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.

  17. Cellular and mucosal immune responses in the respiratory tract of ...

    African Journals Online (AJOL)

    Summary: This experiment was conducted to evaluate the cellular and mucosal responses in the respiratory tract of Nigerian goats vaccinated intranasally with recombinant Mannheimia hemolytica bacterine. Twenty one goats were divided into five groups, five goats each in three vaccinated groups while three goats each ...

  18. Influencing mucosal homeostasis and immune responsiveness: the impact of nutrition and pharmaceuticals.

    Science.gov (United States)

    van't Land, Belinda; Schijf, Marcel A; Martin, Rocio; Garssen, Johan; van Bleek, Grada M

    2011-09-01

    Both nutrition and orally ingested drugs pass the gastrointestinal mucosa and may affect the balance between the mucosal immune system and microbial community herein, i.e. affecting composition of the microbial community as well as the status of local immune system that controls microbial composition and maintains mucosal integrity. Numerous ways are known by which the microbial community stimulates mammalian host's immune system and vice versa. The communication between microbiota and immune system is principally mediated by interaction of bacterial components with pattern recognition receptors expressed by intestinal epithelium and various local antigen-presenting cells, resulting in activation or modulation of both innate and adaptive immune responses. Current review describes some of the factors influencing development and maintenance of a proper mucosal/immune balance, with special attention to Toll like receptor signaling and regulatory T cell development. It further describes examples (antibiotic use, HIV and asthma will be discussed) showing that disruption of the balance can be linked to immune function failure. The therapeutic potential of nutritional pharmacology herein is the main focus of discussion. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Immune barriers of Ebola virus infection.

    Science.gov (United States)

    McElroy, Anita K; Mühlberger, Elke; Muñoz-Fontela, César

    2018-02-01

    Since its initial emergence in 1976 in northern Democratic Republic of Congo (DRC), Ebola virus (EBOV) has been a global health concern due to its virulence in humans, the mystery surrounding the identity of its host reservoir and the unpredictable nature of Ebola virus disease (EVD) outbreaks. Early after the first clinical descriptions of a disease resembling a 'septic-shock-like syndrome', with coagulation abnormalities and multi-system organ failure, researchers began to evaluate the role of the host immune response in EVD pathophysiology. In this review, we summarize how data gathered during the last 40 years in the laboratory as well as in the field have provided insight into EBOV immunity. From molecular mechanisms involved in EBOV recognition in infected cells, to antigen processing and adaptive immune responses, we discuss current knowledge on the main immune barriers of infection as well as outstanding research questions. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Association of sex work with reduced activation of the mucosal immune system.

    Science.gov (United States)

    Lajoie, Julie; Kimani, Makubo; Plummer, Francis A; Nyamiobo, Francis; Kaul, Rupert; Kimani, Joshua; Fowke, Keith R

    2014-07-15

    Unprotected intercourse and seminal discharge are powerful activators of the mucosal immune system and are important risk factors for transmission of human immunodeficiency virus (HIV). This study was designed to determine if female sex work is associated with changes in the mucosal immunity. Cervicovaginal lavage and plasma from 122 HIV-uninfected female sex workers (FSW) and 44 HIV-uninfected low-risk non-FSW from the same socioeconomic district of Nairobi were analyzed for evidence of immune activation (IA). The cervico-mononuclear cells (CMC) were analyzed for cellular activation by flow cytometry. Lower IA was observed in FSW compared to the low-risk women as demonstrated by the lower level of MIP-3α (P sex work and increased with duration of sex work. This study showed that sex work is associated with important changes in the mucosal immune system. By analyzing chemokine/cytokine levels and CMC activation, we observed a lower mucosal IA in HIV-uninfected FSW compared to low-risk women. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Human intestinal dendritic cells as controllers of mucosal immunity

    Directory of Open Access Journals (Sweden)

    David Bernardo

    2013-06-01

    Full Text Available Dendritic cells are the most potent, professional antigen-presenting cells in the body; following antigen presentation they control the type (proinflammatory/regulatory of immune response that will take place, as well as its location. Given their high plasticity and maturation ability in response to local danger signals derived from innate immunity, dendritic cells are key actors in the connection between innate immunity and adaptive immunity responses. In the gut dendritic cells control immune tolerance mechanisms against food and/or commensal flora antigens, and are also capable of initiating an active immune response in the presence of invading pathogens. Dendritic cells are thus highly efficient in controlling the delicate balance between tolerance and immunity in an environment so rich in antigens as the gut, and any factor involving these cells may impact their function, ultimately leading to the development of bowel conditions such as celiac disease or inflammatory bowel disease. In this review we shall summarize our understanding of human intestinal dendritic cells, their ability to express and induce migration markers, the various environmental factors modulating their properties, their subsets in the gut, and the problems entailed by their study, including identification strategies, differences between humans and murine models, and phenotypical variations along the gastrointestinal tract.

  2. Simultaneous approach using systemic, mucosal and transcutaneous routes of immunization for development of protective HIV-1 vaccines.

    Science.gov (United States)

    Belyakov, I M; Ahlers, J D

    2011-01-01

    Mucosal tissues are major sites of HIV entry and initial infection. Induction of a local mucosal cytotoxic T lymphocyte response is considered an important goal in developing an effective HIV vaccine. In addition, activation and recruitment of memory CD4(+) and CD8(+) T cells in systemic lymphoid circulation to mucosal effector sites might provide the firewall needed to prevent virus spread. Therefore a vaccine that generates CD4(+) and CD8(+) responses in both mucosal and systemic tissues might be required for protection against HIV. However, optimal routes and number of vaccinations required for the generation of long lasting CD4(+) and CD8(+) CTL effector and memory responses are not well understood especially for mucosal T cells. A number of studies looking at protective immune responses against diverse mucosal pathogens have shown that mucosal vaccination is necessary to induce a compartmentalized immune response including maximum levels of mucosal high-avidity CD8(+) CTL, antigen specific mucosal antibodies titers (especially sIgA), as well as induction of innate anti-viral factors in mucosa tissue. Immune responses are detectable at mucosal sites after systemic delivery of vaccine, and prime boost regimens can amplify the magnitude of immune responses in mucosal sites and in systemic lymphoid tissues. We believe that the most optimal mucosal and systemic HIV/SIV specific protective immune responses and innate factors might best be achieved by simultaneous mucosal and systemic prime and boost vaccinations. Similar principals of vaccination may be applied for vaccine development against cancer and highly invasive pathogens that lead to chronic infection.

  3. Milk fermentation products of L. helveticus R389 activate calcineurin as a signal to promote gut mucosal immunity

    Directory of Open Access Journals (Sweden)

    Perdigón Gabriela

    2007-09-01

    Full Text Available Background Fermented milks containing probiotic bacteria are a way of delivering bioactive constituents to targets in the gastrointestinal tract. We reported previously that the fermentation of milk at constant pH 6 by L. helveticus R389 increased its content of peptide fractions, and the oral administration of the non-bacterial fraction (FMSpH6 to mice increased total secretory IgA in the intestinal lumen and enhanced the number of IgA and various cytokines producing cells as well as the secretion of IL-6 by small intestine epithelial cells. We also demonstrated that this FMSpH6 was effective for the prevention of Salmonella typhimurium infection in mice. In this work, we studied in mice the impact of the oral administration of the supernatant of milk fermented by L. helveticus R389 on the gut physiology by measuring parameters such as calcium channels and E-cadherin expression, the activation of the biological signal calcineurin and mast and goblet cells, as a way to determine some mechanisms involved in the immunomodulating effects of the milk fermentation products, observed in previous studies. We analyzed the impact of the supernatant of milk fermented by L. helveticus R389 at pH6-controlled on the expression of calcineurin and on the reinforcement of the ephitelial barrier, measuring parameters such as calcium channels and E-cadherin expression and in the reinforcement of the non-specific immunity determining mast cells and goblet cells associated to the gut. Results We observed an enhanced expression of TRPV6 channels in the duodenum, indicating an improved capacity for dietary Ca2+ uptake. We demonstrated an enhanced expression of calcineurin in the small intestine, able to upregulate immune parameters such as IL-2 and TNF production, with an increase in the number of these cytokines secreting cells. We determined an increase in the number of mucosal mast cells and goblet cells, which would mean an improved state of mucosal surveillance

  4. Novel mucosal DNA-MVA HIV vaccination in which DNA-IL-12 plus Cholera Toxin B subunit (CTB) cooperates to enhance cellular systemic and mucosal genital tract immunity

    OpenAIRE

    Maeto, Cynthia Alejandra; Rodríguez, Ana María; Holgado, María Pía; Falivene, Juliana; Gherardi, Maria Magdalena

    2017-01-01

    Induction of local antiviral immune responses at the mucosal portal surfaces where HIV-1 and other viral pathogens are usually first encountered remains a primary goal for most vaccines against mucosally acquired viral infections. Exploring mucosal immunization regimes in order to find optimal vector combinations and also appropriate mucosal adjuvants in the HIV vaccine development is decisive. In this study we analyzed the interaction of DNA-IL-12 and cholera toxin B subunit (CTB) after thei...

  5. The role of CD103+ Dendritic cells in the intestinal mucosal immune system.

    Directory of Open Access Journals (Sweden)

    Darren Thomas Ruane

    2011-07-01

    Full Text Available While dendritic cells (DC are central to the induction and regulation of adaptive immunity, these cells are very heterogenous and specific subsets can be characterized based on the expression of cell surface markers and functional properties. Intestinal CD103+ DCs are the subject of particular interest due to their role in regulating mucosal immunity. Since the epithelial surfaces are constantly exposed to a high antigenic load, tight regulation of innate and adaptive intestinal immune responses is vital as intestinal inflammation can have detrimental consequences for the host. Strategically positioned within the lamina propria, CD103+ DCs play an important role in maintaining intestinal immune homeostasis. These cells are required for the induction of tolerogenic immune responses and imprinting gut homing phenotypic changes on antigen-specific T cells. Recent insights into their development and regulatory properties have revealed additional immunoregulatory roles and further highlighted their importance for intestinal immunity. In this review we discuss the nature of the intestinal CD103+ DC population and the emerging roles of these cells in the regulation of mucosal immunity.

  6. Plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B.

    Science.gov (United States)

    Khatri, Kapil; Goyal, Amit K; Gupta, Prem N; Mishra, Neeraj; Vyas, Suresh P

    2008-04-16

    This work investigates the preparation and in vivo efficacy of plasmid DNA loaded chitosan nanoparticles for nasal mucosal immunization against hepatitis B. Chitosan pDNA nanoparticles were prepared using a complex coacervation process. Prepared nanoparticles were characterized for size, shape, surface charge, plasmid loading and ability of nanoparticles to protect DNA against nuclease digestion and for their transfection efficacy. Nasal administration of nanoparticles resulted in serum anti-HBsAg titre that was less compared to that elicited by naked DNA and alum adsorbed HBsAg, but the mice were seroprotective within 2 weeks and the immunoglobulin level was above the clinically protective level. However, intramuscular administration of naked DNA and alum adsorbed HBsAg did not elicit sIgA titre in mucosal secretions that was induced by nasal immunization with chitosan nanoparticles. Similarly, cellular responses (cytokine levels) were poor in case of alum adsorbed HBsAg. Chitosan nanoparticles thus produced humoral (both systemic and mucosal) and cellular immune responses upon nasal administration. The study signifies the potential of chitosan nanoparticles as DNA vaccine carrier and adjuvant for effective immunization through non-invasive nasal route.

  7. Mucosal Herpes Immunity and Immunopathology to Ocular and Genital Herpes Simplex Virus Infections

    Science.gov (United States)

    Chentoufi, Aziz Alami; BenMohamed, Lbachir

    2012-01-01

    Herpes simplex viruses type 1 and type 2 (HSV-1 and HSV-2) are amongst the most common human infectious viral pathogens capable of causing serious clinical diseases at every stage of life, from fatal disseminated disease in newborns to cold sores genital ulcerations and blinding eye disease. Primary mucocutaneous infection with HSV-1 & HSV-2 is followed by a lifelong viral latency in the sensory ganglia. In the majority of cases, herpes infections are clinically asymptomatic. However, in symptomatic individuals, the latent HSV can spontaneously and frequently reactivate, reinfecting the muco-cutaneous surfaces and causing painful recurrent diseases. The innate and adaptive mucosal immunities to herpes infections and disease remain to be fully characterized. The understanding of innate and adaptive immune mechanisms operating at muco-cutaneous surfaces is fundamental to the design of next-generation herpes vaccines. In this paper, the phenotypic and functional properties of innate and adaptive mucosal immune cells, their role in antiherpes immunity, and immunopathology are reviewed. The progress and limitations in developing a safe and efficient mucosal herpes vaccine are discussed. PMID:23320014

  8. Mucosal Herpes Immunity and Immunopathology to Ocular and Genital Herpes Simplex Virus Infections

    Directory of Open Access Journals (Sweden)

    Aziz Alami Chentoufi

    2012-01-01

    Full Text Available Herpes simplex viruses type 1 and type 2 (HSV-1 and HSV-2 are amongst the most common human infectious viral pathogens capable of causing serious clinical diseases at every stage of life, from fatal disseminated disease in newborns to cold sores genital ulcerations and blinding eye disease. Primary mucocutaneous infection with HSV-1 & HSV-2 is followed by a lifelong viral latency in the sensory ganglia. In the majority of cases, herpes infections are clinically asymptomatic. However, in symptomatic individuals, the latent HSV can spontaneously and frequently reactivate, reinfecting the muco-cutaneous surfaces and causing painful recurrent diseases. The innate and adaptive mucosal immunities to herpes infections and disease remain to be fully characterized. The understanding of innate and adaptive immune mechanisms operating at muco-cutaneous surfaces is fundamental to the design of next-generation herpes vaccines. In this paper, the phenotypic and functional properties of innate and adaptive mucosal immune cells, their role in antiherpes immunity, and immunopathology are reviewed. The progress and limitations in developing a safe and efficient mucosal herpes vaccine are discussed.

  9. Role of ABO secretor status in mucosal innate immunity and H. pylori infection.

    Directory of Open Access Journals (Sweden)

    Sara Lindén

    2008-01-01

    Full Text Available The fucosylated ABH antigens, which constitute the molecular basis for the ABO blood group system, are also expressed in salivary secretions and gastrointestinal epithelia in individuals of positive secretor status; however, the biological function of the ABO blood group system is unknown. Gastric mucosa biopsies of 41 Rhesus monkeys originating from Southern Asia were analyzed by immunohistochemistry. A majority of these animals were found to be of blood group B and weak-secretor phenotype (i.e., expressing both Lewis a and Lewis b antigens, which are also common in South Asian human populations. A selected group of ten monkeys was inoculated with Helicobacter pylori and studied for changes in gastric mucosal glycosylation during a 10-month period. We observed a loss in mucosal fucosylation and concurrent induction and time-dependent dynamics in gastric mucosal sialylation (carbohydrate marker of inflammation, which affect H. pylori adhesion targets and thus modulate host-bacterial interactions. Of particular relevance, gastric mucosal density of H. pylori, gastritis, and sialylation were all higher in secretor individuals compared to weak-secretors, the latter being apparently "protected." These results demonstrate that the secretor status plays an intrinsic role in resistance to H. pylori infection and suggest that the fucosylated secretor ABH antigens constitute interactive members of the human and primate mucosal innate immune system.

  10. Induction of influenza-specific mucosal immunity by an attenuated recombinant Sendai virus.

    Directory of Open Access Journals (Sweden)

    Thuc-vy L Le

    2011-04-01

    Full Text Available Many pathogens initiate infection at the mucosal surfaces; therefore, induction of mucosal immune responses is a first level of defense against infection and is the most powerful means of protection. Although intramuscular injection is widely used for vaccination and is effective at inducing circulating antibodies, it is less effective at inducing mucosal antibodies.Here we report a novel recombinant, attenuated Sendai virus vector (GP42-H1 in which the hemagglutinin (HA gene of influenza A virus was introduced into the Sendai virus genome as an additional gene. Infection of CV-1 cells by GP42-H1 resulted in cell surface expression of the HA protein. Intranasal immunization of mice with 1,000 plaque forming units (pfu of GP42-H1 induced HA-specific IgG and IgA antibodies in the blood, bronchoalveolar lavage fluid, fecal pellet extracts and saliva. The HA-specific antibody titer induced by GP42-H1 closely resembles the titer induced by sublethal infection by live influenza virus; however, in contrast to infection by influenza virus, immunization with GP42-H1 did not result in disease symptoms or the loss of body weight. In mice that were immunized with GP42-H1 and then challenged with 5LD(50 (1250 pfu of influenza virus, no significant weight loss was observed and other visual signs of morbidity were not detected.These results demonstrate that the GP42-H1 Sendai virus recombinant is able to confer full protection from lethal infection by influenza virus, supporting the conclusion that it is a safe and effective mucosal vaccine vector.

  11. Systems Modeling of Interactions between Mucosal Immunity and the Gut Microbiome during Clostridium difficile Infection.

    Directory of Open Access Journals (Sweden)

    Andrew Leber

    Full Text Available Clostridium difficile infections are associated with the use of broad-spectrum antibiotics and result in an exuberant inflammatory response, leading to nosocomial diarrhea, colitis and even death. To better understand the dynamics of mucosal immunity during C. difficile infection from initiation through expansion to resolution, we built a computational model of the mucosal immune response to the bacterium. The model was calibrated using data from a mouse model of C. difficile infection. The model demonstrates a crucial role of T helper 17 (Th17 effector responses in the colonic lamina propria and luminal commensal bacteria populations in the clearance of C. difficile and colonic pathology, whereas regulatory T (Treg cells responses are associated with the recovery phase. In addition, the production of anti-microbial peptides by inflamed epithelial cells and activated neutrophils in response to C. difficile infection inhibit the re-growth of beneficial commensal bacterial species. Computational simulations suggest that the removal of neutrophil and epithelial cell derived anti-microbial inhibitions, separately and together, on commensal bacterial regrowth promote recovery and minimize colonic inflammatory pathology. Simulation results predict a decrease in colonic inflammatory markers, such as neutrophilic influx and Th17 cells in the colonic lamina propria, and length of infection with accelerated commensal bacteria re-growth through altered anti-microbial inhibition. Computational modeling provides novel insights on the therapeutic value of repopulating the colonic microbiome and inducing regulatory mucosal immune responses during C. difficile infection. Thus, modeling mucosal immunity-gut microbiota interactions has the potential to guide the development of targeted fecal transplantation therapies in the context of precision medicine interventions.

  12. Systemic Immunization with Papillomavirus L1 Protein Completely Prevents the Development of Viral Mucosal Papillomas

    Science.gov (United States)

    Suzich, Joann A.; Ghim, Shin-Je; Palmer-Hill, Frances J.; White, Wendy I.; Tamura, James K.; Bell, Judith A.; Newsome, Joseph A.; Bennett Jenson, A.; Schlegel, Richard

    1995-12-01

    Infection of mucosal epithelium by papillomaviruses is responsible for the induction of genital and oral warts and plays a critical role in the development of human cervical and oropharyngeal cancer. We have employed a canine model to develop a systemic vaccine that completely protects against experimentally induced oral mucosal papillomas. The major capsid protein, L1, of canine oral papillomavirus (COPV) was expressed in Sf9 insect cells in native conformation. L1 protein, which self-assembled into virus-like particles, was purified on CsCl gradients and injected intradermally into the foot pad of beagles. Vaccinated animals developed circulating antibodies against COPV and became completely resistant to experimental challenge with COPV. Successful immunization was strictly dependent upon native L1 protein conformation and L1 type. Partial protection was achieved with as little as 0.125 ng of L1 protein, and adjuvants appeared useful for prolonging the host immune response. Serum immunoglobulins passively transferred from COPV L1-immunized beagles to naive beagles conferred protection from experimental infection with COPV. Our results indicate the feasibility of developing a human vaccine to prevent mucosal papillomas, which can progress to malignancy.

  13. The effect of preseason training on mucosal immunity in male basketball players.

    Science.gov (United States)

    Azarbayjani, M; Nikbakht, H; Rasaee, M J

    2011-12-01

    This study examined the effects of pre season training on restring level and acute response of mucosal immunity in male basketball players. Twenty male basketball players performed 8 weeks progressive exercise training, consisting of interval and continuous parts. Five mL un-stimulated saliva was collected from each subject before, immediately and one hour after the end of one bout of exercise to exhaustion on treadmill at the beginning of the first week and end of 8 weeks to determine the acute responses. At the beginning of each 2 weeks (resting state) induced changes in basal mucosal immunity was evaluated. The concentration of sIgA and total protein was measured by the ELISA and Bradford methods respectively. One bout exercise training at beginning of first week decreased significantly sIgA level but not at the end of 8th week. Total protein did not change significantly at 1st week after exercise, but at eight week significantly increased and remained at high level until one hour after exercise. sIgA to total protein ratio at first week significantly decreased and remained constant one hour after exercise. At the eight week sIgA decreased significantly immediately after exercise and remained low until one hour after exercise. The comparison of sIgA and total protein levels indicates significant decrease after eight weeks training. These results suggest that repetition of single bout of exercise training have a cumulative effect on the mucosal immune system.

  14. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets

    Science.gov (United States)

    Dong, Li; Zhong, Xiang; Ahmad, Hussain; Li, Wei; Wang, Yuanxiao; Zhang, Lili

    2014-01-01

    Intrauterine growth restriction (IUGR) is a very common problem in both piglet and human neonate populations. We hypothesized that IUGR neonates have impaired intestinal mucosal immunity from birth. Using neonatal piglets as IUGR models, immune organ weights, the weight and length of the small intestine (SI), intestinal morphology, intraepithelial immune cell numbers, levels of cytokines and immunoglobulins, and the relative gene expression of cytokines in the SI were investigated. IUGR neonatal piglets were observed to have lower absolute immune organ weight and SI length, decreased relative weights of the thymus, spleen, mesenteric lymph node, and thinner but longer SIs. Damaged and jagged villi, shorter microvilli, presence of autophagosomes, swelled mitochondria, and decreased villus surface areas were also found in the SIs of IUGR neonatal piglets. We also found a smaller number of epithelial goblet cells and lymphocytes in the SIs of IUGR neonates. In addition, we detected reduced levels of the cytokines TNF-α and IFN-γ and decreased gene expression of cytokines in IUGR neonates. In conclusion, IUGR was shown to impair the mucosal immunity of the SI in neonatal piglets, and the ileum was the major site of impairment. PMID:24710659

  15. Model systems to analyze the role of miRNAs and commensal microflora in bovine mucosal immune system development.

    Science.gov (United States)

    Liang, Guanxiang; Malmuthuge, Nilusha; Guan, Le Luo; Griebel, Philip

    2015-07-01

    Information is rapidly accumulating regarding the role of miRNAs as key regulators of immune system development and function. It is also increasingly evident that miRNAs play an important role in host-pathogen interactions through regulation of both innate and acquired immune responses. Little is known, however, about the specific role of miRNAs in regulating normal development of the mucosal immune system, especially during the neonatal period. Furthermore, there is limited knowledge regarding the possible role the commensal microbiome may play in regulating mucosal miRNAs expression, although evidence is emerging that a variety of enteric pathogens influence miRNA expression. The current review focuses on recent information that miRNAs play an important role in regulating early development of the bovine mucosal immune system. A possible role for the commensal microbiome in regulating mucosal development by altering miRNA expression is also discussed. Finally, we explore the potential advantages of using the newborn calf as a model to determine how interactions between developmental programming, maternal factors in colostrum, and colonization of the gastrointestinal tract by commensal bacteria may alter mucosal miRNA expression and immune development. Identifying the key factors that regulate mucosal miRNA expression is critical for understanding how the balance between protective immunity and inflammation is maintained to ensure optimal gastrointestinal tract function and health of the whole organism. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Neonatal mucosal immunology.

    Science.gov (United States)

    Torow, N; Marsland, B J; Hornef, M W; Gollwitzer, E S

    2017-01-01

    Although largely deprived from exogenous stimuli in utero, the mucosal barriers of the neonate after birth are bombarded by environmental, nutritional, and microbial exposures. The microbiome is established concurrently with the developing immune system. The nature and timing of discrete interactions between these two factors underpins the long-term immune characteristics of these organs, and can set an individual on a trajectory towards or away from disease. Microbial exposures in the gastrointestinal and respiratory tracts are some of the key determinants of the overall immune tone at these mucosal barriers and represent a leading target for future intervention strategies. In this review, we discuss immune maturation in the gut and lung and how microbes have a central role in this process.

  17. Characterising the mucosal and systemic immune responses to experimental human hookworm infection.

    Directory of Open Access Journals (Sweden)

    Soraya Gaze

    2012-02-01

    Full Text Available The mucosal cytokine response of healthy humans to parasitic helminths has never been reported. We investigated the systemic and mucosal cytokine responses to hookworm infection in experimentally infected, previously hookworm naive individuals from non-endemic areas. We collected both peripheral blood and duodenal biopsies to assess the systemic immune response, as well as the response at the site of adult worm establishment. Our results show that experimental hookworm infection leads to a strong systemic and mucosal Th2 (IL-4, IL-5, IL-9 and IL-13 and regulatory (IL-10 and TGF-β response, with some evidence of a Th1 (IFN-γ and IL-2 response. Despite upregulation after patency of both IL-15 and ALDH1A2, a known Th17-inducing combination in inflammatory diseases, we saw no evidence of a Th17 (IL-17 response. Moreover, we observed strong suppression of mucosal IL-23 and upregulation of IL-22 during established hookworm infection, suggesting a potential mechanism by which Th17 responses are suppressed, and highlighting the potential that hookworms and their secreted proteins offer as therapeutics for human inflammatory diseases.

  18. Oral mucosal lesions and immune status in HIV-infected Indian children.

    Science.gov (United States)

    Subramaniam, Priya; Kumar, Krishna

    2015-04-01

    Pediatric HIV is growing at an alarming rate in developing countries. Due to their compromised immune status, children infected with HIV are prone to a number of opportunistic infections. Oral manifestations are the first signs of the disease in many of them. To assess the oral mucosal status of Indian children with HIV, based on their CD4 cell counts. Two hundred and twenty one HIV infected children aged 6-18 years from various HIV centers, were divided into three groups, based on their CD4 cell counts; Group 1: ≥500, Group 2: 201-499 and Group 3: ≤200 cells. The children in each group were further considered as 'prior to antiretroviral treatment (ART)' and 'on ART'. Oral mucosal examination was done based on presumptive criteria given by Ramos-Gomez for diagnosis of oro-facial lesions commonly associated with HIV infection in children. Data obtained was subjected to statistical analysis. Angular cheilitis and pseudomembranous candidiasis were the frequently seen oral lesions. Children with CD4 cell count ≥500 had significantly fewer oral lesions each. A high percentage of HIV-infected children were affected with oral mucosal lesions. There was a significant association between immune status and frequency of oral lesions. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Human Circulating Antibody-Producing B Cell as a Predictive Measure of Mucosal Immunity to Poliovirus.

    Science.gov (United States)

    Dey, Ayan; Molodecky, Natalie A; Verma, Harish; Sharma, Prashant; Yang, Jae Seung; Saletti, Giulietta; Ahmad, Mohammad; Bahl, Sunil K; Wierzba, Thomas F; Nandy, Ranjan K; Deshpande, Jagadish M; Sutter, Roland W; Czerkinsky, Cecil

    2016-01-01

    The "gold standard" for assessing mucosal immunity after vaccination with poliovirus vaccines consists in measuring virus excretion in stool after challenge with oral poliovirus vaccine (OPV). This testing is time and resource intensive, and development of alternative methods is a priority for accelerating polio eradication. We therefore evaluated circulating antibody-secreting cells (ASCs) as a potential means to evaluate mucosal immunity to poliovirus vaccine. 199 subjects, aged 10 years, and previously immunized repeatedly with OPV, were selected. Subjects were assigned to receive either a booster dose of inactivated poliovirus vaccine (IPV), bivalent OPV (bOPV), or no vaccine. Using a micro-modified whole blood-based ELISPOT assay designed for field setting, circulating poliovirus type-specific IgA- and IgG-ASCs, including gut homing α4β7+ ASCs, were enumerated on days 0 and 7 after booster immunization. In addition, serum samples collected on days 0, 28 and 56 were tested for neutralizing antibody titers against poliovirus types 1, 2, and 3. Stool specimens were collected on day 28 (day of bOPV challenge), and on days 31, 35 and 42 and processed for poliovirus isolation. An IPV dose elicited blood IgA- and IgG-ASC responses in 84.8 to 94.9% of subjects, respectively. In comparison, a bOPV dose evoked corresponding blood ASC responses in 20.0 to 48.6% of subjects. A significant association was found between IgA- and IgG-ASC responses and serum neutralizing antibody titers for poliovirus type 1, 2, 3 (ppoliovirus types 1, 2 and 3 was 62.7%, 89.8% and 45.8%, respectively. A significant association was observed between virus excretion and α4β7+ IgA- and/or IgG-ASC responses to poliovirus type 3 among immunized children; however, only a weak association was found for type 1 poliovirus. Our results suggest that virus-specific blood ASCs, especially for type 3 poliovirus, can serve as surrogate of mucosal immunity after vaccination. Further studies are needed to

  20. Barriers to Immunizations and Strategies to Enhance Immunization Rates in Adults with Autoimmune Inflammatory Diseases.

    Science.gov (United States)

    Kirchner, Elizabeth; Ruffing, Victoria

    2017-02-01

    For as long as there have been immunizations, there have been barriers to them. Immunization rates in the United States are below target. Rheumatologists and rheumatology practitioners need to understand the issues of immunizations in patients with autoimmune inflammatory disease to identify and overcome barriers to immunization. Several strategies for overcoming these barriers are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. The Impact of Western Diet and Nutrients on the Microbiota and Immune Response at Mucosal Interfaces

    Directory of Open Access Journals (Sweden)

    Donjete Statovci

    2017-07-01

    Full Text Available Recent findings point toward diet having a major impact on human health. Diets can either affect the gut microbiota resulting in alterations in the host’s physiological responses or by directly targeting the host response. The microbial community in the mammalian gut is a complex and dynamic system crucial for the development and maturation of both systemic and mucosal immune responses. Therefore, the complex interaction between available nutrients, the microbiota, and the immune system are central regulators in maintaining homeostasis and fighting against invading pathogens at mucosal sites. Westernized diet, defined as high dietary intake of saturated fats and sucrose and low intake of fiber, represent a growing health risk contributing to the increased occurrence of metabolic diseases, e.g., diabetes and obesity in countries adapting a westernized lifestyle. Inflammatory bowel diseases (IBD and asthma are chronic mucosal inflammatory conditions of unknown etiology with increasing prevalence worldwide. These conditions have a multifactorial etiology including genetic factors, environmental factors, and dysregulated immune responses. Their increased prevalence cannot solely be attributed to genetic considerations implying that other factors such as diet can be a major contributor. Recent reports indicate that the gut microbiota and modifications thereof, due to a consumption of a diet high in saturated fats and low in fibers, can trigger factors regulating the development and/or progression of both conditions. While asthma is a disease of the airways, increasing evidence indicates a link between the gut and airways in disease development. Herein, we provide a comprehensive review on the impact of westernized diet and associated nutrients on immune cell responses and the microbiota and how these can influence the pathology of IBD and asthma.

  2. Prolonged protection against Intranasal challenge with influenza virus following systemic immunization or combinations of mucosal and systemic immunizations with a heat-labile toxin mutant.

    Science.gov (United States)

    Zhou, Fengmin; Goodsell, Amanda; Uematsu, Yasushi; Vajdy, Michael

    2009-04-01

    Seasonal influenza virus infections cause considerable morbidity and mortality in the world, and there is a serious threat of a pandemic influenza with the potential to cause millions of deaths. Therefore, practical influenza vaccines and vaccination strategies that can confer protection against intranasal infection with influenza viruses are needed. In this study, we demonstrate that using LTK63, a nontoxic mutant of the heat-labile toxin from Escherichia coli, as an adjuvant for both mucosal and systemic immunizations, systemic (intramuscular) immunization or combinations of mucosal (intranasal) and intramuscular immunizations protected mice against intranasal challenge with a lethal dose of live influenza virus at 3.5 months after the second immunization.

  3. Gold nanoparticles conjugating recombinant influenza hemagglutinin trimers and flagellin enhanced mucosal cellular immunity.

    Science.gov (United States)

    Wang, Chao; Zhu, Wandi; Luo, Yuan; Wang, Bao-Zhong

    2018-04-09

    The immunogenicity of subunit vaccines can be augmented by formulating them into nanoparticles. We conjugated recombinant trimetric influenza A/Aichi/2/68(H3N2) hemagglutinin (HA) onto functionalized gold nanoparticles (AuNPs) surfaces in a repetitive, oriented configuration. To further improve the immunogenicity, we generated Toll-like receptor 5 (TLR5) agonist flagellin (FliC)-coupled AuNPs as particulate adjuvants. Intranasal immunizations with an AuNP-HA and AuNP-FliC particle mixture elicited strong mucosal and systemic immune responses that protected hosts against lethal influenza challenges. Compared with the AuNP-HA alone group, the addition of AuNP-FliC improved mucosal B cell responses as characterized by elevated influenza specific IgA and IgG levels in nasal, tracheal, and lung washes. AuNP-HA/AuNP-FliC also stimulated antigen-specific interferon-γ (IFN-γ)-secreting CD4 + cell proliferation and induced strong effector CD8 + T cell activation. Our results indicate that intranasal co-delivery of antigen and adjuvant-displaying AuNPs enhanced vaccine efficacy by inducing potent cellular immune responses. Copyright © 2018. Published by Elsevier Inc.

  4. Commensal bacteria (normal microflora), mucosal immunity and chronic inflammatory and autoimmune diseases

    Czech Academy of Sciences Publication Activity Database

    Tlaskalová, Helena; Štěpánková, Renata; Hudcovic, Tomáš; Tučková, Ludmila; Cukrowska, B.; Lodinová-Žádníková, R.; Kozáková, Hana; Rossmann, Pavel; Bártová, J.; Sokol, Dan

    2004-01-01

    Roč. 93, - (2004), s. 97-108 ISSN 0165-2478 R&D Projects: GA ČR GA310/01/0933; GA ČR GA310/02/1470; GA AV ČR IAA5020101; GA AV ČR IAA5020205; GA AV ČR IAA5020210; GA AV ČR IBS5020203; GA MZd NK6742; GA MZd NI7525 Institutional research plan: CEZ:AV0Z5020903 Keywords : mucosal microbiota * intestina barrier * germ-free animal Subject RIV: EE - Microbiology, Virology Impact factor: 2.136, year: 2004

  5. Epithelium-innate immune cell axis in mucosal responses to SIV.

    Science.gov (United States)

    Shang, L; Duan, L; Perkey, K E; Wietgrefe, S; Zupancic, M; Smith, A J; Southern, P J; Johnson, R P; Haase, A T

    2017-03-01

    In the SIV (simian immunodeficiency virus)-rhesus macaque model of HIV-1 (human immunodeficiency virus type I) transmission to women, one hallmark of the mucosal response to exposure to high doses of SIV is CD4 T-cell recruitment that fuels local virus expansion in early infection. In this study, we systematically analyzed the cellular events and chemoattractant profiles in cervical tissues that precede CD4 T-cell recruitment. We show that vaginal exposure to the SIV inoculum rapidly induces chemokine expression in cervical epithelium including CCL3, CCL20, and CXCL8. The chemokine expression is associated with early recruitment of macrophages and plasmacytoid dendritic cells that are co-clustered underneath the cervical epithelium. Production of chemokines CCL3 and CXCL8 by these cells in turn generates a chemokine gradient that is spatially correlated with the recruitment of CD4 T cells. We further show that the protection of SIVmac239Δnef vaccination against vaginal challenge is correlated with the absence of this epithelium-innate immune cell-CD4 T-cell axis response in the cervical mucosa. Our results reveal a critical role for cervical epithelium in initiating early mucosal responses to vaginal infection, highlight an important role for macrophages in target cell recruitment, and provide further evidence of a paradoxical dampening effect of a protective vaccine on these early mucosal responses.

  6. Effects of positive acceleration exposure on intestinal mucosal barrier and sIgA level in rats

    Directory of Open Access Journals (Sweden)

    Jie QIU

    2016-10-01

    Full Text Available Objective  To explore the effect of positive acceleration (+Gz on immune barrier of intestinal mucosa in rats. Methods  Thirty two male SD rats were randomly divided into 4 groups (8 each: Group A (control group, Group B (+5Gz group, Group C (+10Gz group and Group D (repeated exposure group. The animal centrifuge was used to simulate the exposure of acceleration. Group A was no disposed. +5Gz group and +10Gz group were subjected to centrifugal force of +5Gz and +10Gz respectively for 5min; repeated exposure group was continuously exposed to 1.5min under +5Gz value, 2min under +10Gz value and 1.5min under +5Gz. All groups were exposed to the respective acceleration once daily for 5 days. The damage of intestinal mucosa was observed by light microscopy after the experiment was finished, and the content of sIgA in intestinal mucosa was detected by ELISA. Results  Except for group A, intestinal mucosal injury was observed in the other three groups. Group D was shown as the most serious one, followed by group C and group B. Compared with group A, the level of sIgA was significantly lower in other three groups (P<0.05. The level of sIgA in group C was significantly lower than that in group B (P<0.05 and higher than that in group D (P<0.05. Conclusion  +Gz exposure can result in intestinal injury and weaken the function of immune barrier of intestinal mucosa in rats. DOI: 10.11855/j.issn.0577-7402.2016.10.14

  7. Effects of pig antibacterial peptides on growth performance and intestine mucosal immune of broiler chickens.

    Science.gov (United States)

    Bao, H; She, R; Liu, T; Zhang, Y; Peng, K S; Luo, D; Yue, Z; Ding, Y; Hu, Y; Liu, W; Zhai, L

    2009-02-01

    Currently, substitutions for antibiotic growth promoters in animals are attracting interest. This study investigated the effects of pig antibacterial peptides (PABP) on growth performance and small intestine mucosal immune responses in broilers. Three hundred 1-d-old Arbor Acre male broiler chickens were randomly allocated to 5 groups with 60 birds per group. The groups were control group; PABP administered in drinking water at 20 and 30 mg/L of water; or PABP supplemented in feed at 150 and 200 mg/kg of diet. The birds were fed a corn-soybean based diet for 6 wk. Chickens were weighed weekly and killed after 42 d of feeding, and growth performance was measured. Samples of the duodenum and jejunum were collected. The villus height, mucosa thickness, alkaline phosphatase activity, and numbers of secreting IgA and goblet cells were evaluated. The PABP-treated groups had greater BW and average daily gain, greater height of villus and thickness of gut mucosa, greater activity of alkaline phosphatase, higher ratio of secreting IgA, and a greater number of goblet cells compared with the control group (P<0.05). In conclusion, PABP can improve the growth performance, increase the intestinal ability to absorb nutrients, and improve the mucosal immunity of the intestine.

  8. The relationship between mucosal immunity, nasopharyngeal carriage, asymptomatic transmission and the resurgence of Bordetella pertussis

    Science.gov (United States)

    Gill, Christopher; Rohani, Pejman; Thea, Donald M

    2017-01-01

    The incidence of whooping cough in the US has been rising slowly since the 1970s, but the pace of this has accelerated sharply since acellular pertussis vaccines replaced the earlier whole cell vaccines in the late 1990s. A similar trend occurred in many other countries, including the UK, Canada, Australia, Ireland, and Spain, following the switch to acellular vaccines. The key question is why. Two leading theories (short duration of protective immunologic persistence and evolutionary shifts in the pathogen to evade the vaccine) explain some but not all of these shifts, suggesting that other factors may also be important. In this synthesis, we argue that sterilizing mucosal immunity that blocks or abbreviates the duration of nasopharyngeal carriage of Bordetella pertussis and impedes person-to-person transmission (including between asymptomatically infected individuals) is a critical factor in this dynamic. Moreover, we argue that the ability to induce such mucosal immunity is fundamentally what distinguishes whole cell and acellular pertussis vaccines and may be pivotal to understanding much of the resurgence of this disease in many countries that adopted acellular vaccines. Additionally, we offer the hypothesis that observed herd effects generated by acellular vaccines may reflect a modification of disease presentation leading to reduced potential for transmission by those already infected, as opposed to inducing resistance to infection among those who have been exposed. PMID:28928960

  9. Transgene vaccination using Ulex europaeus agglutinin I (UEA-1) for targeted mucosal immunization against HIV-1 envelope.

    Science.gov (United States)

    Wang, Xinhai; Kochetkova, Irina; Haddad, Asmahan; Hoyt, Teri; Hone, David M; Pascual, David W

    2005-05-31

    Receptor-mediated gene transfer using an M cell ligand has been shown to be an efficient method for mucosal DNA immunization. To investigate further into alternative M cell ligands, the plant lectin, Ulex europaeus agglutinin I (UEA-1), was tested. UEA-1 binds to human intestinal Caco-2 cells, and these cells can be transfected with poly-l-lysine (PL)-conjugated UEA-1 for expression of reporter cDNAs. When tested in vivo, mice nasally immunized with UEA-1-PL complexed to plasmid encoding HIV-1 envelope showed elevated systemic and mucosal antibody responses, and these were supported by tissue antibody-forming cells. Likewise, elevated envelope-specific CTLs were induced. Thus, UEA-1 mediated DNA delivery represents an alternative mucosal formulation for inducing humoral and cellular immunity against HIV-1.

  10. CCR2 mediates Helicobacter pylori-induced immune tolerance and contributes to mucosal homeostasis.

    Science.gov (United States)

    Sun, Xia; Zhang, Min; El-Zaatari, Mohamad; Huffnagle, Gray B; Kao, John Y

    2017-04-01

    We previously demonstrated that H. pylori infection leads to increased induction of regulatory T cells in local and systemic immune compartments. Here, we investigate the role of CCR2 in the tolerogenic programing of dendritic cells in a mouse model of H. pylori infection. CCR2 deficient (CCR2KO) mice and wild-type (Wt) mice infected with H. pylori SS1 strain were analyzed by qPCR and FACS analysis. In vitro, bone marrow-derived DC on day 6 from CCR2KO and Wt mice cocultured with or without H. pylori were examined to determine the impact of CCR2 signaling on dendritic cells function by qPCR, ELISA, and FACS analyses. Acute H. pylori infection was associated with a threefold increase in CCR2 mRNA expression in the gastric mucosa. H. pylori-infected CCR2KO mice exhibited a higher degree of mucosal inflammation, that is, increased gastritis scores and pro-inflammatory cytokine mRNA levels, but lower degree of H. pylori gastric colonization compared to infected Wt mice. Peripheral H. pylori-specific immune response measured in the CCR2KO spleen was characterized by a higher Th17 response and a lower Treg response. In vitro, CCR2KO bone marrow-derived DC was less mature and shown a lower Treg/Th17 ratio. Moreover, blockade of CCR2 signaling by MCP-1 neutralizing antibody inhibited H. pylori-stimulated bone marrow-derived DC maturation. Our results indicate that CCR2 plays an essential role in H. pylori-induced immune tolerance and shed light on a novel mechanism of CCR2-dependent DC Treg induction, which appears to be important in maintaining mucosal homeostasis during H. pylori infection. © 2016 John Wiley & Sons Ltd.

  11. Predictive computational modeling of the mucosal immune responses during Helicobacter pylori infection.

    Directory of Open Access Journals (Sweden)

    Adria Carbo

    Full Text Available T helper (Th cells play a major role in the immune response and pathology at the gastric mucosa during Helicobacter pylori infection. There is a limited mechanistic understanding regarding the contributions of CD4+ T cell subsets to gastritis development during H. pylori colonization. We used two computational approaches: ordinary differential equation (ODE-based and agent-based modeling (ABM to study the mechanisms underlying cellular immune responses to H. pylori and how CD4+ T cell subsets influenced initiation, progression and outcome of disease. To calibrate the model, in vivo experimentation was performed by infecting C57BL/6 mice intragastrically with H. pylori and assaying immune cell subsets in the stomach and gastric lymph nodes (GLN on days 0, 7, 14, 30 and 60 post-infection. Our computational model reproduced the dynamics of effector and regulatory pathways in the gastric lamina propria (LP in silico. Simulation results show the induction of a Th17 response and a dominant Th1 response, together with a regulatory response characterized by high levels of mucosal Treg cells. We also investigated the potential role of peroxisome proliferator-activated receptor γ (PPARγ activation on the modulation of host responses to H. pylori by using loss-of-function approaches. Specifically, in silico results showed a predominance of Th1 and Th17 cells in the stomach of the cell-specific PPARγ knockout system when compared to the wild-type simulation. Spatio-temporal, object-oriented ABM approaches suggested similar dynamics in induction of host responses showing analogous T cell distributions to ODE modeling and facilitated tracking lesion formation. In addition, sensitivity analysis predicted a crucial contribution of Th1 and Th17 effector responses as mediators of histopathological changes in the gastric mucosa during chronic stages of infection, which were experimentally validated in mice. These integrated immunoinformatics approaches

  12. A strong adjuvant based on glycol-chitosan-coated lipid-polymer hybrid nanoparticles potentiates mucosal immune responses against the recombinant Chlamydia trachomatis fusion antigen CTH522

    DEFF Research Database (Denmark)

    Rose, Fabrice; Erbo Wern, Jeanette; Gavins, Francesca

    2018-01-01

    with the cationic surfactant dimethyldioctadecylammonium bromide and the immunopotentiator trehalose-6,6'-dibehenate. Here we show that immunization with these lipid-polymer hybrid nanoparticles (LPNs) coated with the mucoadhesive polymer chitosan enhances mucosal immune responses. Glycol chitosan (GC......-specific IgG/IgA antibodies, together with CTH522-specific interferon γ-producing Th1 cells. This study demonstrates that mucosal administration of chitosan-coated LPNs represents a promising strategy to modulate the magnitude of mucosal vaccine responses....

  13. Shifts in Host Mucosal Innate Immune Function Are Associated with Ruminal Microbial Succession in Supplemental Feeding and Grazing Goats at Different Ages

    Directory of Open Access Journals (Sweden)

    Jinzhen Jiao

    2017-08-01

    Full Text Available Gastrointestinal microbiota may play an important role in regulating host mucosal innate immune function. This study was conducted to test the hypothesis that age (non-rumination, transition and rumination and feeding type [Supplemental feeding (S vs. Grazing (G] could alter ruminal microbial diversity and maturation of host mucosal innate immune system in goat kids. MiSeq sequencing was applied to investigate ruminal microbial composition and diversity, and RT-PCR was used to test expression of immune-related genes in ruminal mucosa. Results showed that higher (P < 0.05 relative abundances of Prevotella, Butyrivibrio, Pseudobutyrivibrio, Methanobrevibacter.gottschalkii, Neocallimastix, Anoplodinium–Diplodinium, and Polyplastron, and lower relative abundance of Methanosphaera (P = 0.042 were detected in the rumen of S kids when compared to those in G kids. The expression of genes encoding TLRs, IL1α, IL1β and TICAM2 was down-regulated (P < 0.01, while expression of genes encoding tight junction proteins was up-regulated (P < 0.05 in the ruminal mucosa of S kids when compared to that in G kids. Moreover, irrespective of feeding type, relative abundances of ruminal Prevotella, Fibrobacter, Ruminococcus, Butyrivibrio, Methanobrevibacter, Neocallimastix, and Entodinium increased with age. The expression of most genes encoding TLRs and cytokines increased (P < 0.05 from day 0 to 7, while expression of genes encoding tight junction proteins declined with age (P < 0.05. This study revealed that the composition of each microbial domain changed as animals grew, and these changes might be associated with variations in host mucosal innate immune function. Moreover, supplementing goat kids with concentrate could modulate ruminal microbial composition, enhance barrier function and decrease local inflammation. The findings provide useful information in interpreting microbiota and host interactions, and developing nutritional strategies to improve the

  14. Eosinophils express muscarinic receptors and corticotropin-releasing factor to disrupt the mucosal barrier in ulcerative colitis.

    Science.gov (United States)

    Wallon, Conny; Persborn, Mats; Jönsson, Maria; Wang, Arthur; Phan, Van; Lampinen, Maria; Vicario, Maria; Santos, Javier; Sherman, Philip M; Carlson, Marie; Ericson, Ann-Charlott; McKay, Derek M; Söderholm, Johan D

    2011-05-01

    Altered intestinal barrier function has been implicated in the pathophysiology of ulcerative colitis (UC) in genetic, functional, and epidemiological studies. Mast cells and corticotropin-releasing factor (CRF) regulate the mucosal barrier in human colon. Because eosinophils are often increased in colon tissues of patients with UC, we assessed interactions among mast cells, CRF, and eosinophils in the mucosal barrier of these patients. Transmucosal fluxes of protein antigens (horseradish peroxidase) and paracellular markers ((51)Cr-EDTA, fluorescein isothiocyanate-dextran 4000) were studied in noninflamed, colonic mucosal biopsy samples collected from 26 patients with UC and 53 healthy volunteers (controls); samples were mounted in Ussing chambers. We also performed fluorescence and electron microscopy of human tissue samples, assessed isolated eosinophils, and performed mechanistic studies using in vitro cocultured eosinophils (15HL-60), mast cells (HMC-1), and a colonic epithelial cell line (T84). Colon tissues from patients with UC had significant increases in permeability to protein antigens compared with controls. Permeability was blocked by atropine (a muscarinic receptor antagonist), α-helical CRF(9-41) (a CRF receptor antagonist), and lodoxamide (a mast-cell stabilizer). Eosinophils were increased in number in UC tissues (compared with controls), expressed the most M2 and M3 muscarinic receptors of any mucosal cell type, and had immunoreactivity to CRF. In coculture studies, carbachol activation of eosinophils caused production of CRF and activation of mast cells, which increased permeability of T84 epithelial cells to macromolecules. We identified a neuroimmune intercellular circuit (from cholinergic nerves, via eosinophils to mast cells) that mediates colonic mucosal barrier dysfunction in patients with UC. This circuit might exacerbate mucosal inflammation. Copyright © 2011 AGA Institute. Published by Elsevier Inc. All rights reserved.

  15. Nasal Lipopolysaccharide Challenge and Cytokine Measurement Reflects Innate Mucosal Immune Responsiveness.

    Directory of Open Access Journals (Sweden)

    Jaideep Dhariwal

    Full Text Available Practical methods of monitoring innate immune mucosal responsiveness are lacking. Lipopolysaccharide (LPS is a component of the cell wall of Gram negative bacteria and a potent activator of Toll-like receptor (TLR-4. To measure LPS responsiveness of the nasal mucosa, we administered LPS as a nasal spray and quantified chemokine and cytokine levels in mucosal lining fluid (MLF.We performed a 5-way cross-over, single blind, placebo-controlled study in 15 healthy non-atopic subjects (n = 14 per protocol. Doses of ultrapure LPS (1, 10, 30 or 100μg/100μl or placebo were administered by a single nasal spray to each nostril. Using the recently developed method of nasosorption with synthetic adsorptive matrices (SAM, a series of samples were taken. A panel of seven cytokines/chemokines were measured by multiplex immunoassay in MLF. mRNA for intercellular cell adhesion molecule-1 (ICAM-1 was quantified from nasal epithelial curettage samples taken before and after challenge.Topical nasal LPS was well tolerated, causing no symptoms and no visible changes to the nasal mucosa. LPS induced dose-related increases in MLF levels of IL-1β, IL-6, CXCL8 (IL-8 and CCL3 (MIP-1α (AUC at 0.5 to 10h, compared to placebo, p<0.05 at 30 and 100μg LPS. At 100μg LPS, IL-10, IFN-α and TNF-α were also increased (p<0.05. Dose-related changes in mucosal ICAM-1 mRNA were also seen after challenge, and neutrophils appeared to peak in MLF at 8h. However, 2 subjects with high baseline cytokine levels showed prominent cytokine and chemokine responses to relatively low LPS doses (10μg and 30μg LPS.Topical nasal LPS causes dose-dependent increases in cytokines, chemokines, mRNA and cells. However, responsiveness can show unpredictable variations, possibly because baseline innate tone is affected by environmental factors. We believe that this new technique will have wide application in the study of the innate immune responses of the respiratory mucosa.Ultrapure LPS was used

  16. Vaginal type-II mucosa is an inductive site for primary CD8+ T-cell mucosal immunity

    Science.gov (United States)

    Wang, Yichuan; Sui, Yongjun; Kato, Shingo; Hogg, Alison E.; Steel, Jason C.; Morris, John C.; Berzofsky, Jay A.

    2014-01-01

    The structured lymphoid tissues are considered the only inductive sites where primary T cell immune responses occur. The naïve T cells in structured lymphoid tissues, once being primed by antigen -bearing dendritic cells, differentiate into memory T cells and traffic back to the mucosal sites through the bloodstream. Contrary to this belief, here we show that the vaginal type-II mucosa itself, despite lack of structured lymphoid tissues, can act as an inductive site during primary CD8+ T cell immune responses. We provide evidence that the vaginal mucosa supports both the local immune priming of naïve CD8+ T cells and the local expansion of antigen-specific CD8+ T cells, thereby demonstrating a different paradigm for primary mucosal T cell immune induction. PMID:25600442

  17. Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

    For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

  18. Secretory IgA's complex roles in immunity and mucosal homeostasis in the gut.

    Science.gov (United States)

    Mantis, N J; Rol, N; Corthésy, B

    2011-11-01

    Secretory IgA (SIgA) serves as the first line of defense in protecting the intestinal epithelium from enteric toxins and pathogenic microorganisms. Through a process known as immune exclusion, SIgA promotes the clearance of antigens and pathogenic microorganisms from the intestinal lumen by blocking their access to epithelial receptors, entrapping them in mucus, and facilitating their removal by peristaltic and mucociliary activities. In addition, SIgA functions in mucosal immunity and intestinal homeostasis through mechanisms that have only recently been revealed. In just the past several years, SIgA has been identified as having the capacity to directly quench bacterial virulence factors, influence composition of the intestinal microbiota by Fab-dependent and Fab-independent mechanisms, promote retro-transport of antigens across the intestinal epithelium to dendritic cell subsets in gut-associated lymphoid tissue, and, finally, to downregulate proinflammatory responses normally associated with the uptake of highly pathogenic bacteria and potentially allergenic antigens. This review summarizes the intrinsic biological activities now associated with SIgA and their relationships with immunity and intestinal homeostasis.

  19. Lacrimal drainage-associated lymphoid tissue (LDALT): a part of the human mucosal immune system.

    Science.gov (United States)

    Knop, E; Knop, N

    2001-03-01

    Mucosa-associated lymphoid tissue (MALT) specifically protects mucosal surfaces. In a previous study of the human conjunctiva, evidence was also found for the presence of MALT in the lacrimal sac. The present study, therefore, aims to investigate its morphology and topographical distribution in the human lacrimal drainage system. Lacrimal drainage systems (n = 51) obtained from human cadavers were investigated by clearing flat wholemounts or by serial sections of tissue embedded in paraffin, OCT compound, or epoxy resin. These were further analyzed by histology, immunohistochemistry, and electron microscopy. All specimens showed the presence of lymphocytes and plasma cells as a diffuse lymphoid tissue in the lamina propria, together with intraepithelial lymphocytes and occasional high endothelial venules (HEV). It formed a narrow layer along the canaliculi that became thicker in the cavernous parts. The majority of lymphocytes were T cells, whereas B cells were interspersed individually or formed follicular centers. T cells were positive for CD8 and the human mucosa lymphocyte antigen (HML-1). Most plasma cells were positive for IgA and the overlying epithelium expressed its transporter molecule secretory component (SC). Basal mucous glands were present in the lacrimal canaliculi and in the other parts accompanied by alveolar and acinar glands, all producing IgA-rich secretions. Primary and secondary lymphoid follicles possessing HEV were present in about half of the specimens. The term lacrimal drainage-associated lymphoid tissue (LDALT) is proposed here to describe the lymphoid tissue that is regularly present and belongs to the common mucosal immune system and to the secretory immune system. It is suggested that it may form a functional unit together with the lacrimal gland and conjunctiva, connected by tear flow, lymphocyte recirculation, and probably the neural reflex arc, and play a major role in preserving ocular surface integrity.

  20. Regulation of Mucosal Immune Responses – The Missing Link in IBD?

    Directory of Open Access Journals (Sweden)

    Charles O Elson

    1996-01-01

    Full Text Available Although the etiology of inflammatory bowel disease (IBD remains unknown, a major working hypothesis is that it represents a dysregulated immune response to common enteric bacterial antigens. Until recently there has been a relative dearth of experimental models to study this hypothesis. However, exciting developments in experimental models of colitis, including spontaneous, transgenic and knockout mice, now allow this and other hypotheses to be tested. The regulation of mucosal immune responses is not well understood in the normal animal, much less in those with chronic intestinal inflammation. Clearly the CD4 Th1 and Th2 pathways are important in the host response to microbial pathogens, and recent data indicate that the intestinal mucosa seems to be a site of preferential Th2 responses toward exogenous antigens. Deletion of certain cytokine genes involved in maintaining this Th1/Th2 balance (interleukin [IL]-2, IL-10 resulted in colitis, although deletion of others (IL-4, interferon-gamma that are also involved did not. Whether these cytokine gene deletions cause a dysregulation of the mucosal immune response has yet to be shown. However, the importance of regulation can be demonstrated in a model in which a normal CD4+ T cell subset (CD45Rbhigh is transferred into syngeneic severe combined immunodeficiency syndrome recipients. This results in a striking colitis over the ensuing weeks with chronic diarrhea and wasting of the animals. If the reciprocal CD4+ subset (CD45Rblow is co-transferred or if whole CD4+ T cells are transferred no colitis ensues. Therefore, T cells capable of causing colitis are present in normal animals but are prevented from doing so by immunoregulatory mechanisms. The antigens that drive the colitis in several of these models (IL-2 knockout mouse, human leukocyte antigen B27/β2M transgenic rat appear to be those of the normal enteric bacterial flora because germ-free animals do not get the disease. Spontaneously

  1. Immunology of Gut Mucosal Vaccines

    Science.gov (United States)

    Pasetti, Marcela F.; Simon, Jakub K.; Sztein, Marcelo B.; Levine, Myron M.

    2011-01-01

    Summary Understanding the mechanisms underlying the induction of immunity in the gastrointestinal mucosa following oral immunization and the cross-talk between mucosal and systemic immunity should expedite the development of vaccines to diminish the global burden caused by enteric pathogens. Identifying an immunological correlate of protection in the course of field trials of efficacy, animal models (when available), or human challenge studies is also invaluable. In industrialized country populations, live attenuated vaccines (e.g. polio, typhoid, and rotavirus) mimic natural infection and generate robust protective immune responses. In contrast, a major challenge is to understand and overcome the barriers responsible for the diminished immunogenicity and efficacy of the same enteric vaccines in underprivileged populations in developing countries. Success in developing vaccines against some enteric pathogens has heretofore been elusive (e.g. Shigella). Different types of oral vaccines can selectively or inclusively elicit mucosal secretory immunoglobulin A and serum immunoglobulin G antibodies and a variety of cell-mediated immune responses. Areas of research that require acceleration include interaction between the gut innate immune system and the stimulation of adaptive immunity, development of safe yet effective mucosal adjuvants, better understanding of homing to the mucosa of immunologically relevant cells, and elicitation of mucosal immunologic memory. This review dissects the immune responses elicited in humans by enteric vaccines. PMID:21198669

  2. Expert-led didactic versus self-directed audiovisual training of confocal laser endomicroscopy in evaluation of mucosal barrier defects.

    Science.gov (United States)

    Huynh, Roy; Ip, Matthew; Chang, Jeff; Haifer, Craig; Leong, Rupert W

    2018-01-01

     Confocal laser endomicroscopy (CLE) allows mucosal barrier defects along the intestinal epithelium to be visualized in vivo during endoscopy. Training in CLE interpretation can be achieved didactically or through self-directed learning. This study aimed to compare the effectiveness of expert-led didactic with self-directed audiovisual teaching for training inexperienced analysts on how to recognize mucosal barrier defects on endoscope-based CLE (eCLE).  This randomized controlled study involved trainee analysts who were taught how to recognize mucosal barrier defects on eCLE either didactically or through an audiovisual clip. After being trained, they evaluated 6 sets of 30 images. Image evaluation required the trainees to determine whether specific features of barrier dysfunction were present or not. Trainees in the didactic group engaged in peer discussion and received feedback after each set while this did not happen in the self-directed group. Accuracy, sensitivity, and specificity of both groups were compared. Trainees in the didactic group achieved a higher overall accuracy (87.5 % vs 85.0 %, P  = 0.002) and sensitivity (84.5 % vs 80.4 %, P  = 0.002) compared to trainees in the self-directed group. Interobserver agreement was higher in the didactic group (k = 0.686, 95 % CI 0.680 - 0.691, P  barrier defects on eCLE.

  3. Mucosal T cells in gut homeostasis and inflammation

    OpenAIRE

    van Wijk, Femke; Cheroutre, Hilde

    2010-01-01

    The antigen-rich environment of the gut interacts with a highly integrated and specialized mucosal immune system that has the challenging task of preventing invasion and the systemic spread of microbes, while avoiding excessive or unnecessary immune responses to innocuous antigens. Disruption of the mucosal barrier and/or defects in gut immune regulatory networks may lead to chronic intestinal inflammation as seen in inflammatory bowel disease. The T-cell populations of the intestine play a c...

  4. The Design of New Adjuvants for Mucosal Immunity to Neisseria meningitidis B in Nasally Primed Neonatal Mice for Adult Immune Response

    Directory of Open Access Journals (Sweden)

    Tatiane Ferreira

    2012-01-01

    Full Text Available The aim of this study was to determine the value of detoxified Shiga toxins Stx1 and Stx2 (toxoids of Escherichia coli as mucosal adjuvants in neonatal mice for immunogenicity against the outer membrane proteins (OMPs of Neisseria meningitidis B. Mucosal immunization has been shown to be effective for the induction of antigen-specific immune responses in both the systemic and mucosal compartments. Systemic antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, and IgA and mucosal IgM and IgA were measured by ELISA using an N. meningitidis as an antigen. In addition, IFN-γ and IL-6 production were measured after stimulated proliferation of immune cells. Intranasal administration elicited a higher anti-OMP IgA response in both saliva and vaginal fluids. Our results suggest that both Stx1 and Stx2 toxoids are effective mucosal adjuvants for the induction of Ag-specific IgG, IgM, and IgA antibodies. The toxoids significantly enhanced the IgG and IgM response against OMPs with a potency equivalent to CT, with the response being characterized by both IgG1 and IgG2a isotypes, and increased IFN-gamma production. Additionally, bactericidal activity was induced with IgG and IgM antibodies of high avidity. These results support the use of the new toxoids as potent inducing adjuvants that are particularly suitable for mucosal immunization.

  5. MICROECOLOGY OF NASOPHARYNGEAL MUCOSAL MEMBRANES AND ESTIMATION OF FACTORS OF MUCOSAL AND LYMPHOCYTIC IMMUNITY IN RECRUITS DURING THE FORMATION OF ORGANIZED TEAM

    Directory of Open Access Journals (Sweden)

    V. A. Nikiforov

    2014-01-01

    Full Text Available Contamination of nasopharyngeal mucosa by opportunistic and pathogenic bacteria in practically healthy people during the formation of the close group has been accompanied by a dysfunction of mucosal immunity, imbalanceof cytokine profile, insolvency of antioxidant system, increasing endointoxication. Adequate changes of serum immunoglobulins level in patients with nasopharyngeal dysbiosis allow to conclude of usefulness of the pre-emptive vaccination and using drugs with immunomodulatory effect which reliably satisfy body’s need for antioxidants.

  6. Altered biomarkers of mucosal immunity and reduced vaginal Lactobacillus concentrations in sexually active female adolescents.

    Directory of Open Access Journals (Sweden)

    Rebecca Pellett Madan

    Full Text Available Genital secretions collected from adult women exhibit in vitro activity against herpes simplex virus (HSV and Escherichia coli (E. coli, but prior studies have not investigated this endogenous antimicrobial activity or its mediators in adolescent females.Anti-HSV and anti-E.coli activity were quantified from cervicovaginal lavage (CVL specimens collected from 20 sexually active adolescent females (15-18 years. Soluble immune mediators that may influence this activity were measured in CVL, and concentrations of Lactobacillus jensenii and crispatus were quantified by PCR from vaginal swabs. Results for adolescents were compared to those obtained from 54 healthy, premenopausal adult women. Relative to specimens collected from adults, CVL collected from adolescent subjects had significantly reduced activity against E. coli and diminished concentrations of protein, IgG, and IgA but significantly increased anti-HSV activity and concentrations of interleukin (IL-1α, IL-6 and IL-1 receptor antagonist. Vaginal swabs collected from adolescent subjects had comparable concentrations of L. crispatus but significantly reduced concentrations of L. jensenii, relative to adult swabs.Biomarkers of genital mucosal innate immunity may differ substantially between sexually active adolescents and adult women. These findings warrant further study and may have significant implications for prevention of sexually transmitted infections in adolescent females.

  7. Enhanced mucosal and systemic immune response with intranasal immunization of mice with HIV peptides entrapped in PLG microparticles in combination with Ulex Europaeus-I lectin as M cell target.

    Science.gov (United States)

    Manocha, Monika; Pal, Pramod Chandra; Chitralekha, K T; Thomas, Beena Elizabeth; Tripathi, Vinita; Gupta, Siddhartha Dutta; Paranjape, Ramesh; Kulkarni, Smita; Rao, D Nageswara

    2005-12-01

    The predominant route of HIV infection is through the sexual transmission via M cells. Most of the peptide and protein vaccines show poor transport across the epithelial barrier and are commonly administered by parenteral route. In the present study four HIV peptides from envelope (gp 41-LZ (leucine zipper), gp 41-FD (fusion domain) and gp120-C2) and regulatory (Nef) region in poly lactic-co-glycolide (PLG) micro-particle delivery were evaluated in mice of outbred and with different genetic background to compare immune response versus MHC restriction. Out of the combinational and single routes of immunization attempted, the single route maintained the IgG, IgA and sIgA in sera and washes for longer duration as compared to combinational routes in which the response was declined. The study demonstrated that single intranasal immunization offered significantly higher immune response (pPP>or=SP. The cytokine measurement profile of IL-2, IFN-gamma and IL-6 and low levels of IL-4 in the cultural supernatants of SP, PP and LP showed mixed CD4(+) Th1 and Th2 immune response. The p24 assay showed high percent inhibition of HIV-IIIB virus with sera and washes obtained from intranasal route. Thus, overall the study highlighted the combination of UEA-1 lectin with HIV peptides in micro-particles through intranasal immunization generated systemic as well as mucosal immune response.

  8. Mucosal immunization in macaques upregulates the innate APOBEC 3G anti-viral factor in CD4(+) memory T cells.

    Science.gov (United States)

    Wang, Yufei; Bergmeier, Lesley A; Stebbings, Richard; Seidl, Thomas; Whittall, Trevor; Singh, Mahavir; Berry, Neil; Almond, Neil; Lehner, Thomas

    2009-02-05

    APOBEC3G is an innate intracellular anti-viral factor which deaminates retroviral cytidine to uridine. In vivo studies of APOBEC3G (A3G) were carried out in rhesus macaques, following mucosal immunization with SIV antigens and CCR5 peptides, linked to the 70kDa heat shock protein. A progressive increase in A3G mRNA was elicited in PBMC after each immunization (p<0.0002 to p< or =0.02), which was maintained for at least 17 weeks. Analysis of memory T cells showed a significant increase in A3G mRNA and protein in CD4(+)CCR5(+) memory T cells in circulating (p=0.0001), splenic (p=0.0001), iliac lymph nodes (p=0.002) and rectal (p=0.01) cells of the immunized compared with unimmunized macaques. Mucosal challenge with SIVmac 251 showed a significant increase in A3G mRNA in the CD4(+)CCR5(+) circulating cells (p<0.01) and the draining iliac lymph node cells (p<0.05) in the immunized uninfected macaques, consistent with a protective effect exerted by A3G. The results suggest that mucosal immunization in a non-human primate can induce features of a memory response to an innate anti-viral factor in CCR5(+)CD4(+) memory and CD4(+)CD95(+)CCR7(-) effector memory T cells.

  9. The polymeric stability of the Escherichia coli F4 (K88) fimbriae enhances its mucosal immunogenicity following oral immunization.

    Science.gov (United States)

    Verdonck, Frank; Joensuu, Jussi Joonas; Stuyven, Edith; De Meyer, Julie; Muilu, Mikko; Pirhonen, Minna; Goddeeris, Bruno Maria; Mast, Jan; Niklander-Teeri, Viola; Cox, Eric

    2008-10-23

    Only a few vaccines are commercially available against intestinal infections since the induction of a protective intestinal immune response is difficult to achieve. For instance, oral administration of most proteins results in oral tolerance instead of an antigen-specific immune response. We have shown before that as a result of oral immunization of piglets with F4 fimbriae purified from pathogenic enterotoxigenic Escherichia coli (ETEC), the fimbriae bind to the F4 receptor (F4R) in the intestine and induce a protective F4-specific immune response. F4 fimbriae are very stable polymeric structures composed of some minor subunits and a major subunit FaeG that is also the fimbrial adhesin. In the present study, the mutagenesis experiments identified FaeG amino acids 97 (N to K) and 201 (I to V) as determinants for F4 polymeric stability. The interaction between the FaeG subunits in mutant F4 fimbriae is reduced but both mutant and wild type fimbriae behaved identically in F4R binding and showed equal stability in the gastro-intestinal lumen. Oral immunization experiments indicated that a higher degree of polymerisation of the fimbriae in the intestine was correlated with a better F4-specific mucosal immunogenicity. These data suggest that the mucosal immunogenicity of soluble virulence factors can be increased by the construction of stable polymeric structures and therefore help in the development of effective mucosal vaccines.

  10. Defining the Interaction of HIV-1 with the Mucosal Barriers of the Female Reproductive Tract

    Science.gov (United States)

    Carias, Ann M.; McCoombe, Scott; McRaven, Michael; Anderson, Meegan; Galloway, Nicole; Vandergrift, Nathan; Fought, Angela J.; Lurain, John; Duplantis, Maurice; Veazey, Ronald S.

    2013-01-01

    Worldwide, HIV-1 infects millions of people annually, the majority of whom are women. To establish infection in the female reproductive tract (FRT), HIV-1 in male ejaculate must overcome numerous innate and adaptive immune factors, traverse the genital epithelium, and establish infection in underlying CD4+ target cells. How the virus achieves this remains poorly defined. By utilizing a new technique, we define how HIV-1 interacts with different tissues of the FRT using human cervical explants and in vivo exposure in the rhesus macaque vaginal transmission model. Despite previous claims of the squamous epithelium being an efficient barrier to virus entry, we reveal that HIV-1 can penetrate both intact columnar and squamous epithelial barriers to depths where the virus can encounter potential target cells. In the squamous epithelium, we identify virus entry occurring through diffusive percolation, penetrating areas where cell junctions are absent. In the columnar epithelium, we illustrate that virus does not transverse barriers as well as previously thought due to mucus impediment. We also show a statistically significant correlation between the viral load of inocula and the ability of HIV-1 to pervade the squamous barrier. Overall, our results suggest a diffusive percolation mechanism for the initial events of HIV-1 entry. With these data, we also mathematically extrapolate the number of HIV-1 particles that penetrate the mucosa per coital act, providing a biological description of the mechanism for HIV-1 transmission during the acute and chronic stages of infection. PMID:23966398

  11. Comparison of subcutaneous versus intranasal immunization of male koalas (Phascolarctos cinereus) for induction of mucosal and systemic immunity against Chlamydia pecorum.

    Science.gov (United States)

    Waugh, Courtney A; Timms, Peter; Andrew, Dean; Rawlinson, Galit; Brumm, Jacqui; Nilsson, Karen; Beagley, Kenneth W

    2015-02-11

    Chlamydia pecorum infections are debilitating in the koala, contributing significantly to morbidity and mortality, with current antibiotic treatments having minimal success and adversely affecting gut microflora. This, combined with the sometimes-asymptomatic nature of the infection, suggests that an efficacious anti-chlamydial vaccine is required to control chlamydial infections in the koala. To date vaccination studies have focused primarily on female koalas, however, given the physiological differences between male and female reproductive tracts, we tested the efficacy of a vaccine in 12 captive male koalas. We evaluated the potential of both subcutaneous and intranasal vaccine delivery to elicit mucosal immunity in male koalas. Our results showed that both intranasal and subcutaneous delivery of a vaccine consisting of C. pecorum major outer membrane protein (MOMP) and the adjuvant immunostimulating complex (ISC) induced significant immune responses in male koalas. Subcutaneous immunization elicited stronger cell-mediated responses in peripheral blood lymphocytes (PBL), and greater plasma antibody levels whereas the intranasal immunization elicited stronger humoral responses in urogenital tract (UGT) secretions. This is the first time a Chlamydia vaccine has been tested in the male koala and the first assessment of a mucosal vaccination route in this species. Our results suggest that vaccination of male koalas can elicit mucosal immunity and could contribute to the long-term survivability of wild populations of the koala. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Systemic and Terminal Ileum Mucosal Immunity Elicited by Oral Immunization With the Ty21a Typhoid Vaccine in HumansSummary

    Directory of Open Access Journals (Sweden)

    Jayaum S. Booth

    2017-11-01

    Full Text Available Background & Aims: Systemic cellular immunity elicited by the Ty21a oral typhoid vaccine has been extensively characterized. However, very limited data are available in humans regarding mucosal immunity at the site of infection (terminal ileum [TI]. Here we investigated the host immunity elicited by Ty21a immunization on terminal ileum–lamina propria mononuclear cells (LPMC and peripheral blood in volunteers undergoing routine colonoscopy. Methods: We characterized LPMC-T memory (TM subsets and assessed Salmonella enterica serovar Typhi (S Typhi–specific responses by multichromatic flow cytometry. Results: No differences were observed in cell yields and phenotypes in LPMC CD8+-TM subsets following Ty21a immunization. However, Ty21a immunization elicited LPMC CD8+ T cells exhibiting significant S Typhi–specific responses (interferon-γ, tumor necrosis factor-α, interleukin-17A, and/or CD107a in all major TM subsets (T-effector/memory [TEM], T-central/memory, and TEM-CD45RA+, although each TM subset exhibited unique characteristics. We also investigated whether Ty21a immunization elicited S Typhi–specific multifunctional effectors in LPMC CD8+ TEM. We observed that LPMC CD8+ TEM responses were mostly multifunctional, except for those cells exhibiting the characteristics associated with cytotoxic responses. Finally, we compared mucosal with systemic responses and made the important observation that LPMC CD8+ S Typhi–specific responses were unique and distinct from their systemic counterparts. Conclusions: This study provides the first demonstration of S Typhi–specific responses in the human terminal ileum mucosa and provides novel insights into the generation of mucosal immune responses following oral Ty21a immunization. Keywords: Lamina Propria Mononuclear Cells, Multifunctional T Cells, CD8+-T Memory Cells, Typhoid, Vaccines

  13. Antibody blockade of IL-17 family cytokines in immunity to acute murine oral mucosal candidiasis.

    Science.gov (United States)

    Whibley, Natasha; Tritto, Elaine; Traggiai, Elisabetta; Kolbinger, Frank; Moulin, Pierre; Brees, Dominique; Coleman, Bianca M; Mamo, Anna J; Garg, Abhishek V; Jaycox, Jillian R; Siebenlist, Ulrich; Kammüller, Michael; Gaffen, Sarah L

    2016-06-01

    Antibodies targeting IL-17A or its receptor, IL-17RA, are approved to treat psoriasis and are being evaluated for other autoimmune conditions. Conversely, IL-17 signaling is critical for immunity to opportunistic mucosal infections caused by the commensal fungus Candida albicans, as mice and humans lacking the IL-17R experience chronic mucosal candidiasis. IL-17A, IL-17F, and IL-17AF bind the IL-17RA-IL-17RC heterodimeric complex and deliver qualitatively similar signals through the adaptor Act1. Here, we used a mouse model of acute oropharyngeal candidiasis to assess the impact of blocking IL-17 family cytokines compared with specific IL-17 cytokine gene knockout mice. Anti-IL-17A antibodies, which neutralize IL-17A and IL-17AF, caused elevated oral fungal loads, whereas anti-IL-17AF and anti-IL-17F antibodies did not. Notably, there was a cooperative effect of blocking IL-17A, IL-17AF, and IL-17F together. Termination of anti-IL-17A treatment was associated with rapid C. albicans clearance. IL-17F-deficient mice were fully resistant to oropharyngeal candidiasis, consistent with antibody blockade. However, IL-17A-deficient mice had lower fungal burdens than anti-IL-17A-treated mice. Act1-deficient mice were much more susceptible to oropharyngeal candidiasis than anti-IL-17A antibody-treated mice, yet anti-IL-17A and anti-IL-17RA treatment caused equivalent susceptibilities. Based on microarray analyses of the oral mucosa during infection, only a limited number of genes were associated with oropharyngeal candidiasis susceptibility. In sum, we conclude that IL-17A is the main cytokine mediator of immunity in murine oropharyngeal candidiasis, but a cooperative relationship among IL-17A, IL-17AF, and IL-17F exists in vivo. Susceptibility displays the following hierarchy: IL-17RA- or Act1-deficiency > anti-IL-17A + anti-IL-17F antibodies > anti-IL-17A or anti-IL-17RA antibodies > IL-17A deficiency. © Society for Leukocyte Biology.

  14. Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin.

    Science.gov (United States)

    Gao, Yan; Su, Qiudong; Yi, Yao; Jia, Zhiyuan; Wang, Hao; Lu, Xuexin; Qiu, Feng; Bi, Shengli

    2015-01-01

    Hepatitis A virus (HAV) and Hepatitis E virus (HEV) are the most common causes of infectious hepatitis. These viruses are spread largely by the fecal-oral route and lead to clinically important disease in developing countries. To evaluate the potential of targeting hepatitis A and E infection simultaneously, a combined mucosal candidate vaccine was developed with the partial open reading frame 2 (ORF2) sequence (aa 368-607) of HEV (HE-ORF2) and partial virus protein 1 (VP1) sequence (aa 1-198) of HAV (HA-VP1), which included the viral neutralization epitopes. Tuftsin is an immunostimulatory peptide which can enhance the immunogenicity of a protein by targeting it to macrophages and dendritic cells. Here, we developed a novel combined protein vaccine by conjugating tuftsin to HE-ORF2 and HA-VP1 and used synthetic CpG oligodeoxynucleotides (ODNs) as the adjuvant. Subsequent experiments in BALB/c mice demonstrated that tuftsin enhanced the serum-specific IgG and IgA antibodies against HEV and HAV at the intestinal, vaginal and pulmonary interface when delivered intranasally. Moreover, mice from the intranasally immunized tuftsin group (HE-ORF2-tuftsin + HA-VP1-tuftsin + CpG) showed higher levels of IFN-γ-secreting splenocytes (Th1 response) and ratio of CD4+/CD8+ T cells than those of the no-tuftsin group (HE-ORF2 + HA-VP1 + CpG). Thus, the tuftsin group generated stronger humoral and cellular immune responses compared with the no-tuftsin group. Moreover, enhanced responses to the combined protein vaccine were obtained by intranasal immunization compared with intramuscular injection. By integrating HE-ORF2, HA-VP1 and tuftsin in a vaccine, this study validated an important concept for further development of a combined mucosal vaccine against hepatitis A and E infection.

  15. Carnauba wax nanoparticles enhance strong systemic and mucosal cellular and humoral immune responses to HIV-gp140 antigen.

    Science.gov (United States)

    Arias, Mauricio A; Loxley, Andrew; Eatmon, Christy; Van Roey, Griet; Fairhurst, David; Mitchnick, Mark; Dash, Philip; Cole, Tom; Wegmann, Frank; Sattentau, Quentin; Shattock, Robin

    2011-02-01

    Induction of humoral responses to HIV at mucosal compartments without inflammation is important for vaccine design. We developed charged wax nanoparticles that efficiently adsorb protein antigens and are internalized by DC in the absence of inflammation. HIV-gp140-adsorbed nanoparticles induced stronger in vitro T-cell proliferation responses than antigen alone. Such responses were greatly enhanced when antigen was co-adsorbed with TLR ligands. Immunogenicity studies in mice showed that intradermal vaccination with HIV-gp140 antigen-adsorbed nanoparticles induced high levels of specific IgG. Importantly, intranasal immunization with HIV-gp140-adsorbed nanoparticles greatly enhanced serum and vaginal IgG and IgA responses. Our results show that HIV-gp140-carrying wax nanoparticles can induce strong cellular/humoral immune responses without inflammation and may be of potential use as effective mucosal adjuvants for HIV vaccine candidates. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Progesterone Induces Mucosal Immunity in a Rodent Model of Human Taeniosis by Taenia solium

    Science.gov (United States)

    Escobedo, Galileo; Camacho-Arroyo, Ignacio; Nava-Luna, Paul; Olivos, Alfonso; Pérez-Torres, Armando; Leon-Cabrera, Sonia; Carrero, J.C.; Morales-Montor, Jorge

    2011-01-01

    More than one quarter of human world's population is exposed to intestinal helminth parasites. The Taenia solium tapeworm carrier is the main risk factor in the transmission of both human neurocysticercosis and porcine cysticercosis. Sex steroids play an important role during T. solium infection, particularly progesterone has been proposed as a key immunomodulatory hormone involved in susceptibility to human taeniosis in woman and cysticercosis in pregnant pigs. Thus, we evaluated the effect of progesterone administration upon the experimental taeniosis in golden hamsters (Mesocricetus auratus). Intact female adult hamsters were randomly divided into 3 groups: progesterone-subcutaneously treated; olive oil-treated as the vehicle group; and untreated controls. Animals were treated every other day during 4 weeks. After 2 weeks of treatment, all hamsters were orally infected with 4 viable T. solium cysticerci. After 2 weeks post infection, progesterone-treated hamsters showed reduction in adult worm recovery by 80%, compared to both vehicle-treated and non-manipulated infected animals. In contrast to control and vehicle groups, progesterone treatment diminished tapeworm length by 75% and increased proliferation rate of leukocytes from spleen and mesenteric lymph nodes of infected hamsters by 5-fold. The latter exhibited high expression levels of IL-4, IL-6 and TNF-α at the duodenal mucosa, accompanied with polymorphonuclear leukocytes infiltration. These results support that progesterone protects hamsters from the T. solium adult tapeworm establishment by improving the intestinal mucosal immunity, suggesting a potential use of analogues of this hormone as novel inductors of the gut immune response against intestinal helminth infections and probably other bowel-related disorders. PMID:22110394

  17. Progesterone induces mucosal immunity in a rodent model of human taeniosis by Taenia solium.

    Science.gov (United States)

    Escobedo, Galileo; Camacho-Arroyo, Ignacio; Nava-Luna, Paul; Olivos, Alfonso; Pérez-Torres, Armando; Leon-Cabrera, Sonia; Carrero, J C; Morales-Montor, Jorge

    2011-01-01

    More than one quarter of human world's population is exposed to intestinal helminth parasites. The Taenia solium tapeworm carrier is the main risk factor in the transmission of both human neurocysticercosis and porcine cysticercosis. Sex steroids play an important role during T. solium infection, particularly progesterone has been proposed as a key immunomodulatory hormone involved in susceptibility to human taeniosis in woman and cysticercosis in pregnant pigs. Thus, we evaluated the effect of progesterone administration upon the experimental taeniosis in golden hamsters (Mesocricetus auratus). Intact female adult hamsters were randomly divided into 3 groups: progesterone-subcutaneously treated; olive oil-treated as the vehicle group; and untreated controls. Animals were treated every other day during 4 weeks. After 2 weeks of treatment, all hamsters were orally infected with 4 viable T. solium cysticerci. After 2 weeks post infection, progesterone-treated hamsters showed reduction in adult worm recovery by 80%, compared to both vehicle-treated and non-manipulated infected animals. In contrast to control and vehicle groups, progesterone treatment diminished tapeworm length by 75% and increased proliferation rate of leukocytes from spleen and mesenteric lymph nodes of infected hamsters by 5-fold. The latter exhibited high expression levels of IL-4, IL-6 and TNF-α at the duodenal mucosa, accompanied with polymorphonuclear leukocytes infiltration. These results support that progesterone protects hamsters from the T. solium adult tapeworm establishment by improving the intestinal mucosal immunity, suggesting a potential use of analogues of this hormone as novel inductors of the gut immune response against intestinal helminth infections and probably other bowel-related disorders.

  18. Induction of systemic and mucosal immunity against methicillin-resistant Staphylococcus aureus infection by a novel nanoemulsion adjuvant vaccine

    Directory of Open Access Journals (Sweden)

    Sun HW

    2015-12-01

    Full Text Available HongWu Sun,1,* Chao Wei,1,* BaoShuai Liu,1 HaiMing Jing,1 Qiang Feng,2 YaNan Tong,1 Yun Yang,1 LiuYang Yang,1 QianFei Zuo,1 Yi Zhang,1 QuanMing Zou,1 Hao Zeng1 1National Engineering Research Center of Immunological Products, Department of Microbiology and Biochemical Pharmacy, College of Pharmacy, Third Military Medical University of Chinese PLA, 2Department of Biological and Chemical Engineering, Chongqing University of Education, Chongqing, People’s Republic of China *These authors contributed equally to this work Abstract: The Gram-positive bacterial pathogen methicillin-resistant Staphylococcus aureus (MRSA can cause infections in the bloodstream, endocardial tissue, respiratory tract, culture-confirmed skin, or soft tissue. There are currently no effective vaccines, and none are expected to become available in the near future. An effective vaccine capable of eliciting both systemic and mucosal immune responses is also urgently needed. Here, we reported a novel oil-in-water nanoemulsion adjuvant vaccine containing an MRSA recombination protein antigen, Cremophor EL-35® as a surfactant, and propylene glycol as a co-surfactant. This nanoemulsion vaccine, whose average diameter was 31.34±0.49 nm, demonstrated good protein structure integrity, protein specificity, and good stability at room temperature for 1 year. The intramuscular systemic and nasal mucosal immune responses demonstrated that this nanoemulsion vaccine could improve the specific immune responses of immunoglobulin (IgG and related subclasses, such as IgG1, IgG2a, and IgG2b, as well as IgA, in the serum after Balb/c mice intramuscular immunization and C57 mice nasal immunization. Furthermore, this nanoemulsion vaccine also markedly enhanced the interferon-γ and interleukin-17A cytokine cell immune response, improved the survival ratio, and reduced bacterial colonization. Taken together, our results show that this novel nanoemulsion vaccine has great potential and is a

  19. Toward improving mucosal barrier defenses: rhG-CSF plus IgG antibody.

    Science.gov (United States)

    Simmonds, Aryeh; LaGamma, Edmund F

    2006-11-01

    Epithelial cell functions ultimately define the ability of the extremely low birth weight human fetus to survive outside of the uterus. These specialized epithelial cell capacities manage all human interactions with the ex utero world including: (i) lung mechanics, surface chemistry and gas exchange, (ii) renal tubular balance of fluid and electrolytes, (iii) barrier functions of the intestine and skin for keeping bacteria out and water in, plus enabling intestinal digestion, as well as (iv) maintaining an intact neuroepithelium lining of the ventricles of the brain and retina. In Part I of this two part review, the authors describe why the gut barrier is a clinically relevant model system for studying the complex interplay between innate and adaptive immunity, dendritic &epithelial cell interactions, intraepithelial lymphocytes, M-cells, as well as the gut associated lymphoid tissues where colonization after birth, clinician feeding practices, use of antibiotics as well as exposure to prebiotics, probiotics and maternal vaginal flora all program the neonate for a life-time of immune competence distinguishing "self" from foreign antigens. These barrier defense capacities become destructive during disease processes like necrotizing enterocolitis (NEC) when an otherwise maturationally normal, yet dysregulated and immature, immune defense system is associated with high levels of certain inflammatory mediators like TNFa. In Part II the authors discuss the rationale for why rhG-CSF has theoretical advantages in managing NEC or sepsis by augmenting neonatal neutrophil number, neutrophil expression of Fcg and complement receptors, as well as phagocytic function and oxidative burst. rhG-CSF also has potent anti-TNFa functions that may serve to limit extension of tissue destruction while not impairing bacterial killing capacity. Healthy, non-infected neutropenic and septic neonates differ in their ability to respond to rhG-CSF; however, no neonatal clinical trials to date

  20. Effects of date palm fruit extracts on skin mucosal immunity, immune related genes expression and growth performance of common carp (Cyprinus carpio) fry.

    Science.gov (United States)

    Hoseinifar, Seyed Hossein; Khalili, Mohsen; Rufchaei, Rudabeh; Raeisi, Mojtaba; Attar, Marzieh; Cordero, Héctor; Esteban, M Ángeles

    2015-12-01

    The aim of this study was to investigate the effects of date palm fruit extracts (DPFE) on skin mucosal immunity, immune related genes expression and growth performance of fry common carp (Cyprinus carpio). One hundred and twenty specimens (4.06 ± 0.13 g) were supplied and allocated into six aquaria; specimens in three aquaria were fed non-supplemented diet (control) while the fish in the other 3 aquaria were fed with DPFE at 200 ml kg(-1). At the end of feeding trial (8 weeks) skin mucus immune parameters (total immunoglobulins, lysozyme, protease and alkaline phosphatase activity) and immune related gene expression (tumor necrosis factor α [tnfa], lysozyme [ly] and interleukin-1-beta, [il1b]) in the head-kidney were studied. The results revealed that feeding carp fry with 200 ml kg(-1) DPFE remarkably elevated the three skin mucus immune parameters tested (P 0.05) compared to control fish (fed control diet). Furthermore, growth performance parameters were significantly improved in fry fed DPFE (P < 0.05). More studies are needed to understand different aspects of DPFE administration in fry mucosal immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Role of viability of probiotic strains in their persistence in the gut and in mucosal immune stimulation.

    Science.gov (United States)

    Galdeano, C Maldonado; Perdigón, G

    2004-01-01

    To determine how probiotic bacteria contact with intestinal epithelial and immune cells and the conditions to induce a good mucosal immune stimulation. Lactobacillus casei was studied by transmission electron microscopy (TEM) to determine its interaction with the gut. We compared the influence of viable and nonviable lactic acid bacteria on the intestinal mucosal immune system (IMIS) and their persistence in the gut of mice. TEM showed whole Lact. casei adhered to the villi; the bacterial antigen was found in the cytoplasm of the enterocytes. Viable bacteria stimulated the IMIS to a greater extent than nonviable bacteria with the exception of Lact. delbrueckii subsp. bulgaricus. For all the strains assayed at 72 h no antigenic particles were found in the intestine. Antigenic particles but not the whole bacteria can enter to epithelial cells and contact with the immune cells. Bacterial viability is a condition for a better stimulation of the IMIS. We demonstrated that only antigenic particle interact with the immune cells and their fast clearance from the gut agrees with those described for the particulate antigens. The regular consumption of probiotics should not adversely affect the host.

  2. Assessing Pharmacists' Attitudes and Barriers Involved with Immunizations

    Directory of Open Access Journals (Sweden)

    Sarah Aldrich

    2014-01-01

    Full Text Available Pharmacists are considered the most accessible health care professional. Immunizations create an opportunity for the profession to grow and develop toward direct patient care. Between 1995 and 2004 programs involving immunizations led to a national initiative to train pharmacists that became a significant leap toward pharmacist's involvement in direct patient care. Although immunizations can be considered a catalyst to change the pharmacist's role, little was known about pharmacist's attitudes and the barriers involved with immunizing. Few studies have assessed barriers, attitudes, and practice issues experienced by immunizing pharmacists. The objective of this study was to determine pharmacists' attitudes toward immunizations and more specifically to assess possible barriers involved with this practice. Five hundred pharmacists were randomly selected for inclusion in the study from the State of Ohio Board of Pharmacy Database, of which 137 (27.4% completed the survey. A 37- item questionnaire was administered via an e-mail invitation to take an online survey using Qualtrics software with a Likert-type scale, where 1 = strongly disagree and 7 = strongly agree. Several topics were assessed regarding immunizations including time constraints, workflow constraints, adequacy of training, technician support, worksite conditions and space, immunization processes, reimbursement issues, safety issues, documentation issues, and the future direction of immunizations. Demographics included gender, age, degree, number of years practicing, practice site, and number of years immunizing. Seventy-three percent of pharmacists believed that immunizing could lead to prescription filling errors (mean=4.45, SD=1.79. Pharmacists strongly agreed that having more technicians on staff would make providing immunizations easier (mean=5.80, SD=1.39 and that they play a vital role in keeping the process running smoothly (mean=6.08, SD=1.16. Also, pharmacists strongly agreed

  3. Systemic BCG immunization induces persistent lung mucosal multifunctional CD4 T(EM cells which expand following virulent mycobacterial challenge.

    Directory of Open Access Journals (Sweden)

    Daryan A Kaveh

    Full Text Available To more closely understand the mechanisms of how BCG vaccination confers immunity would help to rationally design improved tuberculosis vaccines that are urgently required. Given the established central role of CD4 T cells in BCG induced immunity, we sought to characterise the generation of memory CD4 T cell responses to BCG vaccination and M. bovis infection in a murine challenge model. We demonstrate that a single systemic BCG vaccination induces distinct systemic and mucosal populations of T effector memory (T(EM cells in vaccinated mice. These CD4+CD44(hiCD62L(loCD27⁻ T cells concomitantly produce IFN-γ and TNF-α, or IFN-γ, IL-2 and TNF-α and have a higher cytokine median fluorescence intensity MFI or 'quality of response' than single cytokine producing cells. These cells are maintained for long periods (>16 months in BCG protected mice, maintaining a vaccine-specific functionality. Following virulent mycobacterial challenge, these cells underwent significant expansion in the lungs and are, therefore, strongly associated with protection against M. bovis challenge. Our data demonstrate that a persistent mucosal population of T(EM cells can be induced by parenteral immunization, a feature only previously associated with mucosal immunization routes; and that these multifunctional T(EM cells are strongly associated with protection. We propose that these cells mediate protective immunity, and that vaccines designed to increase the number of relevant antigen-specific T(EM in the lung may represent a new generation of TB vaccines.

  4. Comparison of the chloride channel activator lubiprostone and the oral laxative Polyethylene Glycol 3350 on mucosal barrier repair in ischemic-injured porcine intestine.

    Science.gov (United States)

    Moeser, Adam-J; Nighot, Prashant-K; Roerig, Birgit; Ueno, Ryuji; Blikslager, Anthony-T

    2008-10-21

    To investigate the effects of lubiprostone and Polyethylene Glycol 3350 (PEG) on mucosal barrier repair in ischemic-injured porcine intestine. Ileum from 6 piglets (approximately 15 kg body weight) was subjected to ischemic conditions by occluding the local mesenteric circulation for 45 min in vivo. Ileal tissues from each pig were then harvested and mounted in Ussing chambers and bathed in oxygenated Ringer's solution in vitro. Intestinal barrier function was assessed by measuring transepithelial electrical resistance (TER) and mucosal-to-serosal fluxes of (3)H-mannitol and (14)C-inulin. Statistical analyses of data collected over a 120-min time course included 2-way ANOVA for the effects of time and treatment on indices of barrier function. Application of 1 micromol/L lubiprostone to the mucosal surface of ischemic-injured ileum in vitro induced significant elevations in TER compared to non-treated tissue. Lubiprostone also reduced mucosal-to-serosal fluxes of (3)H-mannitol and (14)C-inulin. Alternatively, application of a polyethylene laxative (PEG, 20 mmol/L) to the mucosal surface of ischemic tissues significantly increased flux of (3)H-mannitol and (14)C-inulin. This experiment demonstrates that lubiprostone stimulates recovery of barrier function in ischemic intestinal tissues whereas the PEG laxative had deleterious effects on mucosal repair. These results suggest that, unlike osmotic laxatives, lubiprostone stimulates repair of the injured intestinal barrier.

  5. Comparative analysis of mucosal immunity to Mycoplasma hyopneumoniae in Jiangquhai porcine lean strain and DLY piglets.

    Science.gov (United States)

    Hua, L Z; Wu, Y Z; Bai, F F; William, K K; Feng, Z X; Liu, M J; Yao, J T; Zhang, X; Shao, G Q

    2014-07-07

    The Jiangquhai porcine lean strain (JQHPL) is a new pork meat-type strain that has been developed in recent years from the parent lines Duroc, Fengjing, and Jiangquhai pigs (DurocxFengjing pigxJiangquhai pig). Enzootic pneumonia (EP) in pigs induced by Mycoplasma hyopneumoniae (M. hyopneumoniae) is a chronic respiratory disease of pigs, generating high economic losses in the swine industry. Here, we investigated the degree of resistance to M. hyopneumoniae for the Jiangquhai porcine lean strain and the Duroc x Landrace x Yorkshire (DLY) pigs, which are Western commercial pigs that have been introduced in China. A total of 209 DLY piglets and 221 JQHPL piglets from 19 Landrace x Yorkshire and 22 JQHPL M. hyopneumoniae positive gestating sows with different expected dates of confinement were selected and raised in the same M. hyopneumoniae positive farrowing barn. When the oldest suckling piglets were 37 days old, nasal swabs were collected from all the piglets (ranging from 4 to 37 days old) to detect the M. hyopneumoniae pathogen using n-PCR and M. hyopneumoniae specific SIgA using ELISA. Positive M. hyopneumoniae infection rates in both the strains increased with age; however, positive rates for JQHPL were lower compared to DLY at 14 to 35 days old. The level of the specific SIgA rose rapidly in JQHPL respiratory tracts, particularly in piglets 21 to 35 days in age compared to DLY piglets of the same age; however, the level of the specific SIgA in DLY also marginally increased. In conclusion, JQHPL pigs exhibits higher resistance to M. hyopneumoniae compared to DLY. It is possible that this characteristic is caused by the faster and stronger mucosal immunity phenotype of the JQHPL strain.

  6. Food allergens and mucosal immune systems with special reference to recognition of food allergens by gut-associated lymphoid tissue

    Directory of Open Access Journals (Sweden)

    Shuichi Kaminogawa

    1999-01-01

    Full Text Available Food allergy, triggered by an aberrant immune response elicited by orally ingested food allergens, is generated through a complicated mechanism because the allergen interacts with the mucosal immune system (the gut- associated lymphoid tissue, GALT and the resulting immune response affects the generation of allergy. This review will describe the process by which antigens or allergens are recognized by the GALT and the characteristic immune responses induced thereafter. Orally administered antigens induce distinct immune responses in the Peyer's patches, lamina propria and the intestinal epithelium. In addition to these local immune responses in the gut, ingested antigens are known to affect systemic immunity. These may induce a suppressed state of systemic immune responsiveness, which is called oral tolerance, or in some cases they may elicit a systemic IgE antibody response which may lead to allergic reactions. Information on the regions on food allergens recognized by T cells and IgE antibodies is important in understanding the fates of food allergens after being recognized by the GALT. The structure of T and B cell epitopes on food allergens and the possibility of modulation of allergic reactions by amino-acid substituted analogs of allergen- derived peptides will also be discussed.

  7. Immunopathophysiology of inflammatory bowel disease: how genetics link barrier dysfunction and innate immunity to inflammation.

    Science.gov (United States)

    Mehta, Minesh; Ahmed, Shifat; Dryden, Gerald

    2017-08-01

    Inflammatory bowel diseases (IBD) comprise a distinct set of clinical symptoms resulting from chronic or relapsing immune activation and corresponding inflammation within the gastrointestinal (GI) tract. Diverse genetic mutations, encoding important aspects of innate immunity and mucosal homeostasis, combine with environmental triggers to create inappropriate, sustained inflammatory responses. Recently, significant advances have been made in understanding the interplay of the intestinal epithelium, mucosal immune system, and commensal bacteria as a foundation of the pathogenesis of inflammatory bowel disease. Complex interactions between specialized intestinal epithelial cells and mucosal immune cells determine different outcomes based on the environmental input: the development of tolerance in the presence of commensal bacterial or the promotion of inflammation upon recognition of pathogenic organisms. This article reviews key genetic abnormalities involved in inflammatory and homeostatic pathways that enhance susceptibility to immune dysregulation and combine with environmental triggers to trigger the development of chronic intestinal inflammation and IBD.

  8. Dietary Factors and Mucosal Immune Response in Celiac Disease Patients Having Persistent Symptoms Despite a Gluten-free Diet.

    Science.gov (United States)

    Laurikka, Pilvi; Lindfors, Katri; Oittinen, Mikko; Huhtala, Heini; Salmi, Teea; Lähdeaho, Marja-Leena; Ilus, Tuire; Mäki, Markku; Kaukinen, Katri; Kurppa, Kalle

    2018-03-02

    The aim of this study was to investigate the role of dietary factors, distinct small-bowel mucosal immune cell types, and epithelial integrity in the perpetuation of gastrointestinal symptoms in treated celiac disease patients. For unexplained reasons, many celiac disease patients suffer from persistent symptoms, despite a strict gluten-free diet (GFD) and recovered intestinal mucosa. We compared clinical and serological data and mucosal recovery in 22 asymptomatic and 25 symptomatic celiac patients on a long-term GFD. The density of CD3 and γδ intraepithelial lymphocytes (IELs), CD25 and FOXP3 regulatory T cells, and CD117 mast cells, and the expression of tight junction proteins claudin-3 and occludin, heat shock protein 60, interleukin 15, and Toll-like receptor 2 and 4 were evaluated in duodenal biopsies. All subjects kept a strict GFD and had negative celiac autoantibodies and recovered mucosal morphology. The asymptomatic patients had higher mean fiber intake (20.2 vs. 15.2 g/d, P=0.028) and density of CD3 IELs (59.3 vs. 45.0 cell/mm, P=0.045) than those with persistent symptoms. There was a similar but nonsignificant trend in γδ IELs (17.9 vs. 13.5, P=0.149). There were no differences between the groups in other parameters measured. Low fiber intake may predispose patients to persistent symptoms in celiac disease. There were no differences between the groups in the markers of innate immunity, epithelial stress or epithelial integrity. A higher number of IELs in asymptomatic subjects may indicate that the association between symptoms and mucosal inflammation is more complicated than previously thought.

  9. Transcriptome analysis reveals regional and temporal differences in mucosal immune system development in the small intestine of neonatal calves.

    Science.gov (United States)

    Liang, Guanxiang; Malmuthuge, Nilusha; Bao, Hua; Stothard, Paul; Griebel, Philip J; Guan, Le Luo

    2016-08-11

    Postnatal development of the mammalian mucosal immune system is crucial for responding to the rapid colonization by commensal bacteria and possible exposure to pathogens. This study analyzed expression patterns for mRNAs and their relationship with microRNAs (miRNAs) in the bovine small intestine during the critical neonatal period (0 to 42 days). This analysis revealed molecular mechanisms regulating the postnatal development of the intestinal mucosal immune system. Small intestine samples (jejunum and ileum) were collected from newborn male, Holstein calves immediately post-partum (n = 3) and at 7 (n = 5), 21 (n = 5), and 42 (n = 5) days of age and the transcriptomes were profiled using RNA-Seq. When analyzing all time points collectively, greater expression of genes encoding the complement functional pathway, as well as lower expression of genes encoding Toll-like receptors and NOD-like receptors were observed in the jejunum when compared to the ileum. In addition, significant changes in the expression of immune-related genes were detected within the first week post-partum in both jejunum and ileum. For example, increased expression of genes encoding tight junction proteins (claudin 1, claudin 4 and occludin), an antimicrobial peptide (Regenerating Islet-Derived 3-γ), NOD-like receptors (NACHT, LRR and PYD domain-containing protein 3), regulatory T cell marker (forkhead box P3), and both anti-inflammatory (interleukin 10) and pro-inflammatory (interleukin 8) cytokines was observed throughout the small intestine of 7-day-old calves when compared to newborn calves. Moreover, the expression of mucosal immune-related genes were either positively or negatively correlated with total bacterial population depending on both intestinal region and age. The integrated analysis of miRNAs and mRNAs supported the conclusion that miRNAs may regulate temporal changes in the expression of genes encoding tight junction proteins (miR-335), cytokines (miR-335) and

  10. Acidic bile salts induces mucosal barrier dysfunction through let-7a reduction during gastric carcinogenesis after Helicobacter pylori eradication

    Science.gov (United States)

    Takahashi, Yasushi; Uno, Kaname; Iijima, Katsunori; Abe, Yasuhiko; Koike, Tomoyuki; Asano, Naoki; Asanuma, Kiyotaka; Shimosegawa, Tooru

    2018-01-01

    Gastric cancer (GC) after eradication for Helicobacter pylori (H.pylori) increases, but its carcinogenesis is not elucidated. It is mainly found in acid non-secretion areas (ANA), as mucosal regeneration in acid secretory areas (AA) after eradication changes the acidity and bile toxicity of gastric juice. We aimed to clarify the role of barrier dysfunction of ANA by the stimulation of pH3 bile acid cocktail (ABC) during carcinogenesis. We collected 18 patients after curative endoscopic resection for GC, identified later than 24 months after eradication, and took biopsies by Congo-red chromoendoscopy to distinguish AA and ANA (UMIN00018967). The mucosal barrier function was investigated using a mini-Ussing chamber system and molecular biological methods. The reduction in mucosal impedance in ANA after stimulation was significantly larger than that in AA, 79.6% vs. 87.9%, respectively. The decrease of zonula occludens-1 (ZO-1) and let-7a and the increase of snail in ANA were significant compared to those in AA. In an in vitro study, the restoration of ZO-1 and let-7a as well as the induction of snail were observed after stimulation. High mobility group A2 (HMGA2)-snail activation, MTT proliferation, and cellular infiltration capacity were significantly increased in AGS transfected with let-7a inhibitor, and vice versa. Accordingly, using a mini-Ussing chamber system for human biopsy specimens followed by an in vitro study, we demonstrated for the first time that the exposure of acidic bile salts to ANA might cause serious barrier dysfunction through the let-7a reduction, promoting epithelial-mesenchymal transition during inflammation-associated carcinogenesis even after eradication. PMID:29719591

  11. Gut-Associated Lymphoid Tissue: A Key Tissue Inside the Mucosal Immune System of Hens Immunized with Escherichia coli F4.

    Science.gov (United States)

    Peralta, Maria F; Magnoli, Alejandra; Alustiza, Fabrisio; Nilson, Armando; Miazzo, Raúl; Vivas, Adriana

    2017-01-01

    Immunoglobulin Y (IgY) is the predominant antibody found in hen's ( Gallus domesticus ) egg yolk. This antibody, developed against several microorganisms in hen egg yolk, has been successfully used as an alternative to immunoglobulins from mammals for use in immunodiagnostics and immunotherapy. Enteropathogenic Escherichia coli (E.coli) F 4 is the main etiological agent associated with swine neonatal diarrhea, and it causes notable economic losses in swine production. The aim of the present study was to evaluate the relationship between humoral immune response and the activation of gut-associated lymphoid tissue (GALT) in laying hens intramuscularly immunized with E. coli F 4 . Adult laying Shaver hens were immunized with a bacterin based on an inactivated lysate E. coli F 4 strain that was originally isolated from neonatal piglet diarrhea, following a recommended schedule. The percentage of B lymphocytes in blood and spleen homogenates was determined by flow cytometry. Villi histomorphometry and the size of germinal centers (GC) activated in GALT and the spleen were measured in histological samples either stained with hematoxylin/eosin or through immunofluorescence. Antibody and isotype-specific antibodies in serum and egg yolk were measured using indirect enzyme-linked immunosorbent assay (ELISA). Secretory and serum immunoglobulin A (IgA) were measured by ELISA tests. Laying hen with intramuscular immunization with E. coli F 4 lysate, activated both mucosal and systemic protection. Mucosal protection was provided through B lymphocytes, and most of them were activated on Peyer's patches and esophageal tonsils, in GALT. Furthermore, increased B lymphocyte number in the lamina propria of the gut, and increased intraepithelial plasmatic cell number, produced high levels of mucosal IgA. Activated B lymphocytes interacted with absorptive cells, immune cells, and microbiota in the gut, producing signals that were translated into a powerful physical defense by producing

  12. Side chain variations radically alter the diffusion of poly(2-alkyl-2-oxazoline) functionalised nanoparticles through a mucosal barrier.

    Science.gov (United States)

    Mansfield, Edward D H; de la Rosa, Victor R; Kowalczyk, Radoslaw M; Grillo, Isabelle; Hoogenboom, Richard; Sillence, Katy; Hole, Patrick; Williams, Adrian C; Khutoryanskiy, Vitaliy V

    2016-08-16

    Functionalised nanomaterials are gaining popularity for use as drug delivery vehicles and, in particular, mucus penetrating nanoparticles may improve drug bioavailability via the oral route. To date, few polymers have been investigated for their muco-penetration, and the effects of systematic structural changes to polymer architectures on the penetration and diffusion of functionalised nanomaterials through mucosal tissue have not been reported. We investigated the influence of poly(2-oxazoline) alkyl side chain length on nanoparticle diffusion; poly(2-methyl-2-oxazoline), poly(2-ethyl-2-oxazoline), and poly(2-n-propyl-2-oxazoline) were grafted onto the surface of thiolated silica nanoparticles and characterised by FT-IR, Raman and NMR spectroscopy, thermogravimetric analysis, and small angle neutron scattering. Diffusion coefficients were determined in water and in a mucin dispersion (using Nanoparticle Tracking Analysis), and penetration through a mucosal barrier was assessed using an ex vivo fluorescence technique. The addition of a single methylene group in the side chain significantly altered the penetration and diffusion of the materials in both mucin dispersions and mucosal tissue. Nanoparticles functionalised with poly(2-methyl-2-oxazoline) were significantly more diffusive than particles with poly(2-ethyl-2-oxazoline) while particles with poly(2-n-propyl-2-oxazoline) showed no significant increase compared to the unfunctionalised particles. These data show that variations in the polymer structure can radically alter their diffusive properties with clear implications for the future design of mucus penetrating systems.

  13. Upper respiratory tract infection and mucosal immunity in young ice hockey players during the pre-tournament training period.

    Science.gov (United States)

    Orysiak, Joanna; Witek, Konrad; Malczewska-Lenczowska, Jadwiga; Zembron-Lacny, Agnieszka; Pokrywka, Andrzej; Sitkowski, Dariusz

    2018-02-27

    The aim of this study was to determine the effects of 17 days of training during preparation for the Ice Hockey Under 18 World Championship of the Polish ice hockey national team on the mucosal immune function and monitor upper respiratory tract infection (URTI) incidence before, during and after the competition. Twelve male ice hockey players (age 17.7±0.5 years) were recruited for this study. The first saliva/blood collection took place at the beginning of the training camp (without training at the training camp), the second one was conducted on the 9th day of the training camp immediately after the intensification of training, and the third collection was carried out on the 13th day of training (4 days before leaving for the World Championship) in the tapering phase. To assess the mucosal immune function, concentrations of secretory immunoglobulin A (sIgA), sIgA1, and sIgA2 were analyzed in saliva. Cortisol concentration and creatine kinase activity were determined in blood, as indicators of stress and muscle damage, respectively. The Wisconsin Upper Respiratory Symptom Survey-21 questionnaire was used to assess URTI symptoms. A significant increase in the sIgA1 and sIgA2 concentrations was observed in the third collection compared with the second time point (114.45±33.00 vs 77.49±27.29 and 88.97±25.33 vs 71.65±32.44 U, respectively). There were no statistically significant correlations between the URTI incidence and saliva variables. In conclusion, the tapering period positively affects the mucosal immune function, especially sIgA1 and sIgA2 concentrations, with no significant change in frequency of URTI in young ice hockey players.

  14. Barrier effect of Esoxx® on esophageal mucosal damage: experimental study on ex-vivo swine model

    Directory of Open Access Journals (Sweden)

    Di Simone MP

    2012-06-01

    Full Text Available Massimo P Di Simone,1 Fabio Baldi,2,3 Valentina Vasina,4 Fabrizio Scorrano,5 Maria Laura Bacci,5 Antonella Ferrieri,6 Gilberto Poggioli11Department of General Surgery and Transplants, 2Centre for the Study and Therapy of the Esophageal Diseases, 3GVM Care and Research, MCH Cotignola (RA, 4Department of Pharmacology, Alma Mater Studiorum, University of Bologna, Bologna, 5Department of Veterinary Medical Science – DMSVET – University of Bologna, Bologna, 6Clinical Research Department, Alfa Wassermann Spa, Bologna, ItalyAbstract: The aim of the present study was to assess the potential barrier effect of Esoxx®, a new nonprescription medication under development for the relief of gastroesophageal reflux symptoms. Esoxx is based on a mixture of hyaluronic acid and chondroitin sulfate in a bioadhesive suspension of Lutrol® F 127 polymer (poloxamer 407 which facilitates the product adhesion on the esophageal mucosa. The mucosal damage was induced by 15 to 90 minutes of perfusion with an acidic solution (HCl, pH 1.47 with or without pepsin (2000 U/mL, acidified to pH 2; Sigma-Aldrich. Mucosal esophageal specimens were histologically evaluated and Evans blue dye solution was used to assess the permeability of the swine mucosa after the chemical injury. The results show that: (1 esophageal mucosal damage is related to the perfusion time and to the presence of pepsin, (2 mucosal damage is associated with an increased permeability, documented by an evident Evans blue staining, (3 perfusion with Esoxx is able to reduce the permeability of the injured mucosa, even after saline washing of the swine esophagus. These preliminary results support further clinical studies of Esoxx in the topical treatment of gastroesophageal reflux symptoms.Keywords: bioadhesion, hyaluronic acid, Evans blue dye, animal model, esophagus, reflux esophagitis

  15. Mucosal Immunity and Protective Efficacy of Intranasal Inactivated Influenza Vaccine Is Improved by Chitosan Nanoparticle Delivery in Pigs

    Directory of Open Access Journals (Sweden)

    Santosh Dhakal

    2018-05-01

    Full Text Available Annually, swine influenza A virus (SwIAV causes severe economic loss to swine industry. Currently used inactivated SwIAV vaccines administered by intramuscular injection provide homologous protection, but limited heterologous protection against constantly evolving field viruses, attributable to the induction of inadequate levels of mucosal IgA and cellular immune responses in the respiratory tract. A novel vaccine delivery platform using mucoadhesive chitosan nanoparticles (CNPs administered through intranasal (IN route has the potential to elicit strong mucosal and systemic immune responses in pigs. In this study, we evaluated the immune responses and cross-protective efficacy of IN chitosan encapsulated inactivated SwIAV vaccine in pigs. Killed SwIAV H1N2 (δ-lineage antigens (KAg were encapsulated in chitosan polymer-based nanoparticles (CNPs-KAg. The candidate vaccine was administered twice IN as mist to nursery pigs. Vaccinates and controls were then challenged with a zoonotic and virulent heterologous SwIAV H1N1 (γ-lineage. Pigs vaccinated with CNPs-KAg exhibited an enhanced IgG serum antibody and mucosal secretory IgA antibody responses in nasal swabs, bronchoalveolar lavage (BAL fluids, and lung lysates that were reactive against homologous (H1N2, heterologous (H1N1, and heterosubtypic (H3N2 influenza A virus strains. Prior to challenge, an increased frequency of cytotoxic T lymphocytes, antigen-specific lymphocyte proliferation, and recall IFN-γ secretion by restimulated peripheral blood mononuclear cells in CNPs-KAg compared to control KAg vaccinates were observed. In CNPs-KAg vaccinated pigs challenged with heterologous virus reduced severity of macroscopic and microscopic influenza-associated pulmonary lesions were observed. Importantly, the infectious SwIAV titers in nasal swabs [days post-challenge (DPC 4] and BAL fluid (DPC 6 were significantly (p < 0.05 reduced in CNPs-KAg vaccinates but not in KAg vaccinates when compared

  16. Effect of feeding soybean meal and differently processed peas on the gut mucosal immune system of broilers.

    Science.gov (United States)

    Röhe, I; Göbel, T W; Goodarzi Boroojeni, F; Zentek, J

    2017-07-01

    Peas are traditionally used as a protein source for poultry. However, peas contain antinutritional factors (ANF), which are associated with the initiation of local and systemic immune reactions. The current study examined the effect of feeding raw or differently processed peas in comparison with feeding a soybean meal (SBM) based control diet (C) on the gut mucosal immune system of broilers in a 35 day feeding trial. In six replicates, a total of 360 one-day-old male broilers were randomly allocated to four different groups receiving C, or three treatment diets containing raw, fermented, and enzymatically pre-digested peas, each supplying 30% of required crude protein. After slaughtering, jejunal samples were taken for immunohistochemical, flow cytometric, and gene expression analyses. Investigations were focused on the topological distribution of intraepithelial leukocytes (villus tip, villus mid, and crypt region) as well as on the further characterization of the different intraepithelial lymphocytes (IEL) and concomitant pro- and anti-inflammatory cytokines. Broilers receiving the raw or processed pea diets had higher numbers of intraepithelial CD45+ leukocytes in the tip (P = 0.004) and mid region (P pea containing diets in comparison with those fed C. The flow cytometric phenotyping showed a similar relative distribution of IEL among the feeding groups. The expression of intestinal pro- and anti-inflammatory cytokines was affected by feeding the different diets only to a minor extent. To conclude, feeding of diets formulated with raw and processed peas in comparison with feeding a SBM control diet initiated mucosal immune responses in the jejunum of broilers indicated by a quantitative increase of intraepithelial T cells. Further research is needed in order to ascertain the specific factors which are responsible for observed local immune reactions and how these local reactions might affect the immune status and health of broilers. © 2017 Poultry Science

  17. Role of serotonin in the intestinal mucosal epithelium barrier in weaning mice undergoing stress-induced diarrhea.

    Science.gov (United States)

    Dong, Yulan; Wang, Zixu; Qin, Zhuoming; Cao, Jing; Chen, Yaoxing

    2018-02-01

    Stress-induced diarrhea is a frequent and challenging threat to humans and domestic animals. Serotonin (5-HT) has been shown to be involved in the pathological process of stress-induced diarrhea. However, the role of 5-HT in stress-induced diarrhea remains unclear. A stress-induced diarrhea model was established in 21-day-old ICR weaning mice through an intragastric administration of 0.25 mL of 0.4 g/mL folium sennae and restraint of the hind legs with adhesive tape for 4 h to determine whether 5-HT regulates the mucosal barrier to cause diarrhea. Mice with decreased levels of 5-HT were pretreated with an intraperitoneal injection of 300 mg/kg p-chlorophenylalanine (PCPA), a 5-HT synthesis inhibitor. After 5 days of treatment, the stress level, body weight and intestinal mucosal morphology indexes were measured. Compared to the controls, the mice with stress-induced diarrhea displayed a stress reaction, with increased corticosterone levels, as well as increased 5-HT-positive cells. However, the mice with stress-induced diarrhea exhibited decreased body weights, villus height to crypt depth ratios (V/C), and Occludin and Claudin1 expression. The PCPA injection reversed these effects in mice with different degrees of stress-induced diarrhea. Based on these findings, inhibition of 5-HT synthesis relieved the stress response and improved the health of the intestinal tract, including both the intestinal absorption capacity, as determined by the villus height and crypt depth, and the mucosal barrier function, as determined by the tight junction proteins of epithelial cell.

  18. Protective effect of lactobacillus acidophilus and isomaltooligosaccharide on intestinal mucosal barriers in rat models of antibiotic-associated diarrhea

    International Nuclear Information System (INIS)

    Du Dan; Fang Lichao; Chen Bingbo; Wei Hong

    2008-01-01

    Objective: To investigate the protective effect of synbiotics combined lactobacillus acidophilus and iso-malto-oligosaccharide (IMO) on intestinal mucosal barriers in rat models of antibiotic-associated diarrhea(AAD). Methods: Rat models of AAD were prepared with lincomycin gavage for 5 days. The synbiotics was orally administered to the AAD rats daily at three different strengths for 7 days. The intestinal flora and intestinal mucus SIgA levels were determined on d6, d9 and d13. The histopathological changes of ileal mucosa were studied on d13. Results: In the prepared AAD model rats (on d6) there were lower intestinal mucus SIgA levels and intestinal flora disorders were demonstrated. The intestinal floras of the rats administering synbiotics were readjusted to the similar pattern of healthy rats with bacterial translocation corrected on d13 and the levels of SIgA were not significantly different from of the control (P>0.05). The histopathological picture was basically normal in the treated models on d13. Conclusion: The synbiotics combined lactobacillus acidophilus and isomaltooligosaccharide possessed good protective effect on the intestinal mucosal barrier in lincomycin induced rat models of AAD. (authors)

  19. Increased levels of inflammatory cytokines in the female reproductive tract are associated with altered expression of proteases, mucosal barrier proteins, and an influx of HIV-susceptible target cells.

    Science.gov (United States)

    Arnold, Kelly B; Burgener, Adam; Birse, Kenzie; Romas, Laura; Dunphy, Laura J; Shahabi, Kamnoosh; Abou, Max; Westmacott, Garrett R; McCorrister, Stuart; Kwatampora, Jessie; Nyanga, Billy; Kimani, Joshua; Masson, Lindi; Liebenberg, Lenine J; Abdool Karim, Salim S; Passmore, Jo-Ann S; Lauffenburger, Douglas A; Kaul, Rupert; McKinnon, Lyle R

    2016-01-01

    Elevated inflammatory cytokines (EMCs) at mucosal surfaces have been associated with HIV susceptibility, but the underlying mechanisms remain unclear. We characterized the soluble mucosal proteome associated with elevated cytokine expression in the female reproductive tract. A scoring system was devised based on the elevation (upper quartile) of at least three of seven inflammatory cytokines in cervicovaginal lavage. Using this score, HIV-uninfected Kenyan women were classified as either having EMC (n=28) or not (n=68). Of 455 proteins quantified in proteomic analyses, 53 were associated with EMC (5% false discovery rate threshold). EMCs were associated with proteases, cell motility, and actin cytoskeletal pathways, whereas protease inhibitor, epidermal cell differentiation, and cornified envelope pathways were decreased. Multivariate analysis identified an optimal signature of 16 proteins that distinguished the EMC group with 88% accuracy. Three proteins in this signature were neutrophil-associated proteases that correlated with many cytokines, especially GM-CSF (granulocyte-macrophage colony-stimulating factor), IL-1β (interleukin-1β), MIP-3α (macrophage inflammatory protein-3α), IL-17, and IL-8. Gene set enrichment analyses implicated activated immune cells; we verified experimentally that EMC women had an increased frequency of endocervical CD4(+) T cells. These data reveal strong linkages between mucosal cytokines, barrier function, proteases, and immune cell movement, and propose these as potential mechanisms that increase risk of HIV acquisition.

  20. The short isoform of the CEACAM1 receptor in intestinal T cells regulates mucosal immunity and homeostasis via Tfh cell induction.

    Science.gov (United States)

    Chen, Lanfen; Chen, Zhangguo; Baker, Kristi; Halvorsen, Elizabeth M; da Cunha, Andre Pires; Flak, Magdalena B; Gerber, Georg; Huang, Yu-Hwa; Hosomi, Shuhei; Arthur, Janelle C; Dery, Ken J; Nagaishi, Takashi; Beauchemin, Nicole; Holmes, Kathryn V; Ho, Joshua W K; Shively, John E; Jobin, Christian; Onderdonk, Andrew B; Bry, Lynn; Weiner, Howard L; Higgins, Darren E; Blumberg, Richard S

    2012-11-16

    Carcinoembryonic antigen cell adhesion molecule like I (CEACAM1) is expressed on activated T cells and signals through either a long (L) cytoplasmic tail containing immune receptor tyrosine based inhibitory motifs, which provide inhibitory function, or a short (S) cytoplasmic tail with an unknown role. Previous studies on peripheral T cells show that CEACAM1-L isoforms predominate with little to no detectable CEACAM1-S isoforms in mouse and human. We show here that this was not the case in tissue resident T cells of intestines and gut associated lymphoid tissues, which demonstrated predominant expression of CEACAM1-S isoforms relative to CEACAM1-L isoforms in human and mouse. This tissue resident predominance of CEACAM1-S expression was determined by the intestinal environment where it served a stimulatory function leading to the regulation of T cell subsets associated with the generation of secretory IgA immunity, the regulation of mucosal commensalism, and defense of the barrier against enteropathogens. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. A polyphenol-enriched diet and Ascaris suum infection modulate mucosal immune responses and gut microbiota composition in pigs

    DEFF Research Database (Denmark)

    Williams, Andrew R.; Krych, Lukasz; Ahmad, Hajar Fauzan

    2017-01-01

    . suum for 14 days to assess parasite establishment, acquisition of local and systemic immune responses and effects on the gut microbiome. Despite in vitro anthelmintic activity of GP-extracts, numbers of parasite larvae in the intestine were not altered by GP-supplementation. However, the bioactive diet......Polyphenols are a class of bioactive plant secondary metabolites that are thought to have beneficial effects on gut health, such as modulation of mucosal immune and inflammatory responses and regulation of parasite burdens. Here, we examined the interactions between a polyphenol-rich diet...... supplement and infection with the enteric nematode Ascaris suum in pigs. Pigs were fed either a basal diet or the same diet supplemented with grape pomace (GP), an industrial by-product rich in polyphenols such as oligomeric proanthocyanidins. Half of the animals in each group were then inoculated with A...

  2. Dual RNAseq shows the human mucosal immunity protein, MUC13, is a hallmark of Plasmodium exoerythrocytic infection

    KAUST Repository

    LaMonte, Gregory; Orjuela-Sanchez, Pamela; Wang, Lawrence; Li, Shangzhong; Swann, Justine; Cowell, Annie; Zou, Bing Yu; Abdel- Haleem Mohamed, Alyaa; Villa-Galarce, Zaira; Moreno, Marta; Tong-Rios, Carlos; Vinetz, Joseph; Lewis, Nathan; Winzeler, Elizabeth A

    2017-01-01

    The exoerythrocytic stage of Plasmodium malaria infection is a critical window for prophylactic intervention. Using a genome-wide dual RNA sequencing of flow-sorted infected and uninfected hepatoma cells we identify the human mucosal immunity gene, Mucin13 (MUC13), as strongly upregulated during Plasmodium exoerythrocytic hepatic-stage infection. We confirm that MUC13 expression is upregulated in hepatoma cell lines and primary hepatocytes. In immunofluorescence assays, host MUC13 protein expression distinguishes infected cells from adjacent uninfected cells and shows similar colocalization with parasite biomarkers such as UIS4 and HSP70. We further show that localization patterns are species independent, distinguishing both P. berghei and P. vivax infected cells, and that MUC13 can be used to identify compounds that inhibit parasite replication in hepatocytes across all Human-infecting Plasmodium species. This data presents a novel interface of host-parasite interactions in Plasmodium, in that a component of host mucosal immunity is reprogrammed to assist the progression of infection.

  3. Dual RNAseq shows the human mucosal immunity protein, MUC13, is a hallmark of Plasmodium exoerythrocytic infection

    KAUST Repository

    LaMonte, Gregory

    2017-10-03

    The exoerythrocytic stage of Plasmodium malaria infection is a critical window for prophylactic intervention. Using a genome-wide dual RNA sequencing of flow-sorted infected and uninfected hepatoma cells we identify the human mucosal immunity gene, Mucin13 (MUC13), as strongly upregulated during Plasmodium exoerythrocytic hepatic-stage infection. We confirm that MUC13 expression is upregulated in hepatoma cell lines and primary hepatocytes. In immunofluorescence assays, host MUC13 protein expression distinguishes infected cells from adjacent uninfected cells and shows similar colocalization with parasite biomarkers such as UIS4 and HSP70. We further show that localization patterns are species independent, distinguishing both P. berghei and P. vivax infected cells, and that MUC13 can be used to identify compounds that inhibit parasite replication in hepatocytes across all Human-infecting Plasmodium species. This data presents a novel interface of host-parasite interactions in Plasmodium, in that a component of host mucosal immunity is reprogrammed to assist the progression of infection.

  4. Oral immunization with rotavirus VP7 expressed in transgenic potatoes induced high titers of mucosal neutralizing IgA

    International Nuclear Information System (INIS)

    Wu Yuzhang; Li Jintao; Mou Zhirong; Fei Lei; Ni Bing; Geng Miao; Jia Zhengcai; Zhou Wei; Zou Liyun; Tang Yan

    2003-01-01

    Rotaviruses (RV) are a common cause of severe diarrhea in young children, resulting in nearly one million deaths worldwide annually. Rotavirus VP7 was the rotavirus neutralizing protein. Previous study reported that VP7 DNA vaccine can induce high levels of IgG in mice but cannot protect mice against challenge (Choi, A.H., Basu, M., Rae, M.N., McNeal, M.M., Ward, R.L., 1998. Virology 250, 230-240). We found that rotavirus VP7 could maintain its neutralizing immunity when it was transformed into the potato genome. Mice immunized with the transformed tubers successfully elicited serum IgG and mucosal IgA specific for VP7. The mucosal IgA titer was as high as 1000, while serum IgG titer was only 600. Neutralizing assays indicated that IgA could neutralize rotavirus. These results indicate the potential usefulness of plants for production and delivery of edible rotavirus vaccines

  5. Dietary Lactobacillus rhamnosus GG Supplementation Improves the Mucosal Barrier Function in the Intestine of Weaned Piglets Challenged by Porcine Rotavirus.

    Directory of Open Access Journals (Sweden)

    Xiangbing Mao

    Full Text Available Lactobacillus rhamnosus GG (LGG has been regarded as a safe probiotic strain. The aim of this study was to investigate whether dietary LGG supplementation could alleviate diarrhea via improving jejunal mucosal barrier function in the weaned piglets challenged by RV, and further analyze the potential roles for apoptosis of jejunal mucosal cells and intestinal microbiota. A total of 24 crossbred barrows weaned at 21 d of age were assigned randomly to 1 of 2 diets: the basal diet and LGG supplementing diet. On day 11, all pigs were orally infused RV or the sterile essential medium. RV infusion increased the diarrhea rate, increased the RV-Ab, NSP4 and IL-2 concentrations and the Bax mRNA levels of jejunal mucosa (P<0.05, decreased the villus height, villus height: crypt depth, the sIgA, IL-4 and mucin 1 concentrations and the ZO-1, occludin and Bcl-2 mRNA levels of jejunal mucosa (P<0.05, and affected the microbiota of ileum and cecum (P<0.05 in the weaned pigs. Dietary LGG supplementation increased the villus height and villus height: crypt depth, the sIgA, IL-4, mucin 1 and mucin 2 concentrations, and the ZO-1, occludin and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05 reduced the Bax mRNA levels of the jejunal mucosa (P<0.05 in weaned pigs. Furthermore, dietary LGG supplementation alleviated the increase of diarrhea rate in the weaned pigs challenged by RV (P<0.05, and relieve the effect of RV infection on the villus height, crypt depth and the villus height: crypt depth of the jejunal mucosa (P<0.05, the NSP4, sIgA, IL-2, IL-4, mucin 1 and mucin 2 concentrations of jejunal mucosa (P<0.05, the ZO-1, occludin, Bax and Bcl-2 mRNA levels of the jejunal mucosa (P<0.05, and the microbiota of ileum and cecum (P<0.05 in the weaned pigs challenged by RV. These results suggest that supplementing LGG in diets alleviated the diarrhea of weaned piglets challenged by RV via inhibiting the virus multiplication and improving the jejunal mucosal barrier

  6. Oral Immunization with Recombinant Norwalk Virus-Like Particles Induces a Systemic and Mucosal Immune Response in Mice

    Science.gov (United States)

    Ball, Judith M.; Hardy, Michele E.; Atmar, Robert L.; Conner, Margaret E.; Estes, Mary K.

    1998-01-01

    Recombinant Norwalk virus-like particles (rNV VLPs) produced in insect cells were evaluated as an oral immunogen in CD1 and BALB/c mice by monitoring rNV-specific serum total and subclass immunoglobulin G (IgG) and intestinal IgA responses. Dose and kinetics of response were evaluated in the presence and absence of the mucosal adjuvant cholera toxin (CT). rNV-specific serum IgG and intestinal IgA were detected in the absence of CT, and the number of responders was not significantly different from that of mice administered VLPs with CT at most doses. The use of CT was associated with induction of higher levels of IgG in serum; this effect was greater at higher doses of VLPs. IgG in serum was detected in the majority of animals by 9 days postimmunization (dpi), and intestinal IgA responses were detected by 24 dpi. In the absence of CT, IgG2b was the dominant IgG subclass response in both mouse strains. Thus, nonreplicating rNV VLPs are immunogenic when administered orally in the absence of any delivery system or mucosal adjuvant. These studies demonstrate that rNV VLPs are an excellent model to study the oral delivery of antigen, and they are a potential mucosal vaccine for NV infections. PMID:9445035

  7. Recombinant interleukin 6 with M cell-targeting moiety produced in Lactococcus lactis IL1403 as a potent mucosal adjuvant for peroral immunization.

    Science.gov (United States)

    Li, Hui-Shan; Piao, Da-Chuan; Jiang, Tao; Bok, Jin-Duck; Cho, Chong-Su; Lee, Yoon-Seok; Kang, Sang-Kee; Choi, Yun-Jaie

    2015-04-15

    Development and application of safe and effective mucosal adjuvants are important to improve immunization efficiency in oral vaccine. Here, we report a novel mucosal adjuvant, IL-6-CKS9, a recombinant cytokine generated by conjugating an M cell-targeting peptide (CKS9) with c-terminus of the murine interleukin 6 (IL-6), which facilitated enhancement of mucosal immune response. Lactococcus lactis IL1403, a food-grade strain of lactic acid bacteria (LAB) which is widely used in dairy industry, was used as a host cell to express and secrete the IL-6-CKS9 for a mucosal vaccine adjuvant. The recombinant L. lactis IL1403 secreting IL-6-CKS9 was orally administered with a model antigen protein, M-BmpB (Brachyspira membrane protein B conjugated with CKS9), to BALB/c mice for mucosal immunization. ELISA analyses showed consistent enhancement tendencies in induction of anti-M-BmpB antibody levels both with mucosal (IgA) and systemic (IgG) immune responses in IL-6-CKS9-LAB treated group compared with other groups tested by conducting two separated mice immunization assays. In addition, we characterized that the oral administration of model protein antigen with live LAB producing IL-6-CKS9 could induce both Th1 and Th2 type immune responses by analysis of the specific anti-BmpB IgG1 and IgG2a isotypes in the sera and also investigated possible oral tolerance in our vaccine strategy. Collectively, our results showed successful production and secretion of recombinant murine IL-6 with M cell-targeting moiety (IL-6-CKS9) from L. lactis IL1403 and demonstrated the live recombinant LAB producing IL-6-CKS9 could have a potential to be used as an efficient adjuvant for peroral vaccination. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Permeabilization of the blood-brain barrier via mucosal engrafting: implications for drug delivery to the brain.

    Science.gov (United States)

    Bleier, Benjamin S; Kohman, Richie E; Feldman, Rachel E; Ramanlal, Shreshtha; Han, Xue

    2013-01-01

    Utilization of neuropharmaceuticals for central nervous system(CNS) disease is highly limited due to the blood-brain barrier(BBB) which restricts molecules larger than 500Da from reaching the CNS. The development of a reliable method to bypass the BBB would represent an enormous advance in neuropharmacology enabling the use of many potential disease modifying therapies. Previous attempts such as transcranial catheter implantation have proven to be temporary and associated with multiple complications. Here we describe a novel method of creating a semipermeable window in the BBB using purely autologous tissues to allow for high molecular weight(HMW) drug delivery to the CNS. This approach is inspired by recent advances in human endoscopic transnasal skull base surgical techniques and involves engrafting semipermeable nasal mucosa within a surgical defect in the BBB. The mucosal graft thereby creates a permanent transmucosal conduit for drugs to access the CNS. The main objective of this study was to develop a murine model of this technique and use it to evaluate transmucosal permeability for the purpose of direct drug delivery to the brain. Using this model we demonstrate that mucosal grafts allow for the transport of molecules up to 500 kDa directly to the brain in both a time and molecular weight dependent fashion. Markers up to 40 kDa were found within the striatum suggesting a potential role for this technique in the treatment of Parkinson's disease. This proof of principle study demonstrates that mucosal engrafting represents the first permanent and stable method of bypassing the BBB thereby providing a pathway for HMW therapeutics directly into the CNS.

  9. Colonization and effector functions of innate lymphoid cells in mucosal tissues

    Science.gov (United States)

    Kim, Myunghoo; Kim, Chang H.

    2016-01-01

    Innate lymphoid cells (ILCs) protect mucosal barrier tissues to fight infection and maintain tissue integrity. ILCs and their progenitors are developmentally programmed to migrate, differentiate and populate various mucosal tissues and associated lymphoid tissues. Functionally mature ILC subsets respond to diverse pathogens such as bacteria, viruses, fungi and parasites in subset-specific manners. In this review, we will discuss how ILCs populate mucosal tissues and regulate immune responses to distinct pathogens to protect the host and maintain tissue integrity. PMID:27365193

  10. Enrichment of gilthead seabream (Sparus aurata L.) diet with palm fruit extracts and probiotics: Effects on skin mucosal immunity.

    Science.gov (United States)

    Cerezuela, Rebeca; Guardiola, Francisco A; Cuesta, Alberto; Esteban, M Ángeles

    2016-02-01

    Fish skin mucus contains numerous immune substances still poorly studied. To date, there are no studies regarding the possible influence of dietary supplements on such important substances. In the present work, a commercial diet used as control diet was enriched with: 1) probiotic Shewanella putrefaciens (Pdp11 diet, 10(9) cfu g(-1)); 2) probiotic Bacillus sp. (Bacillus diet, 10(9) ufc g(-1)); 3) aqueous date palm fruits extracts (DPE diet, 4%), and 4) a combination of Pdp11 + Bacillus sp + aqueous DPE (Mix diet). After 2 and 4 weeks of the feeding trial, enzymatic activities (proteases, antiproteases and peroxidases), IgM levels and terminal carbohydrates abundance were determined in skin mucus. In addition, the expression of certain immune related genes was evaluated in the skin. Our results demonstrated the significant alteration of the terminal carbohydrate abundance in skin mucus. Carbohydrates more affected by experimental diets were N-acetyl-galactosamine, N-acetyl-glucosamine, galactose, mannose, glucose and fucose. IgM, peroxidase activity and protease were also significantly higher in fish fed enriched diets. For last, an important up-regulation on the immune related gene studied on the skin was also detected. Present findings provide robust evidence that fish skin mucosal immunity can be improved by the diet. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Clinical, Immune, and Microbiome Traits of Gingivitis and Peri-implant Mucositis.

    Science.gov (United States)

    Schincaglia, G P; Hong, B Y; Rosania, A; Barasz, J; Thompson, A; Sobue, T; Panagakos, F; Burleson, J A; Dongari-Bagtzoglou, A; Diaz, P I

    2017-01-01

    Tissues surrounding dental implants and teeth develop clinical inflammation in response to microbial stimuli. However, the literature suggests that differences exist in the microbial insult and inflammatory responses leading to gingivitis and peri-implant mucositis. In this pilot study, the authors use for the first time a systems biology approach to comprehensively evaluate clinical parameters, selected inflammatory markers, and the microbiome of subject-matched tooth and implant sites during native inflammation and in response to experimental plaque accumulation. Fifteen subjects with 2 posterior implants and corresponding contralateral teeth were examined at enrollment; at day 0, after reinstitution of gingival/mucosal health; at days 7, 14, and 21, during stent-mediated oral hygiene (OH) abstention; and at day 42, after resumption of OH. The subgingival microbiome was evaluated via 16S rRNA gene sequencing and 8 selected inflammatory markers measured in crevicular fluid. Comparison of teeth and implants via general linear models based on orthogonal polynomials showed similar responses in clinical parameters, inflammatory mediators, and proportions of individual microbial taxa during OH abstention. Implants, however, accumulated less plaque and underwent more heterogeneous shifts in microbiome structure. A multilevel, within-group, sparse partial least squares analysis of covariation of microbial, inflammatory, and clinical parameters throughout all study visits found inflammation around teeth and implants positively correlated with IL-1 alpha and IL-1 beta and with the proportions of Selenomonas, Prevotella, and 5 species-level phylotypes. Gingivitis, however, showed a stronger positive correlation with lactoferrin and IL-1ra and a stronger negative correlation with Rothia. Peri-implant mucositis, on the contrary, correlated positively with certain microbial taxa not associated with gingivitis by a previous study or the current one. In summary, differences

  12. Small intestine in lymphocytic and collagenous colitis: mucosal morphology, permeability, and secretory immunity to gliadin.

    OpenAIRE

    Moayyedi, P; O'Mahony, S; Jackson, P; Lynch, D A; Dixon, M F; Axon, A T

    1997-01-01

    There is a recognised association between the "microscopic" forms of colitis and coeliac disease. There are a variety of subtle small intestinal changes in patients with "latent" gluten sensitivity, namely high intraepithelial lymphocyte (IEL) counts, abnormal mucosal permeability, and high levels of secretory IgA and IgM antibody to gliadin. These changes have hitherto not been investigated in microscopic colitis. Nine patients (four collagenous, five lymphocytic colitis) with normal villous...

  13. Mucosal and systemic immune responses elicited by recombinant Lactococcus lactis expressing a fusion protein composed of pertussis toxin and filamentous hemagglutinin from Bordetella pertussis.

    Science.gov (United States)

    Torkashvand, Ali; Bahrami, Fariborz; Adib, Minoo; Ajdary, Soheila

    2018-05-05

    We constructed a food-grade expression system harboring a F1S1 fusion protein of Bordetella pertussis to be produced in Lactococcus lactis NZ3900 as a new oral vaccine model against whooping cough, caused by B. pertussis. F1S1 was composed of N-terminally truncated S1 subunit of pertussis toxin and type I immunodominant domain of filamentous hemagglutinin which are both known as protective immunogens against pertussis. The recombinant L. lactis was administered via oral or intranasal routes to BALB/c mice and the related specific systemic and mucosal immune responses were then evaluated. The results indicated significantly higher levels of specific IgA in the lung extracts and IgG in sera of mucosally-immunized mice, compared to their controls. It was revealed that higher levels of IgG2a, compared to IgG1, were produced in all mucosally-immunized mice. Moreover, immunized mice developed Th1 responses with high levels of IFN-γ production by the spleen cells. These findings provide evidence for L. lactis to be used as a suitable vehicle for expression and delivery of F1S1 fusion protein to mucosa and induction of appropriate systemic and mucosal immune responses against pertussis. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. M cell-targeting strategy facilitates mucosal immune response and enhances protection against CVB3-induced viral myocarditis elicited by chitosan-DNA vaccine.

    Science.gov (United States)

    Ye, Ting; Yue, Yan; Fan, Xiangmei; Dong, Chunsheng; Xu, Wei; Xiong, Sidong

    2014-07-31

    Efficient delivery of antigen to mucosal associated lymphoid tissue is a first and critical step for successful induction of mucosal immunity by vaccines. Considering its potential transcytotic capability, M cell has become a more and more attractive target for mucosal vaccines. In this research, we designed an M cell-targeting strategy by which mucosal delivery system chitosan (CS) was endowed with M cell-targeting ability via conjugating with a CPE30 peptide, C terminal 30 amino acids of clostridium perfringens enterotoxin (CPE), and then evaluated its immune-enhancing ability in the context of coxsackievirus B3 (CVB3)-specific mucosal vaccine consisting of CS and a plasmid encoding CVB3 predominant antigen VP1. It had shown that similar to CS-pVP1, M cell-targeting CPE30-CS-pVP1 vaccine appeared a uniform spherical shape with about 300 nm diameter and +22 mV zeta potential, and could efficiently protect DNA from DNase I digestion. Mice were orally immunized with 4 doses of CPE30-CS-pVP1 containing 50 μg pVP1 at 2-week intervals and challenged with CVB3 4 weeks after the last immunization. Compared with CS-pVP1 vaccine, CPE30-CS-pVP1 vaccine had no obvious impact on CVB3-specific serum IgG level and splenic T cell immune responses, but significantly increased specific fecal SIgA level and augmented mucosal T cell immune responses. Consequently, much milder myocarditis and lower viral load were witnessed in CPE30-CS-pVP1 immunized group. The enhanced immunogenicity and immunoprotection were associated with the M cell-targeting ability of CPE30-CS-pVP1 which improved its mucosal uptake and transcytosis. Our findings indicated that CPE30-CS-pVP1 may represent a novel prophylactic vaccine against CVB3-induced myocarditis, and this M cell-targeting strategy indeed could be applied as a promising and universal platform for mucosal vaccine development. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Oral Immunization with Recombinant Norwalk Virus-Like Particles Induces a Systemic and Mucosal Immune Response in Mice

    OpenAIRE

    Ball, Judith M.; Hardy, Michele E.; Atmar, Robert L.; Conner, Margaret E.; Estes, Mary K.

    1998-01-01

    Recombinant Norwalk virus-like particles (rNV VLPs) produced in insect cells were evaluated as an oral immunogen in CD1 and BALB/c mice by monitoring rNV-specific serum total and subclass immunoglobulin G (IgG) and intestinal IgA responses. Dose and kinetics of response were evaluated in the presence and absence of the mucosal adjuvant cholera toxin (CT). rNV-specific serum IgG and intestinal IgA were detected in the absence of CT, and the number of responders was not significantly different ...

  16. Mucosal Immunity and Protective Efficacy of Intranasal Inactivated Influenza Vaccine Is Improved by Chitosan Nanoparticle Delivery in Pigs.

    Science.gov (United States)

    Dhakal, Santosh; Renu, Sankar; Ghimire, Shristi; Shaan Lakshmanappa, Yashavanth; Hogshead, Bradley T; Feliciano-Ruiz, Ninoshkaly; Lu, Fangjia; HogenEsch, Harm; Krakowka, Steven; Lee, Chang Won; Renukaradhya, Gourapura J

    2018-01-01

    Annually, swine influenza A virus (SwIAV) causes severe economic loss to swine industry. Currently used inactivated SwIAV vaccines administered by intramuscular injection provide homologous protection, but limited heterologous protection against constantly evolving field viruses, attributable to the induction of inadequate levels of mucosal IgA and cellular immune responses in the respiratory tract. A novel vaccine delivery platform using mucoadhesive chitosan nanoparticles (CNPs) administered through intranasal (IN) route has the potential to elicit strong mucosal and systemic immune responses in pigs. In this study, we evaluated the immune responses and cross-protective efficacy of IN chitosan encapsulated inactivated SwIAV vaccine in pigs. Killed SwIAV H1N2 (δ-lineage) antigens (KAg) were encapsulated in chitosan polymer-based nanoparticles (CNPs-KAg). The candidate vaccine was administered twice IN as mist to nursery pigs. Vaccinates and controls were then challenged with a zoonotic and virulent heterologous SwIAV H1N1 (γ-lineage). Pigs vaccinated with CNPs-KAg exhibited an enhanced IgG serum antibody and mucosal secretory IgA antibody responses in nasal swabs, bronchoalveolar lavage (BAL) fluids, and lung lysates that were reactive against homologous (H1N2), heterologous (H1N1), and heterosubtypic (H3N2) influenza A virus strains. Prior to challenge, an increased frequency of cytotoxic T lymphocytes, antigen-specific lymphocyte proliferation, and recall IFN-γ secretion by restimulated peripheral blood mononuclear cells in CNPs-KAg compared to control KAg vaccinates were observed. In CNPs-KAg vaccinated pigs challenged with heterologous virus reduced severity of macroscopic and microscopic influenza-associated pulmonary lesions were observed. Importantly, the infectious SwIAV titers in nasal swabs [days post-challenge (DPC) 4] and BAL fluid (DPC 6) were significantly ( p  influenza nanovaccine may be an ideal candidate vaccine for use in pigs, and pig is a

  17. An adenovirus vectored mucosal adjuvant augments protection of mice immunized intranasally with an adenovirus-vectored foot-and-mouth disease virus subunit vaccine.

    Science.gov (United States)

    Alejo, Diana M; Moraes, Mauro P; Liao, Xiaofen; Dias, Camila C; Tulman, Edan R; Diaz-San Segundo, Fayna; Rood, Debra; Grubman, Marvin J; Silbart, Lawrence K

    2013-04-26

    Foot-and-mouth disease virus (FMDV) is a highly contagious pathogen that causes severe morbidity and economic losses to the livestock industry in many countries. The oral and respiratory mucosae are the main ports of entry of FMDV, so the stimulation of local immunity in these tissues may help prevent initial infection and viral spread. E. coli heat-labile enterotoxin (LT) has been described as one of the few molecules that have adjuvant activity at mucosal surfaces. The objective of this study was to evaluate the efficacy of replication-defective adenovirus 5 (Ad5) vectors encoding either of two LT-based mucosal adjuvants, LTB or LTR72. These vectored adjuvants were delivered intranasally to mice concurrent with an Ad5-FMDV vaccine (Ad5-A24) to assess their ability to augment mucosal and systemic humoral immune responses to Ad5-A24 and protection against FMDV. Mice receiving Ad5-A24 plus Ad5-LTR72 had higher levels of mucosal and systemic neutralizing antibodies than those receiving Ad5-A24 alone or Ad5-A24 plus Ad5-LTB. The vaccine plus Ad5-LTR72 group also demonstrated 100% survival after intradermal challenge with a lethal dose of homologous FMDV serotype A24. These results suggest that Ad5-LTR72 could be used as an important tool to enhance mucosal and systemic immunity against FMDV and potentially other pathogens with a common route of entry. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Mucosal-Associated Invariant T Cell Interactions with Commensal and Pathogenic Bacteria: Potential Role in Antimicrobial Immunity in the Child

    Directory of Open Access Journals (Sweden)

    Liana Ghazarian

    2017-12-01

    Full Text Available Mucosal-associated invariant T (MAIT cells are unconventional CD3+CD161high T lymphocytes that recognize vitamin B2 (riboflavin biosynthesis precursor derivatives presented by the MHC-I related protein, MR1. In humans, their T cell receptor is composed of a Vα7.2-Jα33/20/12 chain, combined with a restricted set of Vβ chains. MAIT cells are very abundant in the liver (up to 40% of resident T cells and in mucosal tissues, such as the lung and gut. In adult peripheral blood, they represent up to 10% of circulating T cells, whereas they are very few in cord blood. This large number of MAIT cells in the adult likely results from their gradual expansion with age following repeated encounters with riboflavin-producing microbes. Upon recognition of MR1 ligands, MAIT cells have the capacity to rapidly eliminate bacterially infected cells through the production of inflammatory cytokines (IFNγ, TNFα, and IL-17 and cytotoxic effector molecules (perforin and granzyme B. Thus, MAIT cells may play a crucial role in antimicrobial defense, in particular at mucosal sites. In addition, MAIT cells have been implicated in diseases of non-microbial etiology, including autoimmunity and other inflammatory diseases. Although their participation in various clinical settings has received increased attention in adults, data in children are scarce. Due to their innate-like characteristics, MAIT cells might be particularly important to control microbial infections in the young age, when long-term protective adaptive immunity is not fully developed. Herein, we review the data showing how MAIT cells may control microbial infections and how they discriminate pathogens from commensals, with a focus on models relevant for childhood infections.

  19. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; A randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; Vos, De Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm J.H.M.; Wit, De Nicole J.W.; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

  20. The effects of probiotics on barrier function and mucosal pouch microbiota during maintenance treatment for severe pouchitis in patients with ulcerative colitis

    NARCIS (Netherlands)

    Persborn, M.; Gerritsen, J.; Wallon, C.; Carlsson, A.; Akkermans, L.M.A.; Soderholm, J.D.

    2013-01-01

    Background A total of 10-15% of patients with an ileoanal pouch develop severe pouchitis necessitating long-term use of antibiotics or pouch excision. Probiotics reduce the risk of recurrence of pouchitis, but mechanisms behind these effects are not fully understood. Aim To examine mucosal barrier

  1. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; de Vos, Paul; Boekschoten, Mark V.; Govers, Coen; Pieters, Harm-Jan H M; de Wit, Nicole J. W.; Bron, Peter A.; Masclee, Ad A M; Troost, Freddy J

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gut mucosal gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein

  2. Association of High-Risk Human Papillomavirus with Genital Tract Mucosal Immune Factors In HIV-Infected Women

    Science.gov (United States)

    Buckley, Niall; Huber, Ashley; Lo, Yungtai; Castle, Philip E.; Kemal, Kimdar; Burk, Robert D.; Strickler, Howard D.; Einstein, Mark H.; Young, Mary; Anastos, Kathryn; Herold, Betsy C.

    2015-01-01

    Problem High-risk human papillomavirus (HR-HPV) is prevalent in HIV-infected women and may be associated with mucosal changes that promote HIV replication. Method of Study Innate immune molecules, antimicrobial activity, HIV RNA, and HPV DNA genotypes were measured in a cross-sectional study of 128 HIV-infected women categorized into HPV-16 (n=8), other HR-HPV (n=41), and non-HR-HPV controls (n=79). Results Compared to controls, HR-HPV groups had higher plasma viral loads (p=0.004), lower CD4 cells (p=0.02), more genital tract HIV RNA (p=0.03), greater number of different HPV types (p<0.001), higher cervicovaginal lavage (CVL) IL-1α (p=0.03) and human beta defensin 2 (HBD2) (p=0.049), and less anti-HIVBal activity (p=0.03). HPV-16 remained significantly associated with higher HBD2 (p=0.03), higher IL-1α (p=0.009), and lower anti-HIVBaL activity (p=0.03) compared to controls after adjusting for plasma viral load and CD4 T cell count. Conclusion HR-HPV is associated with mucosal changes in HIV-infected women that could adversely impact genital tract health. PMID:26685115

  3. Transcriptomic variation of locally-infected skin of Epinephelus coioides reveals the mucosal immune mechanism against Cryptocaryon irritans.

    Science.gov (United States)

    Hu, Yazhou; Li, Anxing; Xu, Yang; Jiang, Biao; Lu, Geling; Luo, Xiaochun

    2017-07-01

    Fish skin is the largest immunologically active mucosal organ, providing first-line defense against external pathogens. However, the skin-associated immune mechanisms of fish are still unclear. Cryptocaryon irritans is an obligate ectoparasitic ciliated protozoan that infects almost all marine fish, and is believed to be an excellent pathogen model to study fish mucosal immunity. In this study, a de novo transcriptome assembly of Epinephelus coioides skin post C. irritans tail-infection was performed for the first time using the Illumina HiSeq™ 2500 system. Comparative analyses of infected skin (group Isk) and uninfected skin (group Nsk) from the same challenged fish and control skin (group C) from uninfected control fish were conducted. As a result, a total of 91,082 unigenes with an average length of 2880 base pairs were obtained and among them, 38,704 and 48,617 unigenes were annotated based on homology with matches in the non-redundant and zebrafish database, respectively. Pairwise comparison resulted in 10,115 differentially-expressed genes (DEGs) in the Isk/C group comparison (4,983 up-regulated and 5,132 down-regulated), 2,275 DEGs in the Isk/Nsk group comparison (1,319 up-regulated and 956 down-regulated) and 4,566 DEGs in the Nsk/C group comparison (1,534 up-regulated and 3,032 down-regulated). Seven immune-related categories including 91 differentially-expressed immune genes (86 up-regulated and 5 down-regulated) were scrutinized. Both DEGs and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and immune-related gene expression analysis were used, and both analyses showed that the genes were more significantly altered in the locally-infected skin than in the uninfected skin of the same challenged fish. This suggests the skin's local immune response is important for host defense against this ectoparasite infection. Innate immune molecules, including hepcidin, C-type lectin, transferrin, transferrin receptor protein, serum amyloid A

  4. Systematic review of mucosal immunity induced by oral and inactivated poliovirus vaccines against virus shedding following oral poliovirus challenge.

    Directory of Open Access Journals (Sweden)

    Thomas R Hird

    Full Text Available Inactivated poliovirus vaccine (IPV may be used in mass vaccination campaigns during the final stages of polio eradication. It is also likely to be adopted by many countries following the coordinated global cessation of vaccination with oral poliovirus vaccine (OPV after eradication. The success of IPV in the control of poliomyelitis outbreaks will depend on the degree of nasopharyngeal and intestinal mucosal immunity induced against poliovirus infection. We performed a systematic review of studies published through May 2011 that recorded the prevalence of poliovirus shedding in stool samples or nasopharyngeal secretions collected 5-30 days after a "challenge" dose of OPV. Studies were combined in a meta-analysis of the odds of shedding among children vaccinated according to IPV, OPV, and combination schedules. We identified 31 studies of shedding in stool and four in nasopharyngeal samples that met the inclusion criteria. Individuals vaccinated with OPV were protected against infection and shedding of poliovirus in stool samples collected after challenge compared with unvaccinated individuals (summary odds ratio [OR] for shedding 0.13 (95% confidence interval [CI] 0.08-0.24. In contrast, IPV provided no protection against shedding compared with unvaccinated individuals (summary OR 0.81 [95% CI 0.59-1.11] or when given in addition to OPV, compared with individuals given OPV alone (summary OR 1.14 [95% CI 0.82-1.58]. There were insufficient studies of nasopharyngeal shedding to draw a conclusion. IPV does not induce sufficient intestinal mucosal immunity to reduce the prevalence of fecal poliovirus shedding after challenge, although there was some evidence that it can reduce the quantity of virus shed. The impact of IPV on poliovirus transmission in countries where fecal-oral spread is common is unknown but is likely to be limited compared with OPV.

  5. Unbiased proteomics analysis demonstrates significant variability in mucosal immune factor expression depending on the site and method of collection.

    Directory of Open Access Journals (Sweden)

    Kenzie M Birse

    Full Text Available Female genital tract secretions are commonly sampled by lavage of the ectocervix and vaginal vault or via a sponge inserted into the endocervix for evaluating inflammation status and immune factors critical for HIV microbicide and vaccine studies. This study uses a proteomics approach to comprehensively compare the efficacy of these methods, which sample from different compartments of the female genital tract, for the collection of immune factors. Matching sponge and lavage samples were collected from 10 healthy women and were analyzed by tandem mass spectrometry. Data was analyzed by a combination of differential protein expression analysis, hierarchical clustering and pathway analysis. Of the 385 proteins identified, endocervical sponge samples collected nearly twice as many unique proteins as cervicovaginal lavage (111 vs. 61 with 55% of proteins common to both (213. Each method/site identified 73 unique proteins that have roles in host immunity according to their gene ontology. Sponge samples enriched for specific inflammation pathways including acute phase response proteins (p = 3.37×10(-24 and LXR/RXR immune activation pathways (p = 8.82×10(-22 while the role IL-17A in psoriasis pathway (p = 5.98×10(-4 and the complement system pathway (p = 3.91×10(-3 were enriched in lavage samples. Many host defense factors were differentially enriched (p<0.05 between sites including known/potential antimicrobial factors (n = 21, S100 proteins (n = 9, and immune regulatory factors such as serpins (n = 7. Immunoglobulins (n = 6 were collected at comparable levels in abundance in each site although 25% of those identified were unique to sponge samples. This study demonstrates significant differences in types and quantities of immune factors and inflammation pathways collected by each sampling technique. Therefore, clinical studies that measure mucosal immune activation or factors assessing HIV transmission should utilize

  6. A polyphenol-enriched diet and Ascaris suum infection modulate mucosal immune responses and gut microbiota composition in pigs.

    Directory of Open Access Journals (Sweden)

    Andrew R Williams

    Full Text Available Polyphenols are a class of bioactive plant secondary metabolites that are thought to have beneficial effects on gut health, such as modulation of mucosal immune and inflammatory responses and regulation of parasite burdens. Here, we examined the interactions between a polyphenol-rich diet supplement and infection with the enteric nematode Ascaris suum in pigs. Pigs were fed either a basal diet or the same diet supplemented with grape pomace (GP, an industrial by-product rich in polyphenols such as oligomeric proanthocyanidins. Half of the animals in each group were then inoculated with A. suum for 14 days to assess parasite establishment, acquisition of local and systemic immune responses and effects on the gut microbiome. Despite in vitro anthelmintic activity of GP-extracts, numbers of parasite larvae in the intestine were not altered by GP-supplementation. However, the bioactive diet significantly increased numbers of eosinophils induced by A. suum infection in the duodenum, jejunum and ileum, and modulated gene expression in the jejunal mucosa of infected pigs. Both GP-supplementation and A. suum infection induced significant and apparently similar changes in the composition of the prokaryotic gut microbiota, and both also decreased concentrations of isobutyric and isovaleric acid (branched-chain short chain fatty acids in the colon. Our results demonstrate that while a polyphenol-enriched diet in pigs may not directly influence A. suum establishment, it significantly modulates the subsequent host response to helminth infection. Our results suggest an influence of diet on immune function which may potentially be exploited to enhance immunity to helminths.

  7. Evaluation of an intranasal virosomal vaccine against respiratory syncytial virus in mice: effect of TLR2 and NOD2 ligands on induction of systemic and mucosal immune responses.

    Directory of Open Access Journals (Sweden)

    Muhammad Shafique

    Full Text Available INTRODUCTION: RSV infection remains a serious threat to newborns and the elderly. Currently, there is no vaccine available to prevent RSV infection. A mucosal RSV vaccine would be attractive as it could induce mucosal as well as systemic antibodies, capable of protecting both the upper and lower respiratory tract. Previously, we reported on a virosomal RSV vaccine for intramuscular injection with intrinsic adjuvant properties mediated by an incorporated lipophilic Toll-like receptor 2 (TLR2 ligand. However, it has not been investigated whether this virosomal RSV vaccine candidate would be suitable for use in mucosal immunization strategies and if additional incorporation of other innate receptor ligands, like NOD2-ligand, could further enhance the immunogenicity and protective efficacy of the vaccine. OBJECTIVE: To explore if intranasal (IN immunization with a virosomal RSV vaccine, supplemented with TLR2 and/or NOD2-ligands, is an effective strategy to induce RSV-specific immunity. METHODS: We produced RSV-virosomes carrying TLR2 (Pam3CSK4 and/or NOD2 (L18-MDP ligands. We tested the immunopotentiating properties of these virosomes in vitro, using TLR2- and/or NOD2-ligand-responsive murine and human cell lines, and in vivo by assessing induction of protective antibody and cellular responses upon IN immunization of BALB/c mice. RESULTS: Incorporation of Pam3CSK4 and/or L18-MDP potentiates the capacity of virosomes to activate (antigen-presenting cells in vitro, as demonstrated by NF-κB induction. In vivo, incorporation of Pam3CSK4 in virosomes boosted serum IgG antibody responses and mucosal antibody responses after IN immunization. While L18-MDP alone was ineffective, incorporation of L18-MDP in Pam3CSK4-carrying virosomes further boosted mucosal antibody responses. Finally, IN immunization with adjuvanted virosomes, particularly Pam3CSK4/L18-MDP-adjuvanted-virosomes, protected mice against infection with RSV, without priming for enhanced

  8. Basis for the Age-related Decline in Intestinal Mucosal Immunity

    Directory of Open Access Journals (Sweden)

    Douglas L. Schmucker

    2003-01-01

    Full Text Available The elderly are characterized by mucosal immunosenescence and high rates of morbidity and mortality associated with infectious diseases of the intestinal tract. Little is known about how the differentiation of immunoglobulin A (IgA plasma cells in Peyer's patches (PPs and their subsequent homing to the small intestinal lamina propria (LP is affected by aging. Quantitative immunohistochemical analyses demonstrated a 2-fold increase in the number of IgA+ cells in the PPs, coupled with significant declines in the numbers of IgA+ and antibody-positive cells in the intestinal LP of senescent rats compared to young adult animals. These data suggest that aging diminishes the emigration of IgA immunoblasts from these lymphoid aggregates, as well as their migration to the intestinal LP. Flow cytometry and lymphocyte adoptive transfer studies showed 3- to 4-fold age-related declines in the homing of antibody-containing cells and mesenteric lymph node lymphocytes to the small intestines of rhesus macaques and rats, respectively. The number of peripheral blood IgA immunoblasts expressing the homing molecule α4β7 declined 30% in senescent rats. This was accompanied by a >17% decrease in the areal density of LP blood vessels staining positive for the cell adhesion molecule MAdCAM-1. Cumulatively, declines in expression of these homing molecules constitute a substantial age-related diminution of IgA immunoblast homing potential. In vitro antibody secretion by LP plasma cells, i.e. antibody secreted per antibody-positive cell, remains unchanged as a function of donor age. Intestinal mucosal immunosenescence is a consequence of reduced homing of IgA plasma cells to the intestinal LP as a result of declines in homing molecule expression.

  9. Long-term evaluation of mucosal and systemic immunity and protection conferred by different polio booster vaccines.

    Science.gov (United States)

    Xiao, Yuhong; Daniell, Henry

    2017-09-25

    Oral polio vaccine (OPV) and Inactivated Polio Vaccine (IPV) have distinct advantages and limitations. IPV does not provide mucosal immunity and introduction of IPV to mitigate consequences of circulating vaccine-derived polio virus from OPV has very limited effect on transmission and OPV campaigns are essential for interrupting wild polio virus transmission, even in developed countries with a high coverage of IPV and protected sewer systems. The problem is magnified in many countries with limited resources. Requirement of refrigeration for storage and transportation for both IPV and OPV is also a major challenge in developing countries. Therefore, we present here long-term studies on comparison of a plant-based booster vaccine, which is free of virus and cold chain with IPV boosters and provide data on mucosal and systemic immunity and protection conferred by neutralizing antibodies. Mice were primed subcutaneously with IPV and boosted orally with lyophilized plant cells containing 1μg or 25μg polio viral protein 1 (VP1), once a month for three months or a single booster one year after the first prime. Our results show that VP1-IgG1 titers in single or double dose IPV dropped to background levels after one year of immunization. This decrease correlated with >50% reduction in seropositivity in double dose and <10% seropositivity in single dose IPV against serotype 1. Single dose IPV offered no or minimal protection against serotype 1 and 2 but conferred protection against serotype 3. VP1-IgA titers were negligible in IPV single or double dose vaccinated mice. VP1 antigen with two plant-derived adjuvants induced significantly high level and long lasting VP1-IgG1, IgA and neutralizing antibody titers (average 4.3-6.8 log2 titers). Plant boosters with VP1 and plant derived adjuvants maintained the same level titers from 29 to 400days and conferred the same level of protection against all three serotypes throughout the duration of this study. Even during period, when

  10. Induction of Mucosal and Systemic Immunity to a Recombinant Simian Immunodeficiency Viral Protein

    Science.gov (United States)

    Lehner, T.; Bergmeier, L. A.; Panagiotidi, C.; Tao, L.; Brookes, R.; Klavinskis, L. S.; Walker, P.; Walker, J.; Ward, R. G.; Hussain, L.; Gearing, A. J. H.; Adams, S. E.

    1992-11-01

    Heterosexual transmission through the cervico-vaginal mucosa is the principal route of human immunodeficiency virus (HIV) infection in Africa and is increasing in the United States and Europe. Vaginal immunization with simian immunodeficiency virus (SIV) had not yet been studied in nonhuman primates. Immune responses in macaques were investigated by stimulation of the genital and gut-associated lymphoid tissue with a recombinant, particulate SIV antigen. Vaginal, followed by oral, administration of the vaccine elicited three types of immunity: (i) gag protein p27-specific, secretory immunoglobulin A (IgA) and immunoglobulin G (IgG) in the vaginal fluid, (ii) specific CD4^+ T cell proliferation and helper function in B cell p27-specific IgA synthesis in the genital lymph nodes, and (iii) specific serum IgA and IgG, with CD4^+ T cell proliferative and helper functions in the circulating blood.

  11. Protective effects of Astragalus-Lilygranules on intestinal mucosal barrier of mice in high altitude hypoxia

    Directory of Open Access Journals (Sweden)

    Ling LI

    2016-10-01

    Full Text Available Objective  To investigate the protective effect of Astragalus-Lily Granules on intestinal mucosa and intestinal flora homeostasis in mice under high altitude hypoxia condition. Methods  We put mice into high altitude hypoxia cabin to establish high altitude hypoxia model mice. Sixty Kunming mice were randomly divided into control group, model group, Astragalus-Lily particles (ALP low, medium and high dose groups [1.75, 3.5, 7g/(kg•d] respectively. After three days of routine feeding, the ALP mice received drug by intragastric administration, once a day for continuous 17 days,control group and model group were given double distilled water in same volume. From the 15th day, all the mice but control group were exposed to simulated high altitude hypoxia condition for 3 days in a high altitude hypoxia cabin after they were gavaged for half an hour daily. By the 18th day, the fresh mouse feces were collected and smeared to observe the changes of microflora. The pathological changes of intestinal tissues were observed by HE staining and the expression of HIF-1αprotein in intestines was detected by immunohistochemistry. Results  The enterococci and gram negative bacteria showed a higher proportion (65.2%±2.4% and 56.7%±3.3%, respectively in the model group compared with the control group (24.7%±1.2%, 23.2%±1.5%, respectively, P<0.05. The pathological score of intestinal mucosal necrosis and edema (3.10±0.99, 3.30±0.67 respectively and inflammatory cell count (15.93±3.30, 16.40±3.97/ HP respectively was higher compared with the model group (0.70±0.67, 0.80±0.78; 4.07±2.12, 4.28±2.16/HP respectively; P<0.05. HIF-1αexpression increased significantly compared with the model group (P<0.05. The enterococci (46.7%±2.0%, 32.0%±2.6% respectively and gram negative bacteria rate (34.2%±1.6%, 38.0%±2.8% respectively in the ALP medium and high dose groups were lower compared with the model group (24.7%±1.2%, 23.2%±1.5% respectively, P<0

  12. New mechanism of oral immunity to mucosal candidiasis in hyper-IgE syndrome.

    Science.gov (United States)

    Conti, H R; Baker, O; Freeman, A F; Jang, W S; Holland, S M; Li, R A; Edgerton, M; Gaffen, S L

    2011-07-01

    Oropharyngeal candidiasis (OPC, thrush) is an opportunistic infection caused by the commensal fungus Candida albicans. An understanding of immunity to Candida has recently begun to unfold with the identification of fungal pattern-recognition receptors such as C-type lectin receptors, which trigger protective T-helper (Th)17 responses in the mucosa. Hyper-IgE syndrome (HIES/Job's syndrome) is a rare congenital immunodeficiency characterized by dominant-negative mutations in signal transducer and activator of transcription 3, which is downstream of the Th17-inductive cytokines interleukin (IL)-6 and IL-23, and hence patients with HIES exhibit dramatic Th17 deficits. HIES patients develop oral and mucocutaneous candidiasis, supporting a protective role for Th17 cells in immunity to OPC. However, the Th17-dependent mechanisms of antifungal immunity in OPC are still poorly defined. An often unappreciated aspect of oral immunity is saliva, which is rich in antimicrobial proteins (AMPs) and exerts direct antifungal activity. In this study, we show that HIES patients show significant impairment in salivary AMPs, including β-defensin 2 and Histatins. This tightly correlates with reduced candidacidal activity of saliva and concomitantly elevated colonization with Candida. Moreover, IL-17 induces histatins in cultured salivary gland cells. This is the first demonstration that HIES is associated with defective salivary activity, and provides a mechanism for the severe susceptibility of these patients to OPC.

  13. Eyedrop Vaccination Induced Systemic and Mucosal Immunity against Influenza Virus in Ferrets.

    Directory of Open Access Journals (Sweden)

    Sangchul Yoon

    Full Text Available We investigated eyedrop vaccination (EDV in pre-clinical development for immunological protection against influenza and for potential side effects involving ocular inflammation and the central nervous system (CNS. Live attenuated influenza EDV, CA07 (H1N1, PZ-4 (H1N2 and Uruguay (H3N2, induced both systemic and mucosal virus-specific antibody responses in ferrets. In addition, EDV resulted in a clinically significant protection against viral challenge, and suppression of viral replication in nasal secretion and lung tissue. Regarding safety, we found that administered EDV flow through the tear duct to reach the base of nasal cavity, and thus do not contact the olfactory bulb. All analyses for potential adverse effects due to EDV, including histological and functional examinations, did not reveal significant side effects. On the basis of these findings, we propose that EDV as effective, while being a safe administration route with minimum local side effects, CNS invasion, or visual function disturbance.

  14. Lack of mucosal immune reconstitution during prolonged treatment of acute and early HIV-1 infection.

    Directory of Open Access Journals (Sweden)

    Saurabh Mehandru

    2006-12-01

    Full Text Available During acute and early HIV-1 infection (AEI, up to 60% of CD4(+ T cells in the lamina propria of the lower gastrointestinal (GI tract are lost as early as 2-4 wk after infection. Reconstitution in the peripheral blood during therapy with highly active antiretroviral therapy (HAART is well established. However, the extent of immune reconstitution in the GI tract is unknown.Fifty-four AEI patients and 18 uninfected control participants underwent colonic biopsy. Forty of the 54 AEI patients were followed after initiation of antiretroviral therapy (18 were studied longitudinally with sequential biopsies over a 3-y period after beginning HAART, and 22 were studied cross sectionally after 1-7 y of uninterrupted therapy. Lymphocyte subsets, markers of immune activation and memory in the peripheral blood and GI tract were determined by flow cytometry and immunohistochemistry. In situ hybridization was performed in order to identify persistent HIV-1 RNA expression. Of the patients studied, 70% maintained, on average, a 50%-60% depletion of lamina propria lymphocytes despite 1-7 y of HAART. Lymphocytes expressing CCR5 and both CCR5 and CXCR4 were persistently and preferentially depleted. Levels of immune activation in the memory cell population, CD45RO+ HLA-DR+, returned to levels seen in the uninfected control participants in the peripheral blood, but were elevated in the GI tract of patients with persistent CD4+ T cell depletion despite therapy. Rare HIV-1 RNA-expressing cells were detected by in situ hybridization.Apparently suppressive treatment with HAART during acute and early infection does not lead to complete immune reconstitution in the GI mucosa in the majority of patients studied, despite immune reconstitution in the peripheral blood. Though the mechanism remains obscure, the data suggest that there is either viral or immune-mediated accelerated T cell destruction or, possibly, alterations in T cell homing to the GI tract. Although clinically

  15. A strong adjuvant based on glycol-chitosan-coated lipid-polymer hybrid nanoparticles potentiates mucosal immune responses against the recombinant Chlamydia trachomatis fusion antigen CTH522.

    Science.gov (United States)

    Rose, Fabrice; Wern, Jeanette Erbo; Gavins, Francesca; Andersen, Peter; Follmann, Frank; Foged, Camilla

    2018-02-10

    Induction of mucosal immunity with vaccines is attractive for the immunological protection against pathogen entry directly at the site of infection. An example is infection with Chlamydia trachomatis (Ct), which is the most common sexually transmitted infection in the world, and there is an unmet medical need for an effective vaccine. A vaccine against Ct should elicit protective humoral and cell-mediated immune (CMI) responses in the genital tract mucosa. We previously designed an antibody- and CMI-inducing adjuvant based on poly(dl-lactic-co-glycolic acid) (PLGA) nanoparticles modified with the cationic surfactant dimethyldioctadecylammonium bromide and the immunopotentiator trehalose-6,6'-dibehenate. Here we show that immunization with these lipid-polymer hybrid nanoparticles (LPNs) coated with the mucoadhesive polymer chitosan enhances mucosal immune responses. Glycol chitosan (GC)-modified LPNs were engineered using an oil-in-water single emulsion solvent evaporation method. The nanoparticle design was optimized in a highly systematic way by using a quality-by-design approach to define the optimal operating space and to gain maximal mechanistic information about the GC coating of the LPNs. Cryo-transmission electron microscopy revealed a PLGA core coated with one or several concentric lipid bilayers. The GC coating of the surface was identified as a saturable, GC concentration-dependent increase in particle size and a reduction of the zeta-potential, and the coating layer could be compressed upon addition of salt. Increased antigen-specific mucosal immune responses were induced in the lungs and the genital tract with the optimized GC-coated LPN adjuvant upon nasal immunization of mice with the recombinant Ct fusion antigen CTH522. The mucosal responses were characterized by CTH522-specific IgG/IgA antibodies, together with CTH522-specific interferon γ-producing Th1 cells. This study demonstrates that mucosal administration of CTH522 adjuvanted with chitosan

  16. Rhubarb Supplementation Promotes Intestinal Mucosal Innate Immune Homeostasis through Modulating Intestinal Epithelial Microbiota in Goat Kids.

    Science.gov (United States)

    Jiao, Jinzhen; Wu, Jian; Wang, Min; Zhou, Chuanshe; Zhong, Rongzhen; Tan, Zhiliang

    2018-01-31

    The abuse and misuse of antibiotics in livestock production pose a potential health risk globally. Rhubarb can serve as a potential alternative to antibiotics, and several studies have looked into its anticancer, antitumor, and anti-inflammatory properties. The aim of this study was to test the effects of rhubarb supplementation to the diet of young ruminants on innate immune function and epithelial microbiota in the small intestine. Goat kids were fed with a control diet supplemented with or without rhubarb (1.25% DM) and were slaughtered at days 50 and 60 of age. Results showed that the supplementation of rhubarb increased ileal villus height (P = 0.036), increased jejujal and ileal anti-inflammatory IL-10 production (P immune function were accompanied by shifts in ileal epithelial bacterial ecosystem in favor of Blautia, Clostridium, Lactobacillus, and Pseudomonas, and with a decline in the relative abundance of Staphylococcus (P immune homeostasis by modulating intestinal epithelial microbiota during the early stages of animal development.

  17. The learning curve, interobserver, and intraobserver agreement of endoscopic confocal laser endomicroscopy in the assessment of mucosal barrier defects.

    Science.gov (United States)

    Chang, Jeff; Ip, Matthew; Yang, Michael; Wong, Brendon; Power, Theresa; Lin, Lisa; Xuan, Wei; Phan, Tri Giang; Leong, Rupert W

    2016-04-01

    Confocal laser endomicroscopy can dynamically assess intestinal mucosal barrier defects and increased intestinal permeability (IP). These are functional features that do not have corresponding appearance on histopathology. As such, previous pathology training may not be beneficial in learning these dynamic features. This study aims to evaluate the diagnostic accuracy, learning curve, inter- and intraobserver agreement for identifying features of increased IP in experienced and inexperienced analysts and pathologists. A total of 180 endoscopic confocal laser endomicroscopy (Pentax EC-3870FK; Pentax, Tokyo, Japan) images of the terminal ileum, subdivided into 6 sets of 30 were evaluated by 6 experienced analysts, 13 inexperienced analysts, and 2 pathologists, after a 30-minute teaching session. Cell-junction enhancement, fluorescein leak, and cell dropout were used to represent increased IP and were either present or absent in each image. For each image, the diagnostic accuracy, confidence, and quality were assessed. Diagnostic accuracy was significantly higher for experienced analysts compared with inexperienced analysts from the first set (96.7% vs 83.1%, P 0.86 for experienced observers. Features representative of increased IP can be rapidly learned with high inter- and intraobserver agreement. Confidence and image quality were significant predictors of accurate interpretation. Previous pathology training did not have an effect on learning. Copyright © 2016 American Society for Gastrointestinal Endoscopy. Published by Elsevier Inc. All rights reserved.

  18. Activation of IGF-1/IGFBP-3 signaling by berberine improves intestinal mucosal barrier of rats with acute endotoxemia.

    Science.gov (United States)

    He, Yan; Yuan, Xiaoming; Zhou, Guangrong; Feng, Aiwen

    2018-01-01

    Insulin-like growth factor I (IGF-I) and binding protein 3 (IGFBP-3) play a role in the maintenance of gut mucosal barrier function. Nevertheless, IGF-I/IGFBP-3 and tight junction protein (TJP) expression in small intestinal mucosa are often impaired during endotoxemia. In this model of acute endotoxemia, the regulatory effect of berberine on IGF-I/IGFBP-3 and TJP expression in ileal mucosa was evaluated. The findings revealed systemic injection of lipopolysaccharide (LPS) suppressed mRNA and protein expression of IGF-I and IGFBP-3, but berberine ameliorated their production. LPS injection inhibited occludin and claudin-1 protein generation, and this inhibitory effect of LPS was abolished by berberine. Inhibition of IGF-I/IGFBP-3 signaling by AG1024 or siRNAs reduced berberine-induced occludin and claudin-1 production. Additionally, GW9662 was found to repress berberine-induced IGF-I/IGFBP-3 expression, indicating of a cross-link between PPARγ and IGF-I/IGFBP-3 axis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Effects of plasma CGRP and NPY level changes on intestinal mucosal barrier injury after scald in rats

    International Nuclear Information System (INIS)

    Shao Lijian; Zhu Qingxian; He Ming; Zhang Hongyan

    2004-01-01

    Objective: To investigate the significance of plasma CGRP and NPY levels changes immediately after scald in rats. Methods: Thirty-two rat models of 30% TBSA III degree scald were prepared. Eight animals each were sacrificed at 3, 6,12 and 24 hrs; taking blood samples for determination of plasma CGRP, NPY levels and 5 cm of ileum for pathologic study. As controls, eight animals without scald were treated in the same way. Results: Plasma CGRP levels were decreased significantly after scald, reaching bottom value at 12 hr and remained lower than those in controls at 24 hr (p 0.05). Plasma levels of CGRP were negatively correlated to plasma NPY levels (p<0.01). Ileum mucosal injuries presented as edema, congestion with necrosis and slough of epithelium were most marked at 12 hr. Conclusion: Plasma CGRP and NPY levels changed significantly after scald and were mutually negatively correlated. Post-scald intestinal mucosa barrier injuries were possibly related to the changes of levels of those vasoactive peptides

  20. Endothelial dysfunction and functional status of intestinal mucosal barrier in asphyxiated low birth weight infants

    Directory of Open Access Journals (Sweden)

    Huseynova S.A.

    2016-03-01

    Full Text Available Aim of study. The main prpose of present study was to determine the effect of endothelial dysfunction to the levels of markers of functional state of digestive system in infants with perinatal hypoxia. Materials and methods. The neuronal dysfunction was detected basing on the levels of NSE and NR2 antibodies. The functional state of gastrointestinal tract was estimated by IFABP, sLFABP, MUC-2, ITF, LBP. As the markers of endothelial dysfunction it was detected endotelin-1 and NO. The concentrations of markers were determined in peripheral blood of 66 preterm newborns exposure intrauterine hypoxia with 32–36 weeks of gestational age, which were classified as asphyxiated (1st group, n=30, non asphyxiated (2nd group, n=36 infants. Control group consisted of 22 healthy preterm babies. Results. It was not detected significant difference of NSE and NR2 antibodies levels between 1st and 2nd groups. The endothelin-1 concentrations significantly decreased in asphyxiated group in the background of high NO levels. The elevated level of IFABP in asphyxiated infants associated with compensative increasing of ITF and low anti endotoxine immunity. Conclusion. Endothelial dysfunction is one of the main factor resulting in hypoxic-ischemic injury of gastrointestinal tract in asphyxiated low birth weight infants.

  1. Long-term persistence of systemic and mucosal immune response to HPV-16/18 AS04-adjuvanted vaccine in preteen/adolescent girls and young women

    DEFF Research Database (Denmark)

    Petäjä, T; Pedersen, Court; Poder, A

    2011-01-01

    Vaccination against oncogenic human papillomavirus (HPV) types is one key intervention for cervical cancer prevention. This follow-up study assessed the persistence of the systemic and mucosal immune responses together with the safety profile of the HPV-16/18 AS04-adjuvanted vaccine administered...... of transudation or exudation of serum IgG antibodies through the cervical epithelium. The HPV-16/18 AS04-adjuvanted vaccine had a clinically acceptable safety profile. In conclusion, this follow-up study shows that the HPV-16/18 AS04-adjuvanted vaccine administered to preteen/adolescents girls and young women...... induces long-term systemic and mucosal immune response and has a clinically acceptable safety profile up to four years after the first vaccine dose....

  2. Long-term persistence of systemic and mucosal immune response to HPV-16/18 AS04-adjuvanted vaccine in preteen/adolescent girls and young women

    DEFF Research Database (Denmark)

    Petäjä, T; Pedersen, C; Andersen, Anne Poder

    2010-01-01

    Vaccination against oncogenic human papillomavirus (HPV) types is one key intervention for cervical cancer prevention. This follow-up study assessed the persistence of the systemic and mucosal immune responses together with the safety profile of the HPV-16/18 AS04-adjuvanted vaccine administered...... of transudation or exudation of serum IgG antibodies through the cervical epithelium. The HPV-16/18 AS04-adjuvanted vaccine had a clinically acceptable safety profile. In conclusion, this follow-up study shows that the HPV-16/18 AS04-adjuvanted vaccine administered to preteen/adolescents girls and young women...... induces long-term systemic and mucosal immune response and has a clinically acceptable safety profile up to four years after the first vaccine dose....

  3. Discovery of J chain in African lungfish (Protopterus dolloi, Sarcopterygii using high throughput transcriptome sequencing: implications in mucosal immunity.

    Directory of Open Access Journals (Sweden)

    Luca Tacchi

    Full Text Available J chain is a small polypeptide responsible for immunoglobulin (Ig polymerization and transport of Igs across mucosal surfaces in higher vertebrates. We identified a J chain in dipnoid fish, the African lungfish (Protopterus dolloi by high throughput sequencing of the transcriptome. P. dolloi J chain is 161 aa long and contains six of the eight Cys residues present in mammalian J chain. Phylogenetic studies place the lungfish J chain closer to tetrapod J chain than to the coelacanth or nurse shark sequences. J chain expression occurs in all P. dolloi immune tissues examined and it increases in the gut and kidney in response to an experimental bacterial infection. Double fluorescent in-situ hybridization shows that 88.5% of IgM⁺ cells in the gut co-express J chain, a significantly higher percentage than in the pre-pyloric spleen. Importantly, J chain expression is not restricted to the B-cell compartment since gut epithelial cells also express J chain. These results improve our current view of J chain from a phylogenetic perspective.

  4. Age-related Defects in Ocular and Nasal Mucosal Immune System and the Immunopathology of Dry Eye Disease

    Science.gov (United States)

    Farid, Marjan; Agrawal, Anshu; Fremgen, Daniel; Tao, Jeremiah; Chuyi, He; Nesburn, Anthony B.; BenMohamed, Lbachir

    2014-01-01

    Dry eye disease (DED) is a prevalent public health concern that affects up to 30% of adults and is particularly chronic and severe in the elderly. Two interconnected mechanisms cause DED: (1) an age-related dysfunction of lacrimal and meibomian glands, which leads to decreased tear production and/or an increase in tear evaporation; and (2) an age-related uncontrolled inflammation of the surface of the eye triggered by yet-to-be-determined internal immunopathological mechanisms, independent of tear deficiency and evaporation. In this review we summarize current knowledge on animal models that mimic both the severity and chronicity of inflammatory DED and that have been reliably used to provide insights into the immunopathological mechanisms of DED, and we provide an overview of the opportunities and limitations of the rabbit model in investigating the role of both ocular and nasal mucosal immune systems in the immunopathology of inflammatory DED and in testing novel immunotherapies aimed at delaying or reversing the uncontrolled age-related inflammatory DED. PMID:25535823

  5. Mucosal delivery of a vectored RSV vaccine is safe and elicits protective immunity in rodents and nonhuman primates

    Directory of Open Access Journals (Sweden)

    Angiolo Pierantoni

    Full Text Available Respiratory Syncytial Virus (RSV is a leading cause of severe respiratory disease in infants and the elderly. No vaccine is presently available to address this major unmet medical need. We generated a new genetic vaccine based on chimpanzee Adenovirus (PanAd3-RSV and Modified Vaccinia Ankara RSV (MVA-RSV encoding the F, N, and M2-1 proteins of RSV, for the induction of neutralizing antibodies and broad cellular immunity. Because RSV infection is restricted to the respiratory tract, we compared intranasal (IN and intramuscular (M administration for safety, immunogenicity, and efficacy in different species. A single IN or IM vaccination completely protected BALB/c mice and cotton rats against RSV replication in the lungs. However, only IN administration could prevent infection in the upper respiratory tract. IM vaccination with MVA-RSV also protected cotton rats from lower respiratory tract infection in the absence of detectable neutralizing antibodies. Heterologous prime boost with PanAd3-RSV and MVA-RSV elicited high neutralizing antibody titers and broad T-cell responses in nonhuman primates. In addition, animals primed in the nose developed mucosal IgA against the F protein. In conclusion, we have shown that our vectored RSV vaccine induces potent cellular and humoral responses in a primate model, providing strong support for clinical testing.

  6. Modulation of Mucosal Immune Response, Tolerance and Proliferation in Mice Colonized by the Mucin-Degrader Akkermansia muciniphila

    Directory of Open Access Journals (Sweden)

    Muriel eDerrien

    2011-08-01

    Full Text Available Epithelial cells of the mammalian intestine are covered with a mucus layer that prevents direct contact with intestinal microbes but also constitutes a substrate for mucus-degrading bacteria. To study the effect of mucus degradation on the host-response, germ-free mice were colonized with Akkermansia muciniphila. This anaerobic bacterium belonging to the Verrucomicrobia is specialized in the degradation of mucin, the glycoprotein present in mucus, and found in high numbers in the intestinal tract of human and other mammalian species. Efficient colonization of A. muciniphila was observed with highest numbers in the cecum, where most mucin is produced. In contrast, following colonization by Lactobacillus plantarum, a facultative anaerobe belonging to the Firmicutes that ferments carbohydrates, similar cell-numbers were found at all intestinal sites. Whereas A. muciniphila was located closely associated with the intestinal cells, L. plantarum was exclusively found in the lumen. The global transcriptional host response was determined in intestinal biopsies and revealed a consistent, site-specific and unique modulation of about 750 genes in mice colonized by A. muciniphila and over 1500 genes after colonization by L. plantarum. Pathway reconstructions showed that colonization by A. muciniphila altered mucosal gene expression profiles towards increased expression of genes involved in immune responses and cell fate determination, while colonization by L. plantarum led to up-regulation of lipid metabolism. These indicate that the colonizers induce host responses that are specific per intestinal location. In conclusion, we propose that A. muciniphila modulates pathways involved in establishing homeostasis for basal metabolism and immune tolerance towards commensal microbiota.

  7. Glucagon-like peptide-2 protects impaired intestinal mucosal barriers in obstructive jaundice rats.

    Science.gov (United States)

    Chen, Jun; Dong, Jia-Tian; Li, Xiao-Jing; Gu, Ye; Cheng, Zhi-Jian; Cai, Yuan-Kun

    2015-01-14

    To observe the protective effect of glucagon-like peptide-2 (GLP-2) on the intestinal barrier of rats with obstructive jaundice and determine the possible mechanisms of action involved in the protective effect. Thirty-six Sprague-Dawley rats were randomly divided into a sham operation group, an obstructive jaundice group, and a GLP-2 group; each group consisted of 12 rats. The GLP-2 group was treated with GLP-2 after the day of surgery, whereas the other two groups were treated with the same concentration of normal saline. Alanine aminotransferase (ALT), total bilirubin, and endotoxin levels were recorded at 1, 3, 7, 10 and 14 d. Furthermore, on the 14(th) day, body weight, the wet weight of the small intestine, pathological changes of the small intestine and the immunoglobulin A (IgA) expressed by plasma cells located in the small intestinal lamina propria were recorded for each group. In the rat model, jaundice was obvious, and the rats' activity decreased 4-6 d post bile duct ligation. Compared with the sham operation group, the obstructive jaundice group displayed increased yellow staining of abdominal visceral serosa, decreased small intestine wet weight, thinning of the intestinal muscle layer and villi, villous atrophy, uneven height, fusion, partial villous epithelial cell shedding, substantial inflammatory cell infiltration and significantly reduced IgA expression. However, no significant gross changes were noted between the GLP-2 and sham groups. With time, the levels of ALT, endotoxin and bilirubin in the GLP-2 group were significantly increased compared with the sham group (P jaundice group than in the GLP-2 group (P jaundice rats, which might be attributed to increased intestinal IgA and reduced bilirubin and endotoxin.

  8. Vaccine-induced mucosal immunity to poliovirus: analysis of cohorts from an open-label, randomised controlled trial in Latin American infants.

    Science.gov (United States)

    Wright, Peter F; Connor, Ruth I; Wieland-Alter, Wendy F; Hoen, Anne G; Boesch, Austin W; Ackerman, Margaret E; Oberste, M Steven; Gast, Chris; Brickley, Elizabeth B; Asturias, Edwin J; Rüttimann, Ricardo; Bandyopadhyay, Ananda S

    2016-12-01

    Identification of mechanisms that limit poliovirus replication is crucial for informing decisions aimed at global polio eradication. Studies of mucosal immunity induced by oral poliovirus (OPV) or inactivated poliovirus (IPV) vaccines and mixed schedules thereof will determine the effectiveness of different vaccine strategies to block virus shedding. We used samples from a clinical trial of different vaccination schedules to measure intestinal immunity as judged by neutralisation of virus and virus-specific IgA in stools. In the FIDEC trial, Latin American infants were randomly assigned to nine groups to assess the efficacy of two schedules of bivalent OPV (bOPV) and IPV and challenge with monovalent type 2 OPV, and stools samples were collected. We selected three groups of particular interest-the bOPV control group (serotypes 1 and 3 at 6, 10, and 14 weeks), the trivalent attenuated OPV (tOPV) control group (tOPV at 6, 10, and 14 weeks), and the bOPV-IPV group (bOPV at 6, 10, and 14 weeks plus IPV at 14 weeks). Neutralising activity and poliovirus type-specific IgA were measured in stool after a monovalent OPV type 2 challenge at 18 weeks of age. Mucosal immunity was measured by in-vitro neutralisation of a type 2 polio pseudovirus (PV2). Neutralisation titres and total and poliovirus-type-specific IgG and IgA concentrations in stools were assessed in samples collected before challenge and 2 weeks after challenge from all participants. 210 infants from Guatemala and Dominican Republic were included in this analysis. Of 38 infants tested for mucosal antibody in the tOPV group, two were shedding virus 1 week after challenge, compared with 59 of 85 infants receiving bOPV (p<0·0001) and 53 of 87 infants receiving bOPV-IPV (p<0·0001). Mucosal type 2 neutralisation and type-specific IgA were noted primarily in response to tOPV. An inverse correlation was noted between virus shedding and both serum type 2 neutralisation at challenge (p<0·0001) and mucosal type 2

  9. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  10. Heat Shock Protein 70 Enhances Mucosal Immunity against Human Norovirus When Coexpressed from a Vesicular Stomatitis Virus Vector

    Science.gov (United States)

    Ma, Yuanmei; Duan, Yue; Wei, Yongwei; Liang, Xueya; Niewiesk, Stefan; Oglesbee, Michael

    2014-01-01

    ABSTRACT Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942–2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 × 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 × 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine. IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is

  11. Evaluation value of intestinal flora detection for intestinal mucosal inflammation and immune response in patients with ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Yan Zou

    2017-09-01

    Full Text Available Objective: To study the evaluation value of intestinal flora detection for intestinal mucosal inflammatory response and immune response in patients with ulcerative colitis. Methods: The patients who were diagnosed with ulcerative colitis in Zigong Fifth People’s Hospital between March 2015 and February 2017 were selected as the UC group, and those who were diagnosed with colonic polyps were selected as the control group. Fresh excreta were collected to detect the number of intestinal flora, and the diseased intestinal mucosa tissue was collected to detect the expression of inflammatory response molecules and immune cell transcription factors. Results: enterococcus contents in intestinal tract and TLR4, NF-kB, TNF-α, HMGB-1, T-bet and RORC mRNA expression levels in intestinal mucosa of UC group were significantly higher than those of control group while bifidobacteria contents in intestinal tract and SOCS2, SOCS3, Foxp3 and GATA-3 mRNA expression levels were significantly lower than those of control group; TLR4, NF-kB, TNF-α, HMGB-1, T-bet and RORC mRNA expression levels in intestinal mucosa of UC patients with grade II and grade III flora disturbance were significantly higher than those of UC patients with normal flora and grade I flora disturbance while SOCS2, SOCS3, Foxp3 and GATA-3 mRNA expression levels were significantly lower than those of UC patients with normal flora and grade I flora disturbance; TLR4, NF-kB, TNF-α, HMGB-1, T-bet and RORC mRNA expression levels in intestinal mucosa of UC patients with grade III flora disturbance were significantly higher than those of UC patients with grade II flora disturbance while SOCS2, SOCS3, Foxp3 and GATA-3 mRNA expression levels were significantly lower than those of UC patients with grade II flora disturbance. Conclusion: The intestinal flora disturbance in patients with ulcerative colitis can result in inflammatory response activation and immune response disorder.

  12. [Protective effect of Saccharomyces boulardii against intestinal mucosal barrier injury in rats with nonalcoholic fatty liver disease].

    Science.gov (United States)

    Liu, Y T; Li, Y Q; Wang, Y Z

    2016-12-20

    Objective: To investigate the protective effect of Saccharomyces boulardii against intestinal mucosal barrier injury in rats with nonalcoholic fatty liver disease (NAFLD). Methods: A total of 36 healthy male Sprague-Dawley rats with a mean body weight of 180±20 g were randomly divided into control group, model group, and treatment group, with 12 rats in each group, after adaptive feeding for 1 week. The rats in the control group were given basic feed, and those in the model group and treatment group were given high-fat feed. After 12 weeks of feeding, the treatment group was given Saccharomyces boulardii (75×10 8 CFU/kg/d) by gavage, and those in the control group and model group were given isotonic saline by gavage. At the 20th week, blood samples were taken from the abdominal aorta to measure the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), intestinal fatty acid binding protein (IFABP), tumor necrosis factor-α (TNF-α), and endotoxins. The liver pathological changes, intestinal histopathological changes, and expression of occludin in the intestinal mucosa were observed. Fecal samples were collected to measure the changes in Escherichia coli and Bacteroides. A one-way analysis of variance and the SNK test were used for comparison between multiple groups, and the rank sum test was used as the non-parametric test. Results: Compared with the control group, the model group had significantly higher body weight, liver mass, and liver index ( P 0.05). Compared with the control group, the model group had significant increases in the levels of endotoxin, TNF-α, and IFABP ( P Saccharomyces boulardii can reduce body weight and improve hepatocyte steatosis. Saccharomyces boulardii can reduce endotoxemia in NAFLD rats and thus alleviate inflammatory response. Saccharomyces boulardii can also adjust the proportion of Escherichia coli and Bacteroides in the intestine of NAFLD rats.

  13. Efficacy of thiolated eudragit microspheres as an oral vaccine delivery system to induce mucosal immunity against enterotoxigenic Escherichia coli in mice.

    Science.gov (United States)

    Lee, Won-Jung; Cha, Seungbin; Shin, Minkyoung; Jung, Myunghwan; Islam, Mohammad Ariful; Cho, Chong-su; Yoo, Han Sang

    2012-05-01

    A vaccine delivery system based on thiolated eudragit microsphere (TEMS) was studied in vivo for its ability to elicit mucosal immunity against enterotoxigenic Escherichia coli (ETEC). Groups of mice were orally immunized with F4 or F18 fimbriae of ETEC and F4 or F18 loaded in TEMS. Mice that were orally administered with F4 or F18 loaded TEMS showed higher antigen-specific IgG antibody responses in serum and antigen-specific IgA in saliva and feces than mice that were immunized with antigens only. In addition, oral vaccination of F4 or F18 loaded TEMS resulted in higher numbers of IgG and IgA antigen-specific antibody secreting cells in the spleen, lamina propria, and Peyer's patches of immunized mice than other groups. Moreover, TEMS administration loaded with F4 or F18 induced mixed Th1 and Th2 type responses based on similarly increased levels of IgG1 and IgG2a. These results suggest that F4 or F18 loaded TEMS may be a promising candidate for an oral vaccine delivery system to elicit systemic and mucosal immunity against ETEC. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Mucosal immunization with recombinant adenoviral vectors expressing murine gammaherpesvirus-68 genes M2 and M3 can reduce latent viral load

    DEFF Research Database (Denmark)

    Hoegh-Petersen, Mette; Thomsen, Allan R; Christensen, Jan P

    2009-01-01

    -68 (MHV-68) is a member of the Gammaherpesvirinae subfamily and represents a useful murine model for this category of infections, in which new vaccination strategies may initially be evaluated. Two attenuated variants of MHV-68 have successfully been used as vaccines, but the oncogenic potential...... of the gammaherpesvirinae speaks against using a similar approach in humans. DNA immunization with plasmids encoding the MHV-68 genes M2 or M3 caused a reduction in either acute or early latent viral load, respectively, but neither immunization had an effect at times later than 14 days post-infection. Adenovirus......-based vaccines are substantially more immunogenic than DNA vaccines and can be applied to induce mucosal immunity. Here we show that a significant reduction of the late viral load in the spleens, at 60 days post-infection, was achieved when immunizing mice both intranasally and subcutaneously with adenoviral...

  15. Modulation of allergic immune responses by mucosal application of recombinant lactic acid bacteria producing the major birch pollen allergen Bet v 1.

    Science.gov (United States)

    Daniel, C; Repa, A; Wild, C; Pollak, A; Pot, B; Breiteneder, H; Wiedermann, U; Mercenier, A

    2006-07-01

    Probiotic lactic acid bacteria (LAB) are able to modulate the host immune system and clinical trials have demonstrated that specific strains have the capacity to reduce allergic symptoms. Therefore, we aimed to evaluate the potential of recombinant LAB producing the major birch pollen allergen Bet v 1 for mucosal vaccination against birch pollen allergy. Recombinant Bet v 1-producing Lactobacillus plantarum and Lactococcus lactis strains were constructed. Their immunogenicity was compared with purified Bet v 1 by subcutaneous immunization of mice. Intranasal application of the live recombinant strains was performed to test their immunomodulatory potency in a mouse model of birch pollen allergy. Bet v 1 produced by the LAB was recognized by monoclonal anti-Bet v 1 and IgE antibodies from birch pollen-allergic patients. Systemic immunization with the recombinant strains induced significantly lower IgG1/IgG2a ratios compared with purified Bet v 1. Intranasal pretreatment led to reduced allergen-specific IgE vs enhanced IgG2a levels and reduced interleukin (IL)-5 production of splenocytes in vitro, indicating a shift towards non-allergic T-helper-1 (Th1) responses. Airway inflammation, i.e. eosinophils and IL-5 in lung lavages, was reduced using either Bet v 1-producing or control strains. Allergen-specific secretory IgA responses were enhanced in lungs and intestines after pretreatment with only the Bet v 1-producing strains. Mucosal vaccination with live recombinant LAB, leading to a shift towards non-allergic immune responses along with enhanced allergen-specific mucosal IgA levels offers a promising approach to prevent systemic and local allergic immune responses.

  16. Effects of a Lactobacillus salivarius probiotic intervention on infection, cold symptom duration and severity, and mucosal immunity in endurance athletes.

    Science.gov (United States)

    Gleeson, Michael; Bishop, Nicolette C; Oliveira, Marta; McCauley, Tracey; Tauler, Pedro; Lawrence, Claire

    2012-08-01

    The purpose of this study was to examine the effects of a probiotic supplement during 4 mo of spring training in men and women engaged in endurance-based physical activities on incidence of upper respiratory tract infections (URTI) and mucosal immune markers. Sixty-six highly active individuals were randomized to probiotic (n = 33) or placebo (n = 33) groups and, under double-blind procedures, received probiotic (PRO: Lactobacillus salivarius, 2 × 1010 bacterium colony-forming units) or placebo (PLA) daily for 16 wk. Resting blood and saliva samples were collected at baseline and after 8 and 16 wk. Weekly training and illness logs were kept. Fifty-four subjects completed the study (n = 27 PRO, n = 27 PLA). The proportion of subjects on PRO who experienced 1 or more wk with URTI symptoms was not different from that of those on PLA (PRO .58, PLA .59; p = .947). The number of URTI episodes was similar in the 2 groups (PRO 1.6 ± 0.3, PLA 1.4 ± 0.3; p = .710). Severity and duration of symptoms were not significantly different between treatments. Blood leukocyte, neutrophil, monocyte, and lymphocyte counts; saliva IgA; and lysozyme concentrations did not change over the course of the study and were not different on PRO compared with PLA. Regular ingestion of L. salivarius does not appear to be beneficial in reducing the frequency of URTI in an athletic cohort and does not affect blood leukocyte counts or levels of salivary antimicrobial proteins during a spring period of training and competition.

  17. T-Cell-Mediated Immune Responses in Patients with Cutaneous or Mucosal Leishmaniasis: Long-Term Evaluation after Therapy

    Science.gov (United States)

    Da-Cruz, Alda Maria; Bittar, Rita; Mattos, Marise; Oliveira-Neto, Manuel P.; Nogueira, Ricardo; Pinho-Ribeiro, Vanessa; Azeredo-Coutinho, Rilza Beatriz; Coutinho, Sergio G.

    2002-01-01

    T-cell immune responses in patients with cutaneous leishmaniasis (CL) and mucosal leishmaniasis (ML) were studied during the active disease, at the end of therapy, and 1 to 17 years posttherapy (long-term follow-up). Lymphocyte proliferative responses, phenotypic characterization of CD4+ and CD8+ Leishmania-reactive T cells, and cytokine production were assayed. Patients with active ML and CL showed higher proportions of CD4+ than CD8+ T cells. In CL, the healing process was associated with a decrease of CD4+ and an increase of CD8+, leading to similar CD4+ and CD8+ proportions. This pattern was only seen in ML after long-term therapy. Long-term follow-up of patients with CL showed a positive CD4+/CD8+ ratio as observed during the active disease, although the percentages of these T cell subsets were significantly lower. Patients with CL did not show significant differences between gamma interferon (IFN-γ) and interleukin-5 (IL-5) production during the period of study. Patients with active ML presented higher IFN-γ and IL-5 levels compared to patients with active CL. IL-4 was only detected during active disease. Patients long term after cure from ML showed increasing production of IFN-γ, significant decrease of IL-5, and no IL-4 production. Two apparently beneficial immunological parameters were detected in tegumentary leishmaniasis: (i) decreasing proportions of CD4+ Leishmania-reactive T cells in the absence of IL-4 production associated with cure of CL and ML and (ii) decreasing levels of IL-5 long after cure, better detected in patients with ML. The observed T-cell responses maintained for a long period in healed patients could be relevant for immunoprotection against reinfection and used as a parameter for determining the prognosis of patients and selecting future vaccine preparations. PMID:11874860

  18. The Probiotic Compound VSL#3 Modulates Mucosal, Peripheral, and Systemic Immunity Following Murine Broad-Spectrum Antibiotic Treatment

    Directory of Open Access Journals (Sweden)

    Ira Ekmekciu

    2017-05-01

    Full Text Available There is compelling evidence linking the commensal intestinal microbiota with host health and, in turn, antibiotic induced perturbations of microbiota composition with distinct pathologies. Despite the attractiveness of probiotic therapy as a tool to beneficially alter the intestinal microbiota, its immunological effects are still incompletely understood. The aim of the present study was to assess the efficacy of the probiotic formulation VSL#3 consisting of eight distinct bacterial species (including Streptococcus thermophilus, Bifidobacterium breve, B. longum, B. infantis, Lactobacillus acidophilus, L. plantarum, L. paracasei, and L. delbrueckii subsp. Bulgaricus in reversing immunological effects of microbiota depletion as compared to reassociation with a complex murine microbiota. To address this, conventional mice were subjected to broad-spectrum antibiotic therapy for 8 weeks and perorally reassociated with either VSL#3 bacteria or a complex murine microbiota. VSL#3 recolonization resulted in restored CD4+ and CD8+ cell numbers in the small and large intestinal lamina propria as well as in B220+ cell numbers in the former, whereas probiotic intervention was not sufficient to reverse the antibiotic induced changes of respective cell populations in the spleen. However, VSL#3 application was as efficient as complex microbiota reassociation to attenuate the frequencies of regulatory T cells, activated dendritic cells and memory/effector T cells in the small intestine, colon, mesenteric lymph nodes, and spleen. Whereas broad-spectrum antibiotic treatment resulted in decreased production of cytokines such as IFN-γ, IL-17, IL-22, and IL-10 by CD4+ cells in respective immunological compartments, VSL#3 recolonization was sufficient to completely recover the expression of the anti-inflammatory cytokine IL-10 without affecting pro-inflammatory mediators. In summary, the probiotic compound VSL#3 has an extensive impact on mucosal, peripheral, and

  19. Lactobacillus plantarum Strains Can Enhance Human Mucosal and Systemic Immunity and Prevent Non-steroidal Anti-inflammatory Drug Induced Reduction in T Regulatory Cells

    Science.gov (United States)

    de Vos, Paul; Mujagic, Zlatan; de Haan, Bart J.; Siezen, Roland J.; Bron, Peter A.; Meijerink, Marjolein; Wells, Jerry M.; Masclee, Ad A. M.; Boekschoten, Mark V.; Faas, Marijke M.; Troost, Freddy J.

    2017-01-01

    Orally ingested bacteria interact with intestinal mucosa and may impact immunity. However, insights in mechanisms involved are limited. In this randomized placebo-controlled cross-over trial, healthy human subjects were given Lactobacillus plantarum supplementation (strain TIFN101, CIP104448, or WCFS1) or placebo for 7 days. To determine whether L. plantarum can enhance immune response, we compared the effects of three stains on systemic and gut mucosal immunity, by among others assessing memory responses against tetanus toxoid (TT)-antigen, and mucosal gene transcription, in human volunteers during induction of mild immune stressor in the intestine, by giving a commonly used enteropathic drug, indomethacin [non-steroidal anti-inflammatory drug (NSAID)]. Systemic effects of the interventions were studies in peripheral blood samples. NSAID was found to induce a reduction in serum CD4+/Foxp3 regulatory cells, which was prevented by L. plantarum TIFN101. T-cell polarization experiments showed L. plantarum TIFN101 to enhance responses against TT-antigen, which indicates stimulation of memory responses by this strain. Cell extracts of the specific L. plantarum strains provoked responses after WCFS1 and TIFN101 consumption, indicating stimulation of immune responses against the specific bacteria. Mucosal immunomodulatory effects were studied in duodenal biopsies. In small intestinal mucosa, TIFN101 upregulated genes associated with maintenance of T- and B-cell function and antigen presentation. Furthermore, L. plantarum TIFN101 and WCFS1 downregulated immunological pathways involved in antigen presentation and shared downregulation of snoRNAs, which may suggest cellular destabilization, but may also be an indicator of tissue repair. Full sequencing of the L. plantarum strains revealed possible gene clusters that might be responsible for the differential biological effects of the bacteria on host immunity. In conclusion, the impact of oral consumption L. plantarum on

  20. Lactobacillus plantarum Strains Can Enhance Human Mucosal and Systemic Immunity and Prevent Non-steroidal Anti-inflammatory Drug Induced Reduction in T Regulatory Cells

    Directory of Open Access Journals (Sweden)

    Paul de Vos

    2017-08-01

    Full Text Available Orally ingested bacteria interact with intestinal mucosa and may impact immunity. However, insights in mechanisms involved are limited. In this randomized placebo-controlled cross-over trial, healthy human subjects were given Lactobacillus plantarum supplementation (strain TIFN101, CIP104448, or WCFS1 or placebo for 7 days. To determine whether L. plantarum can enhance immune response, we compared the effects of three stains on systemic and gut mucosal immunity, by among others assessing memory responses against tetanus toxoid (TT-antigen, and mucosal gene transcription, in human volunteers during induction of mild immune stressor in the intestine, by giving a commonly used enteropathic drug, indomethacin [non-steroidal anti-inflammatory drug (NSAID]. Systemic effects of the interventions were studies in peripheral blood samples. NSAID was found to induce a reduction in serum CD4+/Foxp3 regulatory cells, which was prevented by L. plantarum TIFN101. T-cell polarization experiments showed L. plantarum TIFN101 to enhance responses against TT-antigen, which indicates stimulation of memory responses by this strain. Cell extracts of the specific L. plantarum strains provoked responses after WCFS1 and TIFN101 consumption, indicating stimulation of immune responses against the specific bacteria. Mucosal immunomodulatory effects were studied in duodenal biopsies. In small intestinal mucosa, TIFN101 upregulated genes associated with maintenance of T- and B-cell function and antigen presentation. Furthermore, L. plantarum TIFN101 and WCFS1 downregulated immunological pathways involved in antigen presentation and shared downregulation of snoRNAs, which may suggest cellular destabilization, but may also be an indicator of tissue repair. Full sequencing of the L. plantarum strains revealed possible gene clusters that might be responsible for the differential biological effects of the bacteria on host immunity. In conclusion, the impact of oral consumption L

  1. Adaptation of innate lymphoid cells to nutrient deprivation promotes type 2 barrier immunity

    Science.gov (United States)

    Survival of the host relies on the establishment of site-specific barrier defense tailored to constrain pressures imposed by commensal and parasitic exposures. The host is confronted with the additional challenge of maintaining barrier immunity in fluctuating states of dietary availability, yet how ...

  2. CCL28 induces mucosal homing of HIV-1-specific IgA-secreting plasma cells in mice immunized with HIV-1 virus-like particles.

    Directory of Open Access Journals (Sweden)

    Veronica Rainone

    Full Text Available Mucosae-associated epithelial chemokine (MEC or CCL28 binds to CCR3 and CCR10 and recruits IgA-secreting plasma cells (IgA-ASCs in the mucosal lamina propria. The ability of this chemokine to enhance migration of IgA-ASCs to mucosal sites was assessed in a mouse immunization model using HIV-1(IIIB Virus-like particles (VLPs. Mice receiving either HIV-1(IIIB VLPs alone, CCL28 alone, or the irrelevant CCL19 chemokine were used as controls. Results showed a significantly increased CCR3 and CCR10 expression on CD19(+ splenocytes of HIV-1(IIIB VPL-CCL28-treated mice. HIV-1 Env-specific IFN-γ, IL-4 and IL-5 production, total IgA, anti-Env IgA as well as gastro-intestinal mucosal IgA-secreting plasma cells were also significantly augmented in these mice. Notably, sera and vaginal secretions from HIV-1(IIIB VLP-CCL28-treated mice exhibited an enhanced neutralizing activity against both a HIV-1/B-subtype laboratory strain and a heterologous HIV-1/C-subtype primary isolate. These data suggest that CCL28 could be useful in enhancing the IgA immune response that will likely play a pivotal role in prophylactic HIV vaccines.

  3. Oropharyngeal Candidiasis in HIV Infection: Analysis of Impaired Mucosal Immune Response to Candida albicans in Mice Expressing the HIV-1 Transgene

    Directory of Open Access Journals (Sweden)

    Louis de Repentigny

    2015-06-01

    Full Text Available IL-17-producing Th17 cells are of critical importance in host defense against oropharyngeal candidiasis (OPC. Speculation about defective Th17 responses to oral C. albicans infection in the context of HIV infection prompted an investigation of innate and adaptive immune responses to Candida albicans in transgenic mice expressing the genome of HIV-1 in immune cells and displaying an AIDS-like disease. Defective IL-17 and IL-22-dependent mucosal responses to C. albicans were found to determine susceptibility to OPC in these transgenic mice. Innate phagocytes were quantitatively and functionally intact, and individually dispensable for control of OPC and to prevent systemic dissemination of Candida to deep organs. CD8+ T-cells recruited to the oral mucosa of the transgenic mice limited the proliferation of C. albicans in these conditions of CD4+ T-cell deficiency. Therefore, the immunopathogenesis of OPC in the context of HIV infection involves defective T-cell-mediated immunity, failure of crosstalk with innate mucosal immune effector mechanisms, and compensatory cell responses, which limit Candida infection to the oral mucosa and prevent systemic dissemination.

  4. Effects of the oral administration of the exopolysaccharide produced by Lactobacillus kefiranofaciens on the gut mucosal immunity.

    Science.gov (United States)

    Vinderola, Gabriel; Perdigón, Gabriela; Duarte, Jairo; Farnworth, Edward; Matar, Chantal

    2006-12-01

    IL-10+, IL-6+ and IL-12+ cells, the values found were slightly increased compared to control values, while IFNgamma+ and TNFalpha+ cells did not change compared to control values. The effects observed on immunoglobulins and in all the cytokines assayed in the large intestine after kefiran administration were of greater magnitude than the ones observed in the small intestine lamina propria, which may be due to the saccharolytic action of the colonic microflora. In the intestinal fluid, only IL-4 and IL-12 increased compared to control values. In blood serum, all the cytokines assayed followed a pattern of production quite similar to the one found for them in the small intestine lamina propria. We observed that the exopolysaccharide induced a gut mucosal response and it was able to up and down regulate it for protective immunity, maintaining intestinal homeostasis, enhancing the IgA production at both the small and large intestine level and influencing the systemic immunity through the cytokines released to the circulating blood.

  5. B cell and T cell immunity in the female genital tract: potential of distinct mucosal routes of vaccination and role of tissue-associated dendritic cells and natural killer cells.

    Science.gov (United States)

    Anjuère, F; Bekri, S; Bihl, F; Braud, V M; Cuburu, N; Czerkinsky, C; Hervouet, C; Luci, C

    2012-10-01

    The female genital mucosa constitutes the major port of entry of sexually transmitted infections. Most genital microbial pathogens represent an enormous challenge for developing vaccines that can induce genital immunity that will prevent their transmission. It is now established that long-lasting protective immunity at mucosal surfaces has to involve local B-cell and T-cell effectors as well as local memory cells. Mucosal immunization constitutes an attractive way to generate systemic and genital B-cell and T-cell immune responses that can control early infection by sexually transmitted pathogens. Nevertheless, no mucosal vaccines against sexually transmitted infections are approved for human use. The mucosa-associated immune system is highly compartmentalized and the selection of any particular route or combinations of routes of immunization is critical when defining vaccine strategies against genital infections. Furthermore, mucosal surfaces are complex immunocompetent tissues that comprise antigen-presenting cells and also innate immune effectors and non-immune cells that can act as 'natural adjuvants' or negative immune modulators. The functions of these cells have to be taken into account when designing tissue-specific antigen-delivery systems and adjuvants. Here, we will discuss data that compare different mucosal routes of immunization to generate B-cell and T-cell responses in the genital tract, with a special emphasis on the newly described sublingual route of immunization. We will also summarize data on the understanding of the effector and induction mechanisms of genital immunity that may influence the development of vaccine strategies against genital infections. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  6. Impact of removing mucosal barrier injury laboratory-confirmed bloodstream infections from central line-associated bloodstream infection rates in the National Healthcare Safety Network, 2014.

    Science.gov (United States)

    See, Isaac; Soe, Minn M; Epstein, Lauren; Edwards, Jonathan R; Magill, Shelley S; Thompson, Nicola D

    2017-03-01

    Central line-associated bloodstream infection (CLABSI) event data reported to the National Healthcare Safety Network from 2014, the first year of required use of the mucosal barrier injury laboratory-confirmed bloodstream infection (MBI-LCBI) definition, were analyzed to assess the impact of removing MBI-LCBI events from CLABSI rates. CLABSI rates decreased significantly in some location types after removing MBI-LCBI events, and MBI-LCBI events will be removed from publicly reported CLABSI rates. Published by Elsevier Inc.

  7. Mucosal Expression of Type 2 and Type 17 Immune Response Genes Distinguishes Ulcerative Colitis From Colon-Only Crohn's Disease in Treatment-Naive Pediatric Patients.

    Science.gov (United States)

    Rosen, Michael J; Karns, Rebekah; Vallance, Jefferson E; Bezold, Ramona; Waddell, Amanda; Collins, Margaret H; Haberman, Yael; Minar, Phillip; Baldassano, Robert N; Hyams, Jeffrey S; Baker, Susan S; Kellermayer, Richard; Noe, Joshua D; Griffiths, Anne M; Rosh, Joel R; Crandall, Wallace V; Heyman, Melvin B; Mack, David R; Kappelman, Michael D; Markowitz, James; Moulton, Dedrick E; Leleiko, Neal S; Walters, Thomas D; Kugathasan, Subra; Wilson, Keith T; Hogan, Simon P; Denson, Lee A

    2017-05-01

    There is controversy regarding the role of the type 2 immune response in the pathogenesis of ulcerative colitis (UC)-few data are available from treatment-naive patients. We investigated whether genes associated with a type 2 immune response in the intestinal mucosa are up-regulated in treatment-naive pediatric patients with UC compared with patients with Crohn's disease (CD)-associated colitis or without inflammatory bowel disease (IBD), and whether expression levels are associated with clinical outcomes. We used a real-time reverse-transcription quantitative polymerase chain reaction array to analyze messenger RNA (mRNA) expression patterns in rectal mucosal samples from 138 treatment-naive pediatric patients with IBD and macroscopic rectal disease, as well as those from 49 children without IBD (controls), enrolled in a multicenter prospective observational study from 2008 to 2012. Results were validated in real-time reverse-transcription quantitative polymerase chain reaction analyses of rectal RNA from an independent cohort of 34 pediatric patients with IBD and macroscopic rectal disease and 17 controls from Cincinnati Children's Hospital Medical Center. We measured significant increases in mRNAs associated with a type 2 immune response (interleukin [IL]5 gene, IL13, and IL13RA2) and a type 17 immune response (IL17A and IL23) in mucosal samples from patients with UC compared with patients with colon-only CD. In a regression model, increased expression of IL5 and IL17A mRNAs distinguished patients with UC from patients with colon-only CD (P = .001; area under the receiver operating characteristic curve, 0.72). We identified a gene expression pattern in rectal tissues of patients with UC, characterized by detection of IL13 mRNA, that predicted clinical response to therapy after 6 months (odds ratio [OR], 6.469; 95% confidence interval [CI], 1.553-26.94), clinical response after 12 months (OR, 6.125; 95% CI, 1.330-28.22), and remission after 12 months (OR, 5

  8. Planning and Implementing Immunization Billing Programs at State and Local Health Departments: Barriers and Possible Solutions.

    Science.gov (United States)

    Corriero, Rosemary; Redmon, Ginger

    Before participating in a project funded by the Centers for Disease Control and Prevention, most state and local health departments (LHDs) were not seeking reimbursement or being fully reimbursed by insurance plans for the cost of immunization services (including vaccine costs and administration fees) they provided to insured patients. Centers for Disease Control and Prevention's Billables Project was designed to enable state and LHDs to bill public and private insurance plans for immunization services provided to insured patients. Identify and describe key barriers state and LHDs may encounter while planning and implementing a billing program, as well as possible solutions for overcoming those barriers. This study used reports from Billables Project participants to explore barriers they encountered when planning and implementing a billing program and steps taken to address those barriers. Thirty-eight state immunization programs. Based on project participants' reports, barriers were noted in 7 categories: (1) funding and costs, (2) staff, (3) health department characteristics, (4) third-party payers and insurance plans, (5) software, (6) patient insurance status, and (7) other barriers. Possible solutions for overcoming those barriers included hiring or seeking external help, creating billing guides and training modules, streamlining workflows, and modifying existing software systems. Overcoming barriers during planning and implementation of a billing program can be challenging for state and LHDs, but the experiences and suggestions of past Billables Project participants can help guide future billing program efforts.

  9. Co-administration of Bacillus subtilis RJGP16 and Lactobacillus salivarius B1 strongly enhances the intestinal mucosal immunity of piglets.

    Science.gov (United States)

    Deng, Jun; Li, Yunfeng; Zhang, Jinhua; Yang, Qian

    2013-02-01

    Probiotics, including Bacillus spp. and Lactobacillus, are potential replacements for low dose in-feed antibiotics for pig. This study aimed to evaluate the effect of the co-administration of Bacillus subtilis RJGP16 and Lactobacillus salivarius B1 as potential probiotics to stimulate local immune responses. Thirty two newborn piglets were divided into four groups and orally administrated with different combination of probiotics (none; RJGP16; B1; RJGP16 and B1) at the age of 0, 7 and 11 days. We analysed the parameters of the mucosal immunity of piglets a week after weaning. Our results showed that the gene expression of interleukin (IL)-6 in the duodenum and ileum, porcine beta-defensins (pBD)-2 in the duodenum were significantly increased (p<0.01) with co-administration of the RJGP16 and B1. Also the expression and release of TLR-2 and the number of immunoglobulin (Ig) A producing cells were increased (p<0.01). The results demonstrate that the co-administration of the two bacteria stimulate a more intense mucosal immunity than the administration of each bacterium alone. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Mucosal immunity induced by adenovirus-based H5N1 HPAI vaccine confers protection against a lethal H5N2 avian influenza virus challenge

    International Nuclear Information System (INIS)

    Park, Ki Seok; Lee, Jiyeung; Ahn, So Shin; Byun, Young-Ho; Seong, Baik Lin; Baek, Yun Hee; Song, Min-Suk; Choi, Young Ki; Na, Yun Jeong; Hwang, Inhwan; Sung, Young Chul; Lee, Chang Geun

    2009-01-01

    Development of effective vaccines against highly pathogenic avian influenza (HPAI) H5N1 viruses is a global public health priority. Considering the difficulty in predicting HPAI H5N1 pandemic strains, one strategy used in their design includes the development of formulations with the capacity of eliciting broad cross-protective immunity against multiple viral antigens. To this end we constructed a replication-defective recombinant adenovirus-based avian influenza virus vaccine (rAdv-AI) expressing the codon-optimized M2eX-HA-hCD40L and the M1-M2 fusion genes from HPAI H5N1 human isolate. Although there were no significant differences in the systemic immune responses observed between the intramuscular prime-intramuscular boost regimen (IM/IM) and the intranasal prime-intramuscular boost regimen (IN/IM), IN/IM induced more potent CD8 + T cell and antibody responses at mucosal sites than the IM/IM vaccination, resulting in more effective protection against lethal H5N2 avian influenza (AI) virus challenge. These findings suggest that the strategies used to induce multi-antigen-targeted mucosal immunity, such as IN/IM delivery of rAdv-AI, may be a promising approach for developing broad protective vaccines that may be more effective against the new HPAI pandemic strains.

  11. Changes in intestinal fluid and mucosal immune responses to cholera toxin in Giardia muris infection and binding of cholera toxin to Giardia muris trophozoites.

    Science.gov (United States)

    Ljungström, I; Holmgren, J; Svennerholm, A M; Ferrante, A

    1985-10-01

    The effect of Giardia muris infection on the diarrheal response and gut mucosal antibody response to cholera toxin was examined in mice. The results obtained showed that the fluid accumulation in intestinal loops exposed to cholera toxin was increased in mice infected with a low number (5 X 10(4) ) of G. muris cysts compared with the response in noninfected mice. This effect was associated with a marked reduction in absorption of oral rehydration fluid from the intestine. In contrast, mice infected with a high dose (2 X 10(5) ) of cysts showed a marked decrease in fluid accumulation in response to the toxin. This decrease might be related to the finding that both G. muris and Giardia lamblia trophozoites can bind significant amounts of cholera toxin. Evidence is presented which suggests that the gut mucosal antibody response, mainly immunoglobulin A but also immunoglobulin G, to an immunization course with perorally administered cholera toxin was depressed in mice infected with G. muris. The reduction in antibody levels was particularly evident when the primary immunization was made very early after infection. The serum antitoxin antibodies to the oral immunization with cholera toxin were, however, not affected. Likewise, the delayed-type hypersensitivity response against sheep erythrocytes in animals primed subcutaneously with sheep erythrocytes was not modified during the course of G. muris infection.

  12. The Mucosal Immune Function Is Not Compromised during a Period of High-Intensity Interval Training. Is It Time to Reconsider an Old Assumption?

    Science.gov (United States)

    Born, Dennis-Peter; Zinner, Christoph; Sperlich, Billy

    2017-01-01

    Purpose: The aim of the study was to evaluate the mucosal immune function and circadian variation of salivary cortisol, Immunoglobin-A (sIgA) secretion rate and mood during a period of high-intensity interval training (HIIT) compared to long-slow distance training (LSD). Methods: Recreational male runners (n = 28) completed nine sessions of either HIIT or LSD within 3 weeks. The HIIT involved 4 × 4 min of running at 90–95% of maximum heart rate interspersed with 3 min of active recovery while the LSD comprised of continuous running at 70–75% of maximum heart rate for 60–80 min. The psycho-immunological stress-response was investigated with a full daily profile of salivary cortisol and immunoglobin-A (sIgA) secretion rate along with the mood state on a baseline day, the first and last day of training and at follow-up 4 days after the last day of training. Before and after the training period, each athlete's running performance and peak oxygen uptake (V·O2peak) was determined with an incremental exercise test. Results: The HIIT resulted in a longer time-to-exhaustion (P = 0.02) and increased V·O2peak compared to LSD (P = 0.01). The circadian variation of sIgA secretion rate showed highest values in the morning immediately after waking up followed by a decrease throughout the day in both groups (P HIIT, the wake-up response of sIgA secretion rate was higher on the last day of training (P HIIT and LSD (P HIIT indicates no compromised mucosal immune function compared to LSD and shows the functional adaptation of the mucosal immune system in response to the increased stress and training load of nine sessions of HIIT. PMID:28744226

  13. Antibody classes & subclasses induced by mucosal immunization of mice with Streptococcus pyogenes M6 protein & oligodeoxynucleotides containing CpG motifs.

    Science.gov (United States)

    Teloni, R; von Hunolstein, C; Mariotti, S; Donati, S; Orefici, G; Nisini, R

    2004-05-01

    Type-specific antibodies against M protein are critical for human protection as they enhance phagocytosis and are protective. An ideal vaccine for the protection against Streptococcus pyogenes would warrant mucosal immunity, but mucosally administered M-protein has been shown to be poorly immunogenic in animals. We used a recombinant M type 6 protein to immunize mice in the presence of synthetic oligodeoxynucleotides containing CpG motifs (immunostimulatory sequences: ISS) or cholera toxin (CT) to explore its possible usage in a mucosal vaccine. Mice were immunized by intranasal (in) or intradermal (id) administration with four doses at weekly intervals of M6-protein (10 microg/mouse) with or without adjuvant (ISS, 10 microg/mouse or CT, 0,5 microg/mouse). M6 specific antibodies were measured by enzyme linked immunosorbent assay using class and subclass specific monoclonal antibodies. The use of ISS induced an impressive anti M-protein serum IgG response but when id administered was not detectable in the absence of adjuvant. When used in, M-protein in the presence of both ISS and CT induced anti M-protein IgA in the bronchoalveolar lavage, as well as specific IgG in the serum. IgG were able to react with serotype M6 strains of S. pyogenes. The level of antibodies obtained by immunizing mice in with M-protein and CT was higher in comparison to M-protein and ISS. The analysis of anti-M protein specific IgG subclasses showed high levels of IgG1, IgG2a and IgG2b, and low levels of IgG3 when ISS were used as adjuvant. Thus, in the presence of ISS, the ratio IgG2a/IgG1 and (IgG2a+IgG3)/IgG1 >1 indicated a type 1-like response obtained both in mucosally or systemically vaccinated mice. Our study offers a reproducible model of anti-M protein vaccination that could be applied to test new antigenic formulations to induce an anti-group A Streptococcus (GAS) vaccination suitable for protection against the different diseases caused by this bacterium.

  14. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Science.gov (United States)

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  15. Bacterium-like Particles for efficient immune stimulation of existing vaccines and new subunit vaccines in mucosal applications

    Directory of Open Access Journals (Sweden)

    Natalija eVan Braeckel-Budimir

    2013-09-01

    Full Text Available The successful development of a mucosal vaccine critically depends on the use of a safe and effective immunostimulant and/or carrier system. This review describes the effectiveness and mode of action of an immunostimulating particle derived from bacteria in mucosal subunit vaccines. The non-living particles, designated Bacterium-like Particles (BLPs are based on the food-grade bacterium Lactococcus lactis. The focus of the overview is on the development of intranasal BLP-based vaccines to prevent diseases caused by influenza and respiratory syncytial virus, and includes a selection of Phase I clinical data for the intranasal FluGEM vaccine.

  16. Barriers to the use of reminder/recall interventions for immunizations: a systematic review

    Directory of Open Access Journals (Sweden)

    Pereira Jennifer A

    2012-12-01

    Full Text Available Abstract Background Although many studies have demonstrated the benefits of reminder/recall (RR measures to address patient under-immunization and improve immunization coverage, they are not widely implemented by healthcare providers. We identified providers’ perceived barriers to their use from existing literature. Methods We conducted a systematic review of relevant articles published in English between January 1990 and July 2011 that examined the perceptions of healthcare providers regarding barriers to tracking patient immunization history and implementing RR interventions. We searched MEDLINE, PubMed, EMBASE, Cumulative Index to Nursing and Allied Health Literature, Academic Search Premier, and PsychINFO. Additional strategies included hand-searching the references of pertinent articles and related reviews, and searching keywords in Google Scholar and Google. Results Ten articles were included; all described populations in the United States, and examined perceptions of family physicians, pediatricians, and other immunization staff. All articles were of moderate-high methodological quality; the majority (n=7 employed survey methodology. The most frequently described barriers involved the perceived human and financial resources associated with implementing an RR intervention, as well as low confidence in the accuracy of patient immunization records, given the lack of data sharing between multiple immunization providers. Changes to staff workflow, lack of appropriate electronic patient-tracking functionalities, and uncertainty regarding the success of RR interventions were also viewed as barriers to their adoption. Conclusions Although transitioning to electronic immunization records and registries should facilitate the implementation of RR interventions, numerous perceived barriers must still be overcome before the full benefits of these methods can be realized.

  17. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  18. Colonization and effector functions of innate lymphoid cells in mucosal tissues.

    Science.gov (United States)

    Kim, Myunghoo; Kim, Chang H

    2016-10-01

    Innate lymphoid cells (ILCs) protect mucosal barrier tissues to fight infection and maintain tissue integrity. ILCs and their progenitors are developmentally programmed to migrate, differentiate and populate various mucosal tissues and associated lymphoid tissues. Functionally mature ILC subsets respond to diverse pathogens such as bacteria, viruses, fungi and parasites in subset-specific manners. In this review, we will discuss how ILCs populate mucosal tissues and regulate immune responses to distinct pathogens to protect the host and maintain tissue integrity. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  19. Understanding the main barriers to immunization in Colombia to better tailor communication strategies.

    Science.gov (United States)

    García L, Diego Alejandro; Velandia-González, Martha; Trumbo, Silas Pierson; Pedreira, M Cristina; Bravo-Alcántara, Pamela; Danovaro-Holliday, M Carolina

    2014-06-30

    The Expanded Program on Immunization (EPI) in Colombia has made great advances since its inception in 1979; however, by 2010 vaccination coverage rates had been declining. In 2010, the EPI commissioned a nationwide study on practices on immunization, attitudes and knowledge, perceived service quality, and barriers to childhood immunization in order to tailor EPI communication strategies. Colombia's 32 geographical departments were divided into 10 regions. Interviewers from an independent polling company administered a survey to 4802 parents and guardians of children aged communication preferences, and parental attitudes on vaccination. Although all respondents indicated that vaccines have health benefits, and 4738 (98.7%) possessed vaccination cards for their children, attitudes and knowledge were not always favorable to immunization. Six groups of immunization barriers were identified: 1) factors related to caregivers (24.4%), 2) vaccinators (19.7%), 3) health centers (18.0%), 4) the health system (13.4%), 5) concerns about adverse events (13.1%), and 6) cultural and religious beliefs (11.4%); groups 1, 5 and 6 together represented almost half (48.9%) of users, indicating problems related to the demand for vaccines as the primary barriers to immunization. Differences in demographics, communication preferences, and reported service quality were found among participants in the six groups and among participants in the 10 regions. Additionally, differences between how participants reported receiving information on vaccination and how they believed such information should be communicated were observed. Better understanding immunization barriers and the users of the EPI can help tailor communication strategies to increase demand for immunization services. Results of the study have been used by Colombia's EPI to inform the design of new communication strategies.

  20. Muslim Scholars' Knowledge, Attitudes and Perceived Barriers Towards Polio Immunization in Pakistan.

    Science.gov (United States)

    Khan, Muhammad Umair; Ahmad, Akram; Salman, Saad; Ayub, Maria; Aqeel, Talieha; Haq, Noman-Ul; Saleem, Fahad; Khan, Muhammad Ubaid

    2017-04-01

    Pakistan is one of the two countries where polio remains endemic. Among multiple reasons of polio prevalence, false religious beliefs are accounted as major barriers towards polio immunization in Pakistan. Within this context, religious scholars are now engaged in polio immunization campaigns to dismantle the myths and battle the resurgence of polio in Pakistan. The objective of this study was to assess knowledge, attitudes and perceived barriers of Muslim scholars towards polio immunization in Pakistan. A descriptive, cross-sectional survey of Muslim scholars was conducted in Quetta and Peshawar divisions of Pakistan. From October to December 2015, a convenience sample of 770 Muslim scholars was recruited from the local mosques and religious institutions to participate in this study. Knowledge, attitudes, and perceived barriers were assessed by using self-administered, anonymous and pretested questionnaire. Descriptive and regression analyses were used to express the results with p polio with a mean score of 7.16 ± 2.12 (based on 14 questions). Knowledge gaps were identified about the transmission (32.6 %) and consequences of poliovirus (39.9 %). Overall, 527 (68.4 %) participants showed positive attitudes towards polio immunization with a mean attitude score of 27.35 ± 2.68 (based on nine statements). The majority of participants agreed on the need of depoliticizing polio immunization issues (87.1 %), while reservations were noted about their willingness to participate in future polio immunization programs (44.6 %). Security (75.8 %) and vaccine management issues (64 %) were reported by the participants as the major barriers towards polio immunization in Pakistan. The findings showed poor knowledge of Muslim scholars towards polio; however, their attitudes were positive towards polio immunization. More studies are required to assess the knowledge and attitudes of Muslim scholars at the national level to validate the findings of this study.

  1. Noninvasive Sampling of Mucosal Lining Fluid for the Quantification of In Vivo Upper Airway Immune-mediator Levels

    DEFF Research Database (Denmark)

    Wolsk, Helene Mygind; Chawes, Bo L.; Thorsen, Jonathan

    2017-01-01

    (often used by other techniques). The mucosal lining fluid is sampled on a strip of filter paper placed at the anterior part of the inferior turbinate and left for 2 min of absorption. Analytes are eluted from the filter papers, and the extracted protein-based eluates are analyzed...

  2. A novel non-toxic combined CTA1-DD and ISCOMS adjuvant vector for effective mucosal immunization against influenza virus.

    Science.gov (United States)

    Eliasson, Dubravka Grdic; Helgeby, Anja; Schön, Karin; Nygren, Caroline; El-Bakkouri, Karim; Fiers, Walter; Saelens, Xavier; Lövgren, Karin Bengtsson; Nyström, Ida; Lycke, Nils Y

    2011-05-23

    Here we demonstrate that by using non-toxic fractions of saponin combined with CTA1-DD we can achieve a safe and above all highly efficacious mucosal adjuvant vector. We optimized the construction, tested the requirements for function and evaluated proof-of-concept in an influenza A virus challenge model. We demonstrated that the CTA1-3M2e-DD/ISCOMS vector provided 100% protection against mortality and greatly reduced morbidity in the mouse model. The immunogenicity of the vector was superior to other vaccine formulations using the ISCOM or CTA1-DD adjuvants alone. The versatility of the vector was best exemplified by the many options to insert, incorporate or admix vaccine antigens with the vector. Furthermore, the CTA1-3M2e-DD/ISCOMS could be kept 1 year at 4°C or as a freeze-dried powder without affecting immunogenicity or adjuvanticity of the vector. Strong serum IgG and mucosal IgA responses were elicited and CD4 T cell responses were greatly enhanced after intranasal administration of the combined vector. Together these findings hold promise for the combined vector as a mucosal vaccine against influenza virus infections including pandemic influenza. The CTA1-DD/ISCOMS technology represents a breakthrough in mucosal vaccine vector design which successfully combines immunomodulation and targeting in a safe and stable particulate formation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Inactivated Eyedrop Influenza Vaccine Adjuvanted with Poly(I:C Is Safe and Effective for Inducing Protective Systemic and Mucosal Immunity.

    Directory of Open Access Journals (Sweden)

    Eun-Do Kim

    Full Text Available The eye route has been evaluated as an efficient vaccine delivery routes. However, in order to induce sufficient antibody production with inactivated vaccine, testing of the safety and efficacy of the use of inactivated antigen plus adjuvant is needed. Here, we assessed various types of adjuvants in eyedrop as an anti-influenza serum and mucosal Ab production-enhancer in BALB/c mice. Among the adjuvants, poly (I:C showed as much enhancement in antigen-specific serum IgG and mucosal IgA antibody production as cholera toxin (CT after vaccinations with trivalent hemagglutinin-subunits or split H1N1 vaccine antigen in mice. Vaccination with split H1N1 eyedrop vaccine antigen plus poly(I:C showed a similar or slightly lower efficacy in inducing antibody production than intranasal vaccination; the eyedrop vaccine-induced immunity was enough to protect mice from lethal homologous influenza A/California/04/09 (H1N1 virus challenge. Additionally, ocular inoculation with poly(I:C plus vaccine antigen generated no signs of inflammation within 24 hours: no increases in the mRNA expression levels of inflammatory cytokines nor in the infiltration of mononuclear cells to administration sites. In contrast, CT administration induced increased expression of IL-6 cytokine mRNA and mononuclear cell infiltration in the conjunctiva within 24 hours of vaccination. Moreover, inoculated visualizing materials by eyedrop did not contaminate the surface of the olfactory bulb in mice; meanwhile, intranasally administered materials defiled the surface of the brain. On the basis of these findings, we propose that the use of eyedrop inactivated influenza vaccine plus poly(I:C is a safe and effective mucosal vaccine strategy for inducing protective anti-influenza immunity.

  4. Mucosal immunization with PLGA-microencapsulated DNA primes a SIV-specific CTL response revealed by boosting with cognate recombinant modified vaccinia virus Ankara

    International Nuclear Information System (INIS)

    Sharpe, Sally; Hanke, Tomas; Tinsley-Bown, Anne; Dennis, Mike; Dowall, Stuart; McMichael, Andrew; Cranage, Martin

    2003-01-01

    Systemically administered DNA encoding a recombinant human immunodeficiency virus (HIV) derived immunogen effectively primes a cytotoxic T lymphocyte (CTL) response in macaques. In this further pilot study we have evaluated mucosal delivery of DNA as an alternative priming strategy. Plasmid DNA, pTH.HW, encoding a multi-CTL epitope gene, was incorporated into poly(D,L-lactic-co-glycolic acid) microparticles of less than 10 μm in diameter. Five intrarectal immunizations failed to stimulate a circulating vaccine-specific CTL response in 2 Mamu-A*01 + rhesus macaques. However, 1 week after intradermal immunization with a cognate modified vaccinia virus Ankara vaccine MVA.HW, CTL responses were detected in both animals that persisted until analysis postmortem, 12 weeks after the final boost. In contrast, a weaker and less durable response was seen in an animal vaccinated with the MVA construct alone. Analysis of lymphoid tissues revealed a disseminated CTL response in peripheral and regional lymph nodes but not the spleen of both mucosally primed animals

  5. Lactose intolerance in irritable bowel syndrome patients with diarrhoea: the roles of anxiety, activation of the innate mucosal immune system and visceral sensitivity.

    Science.gov (United States)

    Yang, J; Fox, M; Cong, Y; Chu, H; Zheng, X; Long, Y; Fried, M; Dai, N

    2014-02-01

    Irritable bowel syndrome patients with diarrhoea (IBS-D) often report intolerance to milk; however, the mechanism underlying these symptoms is unknown. To assess the role of psychological factors, immune activation and visceral sensitivity on the development of lactose intolerance (LI) in IBS-D patients. Fifty-five IBS-D patients and 18 healthy controls (HCs) with lactase deficiency underwent a 20-g lactose hydrogen breath test (LHBT). Patients were categorised as lactose malabsorption (LM; malabsorption only) or LI [malabsorption plus increase in total symptom score (TSS). Measurements included (i) psychological status; (ii) enteric biopsies with quantification of mast cells (MCs), T-lymphocytes and enterochromaffin cells; (iii) serum cytokines; (iv) rectal sensitivity before and after lactose ingestion. LI was more prevalent in IBS-D patients than HCs [25/55 (46%) vs. 3/18 (17%), P = 0.029]. IBS-D patients with LI had (i) higher levels of anxiety than those with LM (P = 0.017) or HCs (P = 0.006); (ii) increased mucosal MCs compared with LM (P = 0.006) and HCs (P lactose ingestion compared with LM (P lactose ingestion was associated with the increase in visceral sensitivity after lactose intake (r = 0.629, P lactose intolerence are characterised by anxiety, mucosal immune activation and increased visceral sensitivity after lactose ingestion. The presence of these biomarkers may indicate an IBS phenotype that responds to dietary therapy and/or mast cell stabilisers. © 2013 John Wiley & Sons Ltd.

  6. The impact of a 17-day training period for an international championship on mucosal immune parameters in top-level basketball players and staff members.

    Science.gov (United States)

    Moreira, Alexandre; Arsati, Franco; Cury, Patrícia Ramos; Franciscon, Clóvis; Simões, Antonio Carlos; de Oliveira, Paulo Roberto; de Araújo, Vera Cavalcanti

    2008-10-01

    This investigation examined the impact of a 17-d training period (that included basketball-specific training, sprints, intermittent running exercises, and weight training, prior to an international championship competition) on salivary immunoglobulin A (SIgA) levels in 10 subjects (athletes and staff members) from a national basketball team, as a biomarker for mucosal immune defence. Unstimulated saliva samples were collected at rest at the beginning of the preparation for the Pan American Games and 1 d before the first game. The recovery interval from the last bout of exercise was 4 h. The SIgA level was measured using enzyme-linked immunosorbent assay and expressed as absolute concentrations, secretion rate, and SIgA level relative to total protein. The decrease in SIgA levels following training was greater in athletes than in support staff; however, no significant differences between the two groups were detected. A decrease in SIgA level, regardless of the method used to express IgA results, was verified for athletes. Only one episode of upper respiratory tract illness symptoms was reported, and it was not associated with changes in SIgA levels. In summary, a situation of combined stress for an important championship was found to decrease the level of SIgA-mediated immune protection at the mucosal surface in team members, with greater changes observed in the athletes.

  7. Targeted Delivery of GP5 Antigen of PRRSV to M Cells Enhances the Antigen-Specific Systemic and Mucosal Immune Responses

    Directory of Open Access Journals (Sweden)

    Luping Du

    2018-01-01

    Full Text Available Efficient delivery of antigens through oral immunization is a first and critical step for successful induction of mucosal immunity, which can provide protection against pathogens invading the mucosa. Membranous/microfold cells (M cells within the mucosa can transcytose internalized antigen without degradation and thus play an important role in initiating antigen-specific mucosal immune responses through inducing secretory IgA production. In this research, we modified poly (D, L-lactide-co-glycolide (PLGA nanoparticles (NPs with Ulex europaeus agglutinin 1 (UEA-1 and successfully prepared an oral vaccine delivery system, UEA-1/PLGA NPs. PLGA NPs were prepared using a standard double emulsion solvent evaporation technique, which can protect the entrapped PRRSV DNA vaccine [pcDNA3.1-SynORF5 (synthetic ORF5] or subunit vaccine ORF5-encoded glycoprotein (GP5 from exposure to the gastrointestinal (GI tract and release the plasmids in a controlled manner. With UEA-1 modification, the UEA-1/PLGA NPs can be effectively transported by M-cells. We investigated immune response induced by UEA-1/PLGA-SynORF5 or UEA-1/PLGA-GP5 following inoculation in mice and piglets. Compared with PLGA-SynORF5 or PLGA-GP5 NPs, UEA-1/PLGA-SynORF5, or UEA-1/PLGA-GP5 NPs stimulated significantly increased serum IgG levels and augmented intestinal IgA levels in mice and piglets (P < 0.05. Our findings indicate UEA-1/PLGA NPs can be applied as a promising and universally robust oral vaccine delivery system.

  8. Targeted Delivery of GP5 Antigen of PRRSV to M Cells Enhances the Antigen-Specific Systemic and Mucosal Immune Responses

    Science.gov (United States)

    Du, Luping; Yu, Zhengyu; Pang, Fengjiao; Xu, Xiangwei; Mao, Aihua; Yuan, Wanzhe; He, Kongwang; Li, Bin

    2018-01-01

    Efficient delivery of antigens through oral immunization is a first and critical step for successful induction of mucosal immunity, which can provide protection against pathogens invading the mucosa. Membranous/microfold cells (M cells) within the mucosa can transcytose internalized antigen without degradation and thus play an important role in initiating antigen-specific mucosal immune responses through inducing secretory IgA production. In this research, we modified poly (D, L-lactide-co-glycolide) (PLGA) nanoparticles (NPs) with Ulex europaeus agglutinin 1 (UEA-1) and successfully prepared an oral vaccine delivery system, UEA-1/PLGA NPs. PLGA NPs were prepared using a standard double emulsion solvent evaporation technique, which can protect the entrapped PRRSV DNA vaccine [pcDNA3.1-SynORF5 (synthetic ORF5)] or subunit vaccine ORF5-encoded glycoprotein (GP5) from exposure to the gastrointestinal (GI) tract and release the plasmids in a controlled manner. With UEA-1 modification, the UEA-1/PLGA NPs can be effectively transported by M-cells. We investigated immune response induced by UEA-1/PLGA-SynORF5 or UEA-1/PLGA-GP5 following inoculation in mice and piglets. Compared with PLGA-SynORF5 or PLGA-GP5 NPs, UEA-1/PLGA-SynORF5, or UEA-1/PLGA-GP5 NPs stimulated significantly increased serum IgG levels and augmented intestinal IgA levels in mice and piglets (P < 0.05). Our findings indicate UEA-1/PLGA NPs can be applied as a promising and universally robust oral vaccine delivery system. PMID:29423381

  9. Mucosal IgA Responses: Damaged in Established HIV Infection—Yet, Effective Weapon against HIV Transmission

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    2017-11-01

    Full Text Available HIV infection not only destroys CD4+ T cells but also inflicts serious damage to the B-cell compartment, such as lymphadenopathy, destruction of normal B-cell follicle architecture, polyclonal hypergammaglobulinemia, increased apoptosis of B cells, and irreversible loss of memory B-cell responses with advanced HIV disease. Subepithelial B cells and plasma cells are also affected, which results in loss of mucosal IgG and IgA antibodies. This leaves the mucosal barrier vulnerable to bacterial translocation. The ensuing immune activation in mucosal tissues adds fuel to the fire of local HIV replication. We postulate that compromised mucosal antibody defenses also facilitate superinfection of HIV-positive individuals with new HIV strains. This in turn sets the stage for the generation of circulating recombinant forms of HIV. What can the mucosal B-cell compartment contribute to protect a healthy, uninfected host against mucosal HIV transmission? Here, we discuss proof-of-principle studies we have performed using passive mucosal immunization, i.e., topical administration of preformed anti-HIV monoclonal antibodies (mAbs as IgG1, dimeric IgA1 (dIgA1, and dIgA2 isotypes, alone or in combination. Our data indicate that mucosally applied anti-HIV envelope mAbs can provide potent protection against mucosal transmission of simian-human immunodeficiency virus. Our review also discusses the induction of mucosal antibody defenses by active vaccination and potential strategies to interrupt the vicious cycle of bacterial translocation, immune activation, and stimulation of HIV replication in individuals with damaged mucosal barriers.

  10. Effects of Cordyceps militaris spent mushroom substrate on mucosal and serum immune parameters, disease resistance and growth performance of Nile tilapia, (Oreochromis niloticus).

    Science.gov (United States)

    Doan, Hien Van; Hoseinifar, Seyed Hossein; Tapingkae, Wanaporn; Chitmanat, Chanagun; Mekchay, Supamit

    2017-08-01

    The aim of present study was determination effects of dietary administration of C. militaris spent mushroom substrate (SMS) on mucosal and serum immune parameters, disease resistance, and growth performance of Nile tilapia (Oreochromis niloticus). Two hundred twenty five fish of similar weight (37.28 ± 0.10 g) were assigned to the following diets [0 (T1- Control), 5 (T2), 10 (T3), 20 (T4) and 40 g kg -1 (T5) SMS]. After 60 days of feeding trial, growth performance, skin mucus lysozyme and peroxidase activities as well as serum innate immune were measured. In addition, survival rate and innate immune responses were calculated after challenge test (15 days) against Streptococcus agalactiae. The results revealed that regardless of inclusion levels, feeding Nile tilapia with SMS supplemented diets significantly increased skin mucus lysozyme and peroxidase activities as well as serum immune parameters (SL, ACH50, PI, RB, and RB) compared control group (P health status. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Mucosal and Systemic Immune Responses to Influenza H7N9 Antigen HA1-2 Co-Delivered Intranasally with Flagellin or Polyethyleneimine in Mice and Chickens.

    Science.gov (United States)

    Song, Li; Xiong, Dan; Song, Hongqin; Wu, Lili; Zhang, Meihua; Kang, Xilong; Pan, Zhiming; Jiao, Xinan

    2017-01-01

    Consecutive cases of human infection with H7N9 influenza viruses since 2013 in China have prompted efforts to develop an effective treatment. Subunit vaccines introduced by intranasal administration can block an infection at its primary site; flagellin (fliC) and polyethyleneimine (PEI) have been shown to be potent adjuvants. We previously generated the hemagglutinin (HA)1-2-fliC fusion protein consisting of the globular head domain (HA1-2; amino acids 62-284) of HA fused with Salmonella typhimurium fliC. In the present study, we investigated its effectiveness of both flagellin and PEI as mucosal adjuvants for the H7N9 influenza subunit vaccine. Mice immunized intranasally with HA1-2-fliC and HA1-2-PEI showed higher HA1-2-specific immunoglobulin (Ig)G and IgA titers in serum, nasal wash, and bronchial alveolar lavage fluid. Moreover, splenocyte activation and proliferation and the number of HA1-2-specific interferon (IFN)-γ- and interleukin (IL)-4-producing splenocytes were markedly increased in the fliC and PEI groups; in the latter, there were more cells secreting IL-4 than IFN-γ, suggesting that fliC induced T helper type (Th)1 and Th2 immune responses, and PEI induced Th2-biased responses, consistent with the serum antibody isotype pattern (IgG1/IgG2a ratio). Furthermore, virus challenge was performed in a chicken model. The results showed that chickens receiving fliC and PEI adjuvant vaccine exhibited robust immune responses leading to a significant reduction in viral loads of throat and cloaca compared to chickens receiving only HA1-2. These findings provide a basis for the development of H7N9 influenza HA1-2 mucosal subunit vaccines.

  12. Protein-coated nanoparticles are internalized by the epithelial cells of the female reproductive tract and induce systemic and mucosal immune responses.

    Directory of Open Access Journals (Sweden)

    Savannah E Howe

    Full Text Available The female reproductive tract (FRT includes the oviducts (fallopian tubes, uterus, cervix and vagina. A layer of columnar epithelium separates the endocervix and uterus from the outside environment, while the vagina is lined with stratified squamous epithelium. The mucosa of the FRT is exposed to antigens originating from microflora, and occasionally from infectious microorganisms. Whether epithelial cells (ECs of the FRT take up (sample the lumen antigens is not known. To address this question, we examined the uptake of 20-40 nm nanoparticles (NPs applied vaginally to mice which were not treated with hormones, epithelial disruptors, or adjuvants. We found that 20 and 40 nm NPs are quickly internalized by ECs of the upper FRT and within one hour could be observed in the lymphatic ducts that drain the FRT, as well as in the ileac lymph nodes (ILNs and the mesenteric lymph nodes (MLNs. Chicken ovalbumin (Ova conjugated to 20 nm NPs (NP-Ova when administered vaginally reaches the internal milieu in an immunologically relevant form; thus vaginal immunization of mice with NP-Ova induces systemic IgG to Ova antigen. Most importantly, vaginal immunization primes the intestinal mucosa for secretion of sIgA. Sub-cutaneous (s.c boosting immunization with Ova in complete Freund's adjuvant (CFA further elevates the systemic (IgG1 and IgG2c as well as mucosal (IgG1 and sIgA antibody titers. These findings suggest that the modes of antigen uptake at mucosal surfaces and pathways of antigen transport are more complex than previously appreciated.

  13. Corticotropin-releasing hormone and mast cells in the regulation of mucosal barrier function in the human colon.

    Science.gov (United States)

    Wallon, Conny; Söderholm, Johan D

    2009-05-01

    Corticotropin-releasing hormone (CRH) is an important neuro-endocrine mediator of the stress response. Local effects of CRH in the intestinal mucosa have become evident in recent years. We showed that CRH activates CRH receptor subtypes R1 and R2 on subepithelial mast cells, thereby inducing increased transcellular uptake of protein antigens in human colonic biopsies in Ussing chambers. Ongoing studies also implicate local cholinergic signaling in regulation of macromolecular permeability in the human colon. Since increased uptake of antigenic molecules is associated with mucosal inflammation, our findings may have implications for understanding stress-related intestinal disorders.

  14. Mucosal immunization with recombinant adenoviral vectors expressing murine gammaherpesvirus-68 genes M2 and M3 can reduce latent viral load.

    Science.gov (United States)

    Hoegh-Petersen, Mette; Thomsen, Allan R; Christensen, Jan P; Holst, Peter J

    2009-11-12

    Gammaherpesviruses establish life-long latent infections in their hosts. If the host becomes immunosuppressed, these viruses may reactivate and cause severe disease, and even in immunocompetent individuals the gammaherpesviruses are presumed to have an oncogenic potential. Murine gammaherpesvirus-68 (MHV-68) is a member of the Gammaherpesvirinae subfamily and represents a useful murine model for this category of infections, in which new vaccination strategies may initially be evaluated. Two attenuated variants of MHV-68 have successfully been used as vaccines, but the oncogenic potential of the gammaherpesvirinae speaks against using a similar approach in humans. DNA immunization with plasmids encoding the MHV-68 genes M2 or M3 caused a reduction in either acute or early latent viral load, respectively, but neither immunization had an effect at times later than 14 days post-infection. Adenovirus-based vaccines are substantially more immunogenic than DNA vaccines and can be applied to induce mucosal immunity. Here we show that a significant reduction of the late viral load in the spleens, at 60 days post-infection, was achieved when immunizing mice both intranasally and subcutaneously with adenoviral vectors encoding both M2 and M3. Additionally we show that M3 immunization prevented the usual development of virus-induced splenomegaly at 2-3 weeks post-infection. This is the first time that immunization with a non-replicating vaccine has lead to a significantly reduced viral load at time points beyond 14 days post-infection, and thus demonstrates that a non-replicating vaccine may successfully be employed to reduce the viral burden during chronic gammaherpesvirus infection.

  15. Intranasal administration of a therapeutic HIV vaccine (Vacc-4x induces dose-dependent systemic and mucosal immune responses in a randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Kristin Brekke

    Full Text Available Vacc-4x, a Gag p24-based therapeutic HIV vaccine, has been shown to reduce viral load set-points after intradermal administration. In this randomized controlled pilot study we investigate intranasal administration of Vacc-4x with Endocine as adjuvant.Safety and immunogenicity were tested in patients on effective ART. They were randomized to low, medium or high dose Vacc-4x or adjuvant alone, administered four times at weekly intervals with no booster. Vacc-4x-specific T cell responses were measured in vitro by proliferation and in vivo by a single DTH skin test at the end of study. Nasal and rectal mucosal secretions were analyzed for Vacc-4x-specific antibodies by ELISA. Immune regulation induced by Vacc-4x was assessed by functional blockade of the regulatory cytokines IL-10 and TGF-β.Vacc-4x proliferative T cell responses increased only among the vaccinated (p ≤ 0.031. The low dose group showed the greatest increase in Vacc-4x CD8+T cell responses (p = 0.037 and developed larger DTH (p = 0.005 than the adjuvant group. Rectal (distal Vacc-4x IgA and IgG antibodies also increased (p = 0.043 in this group. In contrast, the high dose generated higher nasal (local Vacc-4x IgA (p = 0.028 and serum IgG (p = 0.030 antibodies than the adjuvant. Irrespective of dose, increased Vacc-4x CD4+T cell responses were associated with low proliferation (r = -0.82, p < 0.001 and high regulation (r = 0.61, p = 0.010 at baseline.Intranasal administration of Vacc-4x with Endocine was safe and induced dose-dependent vaccine-specific T cell responses and both mucosal and systemic humoral responses. The clinical significance of dose, immune regulation and mucosal immunity warrants further investigation.ClinicalTrials.gov NCT01473810.

  16. Use of serological and mucosal immune responses to Mycoplasma hyopneumoniae antigens P97R1, P46 and P36 in the diagnosis of infection.

    Science.gov (United States)

    Feng, Zhi-Xin; Bai, Yun; Yao, Jing-Ting; Pharr, G Todd; Wan, Xiu-Feng; Xiao, Shao-Bo; Chi, Ling-Zhi; Gan, Yuan; Wang, Hai-Yan; Wei, Yan-Na; Liu, Mao-Jun; Xiong, Qi-Yan; Bai, Fang-Fang; Li, Bin; Wu, Xu-Su; Shao, Guo-Qing

    2014-10-01

    Currently available ELISAs used to diagnose Mycoplasma hyopneumoniae infection in pigs have high specificity but low sensitivity. To develop more sensitive assays, the kinetics of specific serum IgG and respiratory mucosal sIgA responses against three M. hyopneumoniae antigens, namely, P97R1 (an adhesin protein), P46 (a membrane protein), and P36 (a cytosolic protein), were characterised over 133 days following experimental infection. Immunoglobulin G against the three proteins remained at high concentrations from 28 to 133 days post-infection (dpi), although IgG against P97R1 was detected earlier and was more reactive than the other two antigens under assessment. Mucosal sIgA appeared earlier than serum IgG but did not persist as long; sIgA concentrations against P97R1 were the highest. Seroconversion was detected 2 weeks earlier with the P97R1-based ELISA than with a commercially available ELISA. On analysis of serum samples from five pig farms that did not use a M. hyopneumoniae vaccine, the P97R1-based IgG ELISA demonstrated a 73.6% coincidence rate with the commercial kit. Moreover, this more specific P97R1-based ELISA detected more positive samples than the commercial kit (52.8% vs. 39.2%). It was concluded that the systemic immune response to M. hyopneumoniae infection in pigs was delayed in onset but persistent whereas the mucosal response developed more rapidly but was less sustained. The P97R1 antigen was identified as a suitable serological marker for diagnosing M. hyopneumoniae infection in pigs, particularly early stage infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Atopic dermatitis results in intrinsic barrier and immune abnormalities: Implications for contact dermatitis

    Science.gov (United States)

    Gittler, Julia K.; Krueger, James G.; Guttman-Yassky, Emma

    2014-01-01

    Atopic dermatitis (AD), as well as irritant contact dermatitis (ICD) and allergic contact dermatitis (ACD), are common skin diseases. These diseases are characterized by skin inflammation mediated by activated innate immunity or acquired immune mechanisms. Although AD, ICD, and ACD can be encountered in pure forms by allergists and dermatologists, patients with AD often present with increased frequency of ICD and ACD. Although a disturbed barrier alone could potentiate immune reactivity in patients with AD through increased antigen penetration, additional immune mechanisms might explain the increased susceptibility of atopic patients to ICD and ACD. This review discusses cellular pathways associated with increased skin inflammation in all 3 conditions and presents mechanisms that might contribute to the increased rate of ICD and ACD in patients with AD. PMID:22939651

  18. Enrichment of common carp (Cyprinus carpio) diet with medlar (Mespilus germanica) leaf extract: Effects on skin mucosal immunity and growth performance.

    Science.gov (United States)

    Hoseinifar, Seyed Hossein; Khodadadian Zou, Hassan; Kolangi Miandare, Hamed; Van Doan, Hien; Romano, Nicholas; Dadar, Maryam

    2017-08-01

    A feeding trial was performed to assess the effects of dietary Medlar (Mespilus germanica) leaf extract (MLE) on the growth performance, skin mucus non-specific immune parameters as well as mRNA levels of immune and antioxidant related genes in the skin of common carp (Cyprinus carpio) fingerlings. Fish were fed diets supplemented with graded levels (0, 0.25, 0.50, and 1.00%) of MLE for 49 days. The results revealed an improvement to the growth performance and feed conversion ratio in MLE fed carps (P  0.05) in case protease activity in the skin mucous or tumor necrosis factor alpha and interleukin 1 beta gene expression in the skin of carps (P > 0.05). The expression of genes encoding glutathione reductase and glutathione S-transferase alpha were remarkably increased in MLE fed carps compared to the control group (P < 0.05) while carp fed 0.50% or 1.00% MLE had significantly increased glutathione peroxidase expression in their skin (P < 0.05). The present results revealed the potentially beneficial effects of MLE on the mucosal immune system and growth performance in common carp fingerlings. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. The Development of Carriers and Adjuvants for use with Peptides to Induce Mucosal and Systemic Immunity against Biologic Toxins

    Science.gov (United States)

    1991-06-30

    not toxic in vitro and is toxic at low doses only in man and monkey . In order to test the SEB vaccines made, new ideas for a mouse model for SEB...Secretory immunity experiments using shigella LPS with protaosones to evaluate oral and intranasal immunization using antigens of known military importance

  20. Effects of dietary prebiotic GroBiotic®- A on growth performance, plasma thyroid hormones and mucosal immunity of great sturgeon, Huso huso (Linnaeus, 1758)

    DEFF Research Database (Denmark)

    Adel, M.; Nayak, S.; Lazado, Carlo Cabacang

    2016-01-01

    The present study was conducted to evaluate the effects of Grobiotic®-A, a commercial prebiotics, when administered in feed on the growth performance, plasma thyroid hormones and mucosal immunity of great sturgeon (Huso huso). The commercial prebiotic mixture was supplemented in the diets at four...... changes in growth performance parameters were observed, but only in those groups fed with 1% and 2% prebiotics. Specifically, marked improvements relative to the control group were observed in percentage weight gain, body weight gain, feed conversion ratio and specific growth rate in prebiotic-fed fish....... The levels of plasma thyroid hormones, specifically thyroxine and thyroid stimulating hormones were significantly elevated in the group receiving 2% prebiotics. Activities of lysozyme and alkaline phosphatase in skin mucus were significantly enhanced in prebiotics-fed groups, particularly at an inclusion...

  1. Mucosal immunization with live attenuated Francisella novicida U112ΔiglB protects against pulmonary F. tularensis SCHU S4 in the Fischer 344 rat model.

    Directory of Open Access Journals (Sweden)

    Aimee L Signarovitz

    Full Text Available The need for an efficacious vaccine against Francisella tularensis is a consequence of its low infectious dose and high mortality rate if left untreated. This study sought to characterize a live attenuated subspecies novicida-based vaccine strain (U112ΔiglB in an established second rodent model of pulmonary tularemia, namely the Fischer 344 rat using two distinct routes of vaccination (intratracheal [i.t.] and oral. Attenuation was verified by comparing replication of U112ΔiglB with wild type parental strain U112 in F344 primary alveolar macrophages. U112ΔiglB exhibited an LD(50>10(7 CFU compared to the wild type (LD(50 = 5 × 10(6 CFU i.t.. Immunization with 10(7 CFU U112ΔiglB by i.t. and oral routes induced antigen-specific IFN-γ and potent humoral responses both systemically (IgG2a>IgG1 in serum and at the site of mucosal vaccination (respiratory/intestinal compartment. Importantly, vaccination with U112ΔiglB by either i.t. or oral routes provided equivalent levels of protection (50% survival in F344 rats against a subsequent pulmonary challenge with ~25 LD(50 (1.25 × 10(4 CFU of the highly human virulent strain SCHU S4. Collectively, these results provide further evidence on the utility of a mucosal vaccination platform with a defined subsp. novicida U112ΔiglB vaccine strain in conferring protective immunity against pulmonary tularemia.

  2. Mucosal immunization with the Moraxella catarrhalis porin m35 induces enhanced bacterial clearance from the lung: a possible role for opsonophagocytosis

    Directory of Open Access Journals (Sweden)

    Donna eEaston

    2011-05-01

    Full Text Available Moraxella catarrhalis is a significant cause of respiratory tract infection against which a vaccine is sought. Several outer membrane proteins are currently under investigation as potential vaccine antigens, including the porin M35. We have previously shown that the third external loop of M35 was immunodominant over the remainder of the protein for antibody produced in mice against the refolded recombinant protein. However, as this loop is predicted to fold inside the porin channel we also predicted that it would not be accessible to these antibodies when M35 is expressed on the surface of the bacteria in its native conformation. This study investigated the functional activity of antibodies against M35 and those specific for the loop 3 region of M35 in vitro and in vivo. Antisera from mice immunized with M35 or the loop 3-deletion, M35loop3–, recombinant proteins were not bactericidal but did have enhanced opsonic activity, whereas antibodies raised against the loop 3 peptide were not opsonising indicating that the immunodominant loop 3 of M35 was not accessible to antibody as we had previously predicted. Mucosal immunization with M35, M35 that had an antigenically altered loop 3 (M35(ID78 and M35loop3– enhanced the clearance of M. catarrhalis from the lungs of mice challenged with live M. catarrhalis. The in vivo clearance of bacteria in the mice with the M35-derived protein constructs correlated significantly (p<0.001 with the opsonic activity assessed an in vitro opsonophagocytosis assay. This study has demonstrated that the immunodominat B-cell epitope to loop 3 of the M. catarrhalis outer membrane protein M35 is not associated with immune protection and that M35-specific antibodies are not bactericidal but are opsonising. The opsonising activity correlated with in vivo clearance of the bacteria suggesting that opsonising antibody may be a good correlate of immune protection.

  3. Mucosal vaccines: a paradigm shift in the development of mucosal adjuvants and delivery vehicles.

    Science.gov (United States)

    Srivastava, Atul; Gowda, Devegowda Vishakante; Madhunapantula, SubbaRao V; Shinde, Chetan G; Iyer, Meenakshi

    2015-04-01

    Mucosal immune responses are the first-line defensive mechanisms against a variety of infections. Therefore, immunizations of mucosal surfaces from which majority of infectious agents make their entry, helps to protect the body against infections. Hence, vaccinization of mucosal surfaces by using mucosal vaccines provides the basis for generating protective immunity both in the mucosal and systemic immune compartments. Mucosal vaccines offer several advantages over parenteral immunization. For example, (i) ease of administration; (ii) non-invasiveness; (iii) high-patient compliance; and (iv) suitability for mass vaccination. Despite these benefits, to date, only very few mucosal vaccines have been developed using whole microorganisms and approved for use in humans. This is due to various challenges associated with the development of an effective mucosal vaccine that can work against a variety of infections, and various problems concerned with the safe delivery of developed vaccine. For instance, protein antigen alone is not just sufficient enough for the optimal delivery of antigen(s) mucosally. Hence, efforts have been made to develop better prophylactic and therapeutic vaccines for improved mucosal Th1 and Th2 immune responses using an efficient and safe immunostimulatory molecule and novel delivery carriers. Therefore, in this review, we have made an attempt to cover the recent advancements in the development of adjuvants and delivery carriers for safe and effective mucosal vaccine production. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  4. Always one step ahead: How pathogenic bacteria use the type III secretion system to manipulate the intestinal mucosal immune system

    Directory of Open Access Journals (Sweden)

    Marchès Olivier

    2011-05-01

    Full Text Available Abstract The intestinal immune system and the epithelium are the first line of defense in the gut. Constantly exposed to microorganisms from the environment, the gut has complex defense mechanisms to prevent infections, as well as regulatory pathways to tolerate commensal bacteria and food antigens. Intestinal pathogens have developed strategies to regulate intestinal immunity and inflammation in order to establish or prolong infection. The organisms that employ a type III secretion system use a molecular syringe to deliver effector proteins into the cytoplasm of host cells. These effectors target the host cell cytoskeleton, cell organelles and signaling pathways. This review addresses the multiple mechanisms by which the type III secretion system targets the intestinal immune response, with a special focus on pathogenic E. coli.

  5. Effects of soluble immunostimulants on mucosal immune responses in rainbow trout immersion-vaccinated against Yersinia ruckeri

    DEFF Research Database (Denmark)

    Skov, Jakob; Chettri, Jiwan Kumar; Jaafar, Rzgar M.

    2018-01-01

    elevate the immune response and the present work elucidates how ERM immersion vaccination of trout in combination with exposure to soluble adjuvants, Montanide™ IMS 1312 VG PR and β-glucan, affects immune reactions. The former adjuvant, when used alone, induced a slightly increased protection (not......Immersion vaccination of rainbow trout against Yersinia ruckeri infection is an established method to prevent enteric red mouth disease (ERM) but the effect is inferior to injection vaccination and the duration of protection is limited to less than six months. Adjuvants in vaccines may in general...... weeks no vaccine induced reaction was seen and after challenge with bacteria mainly unvaccinated fish responded. Adjuvants used in combination with immersion vaccine clearly influences immune reactions and may improve duration and protection but further potency tests should be performed....

  6. Effects of dietary supplementation with a chlorella by-product on the growth performance, immune response, intestinal microflora and intestinal mucosal morphology in broiler chickens.

    Science.gov (United States)

    Kang, H K; Park, S B; Kim, C H

    2017-04-01

    This study aimed to determine the effect of different dietary levels of a Chlorella by-product (CBP) on the growth performance, immune response, intestinal microflora and intestinal mucosal morphology of broilers. In total, 480 one-day-old broiler chickens were randomly allotted to four dietary treatments with four replicated pens consisting of 30 chicks. The basal diet was formulated to be adequate in energy and nutrients. Three additional diets were prepared by supplementing 25, 50 or 75 g/kg of CBP to the basal diet. The diets were fed to the broilers ad libitum for 35 days. Result indicated that increasing inclusion level of CBP improved BW gain (linear, p < 0.05). There was no effect of inclusion level of CBP in diets on total cholesterol, triglyceride, aspartate aminotransferase and alanine aminotransferase levels during the 35 days. Plasma IgG, IgM and IgA concentrations increased (linear, p < 0.05) with inclusion level of CBP in diets. Supplementation of CBP in the diets increased (linear, p < 0.05) the concentrations of Lactobacillus in the caecal content and decreased (linear, p < 0.05) the concentrations of Escherichia coli and Salmonella in the caecal content. Villus height increased (linear and quadratic, p < 0.05) with inclusion level of CBP in diets. Crypt depth increased (quadratic, p < 0.05) with inclusion level of CBP, and a decreased villus height: crypt depth ratio (quadratic, p < 0.05) was observed as inclusion level of CBP in diets increased. The results of the current experiment indicate that dietary supplementation of CBP improves growth performance of birds. Dietary CBP has improving Lactobacillus spp. concentrations in the gastrointestinal tract, plasma immunoglobulin concentrations and intestinal mucosal morphology. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.

  7. The placental barrier in allogenic immune conflict in spontaneous early abortions: immunohistochemical and morphological study.

    Science.gov (United States)

    Gurevich, Pavel; Elhayany, Asher; Milovanov, Andrey P; Halperin, Reuvit; Kaganovsky, Ella; Zusman, Itzhak; Ben-Hur, Herzel

    2007-11-01

    Morphologic changes in the placental barrier in spontaneous early abortions under the maternal-embryonic immune conflict, and the role of maternal immunoglobulins (Igs) in these changes. We examined chorionic villi and other tissues obtained from 54 aborts between weeks 3.5 and 8 of pregnancy. Material was divided into two groups. Group 1 (control) contained 15 medically recommended and spontaneous early aborts with no signs of inflammations or pathologic immune processes. Group 2 contained 39 spontaneous early aborts with acute chorionic villitis. Immunohistochemical and morphometric methods were used to study the Igs, different types of immunocompetent cells, and apoptosis-related components of the placental barrier. Acute villitis was found to be characterized by the destruction of all components of the chorionic villi, thrombovasculitis with apoptosis of the endothelium of capillaries and erythroblasts, mucous swelling of the basal membrane, and coagulation of the blood proteins. Due to destruction of the capillaries, the number of avasculate villi increased, and the average number of capillaries per villus decreased. The extremely high number of phagolysosomes with IgG and IgA in the villous monocytes in the group 2 indicates an increase in the phagocytic activity of monocytes against maternal Igs and may reflect the presence of mother-embryo immune conflict. Apoptosis of monocytes and a high number of promonocytes were seen accompanied by a high concentration of p53 protein. A large disturbance in the trophoblast occurred with disappearance of bcl-2 and the appearance of Fas ligand. Massive destruction of maternal Igs in embryonic monocytes and acute villitis in the placental barrier are manifested during the mother-embryo immune conflict, and this may be one of the reasons of spontaneous early abortions.

  8. Systemic and mucosal immunization with Candida albicans hsp90 elicits hsp90-specific humoral response in vaginal mucosa which is further enhanced during experimental vaginal candidiasis.

    Science.gov (United States)

    Raska, Milan; Belakova, Jana; Horynova, Milada; Krupka, Michal; Novotny, Jiri; Sebestova, Martina; Weigl, Evzen

    2008-08-01

    The Candida albicans heat shock protein 90 kDa (hsp90-CA) is an important target for protective antibodies in disseminated candidiasis of experimental mice and humans. Hsp90-CA is present in the cell wall of Candida pseudohyphae or hyphae--typical pathogenic morphotypes in both mucosal and systemic Candida infections. However, the potential protective effects of hsp90-CA-specific antibodies in vaginal candidiasis has not yet been reported. In the present study we used various vaccine formulations (recombinant hsp90-CA protein and hsp90-CA-encoding DNA vaccine) and routes of administration (intradermal, intranasal, and intravenous) to induce both hsp90-CA-specific systemic and vaginal mucosa immune responses in experimental BALB/c mice. The results showed that intradermal recombinant hsp90-CA protein priming, followed by intranasal or intradermal recombinant hsp90-CA protein boosting induced significant increases in both serum and vaginal hsp90-CA-specific IgG and IgA antibodies compared to the control group, as well as enhanced hsp90-CA-specific splenocyte responses in vitro. In the intradermally boosted group, subsequent experimental vaginal Candida infection induced additional increases in the hsp90-CA specific IgG isotype, suggesting that Candida has the ability to induce a local hsp90-specific antibody (IgG) response during vulvovaginal candidiasis. Further work is required to elucidate the importance of immunity to highly conserved antigens during infection of the human female reproductive tract where a balance between immunity to and tolerance for commonly antigens such as hsp90 is necessary for the maintenance of fertility.

  9. A randomized trial to assess anti-HIV activity in female genital tract secretions and soluble mucosal immunity following application of 1% tenofovir gel.

    Directory of Open Access Journals (Sweden)

    Marla J Keller

    2011-01-01

    Full Text Available Preclinical and early phase clinical microbicide studies have not consistently predicted the outcome of efficacy trials. To address this gap, candidate biomarkers of microbicide pharmacodynamics and safety were evaluated in a double-blind, placebo-controlled trial of tenofovir gel, the first microbicide to demonstrate significant protection against HIV acquisition.30 women were randomized to apply a single daily dose of tenofovir or placebo gel for 14 consecutive days. Anti-HIV activity was measured in cervicovaginal lavage (CVL on Days 0, 3, 7, 14 and 21 by luciferase assay as a surrogate marker of pharmacodynamics. Endogenous activity against E. coli and HSV-2 and concentrations of immune mediators were quantified in CVL as candidate biomarkers of safety. Tenofovir levels were measured in CVL and blood.A significant increase in anti-HIV activity was detected in CVL from women who applied tenofovir gel compared to their endogenous anti-HIV activity in genital tract secretions on Day 0 and compared to activity in CVL from women in the placebo group. The activity correlated significantly with CVL concentration of tenofovir (r = 0.6, p<0.001 and fit a sigmoid E(max pharmacodynamic model. Anti-HIV activity in CVL from women who applied tenofovir persisted when virus was introduced in semen, whereas endogenous anti-HIV activity decreased. Tenofovir did not trigger an inflammatory response or induce sustained loss in endogenous antimicrobial activity or immune mediators.Tenofovir gel had no deleterious impact on soluble mucosal immunity. The increased anti-HIV activity in CVL, which persisted in the presence of semen and correlated with tenofovir concentration, is consistent with the efficacy observed in a recent clinical trial. These results promote quantified CVL anti-HIV activity as a surrogate of tissue pharmacodynamics and as a potential biomarker of adherence to product. This simple, feasible and inexpensive bioassay may promote the development

  10. Analysis of the mucosal immune responses induced by single and trickle infections with the bovine abomasal nematode Ostertagia ostertagi.

    Science.gov (United States)

    Mihi, B; van Meulder, F; Vancoppernolle, S; Rinaldi, M; Chiers, K; van den Broeck, W; Goddeeris, B M; Vercruysse, J; Claerebout, E; Geldhof, P

    2014-04-01

    The purpose of this study was to provide more information on the kinetics of the immunological changes occurring in the abomasal mucosa after single and trickle infections with the bovine parasite Ostertagia ostertagi. The time course analysis of gene expression revealed that the major changes coincided with the emergence of adult worms from the gastric glands. These changes consisted of a simultaneous upregulation of Th1- and Th2-type cytokines. In addition, a single O. ostertagi infection elicited an upregulation of the epithelial-derived cytokine IL33, while TSLP expression levels were not impacted. Apart from the massive increase in inflammatory cytokines IL6, IL17 and IL21, O. ostertagi infection also elicited an upregulation of the immunosuppressors TGFB, IL10 and ARG1, as well as NK and γδ-T cell markers. Furthermore, the cytotoxic factors granulysin, perforin and granzyme B were upregulated following an O. ostertagi infection. Analysis of cytokine transcript levels in animals receiving trickle infections for 60 days showed a similar trend as observed following a single infection except for IL33, IL6, GATA-3, TBX21 and NCR1, which were no longer upregulated after trickle infections. Finally, the long trickle infections were associated with mucosal eosinophilia and mastocytosis. © 2013 John Wiley & Sons Ltd.

  11. Induction of mucosal immune responses and protection of cattle against direct-contact challenge by intranasal delivery with foot-and-mouth disease virus antigen mediated by nanoparticles

    Directory of Open Access Journals (Sweden)

    Pan L

    2014-12-01

    Full Text Available Li Pan,1,2 Zhongwang Zhang,1,2 Jianliang Lv,1,2 Peng Zhou,1,2 Wenfa Hu,1,2 Yuzhen Fang,1,2 Haotai Chen,1,2 Xinsheng Liu,1,2 Junjun Shao,1,2 Furong Zhao,1,2 Yaozhong Ding,1,2 Tong Lin,1,2 Huiyun Chang,1,2 Jie Zhang,1,2 Yongguang Zhang,1,2 Yonglu Wang1,2 1State Key Laboratory of Veterinary Etiological Biology, National Foot-and-Mouth Disease Reference Laboratory, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (CAAS, Lanzhou, Gansu, People’s Republic of China; 2Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, People’s Republic of China Abstract: The aim of this study was to enhance specific mucosal, systemic, and cell-mediated immunity and to induce earlier onset of protection against direct-contact challenge in cattle by intranasal delivery of a nanoparticle-based nasal vaccine against type A foot-and-mouth disease (FMD. In this study, two kinds of nanoparticle-based nasal vaccines against type A FMD were designed: (1 chitosan-coated poly(lactic-co-glycolic acid (PLGA loaded with plasmid DNA (Chi-PLGA-DNA and (2 chitosan-trehalose and inactivated foot-and-mouth disease virus (FMDV (Chi-Tre-Inactivated. Cattle were immunized by an intranasal route with nanoparticles and then challenged for 48 hours by direct contact with two infected donor cattle per pen. Donors were inoculated intradermally in the tongue 48 hours before challenge, with 0.2 mL cattle-passaged FMDV. Serological and mucosal antibody responses were evaluated, and virus excretion and the number of contact infections were quantified. FMDV-specific secretory immunoglobulin (IgA (sIgA antibodies in nasal washes were initially detected at 4 days postvaccination (dpv with two kinds of nanoparticles. The highest levels of sIgA expression were observed in nasal washes, at 10 dpv, from animals with Chi-PLGA-DNA nanoparticles, followed by animals immunized once by intranasal route with

  12. Mucosal immunity in HIV infection: what can be done to restore gastrointestinal-associated lymphoid tissue function?

    Science.gov (United States)

    George, Michael D; Asmuth, David M

    2014-06-01

    This review describes the impact of HIV infection on gut-associated lymphoid tissue, the mechanisms for persistent gut-associated lymphoid tissue dysfunction despite effective antiretroviral therapy, and potential strategies to restore gut-associated lymphoid tissue function and promote immune reconstitution. Recent studies indicate that unresolved microbial translocation and intestinal dysbiosis may continue to promote enteropathy as well as HIV-associated and non-HIV-associated conditions in many HIV patients who otherwise maintain therapeutic control of systemic viral replication. Several novel therapeutic approaches to reduce intestinal inflammation and mitigate microbial translocation may hold promise for restoring gastrointestinal health and thereby increasing the efficacy of immune reconstitution in HIV-infected patients undergoing antiretroviral therapy.

  13. Systems-wide analyses of mucosal immune responses to Helicobacter pylori at the interface between pathogenicity and symbiosis

    Science.gov (United States)

    Kronsteiner, Barbara; Bassaganya-Riera, Josep; Philipson, Casandra; Viladomiu, Monica; Carbo, Adria; Abedi, Vida; Hontecillas, Raquel

    2016-01-01

    Abstract Helicobacter pylori is the dominant member of the gastric microbiota in over half of the human population of which 5–15% develop gastritis or gastric malignancies. Immune responses to H. pylori are characterized by mixed T helper cell, cytotoxic T cell and NK cell responses. The presence of Tregs is essential for the control of gastritis and together with regulatory CX3CR1+ mononuclear phagocytes and immune-evasion strategies they enable life-long persistence of H. pylori. This H. pylori-induced regulatory environment might contribute to its cross-protective effect in inflammatory bowel disease and obesity. Here we review host-microbe interactions, the development of pro- and anti-inflammatory immune responses and how the latter contribute to H. pylori's role as beneficial member of the gut microbiota. Furthermore, we present the integration of existing and new data into a computational/mathematical model and its use for the investigation of immunological mechanisms underlying initiation, progression and outcomes of H. pylori infection. PMID:26939848

  14. Sphingosine 1-phosphate receptor 5 mediates the immune quiescence of the human brain endothelial barrier

    Directory of Open Access Journals (Sweden)

    van Doorn Ruben

    2012-06-01

    Full Text Available Abstract Background The sphingosine 1-phosphate (S1P receptor modulator FTY720P (Gilenya® potently reduces relapse rate and lesion activity in the neuroinflammatory disorder multiple sclerosis. Although most of its efficacy has been shown to be related to immunosuppression through the induction of lymphopenia, it has been suggested that a number of its beneficial effects are related to altered endothelial and blood–brain barrier (BBB functionality. However, to date it remains unknown whether brain endothelial S1P receptors are involved in the maintenance of the function of the BBB thereby mediating immune quiescence of the brain. Here we demonstrate that the brain endothelial receptor S1P5 largely contributes to the maintenance of brain endothelial barrier function. Methods We analyzed the expression of S1P5 in human post-mortem tissues using immunohistochemistry. The function of S1P5 at the BBB was assessed in cultured human brain endothelial cells (ECs using agonists and lentivirus-mediated knockdown of S1P5. Subsequent analyses of different aspects of the brain EC barrier included the formation of a tight barrier, the expression of BBB proteins and markers of inflammation and monocyte transmigration. Results We show that activation of S1P5 on cultured human brain ECs by a selective agonist elicits enhanced barrier integrity and reduced transendothelial migration of monocytes in vitro. These results were corroborated by genetically silencing S1P5 in brain ECs. Interestingly, functional studies with these cells revealed that S1P5 strongly contributes to brain EC barrier function and underlies the expression of specific BBB endothelial characteristics such as tight junctions and permeability. In addition, S1P5 maintains the immunoquiescent state of brain ECs with low expression levels of leukocyte adhesion molecules and inflammatory chemokines and cytokines through lowering the activation of the transcription factor NFκB. Conclusion Our

  15. Effects of dietary supplementation of lipid-coated zinc oxide on intestinal mucosal morphology and expression of the genes associated with growth and immune function in weanling pigs

    Directory of Open Access Journals (Sweden)

    Young Min Song

    2018-03-01

    Full Text Available Objective The present study was conducted to investigate the effects of a lipid-coated zinc oxide (ZnO supplement Shield Zn (SZ at the sub-pharmacological concentration on intestinal morphology and gene expression in weanling pigs, with an aim to gain insights into the mechanism of actions for SZ. Methods Forty 22-day-old weanling pigs were fed a nursery diet supplemented with 100 or 2,500 mg Zn/kg with uncoated ZnO (negative control [NC] or positive control [PC], respectively, 100, 200, or 400 mg Zn/kg with SZ for 14 days and their intestinal tissues were taken for histological and molecular biological examinations. The villus height (VH and crypt depth (CD of the intestinal mucosa were measured microscopically following preparation of the tissue specimen; expression of the genes associated with growth and immune function was determined using the real-time quantitative polymerase chain reaction. Results There was no difference in daily gain, gain:feed, and diarrhea score between the SZ group and either of NC and PC. The VH and VH:CD ratio were less for the SZ group vs NC in the jejunum and duodenum, respectively (p<0.05. The jejunal mucosal mRNA levels of insulin-like growth factor (IGF-I and interleukin (IL-10 regressed and tended to regress (p = 0.053 on the SZ concentration with a positive coefficient, respectively, whereas the IL-6 mRNA level regressed on the SZ concentration with a negative coefficient. The mRNA levels of IGF-I, zonula occludens protein-1, tumor necrosis factor-α, IL-6, and IL-10 did not differ between the SZ group and either of NC and PC; the occludin and transforming growth factor-β1 mRNA levels were lower for the SZ group than for PC. Conclusion The present results are interpreted to suggest that dietary ZnO provided by SZ may play a role in intestinal mucosal growth and immune function by modulating the expression of IGF-I, IL-6, and IL-10 genes.

  16. Effects of Dietary Bacillus licheniformis on Gut Physical Barrier, Immunity, and Reproductive Hormones of Laying Hens.

    Science.gov (United States)

    Wang, Yang; Du, Wei; Lei, Kai; Wang, Baikui; Wang, Yuanyuan; Zhou, Yingshan; Li, Weifen

    2017-09-01

    Previous study showed that dietary Bacillus licheniformis (B. licheniformis) administration contributes to the improvement of laying performance and egg quality in laying hens. In this study, we aimed to further evaluate its underlying mechanisms. Three hundred sixty Hy-Line Variety W-36 hens (28 weeks of age) were randomized into four groups, each group with six replications (n = 15). The control group received the basal diet and the treatment groups received the same basal diets supplemented with 0.01, 0.03, and 0.06% B. licheniformis powder (2 × 10 10  cfu/g) for an 8-week trial. The results demonstrate that B. licheniformis significantly enhance the intestinal barrier functions via decreasing gut permeability, promoting mucin-2 transcription, and regulating inflammatory cytokines. The systemic immunity of layers in B. licheniformis treatment groups is improved through modulating the specific and non-specific immunity. In addition, gene expressions of hormone receptors, including estrogen receptor α, estrogen receptor β, and follicle-stimulating hormone receptor, are also regulated by B. licheniformis. Meanwhile, compared with the control, B. licheniformis significantly increase gonadotropin-releasing hormone level, but markedly reduce ghrelin and inhibin secretions. Overall, our data suggest that dietary inclusion of B. licheniformis can improve the intestinal barrier function and systemic immunity and regulate reproductive hormone secretions, which contribute to better laying performance and egg quality of hens.

  17. Atopic dermatitis: immune deviation, barrier dysfunction, IgE autoreactivity and new therapies

    Directory of Open Access Journals (Sweden)

    Masutaka Furue

    2017-07-01

    Full Text Available Atopic dermatitis (AD is a chronic or chronically relapsing, eczematous, severely pruritic skin disorder mostly associated with IgE elevation and skin barrier dysfunction due to decreased filaggrin expression. The lesional skin of AD exhibits Th2- and Th22-deviated immune reactions that are progressive during disease chronicity. Th2 and Th22 cytokines further deteriorate the skin barrier by inhibiting filaggrin expression. Some IgEs are reactive to self-antigens. The IgE autoreactivity may precipitate the chronicity of AD. Upon activation of the ORAI1 calcium channel, atopic epidermis releases large amounts of thymic stromal lymphopoietin (TSLP, which initiates the Th2 and Th22 immune response. Th2-derived interleukin-31 and TSLP induce an itch sensation. Taken together, TSLP/Th2/Th22 pathway is a promising target for developing new therapeutics for AD. Enhancing filaggrin expression using ligands for the aryl hydrocarbon receptor may also be an adjunctive measure to restore the disrupted barrier function specifically for AD.

  18. SEVERAL MUCOSAL VACCINATION ROUTES CONFER IMMUNITY AGAINST ENTERIC REDMOUTH DISEASE IN RAINBOW TROUT, BUT THE PROTECTIVE MECHANISMS ARE DIFFERENT

    DEFF Research Database (Denmark)

    Neumann, Lukas; Villumsen, Kasper Rømer; Kragelund Strøm, Helene

    Vaccination is a keystone in prophylactic strategies preventing outbreaks of fish pathogenic bacterial diseases in aquaculture. The first commercial fish vaccine consisted of a bacterin of Yersinia ruckeri serotype O1 biotype 1. The vaccine has been very successful and has been used for more than...... cells and M-like cells have been found in fish, is it suggested that gut-associated lymphoid tissue (GALT) associated with the gastrointestinal tract are involved in antigen uptake and generation of a local protective immune response against Y. ruckeri....

  19. Toxin-mediated effects on the innate mucosal defenses: implications for enteric vaccines

    DEFF Research Database (Denmark)

    Glenn, Gregory M; Francis, David H; Danielsen, E Michael

    2009-01-01

    mucosal barrier as a key step in enteric pathogen survival. We review key observations relevant to the roles of LT and cholera toxin in protective immunity and the effects of these toxins on innate mucosal defenses. We suggest either that toxin-mediated fluid secretion mechanically disrupts the mucus...... layer or that toxins interfere with innate mucosal defenses by other means. Such a breach gives pathogens access to the enterocyte, leading to binding and pathogenicity by enterotoxigenic E. coli (ETEC) and other organisms. Given the common exposure to LT(+) ETEC by humans visiting or residing...... unexpectedly broad protective effects against LT(+) ETEC and mixed infections when using a toxin-based enteric vaccine. If toxins truly exert barrier-disruptive effects as a key step in pathogenesis, then a return to classic toxin-based vaccine strategies for enteric disease is warranted and can be expected...

  20. Drosophila as a Model for Human Diseases-Focus on Innate Immunity in Barrier Epithelia.

    Science.gov (United States)

    Bergman, P; Seyedoleslami Esfahani, S; Engström, Y

    2017-01-01

    Epithelial immunity protects the host from harmful microbial invaders but also controls the beneficial microbiota on epithelial surfaces. When this delicate balance between pathogen and symbiont is disturbed, clinical disease often occurs, such as in inflammatory bowel disease, cystic fibrosis, or atopic dermatitis, which all can be in part linked to impairment of barrier epithelia. Many innate immune receptors, signaling pathways, and effector molecules are evolutionarily conserved between human and Drosophila. This review describes the current knowledge on Drosophila as a model for human diseases, with a special focus on innate immune-related disorders of the gut, lung, and skin. The discovery of antimicrobial peptides, the crucial role of Toll and Toll-like receptors, and the evolutionary conservation of signaling to the immune systems of both human and Drosophila are described in a historical perspective. Similarities and differences between human and Drosophila are discussed; current knowledge on receptors, signaling pathways, and effectors are reviewed, including antimicrobial peptides, reactive oxygen species, as well as autophagy. We also give examples of human diseases for which Drosophila appears to be a useful model. In addition, the limitations of the Drosophila model are mentioned. Finally, we propose areas for future research, which include using the Drosophila model for drug screening, as a validation tool for novel genetic mutations in humans and for exploratory research of microbiota-host interactions, with relevance for infection, wound healing, and cancer. © 2017 Elsevier Inc. All rights reserved.

  1. New Insights into the Mechanisms of Chinese Herbal Products on Diabetes: A Focus on the “Bacteria-Mucosal Immunity-Inflammation-Diabetes” Axis

    Directory of Open Access Journals (Sweden)

    Zezheng Gao

    2017-01-01

    Full Text Available Diabetes, especially type 2, has been rapidly increasing all over the world. Although many drugs have been developed and used to treat diabetes, side effects and long-term efficacy are of great challenge. Therefore, natural health product and dietary supplements have been of increasing interest alternatively. In this regard, Chinese herbs and herbal products have been considered a rich resource of product development. Although increasing evidence has been produced from various scientific studies, the mechanisms of action are lacking. Here, we have proposed that many herbal monomers and formulae improve glucose homeostasis and diabetes through the BMID axis; B represents gut microbiota, M means mucosal immunity, I represents inflammation, and D represents diabetes. Chinese herbs have been traditionally used to treat diabetes, with minimal side and toxic effects. Here, we reviewed monomers such as berberine, ginsenoside, M. charantia extract, and curcumin and herbal formulae such as Gegen Qinlian Decoction, Danggui Liuhuang Decoction, and Huanglian Wendan Decoction. This review was intended to provide new perspectives and strategies for future diabetes research and product.

  2. Comparison of mucosal lining fluid sampling methods and influenza-specific IgA detection assays for use in human studies of influenza immunity.

    Science.gov (United States)

    de Silva, Thushan I; Gould, Victoria; Mohammed, Nuredin I; Cope, Alethea; Meijer, Adam; Zutt, Ilse; Reimerink, Johan; Kampmann, Beate; Hoschler, Katja; Zambon, Maria; Tregoning, John S

    2017-10-01

    We need greater understanding of the mechanisms underlying protection against influenza virus to develop more effective vaccines. To do this, we need better, more reproducible methods of sampling the nasal mucosa. The aim of the current study was to compare levels of influenza virus A subtype-specific IgA collected using three different methods of nasal sampling. Samples were collected from healthy adult volunteers before and after LAIV immunization by nasal wash, flocked swabs and Synthetic Absorptive Matrix (SAM) strips. Influenza A virus subtype-specific IgA levels were measured by haemagglutinin binding ELISA or haemagglutinin binding microarray and the functional response was assessed by microneutralization. Nasosorption using SAM strips lead to the recovery of a more concentrated sample of material, with a significantly higher level of total and influenza H1-specific IgA. However, an equivalent percentage of specific IgA was observed with all sampling methods when normalized to the total IgA. Responses measured using a recently developed antibody microarray platform, which allows evaluation of binding to multiple influenza strains simultaneously with small sample volumes, were compared to ELISA. There was a good correlation between ELISA and microarray values. Material recovered from SAM strips was weakly neutralizing when used in an in vitro assay, with a modest correlation between the level of IgA measured by ELISA and neutralization, but a greater correlation between microarray-measured IgA and neutralizing activity. In conclusion we have tested three different methods of nasal sampling and show that flocked swabs and novel SAM strips are appropriate alternatives to traditional nasal washes for assessment of mucosal influenza humoral immunity. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Immunization with the conjugate vaccine Vi-CRM₁₉₇ against Salmonella typhi induces Vi-specific mucosal and systemic immune responses in mice.

    Science.gov (United States)

    Fiorino, Fabio; Ciabattini, Annalisa; Rondini, Simona; Pozzi, Gianni; Martin, Laura B; Medaglini, Donata

    2012-09-21

    Typhoid fever is a public health problem, especially among young children in developing countries. To address this need, a glycoconjugate vaccine Vi-CRM₁₉₇, composed of the polysaccharide antigen Vi covalently conjugated to the non-toxic mutant of diphtheria toxin CRM₁₉₇, is under development. Here, we assessed the antibody and cellular responses, both local and systemic, following subcutaneous injection of Vi-CRM₁₉₇. The glycoconjugate elicited Vi-specific serum IgG titers significantly higher than unconjugated Vi, with prevalence of IgG1 that persisted for at least 60 days after immunization. Vi-specific IgG, but not IgA, were present in intestinal washes. Lymphocytes proliferation after restimulation with Vi-CRM₁₉₇ was observed in spleen and mesenteric lymph nodes. These data confirm the immunogenicity of Vi-CRM₁₉₇ and demonstrate that the vaccine-specific antibody and cellular immune responses are present also in the intestinal tract, thus strengthening the suitability of Vi-CRM₁₉₇ as a promising candidate vaccine against Salmonella Typhi. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Bacterial-derived uracil as a modulator of mucosal immunity and gut-microbe homeostasis in Drosophila.

    Science.gov (United States)

    Lee, Kyung-Ah; Kim, Sung-Hee; Kim, Eun-Kyoung; Ha, Eun-Mi; You, Hyejin; Kim, Boram; Kim, Min-Ji; Kwon, Youngjoo; Ryu, Ji-Hwan; Lee, Won-Jae

    2013-05-09

    All metazoan guts are subjected to immunologically unique conditions in which an efficient antimicrobial system operates to eliminate pathogens while tolerating symbiotic commensal microbiota. However, the molecular mechanisms controlling this process are only partially understood. Here, we show that bacterial-derived uracil acts as a ligand for dual oxidase (DUOX)-dependent reactive oxygen species generation in Drosophila gut and that the uracil production in bacteria causes inflammation in the gut. The acute and controlled uracil-induced immune response is required for efficient elimination of bacteria, intestinal cell repair, and host survival during infection of nonresident species. Among resident gut microbiota, uracil production is absent in symbionts, allowing harmonious colonization without DUOX activation, whereas uracil release from opportunistic pathobionts provokes chronic inflammation. These results reveal that bacteria with distinct abilities to activate uracil-induced gut inflammation, in terms of intensity and duration, act as critical factors that determine homeostasis or pathogenesis in gut-microbe interactions. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Mucosal barrier injury laboratory-confirmed bloodstream infection: results from a field test of a new National Healthcare Safety Network definition.

    Science.gov (United States)

    See, Isaac; Iwamoto, Martha; Allen-Bridson, Kathy; Horan, Teresa; Magill, Shelley S; Thompson, Nicola D

    2013-08-01

    To assess challenges to implementation of a new National Healthcare Safety Network (NHSN) surveillance definition, mucosal barrier injury laboratory-confirmed bloodstream infection (MBI-LCBI). Multicenter field test. Selected locations of acute care hospitals participating in NHSN central line-associated bloodstream infection (CLABSI) surveillance. Hospital staff augmented their CLABSI surveillance for 2 months to incorporate MBI-LCBI: a primary bloodstream infection due to a selected group of organisms in patients with either neutropenia or an allogeneic hematopoietic stem cell transplant with gastrointestinal graft-versus-host disease or diarrhea. Centers for Disease Control and Prevention (CDC) staff reviewed submitted data to verify whether CLABSIs met MBI-LCBI criteria and summarized the descriptive epidemiology of cases reported. Eight cancer, 2 pediatric, and 28 general acute care hospitals including 193 inpatient units (49% oncology/bone marrow transplant [BMT], 21% adult ward, 20% adult critical care, 6% pediatric, 4% step-down) conducted field testing. Among 906 positive blood cultures reviewed, 282 CLABSIs were identified. Of the 103 CLABSIs that also met MBI-LCBI criteria, 100 (97%) were reported from oncology/BMT locations. Agreement between hospital staff and CDC classification of reported CLABSIs as meeting the MBI-LCBI definition was high (90%; κ = 0.82). Most MBI-LCBIs (91%) occurred in patients meeting neutropenia criteria. Some hospitals indicated that their laboratories' methods of reporting cell counts prevented application of neutropenia criteria; revised neutropenia criteria were created using data from field testing. Hospital staff applied the MBI-LCBI definition accurately. Field testing informed modifications for the January 2013 implementation of MBI-LCBI in the NHSN.

  7. Mucosal Barrier Injury Laboratory-Confirmed Bloodstream Infections (MBI-LCBI): Descriptive Analysis of Data Reported to National Healthcare Safety Network (NHSN), 2013.

    Science.gov (United States)

    Epstein, Lauren; See, Isaac; Edwards, Jonathan R; Magill, Shelley S; Thompson, Nicola D

    2016-01-01

    OBJECTIVES To determine the impact of mucosal barrier injury laboratory-confirmed bloodstream infections (MBI-LCBIs) on central-line-associated bloodstream infection (CLABSI) rates during the first year of MBI-LCBI reporting to the National Healthcare Safety Network (NHSN) DESIGN Descriptive analysis of 2013 NHSN data SETTING Selected inpatient locations in acute care hospitals METHODS A descriptive analysis of MBI-LCBI cases was performed. CLABSI rates per 1,000 central-line days were calculated with and without the inclusion of MBI-LCBIs in the subset of locations reporting ≥1 MBI-LCBI, and in all locations (regardless of MBI-LCBI reporting) to determine rate differences overall and by location type. RESULTS From 418 locations in 252 acute care hospitals reporting ≥1 MBI-LCBIs, 3,162 CLABSIs were reported; 1,415 (44.7%) met the MBI-LCBI definition. Among these locations, removing MBI-LCBI from the CLABSI rate determination produced the greatest CLABSI rate decreases in oncology (49%) and ward locations (45%). Among all locations reporting CLABSI data, including those reporting no MBI-LCBIs, removing MBI-LCBI reduced rates by 8%. Here, the greatest decrease was in oncology locations (38% decrease); decreases in other locations ranged from 1.2% to 4.2%. CONCLUSIONS An understanding of the potential impact of removing MBI-LCBIs from CLABSI data is needed to accurately interpret CLABSI trends over time and to inform changes to state and federal reporting programs. Whereas the MBI-LCBI definition may have a large impact on CLABSI rates in locations where patients with certain clinical conditions are cared for, the impact of MBI-LCBIs on overall CLABSI rates across inpatient locations appears to be more modest. Infect. Control Hosp. Epidemiol. 2015;37(1):2-7.

  8. Oral immunization with F4 fimbriae and CpG formulated with carboxymethyl starch enhances F4-specific mucosal immune response and modulates Th1 and Th2 cytokines in weaned pigs.

    Science.gov (United States)

    Delisle, Benjamin; Calinescu, Carmen; Mateescu, Mircea Alexandru; Fairbrother, John Morris; Nadeau, Éric

    2012-01-01

    F4 fimbriae are a potential candidate for an oral subunit vaccine for prevention of post-weaning diarrhea in swine due to infection with F4-positive enterotoxigenic Escherichia coli. However, large quantities of F4 fimbriae are required to induce a specific antibody response. The aim of the present study was to evaluate the effect of supplementation of F4 fimbriae with Cytosine-phosphate-Guanosine-oligodeoxynucleotide (CpG-A D19) or with complete cholera toxin (CT) as adjuvants on the F4-specific antibody response and cytokine production in weaned pigs following oral administration of F4 fimbrial antigen formulated with Carboxymethyl Starch (CMS). Oral dosage forms of F4 fimbriae alone or supplemented with CpG-A D19 or with CT were formulated with CMS as monolithic tablets, obtained by direct compression, and administered to weaned pigs. Blood and faecal samples were collected to determine the systemic and mucosal immune status of animals at various times until necropsy. During necropsy, contents of the jejunum and ileum were collected for determination of mucosal F4 specific antibodies. Segments of jejunum and ileum were also used to measure mRNA cytokine production. The presence of CpG in the formulation of the fimbriae significantly increased F4-specific immunoglobulin (Ig) IgM and IgG levels in intestinal secretions, and enhanced Th1 (Interferon-gamma / IFN-γ, Tumour Necrosis Factor-alpha / TNF-α, Interleukin-12p40 / IL-12p40, IL-1β) and Th2 (IL-4, IL-6) cytokine production in intestinal tissues. Supplementation with CT did not result in induction of F4-specific antibodies in secretions, although a significant Th1 response (IFN-α, IFN-γ, IL-18) was detected in tissues. Neither F4-specific systemic antibodies, nor intestinally secreted IgA were detected throughout the immunization trial for all groups. CpG-A D19 appeared to be a promising adjuvant for an oral F4 subunit vaccine formulated with CMS excipient as monolithic tablets. This matrix afforded gastro

  9. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  10. Interferon-β induced in female genital epithelium by HIV-1 glycoprotein 120 via Toll-like-receptor 2 pathway acts to protect the mucosal barrier.

    Science.gov (United States)

    Nazli, Aisha; Dizzell, Sara; Zahoor, Muhammad Atif; Ferreira, Victor H; Kafka, Jessica; Woods, Matthew William; Ouellet, Michel; Ashkar, Ali A; Tremblay, Michel J; Bowdish, Dawn Me; Kaushic, Charu

    2018-03-19

    More than 40% of HIV infections occur via female reproductive tract (FRT) through heterosexual transmission. Epithelial cells that line the female genital mucosa are the first line of defense against HIV-1 and other sexually transmitted pathogens. These sentient cells recognize and respond to external stimuli by induction of a range of carefully balanced innate immune responses. Previously, we have shown that in response to HIV-1 gp120, the genital epithelial cells (GECs) from upper reproductive tract induce an inflammatory response that may facilitate HIV-1 translocation and infection. In this study, we report that the endometrial and endocervical GECs simultaneously induce biologically active interferon-β (IFNβ) antiviral responses following exposure to HIV-1 that act to protect the epithelial tight junction barrier. The innate antiviral response was directly induced by HIV-1 envelope glycoprotein gp120 and addition of gp120 neutralizing antibody inhibited IFNβ production. Interferon-β was induced by gp120 in upper GECs through Toll-like receptor 2 signaling and required presence of heparan sulfate on epithelial cell surface. The induction of IFNβ was dependent upon activation of transcription factor IRF3 (interferon regulatory factor 3). The IFNβ was biologically active, had a protective effect on epithelial tight junction barrier and was able to inhibit HIV-1 infection in TZM-bl indicator cells and HIV-1 replication in T cells. This is the first report that recognition of HIV-1 by upper GECs leads to induction of innate antiviral pathways. This could explain the overall low infectivity of HIV-1 in the FRT and could be exploited for HIV-1 prophylaxis.Cellular and Molecular Immunology advance online publication, 19 March 2018; doi:10.1038/cmi.2017.168.

  11. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  12. Single-dose mucosal immunization with a candidate universal influenza vaccine provides rapid protection from virulent H5N1, H3N2 and H1N1 viruses.

    Directory of Open Access Journals (Sweden)

    Graeme E Price

    2010-10-01

    Full Text Available The sudden emergence of novel influenza viruses is a global public health concern. Conventional influenza vaccines targeting the highly variable surface glycoproteins hemagglutinin and neuraminidase must antigenically match the emerging strain to be effective. In contrast, "universal" vaccines targeting conserved viral components could be used regardless of viral strain or subtype. Previous approaches to universal vaccination have required protracted multi-dose immunizations. Here we evaluate a single dose universal vaccine strategy using recombinant adenoviruses (rAd expressing the conserved influenza virus antigens matrix 2 and nucleoprotein.In BALB/c mice, administration of rAd via the intranasal route was superior to intramuscular immunization for induction of mucosal responses and for protection against highly virulent H1N1, H3N2, or H5N1 influenza virus challenge. Mucosally vaccinated mice not only survived, but had little morbidity and reduced lung virus titers. Protection was observed as early as 2 weeks post-immunization, and lasted at least 10 months, as did antibodies and lung T cells with activated phenotypes. Virus-specific IgA correlated with but was not essential for protection, as demonstrated in studies with IgA-deficient animals.Mucosal administration of NP and M2-expressing rAd vectors provided rapid and lasting protection from influenza viruses in a subtype-independent manner. Such vaccines could be used in the interval between emergence of a new virus strain and availability of strain-matched vaccines against it. This strikingly effective single-dose vaccination thus represents a candidate off-the-shelf vaccine for emergency use during an influenza pandemic.

  13. The mucosal Immune Response Induced in Chicks Immunized with LactobaciUus casei anchoring NDV HN Protein%锚定NDVHN蛋白重组干酪乳杆菌诱导雏鸡黏膜免疫应答

    Institute of Scientific and Technical Information of China (English)

    孙景秀; 王桂华; 侯喜林; 余丽芸; 田斌; 侯瑞峰; 朱娉慧; 周婷婷; 齐浩

    2012-01-01

    以干酪乳杆菌作为呈递抗原活载体,表达新城疫病毒保护性抗原HN蛋白。重组于酪乳杆菌表达外源蛋白后,经SDS-PAGE、Westernblot及间接免疫荧光分析,表明目的蛋白表达并展示到乳酸菌表面。将重组菌及空质粒菌株分别滴鼻、点眼免疫雏鸡,于不同时间检测血清样品中特异性IgG;于三免后不同时间采集雏鸡的泪液、气管洗液、胆汁和肠洗液样品,采用间接ELISA方法检测样品的特异性sIgA;用MTY法检测免疫鸡脾淋巴细胞增殖情况,结果显示重组干酪乳杆菌表达系统能刺激动物黏膜免疫反应和系统免疫反应。%Neweasfle disease virus (NDV) HN antigen was expressed by the recombinant Lactobacillus casei. The HN protein was surface-displayed on the L.casei verified by Immunofluorescence Microscopy, SDS-PAGE and Western blot. Intranasal and eye dropping immunized chicks was performed with the recombinant strain L. casei harboring pLA-HN or pLA. Specific anti-HN IgG antibody in the serum and specific anti-HN secret immunoglobulin A(sIgA) antibody in the lung and intestine fluid, tear and bile of chicken were detected by indirect ELISA.T-cell proliferation responses were investigated by MTT test. The results demonstrated that the recombinant L.casei could induce the mucosal and systemic immunity.

  14. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  15. Trypanosome infection establishment in the tsetse fly gut is influenced by microbiome-regulated host immune barriers.

    Directory of Open Access Journals (Sweden)

    Brian L Weiss

    Full Text Available Tsetse flies (Glossina spp. vector pathogenic African trypanosomes, which cause sleeping sickness in humans and nagana in domesticated animals. Additionally, tsetse harbors 3 maternally transmitted endosymbiotic bacteria that modulate their host's physiology. Tsetse is highly resistant to infection with trypanosomes, and this phenotype depends on multiple physiological factors at the time of challenge. These factors include host age, density of maternally-derived trypanolytic effector molecules present in the gut, and symbiont status during development. In this study, we investigated the molecular mechanisms that result in tsetse's resistance to trypanosomes. We found that following parasite challenge, young susceptible tsetse present a highly attenuated immune response. In contrast, mature refractory flies express higher levels of genes associated with humoral (attacin and pgrp-lb and epithelial (inducible nitric oxide synthase and dual oxidase immunity. Additionally, we discovered that tsetse must harbor its endogenous microbiome during intrauterine larval development in order to present a parasite refractory phenotype during adulthood. Interestingly, mature aposymbiotic flies (Gmm(Apo present a strong immune response earlier in the infection process than do WT flies that harbor symbiotic bacteria throughout their entire lifecycle. However, this early response fails to confer significant resistance to trypanosomes. Gmm(Apo adults present a structurally compromised peritrophic matrix (PM, which lines the fly midgut and serves as a physical barrier that separates luminal contents from immune responsive epithelial cells. We propose that the early immune response we observe in Gmm(Apo flies following parasite challenge results from the premature exposure of gut epithelia to parasite-derived immunogens in the absence of a robust PM. Thus, tsetse's PM appears to regulate the timing of host immune induction following parasite challenge. Our results

  16. Microneedle and mucosal delivery of influenza vaccines

    Science.gov (United States)

    Kang, Sang-Moo; Song, Jae-Min; Kim, Yeu-Chun

    2017-01-01

    In recent years with the threat of pandemic influenza and other public health needs, alternative vaccination methods other than intramuscular immunization have received great attention. The skin and mucosal surfaces are attractive sites probably because of both non-invasive access to the vaccine delivery and unique immunological responses. Intradermal vaccines using a microinjection system (BD Soluvia) and intranasal vaccines (FluMist) are licensed. As a new vaccination method, solid microneedles have been developed using a simple device that may be suitable for self-administration. Because coated micorneedle influenza vaccines are administered in the solid state, developing formulations maintaining the stability of influenza vaccines is an important issue to be considered. Marketable microneedle devices and clinical trials remain to be developed. Other alternative mucosal routes such as oral and intranasal delivery systems are also attractive for inducing cross protective mucosal immunity but effective non-live mucosal vaccines remain to be developed. PMID:22697052

  17. Effects of Combined CCR5/Integrase Inhibitors-Based Regimen on Mucosal Immunity in HIV-Infected Patients Naïve to Antiretroviral Therapy: A Pilot Randomized Trial.

    Directory of Open Access Journals (Sweden)

    Sergio Serrano-Villar

    2016-01-01

    Full Text Available Whether initiation of antiretroviral therapy (ART regimens aimed at achieving greater concentrations within gut associated lymphoid tissue (GALT impacts the level of mucosal immune reconstitution, inflammatory markers and the viral reservoir remains unknown. We included 12 HIV- controls and 32 ART-naïve HIV patients who were randomized to efavirenz, maraviroc or maraviroc+raltegravir, each with fixed-dose tenofovir disoproxil fumarate/emtricitabine. Rectal and duodenal biopsies were obtained at baseline and at 9 months of ART. We performed a comprehensive assay of T-cell subsets by flow cytometry, T-cell density in intestinal biopsies, plasma and tissue concentrations of antiretroviral drugs by high-performance liquid chromatography/mass spectroscopy, and plasma interleukin-6 (IL-6, lipoteichoic acid (LTA, soluble CD14 (sCD14 and zonulin-1 each measured by ELISA. Total cell-associated HIV DNA was measured in PBMC and rectal and duodenal mononuclear cells. Twenty-six HIV-infected patients completed the follow-up. In the duodenum, the quadruple regimen resulted in greater CD8+ T-cell density decline, greater normalization of mucosal CCR5+CD4+ T-cells and increase of the naïve/memory CD8+ T-cell ratio, and a greater decline of sCD14 levels and duodenal HIV DNA levels (P = 0.004 and P = 0.067, respectively, with no changes in HIV RNA in plasma or tissue. Maraviroc showed the highest drug distribution to the gut tissue, and duodenal concentrations correlated well with other T-cell markers in duodenum, i.e., the CD4/CD8 ratio, %CD4+ and %CD8+ HLA-DR+CD38+ T-cells. Maraviroc use elicited greater activation of the mucosal naïve CD8+ T-cell subset, ameliorated the distribution of the CD8+ T-cell maturational subsets and induced higher improvement of zonulin-1 levels. These data suggest that combined CCR5 and integrase inhibitor based combination therapy in ART treatment naïve patients might more effectively reconstitute duodenal immunity, decrease

  18. Cystic fibrosis: a mucosal immunodeficiency syndrome

    Science.gov (United States)

    Cohen, Taylor Sitarik; Prince, Alice

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) functions as a channel that regulates the transport of ions and the movement of water across the epithelial barrier. Mutations in CFTR, which form the basis for the clinical manifestations of cystic fibrosis, affect the epithelial innate immune function in the lung, resulting in exaggerated and ineffective airway inflammation that fails to eradicate pulmonary pathogens. Compounding the effects of excessive neutrophil recruitment, the mutant CFTR channel does not transport antioxidants to counteract neutrophil-associated oxidative stress. Whereas mutant CFTR expression in leukocytes outside of the lung does not markedly impair their function, the expected regulation of inflammation in the airways is clearly deficient in cystic fibrosis. The resulting bacterial infections, which are caused by organisms that have substantial genetic and metabolic flexibility, can resist multiple classes of antibiotics and evade phagocytic clearance. The development of animal models that approximate the human pulmonary phenotypes—airway inflammation and spontaneous infection—may provide the much-needed tools to establish how CFTR regulates mucosal immunity and to test directly the effect of pharmacologic potentiation and correction of mutant CFTR function on bacterial clearance. PMID:22481418

  19. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  20. Manipulation of the gut microbiota in C57BL/6 mice changes glucose tolerancewithout affecting weight development and gut mucosal immunity

    DEFF Research Database (Denmark)

    Bech-Nielsen, Gunilla Veslemöy; Hansen, Camilla Hartmann Friis; Hufeldt, Majbritt Ravn

    2012-01-01

    Inflammatory diseases such as type 2 diabetes (T2D) in humans and mice are under the influence of the composition of the gut microbiota (GM). It was previously demonstrated that treating Lepob mice with antibiotics improved glucose tolerance. However, wild type C57BL/6J mice may also exhibit plasma...... glucose tolerance without significantly affecting the weight or the number of gut mucosal regulatory T cells, tolerogenic dendritic cells or T helper cells type 1. 16S rRNA gene based denaturing gradient gel electrophoresis profiles clearly clustered according to treatment and showed that antibiotic...

  1. Stimulation of mucosal immune response following oral administration of enterotoxigenic Escherichia coli fimbriae (CFA/I) entrapped in liposomes in conjunction with inactivated whole-cell Vibrio cholerae vaccine.

    Science.gov (United States)

    Dima, V F; Ionescu, M D; Palade, R; Balotescu, C; Becheanu, G; Dima, S V

    2001-01-01

    In this study, we have searched for an effective mucosal vaccine. An oral enterotoxigenic E. coli vaccine containing colonization factor antigen (CFA/I) associated with inactivated whole-cell V. cholerae vaccine (WCV) has been tested for safety and immunogenicity in animals. Five groups of animals were used. The results showed the following: (a) vaccine containing CFA/I antigen entrapped in liposomes and associated with WCV (batch C) had increased titers of specific antibodies to CFA/I antigen in 15 to 18 (83.3%) animals; (b) specific Peyer's patches (PP), lymph nodes (LN) and spleen (SPL) lymphocytes proliferation was detected following in vitro restimulation with CFA/I antigen or WCV. This response gradually increased to the highest value by the 35th postimmunization day. Moreover, lower PP, LN and spleen (SPL) proliferation was observed in rabbits receiving soluble CFA/I antigen (S-CFA/I) or free liposomes (F-L) alone; (c) adhesion of E. coli H10407 strain labelled with 3H-leucine in immunized and control animals revealed the following local effects: (i) protection of rabbit intestinal mucosa against virulent E. coli cells; (ii) inhibition of adhesion of ETEC bacteria to intestinal mucosa and (iii) significantly faster release of E. coli H 10407 strain labelled with 3H-leucine from the intestinal tract of immunized animals. The histopathological and electron microscope findings confirmed the above results. The experimental results point out an efficient protection against infection with E. coli strains (ETEC), after mucosal vaccination with CFA/I antigen entrapped in liposomes associated with inactivated whole-cell Vibrio cholerae as immunological adjuvant.

  2. Involvement of Innate Immunity in the Development of Inflammatory and Autoimmune Diseases

    Czech Academy of Sciences Publication Activity Database

    Tlaskalová, Helena; Tučková, Ludmila; Štěpánková, Renata; Hudcovic, Tomáš; Palová-Jelínková, Lenka; Kozáková, Hana; Rossmann, Pavel; Sánchez, Daniel; Cinová, Jana; Hrnčíř, Tomáš; Kverka, Miloslav; Frolová, Lenka; Uhlig, H.; Powrie, F.; Bland, P.

    2005-01-01

    Roč. 1051, - (2005), s. 787-798 ISSN 0077-8923 R&D Projects: GA AV ČR IAA5020205; GA AV ČR KJB5020407; GA ČR GA310/05/2245; GA ČR GD310/03/H147; GA ČR GP310/04/P242; GA AV ČR IBS5020203; GA MZd NR8356 Institutional research plan: CEZ:AV0Z50200510 Keywords : innate immunity * mucosal immunity * mucosal barrier Subject RIV: EE - Microbiology, Virology Impact factor: 1.971, year: 2005

  3. Facilitators and barriers for RhD-immunized women to become and remain anti-D donors.

    Science.gov (United States)

    Slootweg, Yolentha Maria; Koelewijn, Johanna Maria; de Kort, Wim L; de Haas, Masja; Merz, Eva-Maria

    2018-04-01

    The successful introduction of prophylaxis with anti-RhD immunoglobulin has resulted in a significant decline of pregnancy-related RhD immunizations but also has decreased the availability of naturally immunized women as (new) anti-D donors. An influx of new donors is necessary to maintain a sufficient pool of anti-D donors. We investigated motivators, barriers, and predictors for anti-D donorship in RhD-immunized women. A mixed-methods design was applied, including focus group discussions and questionnaires. Two focus groups (including 11 women) served as input for the questionnaire. In total, 47.6% of 750 anti-D donors and potential donors completed the questionnaire (50.4% donors; 38% nondonors; 11.6% former donors). Almost 70% of the nondonors would have become donors if they had known about the possibility. Travel time investment was reported as a disadvantage; one-half of donors mentioned no disadvantages. Motivators for anti-D donorship were "doing something in return" (31.2%) and "preventing others having a sick child or losing a child" (33.9%). In multivariable analysis, living single (odds ratio, 5.8; p = 0.02) and living partnered without resident children (odds ratio, 7.9; p = 0.03), compared with living partnered with children, were predictors for anti-D donorship. Not being registered as an organ donor (odds ratio, 0.25; p anti-D donor. The main barrier for anti-D donorship was a lack of knowledge. Positive predictors of anti-D donorship were living without resident children, altruism, and being registered as an organ donor. A blood bank should develop targeted recruitment strategies with a focus on spreading knowledge about anti-D donorship among RhD-immunized women. © 2018 AABB.

  4. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Salmonella Typhi Colonization Provokes Extensive Transcriptional Changes Aimed at Evading Host Mucosal Immune Defense During Early Infection of Human Intestinal Tissue

    Directory of Open Access Journals (Sweden)

    K.P. Nickerson

    2018-05-01

    Full Text Available Commensal microorganisms influence a variety of host functions in the gut, including immune response, glucose homeostasis, metabolic pathways and oxidative stress, among others. This study describes how Salmonella Typhi, the pathogen responsible for typhoid fever, uses similar strategies to escape immune defense responses and survive within its human host. To elucidate the early mechanisms of typhoid fever, we performed studies using healthy human intestinal tissue samples and “mini-guts,” organoids grown from intestinal tissue taken from biopsy specimens. We analyzed gene expression changes in human intestinal specimens and bacterial cells both separately and after colonization. Our results showed mechanistic strategies that S. Typhi uses to rearrange the cellular machinery of the host cytoskeleton to successfully invade the intestinal epithelium, promote polarized cytokine release and evade immune system activation by downregulating genes involved in antigen sampling and presentation during infection. This work adds novel information regarding S. Typhi infection pathogenesis in humans, by replicating work shown in traditional cell models, and providing new data that can be applied to future vaccine development strategies. Keywords: Typhoid fever, Salmonella, Snapwell™ system, Human tissue, Terminal ileum, Immune system, Innate immunity, Immune evasion, Host-pathogen interaction, Vaccine development, Intestinal organoids, Organoid monolayer

  6. Preoperative care of Polypoid exposed mucosal template in bladder exstrophy: the role of high-barrier plastic wraps in reducing inflammation and polyp size.

    Science.gov (United States)

    Sabetkish, Nastaran; Sabetkish, Shabnam; Kajbafzadeh, Abdol-Mohammad

    2018-01-26

    To assess the role of high-barrier plastic wrap in reducing the number and size of polyps, as well as decreasing the inflammation and allergic reactions in exstrophy cases, and to compare the results with the application of low-barrier wrap. Eight patients with bladder exstrophy-epispadias complex (BEEC) that had used a low density polyethylene (LDPE) wrap for coverage of the exposed polypoid bladder in preoperative care management were referred. The main complaint of their parents was increase in size and number of polyps. After a period of 2 months using the same wrap and observing the increasing pattern in size of polyps, these patients were recommended to use a high-barrier wrap which is made of polyvinylidene chloride (PVdC), until closure. Patients were monitored for the number and size of polyps before and after the change of barriers. The incidence of para-exstrophy skin infection/inflammation and skin allergy were assessed. Biopsies were taken from the polyps to identify histopathological characteristics of the exposed polyps. The high barrier wrap was applied for a mean ± SD duration of 12±2.1 months. Polyps' size and number decreased after 12 months. No allergic reaction was detected in patients after the usage of PVdC; three patients suffered from low-grade skin allergy when LDPE was applied. Also, pre-malignant changes were observed in none of the patients in histopathological examination after the application of PVdC. Polyps' size and number and skin allergy may significantly decrease with the use of a high-barrier wrap. Certain PVdC wraps with more integrity and less evaporative permeability may be more "exstrophy-friendly". Copyright® by the International Brazilian Journal of Urology.

  7. Chitosan-Based Nanoparticles for Mucosal Delivery of RNAi Therapeutics

    DEFF Research Database (Denmark)

    Martirosyan, Alina; Olesen, Morten Jarlstad; Howard, Kenneth A.

    2014-01-01

    of the polysaccharide chitosan have been used to facilitate delivery of siRNA across mucosal surfaces following local administration. This chapter describes the mucosal barriers that need to be addressed in order to design an effective mucosal delivery strategy and the utilization of the mucoadhesive properties...... of chitosan. Focus is given to preparation methods and the preclinical application of chitosan nanoparticles for respiratory and oral delivery of siRNA....

  8. The effects of Lactobacillus plantarum on small intestinal barrier function and mucosal gene transcription; a randomized double-blind placebo controlled trial

    NARCIS (Netherlands)

    Mujagic, Zlatan; Vos, de Paul; Boekschoten, Mark; Govers, Coen; Pieters, Harm J.H.M.; Wit, de Nicole; Bron, Peter A.; Masclee, Ad A.M.; Troost, Freddy J.

    2017-01-01

    The aim of this study was to investigate the effects of three Lactobacillus plantarum strains on in-vivo small intestinal barrier function and gene transcription in human subjects. The strains were selected for their differential effects on TLR signalling and tight junction protein rearrangement,

  9. Dietary peppermint (Mentha piperita) extracts promote growth performance and increase the main humoral immune parameters (both at mucosal and systemic level) of Caspian brown trout (Salmo trutta caspius Kessler, 1877).

    Science.gov (United States)

    Adel, Milad; Safari, Reza; Pourgholam, Reza; Zorriehzahra, Jalil; Esteban, Maria Ángeles

    2015-11-01

    The effects of dietary administration of peppermint (Mentha piperita L.) on Caspian brown trout fish (Salmo trutta caspius) were studied. Fish were divided into 4 groups before being fed diets supplemented with 0% (control), 1%, 2% and 3% of peppermint extracts for 8 weeks. Dose-dependent increases in growth, immune (both in skin mucus and blood serum) and hematological parameters (number of white cells, hematocrit and hemoglobin content), as well as in amylase activity and in the number of lactic acid bacteria on intestine were recorded in fish fed supplemented diets compared to control fish. However, the dietary peppermint supplements have different effects on the number of blood leucocytes depending on the leukocyte cell type. While no significant differences were observed in the number of blood monocytes and eosinophils, the number of lymphocytes was decreased, respectively, on fish fed peppermint enriched diets, respect to the values found in control fish. Furthermore, dietary peppermint supplements have no significant effect on blood biochemical parameters, enzymatic activities of liver determined in serum and total viable aerobic bacterial count on intestine of Caspian brown trout. Present results support that dietary administration of peppermint promotes growth performance and increases the main humoral immune parameters (both at mucosal and systemic level) and the number of the endogenous lactic acid bacteria of Caspian brown trout. This study underlying several positive effects of dietary administration of peppermint to farmed fish. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Local oral immunization with synthetic peptides induces a dual mucosal IgG and salivary IgA antibody response and prevents colonization of Streptococcus mutans.

    Science.gov (United States)

    Lehner, T; Haron, J; Bergmeier, L A; Mehlert, A; Beard, R; Dodd, M; Mielnik, B; Moore, S

    1989-01-01

    A small cell surface antigen of Streptococcus mutans was partially sequenced and the amino terminal peptides of 11, 15 and 20 amino acid residues and a dimer of the 15 and 20 residues peptides were synthesized. The synthetic peptides (SP) were used in topical oral immunization of the gingivomucosal epithelium of macaque monkeys. Sequential examination for antibodies over a period of up to 30 weeks revealed that six applications of the linear or cyclized SP11 and a random SP11 induced negligible or very low antibody levels. In contrast, the SP17 (SP15 with added cysteine at each terminus), SP21 (SP20 with one cysteine) and the dimer (SP35) induced significant anti-SP as well as anti-native streptococcal antibodies in the gingival fluid and in saliva. The functional significance of this immune response was examined by studying its effect on oral colonization of S. mutans following feeding of a carbohydrate-rich diet. Whereas control animals, sham-immunized with a random SP of 11 residues, showed increased colonization of the teeth by S. mutans, there was no colonization or a significant reduction in colonization of animals immunized with the cyclized SP17, linear SP21 or dimerized SP35. These experiments suggest that local immunization with SP derived from the sequences of a streptococcal cell surface antigen induce a dual local immune response of gingival IgG and salivary IgA antibodies against the SP and native SA. These antibodies may be involved in preventing colonization of S. mutans, which is the principal agent in the development of dental caries. PMID:2759661

  11. A single intranasal immunization with a subunit vaccine formulation induces higher mucosal IgA production than live respiratory syncytial virus

    International Nuclear Information System (INIS)

    Garg, Ravendra; Theaker, Michael; Martinez, Elisa C.; Drunen Littel-van den Hurk, Sylvia van

    2016-01-01

    Respiratory syncytial virus (RSV) causes serious respiratory illness in infants and elderly. RSV infection induces short-lived immunity, which leaves people prone to re-infection. In contrast, the RSV fusion (F) protein formulated with a novel adjuvant (∆F/TriAdj) elicits long term protective immunity. A comparison of RSV-immunized mice to mice vaccinated with a single dose of ∆F/TriAdj showed no difference in IgG1 and IgG2a production; however, local IgA secreting memory B cell development and B cell IgA production were significantly lower in RSV vaccinated mice than in ∆F/TriAdj-immunized mice. This indicates a potential reason as to why long-term immunity is not induced by RSV infection. The comparison also revealed that germinal center lymphocyte populations were higher in ∆F/TriAdj-vaccinated mice. Furthermore, ∆F/TriAdj induced higher gene expression of activation-induced cytidine deaminase (AID), as well as IL-6, IL-21, TGF-β cytokines, which are key players in IgA class switch recombination, ultimately leading to a sustained long-term memory response. - Highlights: •Immune responses to adjuvanted RSV F protein, ∆F/TriAdj, and RSV were compared. •∆F/TriAdj stimulates more local IgA production than RSV. •∆F/TriAdj induces more local IgA secreting memory B cells than RSV. •Germinal center lymphocyte populations are higher in ∆F/TriAdj-vaccinated mice. •∆F/TriAdj induces higher gene expression of AID, IL-6, IL-21, and TGF-β than RSV.

  12. A single intranasal immunization with a subunit vaccine formulation induces higher mucosal IgA production than live respiratory syncytial virus

    Energy Technology Data Exchange (ETDEWEB)

    Garg, Ravendra [VIDO-InterVac, University of Saskatchewan, Saskatoon, SK S7N 5E3 (Canada); Theaker, Michael [Microbiology & Immunology, University of Saskatchewan, Saskatoon, SK S7N 5E3 (Canada); Martinez, Elisa C. [VIDO-InterVac, University of Saskatchewan, Saskatoon, SK S7N 5E3 (Canada); Microbiology & Immunology, University of Saskatchewan, Saskatoon, Canada SK S7N 5E3 (Canada); Drunen Littel-van den Hurk, Sylvia van, E-mail: sylvia.vandenhurk@usask.ca [VIDO-InterVac, University of Saskatchewan, Saskatoon, SK S7N 5E3 (Canada); Microbiology & Immunology, University of Saskatchewan, Saskatoon, SK S7N 5E3 (Canada)

    2016-12-15

    Respiratory syncytial virus (RSV) causes serious respiratory illness in infants and elderly. RSV infection induces short-lived immunity, which leaves people prone to re-infection. In contrast, the RSV fusion (F) protein formulated with a novel adjuvant (∆F/TriAdj) elicits long term protective immunity. A comparison of RSV-immunized mice to mice vaccinated with a single dose of ∆F/TriAdj showed no difference in IgG1 and IgG2a production; however, local IgA secreting memory B cell development and B cell IgA production were significantly lower in RSV vaccinated mice than in ∆F/TriAdj-immunized mice. This indicates a potential reason as to why long-term immunity is not induced by RSV infection. The comparison also revealed that germinal center lymphocyte populations were higher in ∆F/TriAdj-vaccinated mice. Furthermore, ∆F/TriAdj induced higher gene expression of activation-induced cytidine deaminase (AID), as well as IL-6, IL-21, TGF-β cytokines, which are key players in IgA class switch recombination, ultimately leading to a sustained long-term memory response. - Highlights: •Immune responses to adjuvanted RSV F protein, ∆F/TriAdj, and RSV were compared. •∆F/TriAdj stimulates more local IgA production than RSV. •∆F/TriAdj induces more local IgA secreting memory B cells than RSV. •Germinal center lymphocyte populations are higher in ∆F/TriAdj-vaccinated mice. •∆F/TriAdj induces higher gene expression of AID, IL-6, IL-21, and TGF-β than RSV.

  13. Mucosal immunogenicity of plant lectins in mice

    Science.gov (United States)

    Lavelle, E C; Grant, G; Pusztai, A; Pfüller, U; O’Hagan, D T

    2000-01-01

    The mucosal immunogenicity of a number of plant lectins with different sugar specificities was investigated in mice. Following intranasal (i.n.) or oral administration, the systemic and mucosal antibody responses elicited were compared with those induced by a potent mucosal immunogen (cholera toxin; CT) and a poorly immunogenic protein (ovalbumin; OVA). After three oral or i.n. doses of CT, high levels of specific serum antibodies were measured and specific IgA was detected in the serum, saliva, vaginal wash, nasal wash and gut wash of mice. Immunization with OVA elicited low titres of serum IgG but specific IgA was not detected in mucosal secretions. Both oral and i.n. delivery of all five plant lectins investigated [Viscum album (mistletoe lectin 1; ML‐1), Lycospersicum esculentum (tomato lectin; LEA), Phaseolus vulgaris (PHA), Triticum vulgaris (wheat germ agglutinin (WGA), Ulex europaeus I (UEA‐1)] stimulated the production of specific serum IgG and IgA antibody after three i.n. or oral doses. Immunization with ML‐1 induced high titres of serum IgG and IgA in addition to specific IgA in mucosal secretions. The response to orally delivered ML‐1 was comparable to that induced by CT, although a 10‐fold higher dose was administered. Immunization with LEA also induced high titres of serum IgG, particularly after i.n. delivery. Low specific IgA titres were also detected to LEA in mucosal secretions. Responses to PHA, WGA and UEA‐1 were measured at a relatively low level in the serum, and little or no specific mucosal IgA was detected. PMID:10651938

  14. Intradermal delivery of Shigella IpaB and IpaD type III secretion proteins: kinetics of cell recruitment and antigen uptake, mucosal and systemic immunity, and protection across serotypes.

    Science.gov (United States)

    Heine, Shannon J; Diaz-McNair, Jovita; Andar, Abhay U; Drachenberg, Cinthia B; van de Verg, Lillian; Walker, Richard; Picking, Wendy L; Pasetti, Marcela F

    2014-02-15

    Shigella is one of the leading pathogens contributing to the vast pediatric diarrheal disease burden in low-income countries. No licensed vaccine is available, and the existing candidates are only partially effective and serotype specific. Shigella type III secretion system proteins IpaB and IpaD, which are conserved across Shigella spp., are candidates for a broadly protective, subunit-based vaccine. In this study, we investigated the immunogenicity and protective efficacy of IpaB and IpaD administered intradermally (i.d.) with a double-mutant of the Escherichia coli heat-labile enterotoxin (dmLT) adjuvant using microneedles. Different dosage levels of IpaB and IpaD, with or without dmLT, were tested in mice. Vaccine delivery into the dermis, recruitment of neutrophils, macrophages, dendritic cells, and Langerhans cells, and colocalization of vaccine Ag within skin-activated APC were demonstrated through histology and immunofluorescence microscopy. Ag-loaded neutrophils, macrophages, dendritic cells, and Langerhans cells remained in the tissue at least 1 wk. IpaB, IpaD, and dmLT-specific serum IgG- and IgG-secreting cells were produced following i.d. immunization. The protective efficacy was 70% against Shigella flexneri and 50% against Shigella sonnei. Similar results were obtained when the vaccine was administered intranasally, with the i.d. route requiring 25-40 times lower doses. Distinctively, IgG was detected in mucosal secretions; secretory IgA, as well as mucosal and systemic IgA Ab-secreting cells, were seemingly absent. Vaccine-induced T cells produced IFN-γ, IL-2, TNF-α, IL-17, IL-4, IL-5, and IL-10. These results demonstrate the potential of i.d. vaccination with IpaB and IpaD to prevent Shigella infection and support further studies in humans.

  15. Lactobacillus plantarum Strains Can Enhance Human Mucosal and Systemic Immunity and Prevent Non-steroidal Anti-inflammatory Drug Induced Reduction in T Regulatory Cells

    NARCIS (Netherlands)

    de Vos, Paul; Mujagic, Zlatan; de Haan, Bart J.; Siezen, Roland J.; Bron, Peter A.; Meijerink, Marjolein; Wells, Jerry M.; Masclee, Ad A. M.; Boekschoten, Mark V.; Faas, Marijke M.; Troost, Freddy J.

    2017-01-01

    Orally ingested bacteria interact with intestinal mucosa and may impact immunity. However, insights in mechanisms involved are limited. In this randomized placebo-controlled cross-over trial, healthy human subjects were given Lactobacillus plantarum supplementation (strain TIFN101, CIP104448, or

  16. Lactobacillus plantarum strains can enhance human mucosal and systemic immunity and prevent non-steroidal anti-inflammatory drug induced reduction in T regulatory Cells

    NARCIS (Netherlands)

    Vos, de Paul; Mujagic, Zlatan; Haan, de Bart J.; Siezen, Roland J.; Bron, Peter A.; Meijerink, Marjolein; Wells, Jerry M.; Masclee, Ad A.M.; Boekschoten, Mark V.; Faas, Marijke M.; Troost, Freddy J.

    2017-01-01

    Orally ingested bacteria interact with intestinal mucosa and may impact immunity. However, insights in mechanisms involved are limited. In this randomized placebo-controlled cross-over trial, healthy human subjects were given Lactobacillus plantarum supplementation (strain TIFN101, CIP104448, or

  17. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

    Science.gov (United States)

    Shao, Yujing; Guo, Yuming; Wang, Zhong

    2013-07-01

    This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

  18. A Cross-Talk Between Microbiota-Derived Short-Chain Fatty Acids and the Host Mucosal Immune System Regulates Intestinal Homeostasis and Inflammatory Bowel Disease.

    Science.gov (United States)

    Gonçalves, Pedro; Araújo, João Ricardo; Di Santo, James P

    2018-02-15

    Gut microbiota has a fundamental role in the energy homeostasis of the host and is essential for proper "education" of the immune system. Intestinal microbial communities are able to ferment dietary fiber releasing short-chain fatty acids (SCFAs). The SCFAs, particularly butyrate (BT), regulate innate and adaptive immune cell generation, trafficing, and function. For example, BT has an anti-inflammatory effect by inhibiting the recruitment and proinflammatory activity of neutrophils, macrophages, dendritic cells, and effector T cells and by increasing the number and activity of regulatory T cells. Gut microbial dysbiosis, ie, a microbial community imbalance, has been suggested to play a role in the development of inflammatory bowel disease (IBD). The relationship between dysbiosis and IBD has been difficult to prove, especially in humans, and is probably complex and dynamic, rather than one of a simple cause and effect relationship. However, IBD patients have dysbiosis with reduced numbers of SCFAs-producing bacteria and reduced BT concentration that is linked to a marked increase in the number of proinflammatory immune cells in the gut mucosa of these patients. Thus, microbial dysbiosis and reduced BT concentration may be a factor in the emergence and severity of IBD. Understanding the relationship between microbial dysbiosis and reduced BT concentration to IBD may lead to novel therapeutic interventions.

  19. Curcumin protects intestinal mucosal barrier function of rat enteritis via activation of MKP-1 and attenuation of p38 and NF-κB activation.

    Directory of Open Access Journals (Sweden)

    Wei-Bing Song

    Full Text Available BACKGROUND: Intestinal mucosa barrier (IMB dysfunction results in many notorious diseases for which there are currently few effective treatments. We studied curcumin's protective effect on IMB and examined its mechanism by using methotrexate (MTX induced rat enteritis model and lipopolysaccharide (LPS treated cell death model. METHODOLOGY/PRINCIPAL FINDINGS: Curcumin was intragastrically administrated from the first day, models were made for 7 days. Cells were treated with curcumin for 30 min before exposure to LPS. Rat intestinal mucosa was collected for evaluation of pathological changes. We detected the activities of D-lactate and diamine oxidase (DAO according to previous research and measured the levels of myeloperoxidase (MPO and superoxide dismutase (SOD by colorimetric method. Intercellular adhesion molecule-1 (ICAM-1, tumor necrosis factor α (TNF-α and interleukin 1β (IL-1β were determined by RT-PCR and IL-10 production was determined by ELISA. We found Curcumin decreased the levels of D-lactate, DAO, MPO, ICAM-1, IL-1β and TNF-α, but increased the levels of IL-10 and SOD in rat models. We further confirmed mitogen-activated protein kinase phosphatase-1 (MKP-1 was activated but phospho-p38 was inhibited by curcumin by western blot assay. Finally, NF-κB translocation was monitored by immunofluorescent staining. We showed that curcumin repressed I-κB and interfered with the translocation of NF-κB into nucleus. CONCLUSIONS/SIGNIFICANCE: The effect of curcumin is mediated by the MKP-1-dependent inactivation of p38 and inhibition of NF-κB-mediated transcription. Curcumin, with anti-inflammatory and anti-oxidant activities may be used as an effective reagent for protecting intestinal mucosa barrier and other related intestinal diseases.

  20. Novel Role for Interleukin-17 in Enhancing Type 1 Helper T Cell Immunity in the Female Genital Tract following Mucosal Herpes Simplex Virus 2 Vaccination.

    Science.gov (United States)

    Bagri, Puja; Anipindi, Varun C; Nguyen, Philip V; Vitali, Danielle; Stämpfli, Martin R; Kaushic, Charu

    2017-12-01

    It is well established that interferon gamma (IFN-γ) production by CD4 + T cells is critical for antiviral immunity against herpes simplex virus 2 (HSV-2) genital infection. However, the role of interleukin-17A (IL-17A) production by CD4 + T cells in HSV-2 antiviral immunity is yet to be elucidated. Here we demonstrate that IL-17A plays an important role in enhancing antiviral T helper type 1 (T h 1) responses in the female genital tract (FGT) and is essential for effective protection conferred by HSV-2 vaccination. While IL-17A did not play a critical role during primary genital HSV-2 infection, seen by lack of differences in susceptibility between IL-17A-deficient ( IL-17A -/- ) and wild-type (WT) C57BL/6 mice, it was critical for mediating antiviral responses after challenge/reexposure. Compared to WT mice, IL-17A -/- mice (i) infected intravaginally and reexposed or (ii) vaccinated intranasally and challenged intravaginally demonstrated poor outcomes. Following intravaginal HSV-2 reexposure or challenge, vaccinated IL-17A -/- mice had significantly higher mortality, greater disease severity, higher viral shedding, and higher levels of proinflammatory cytokines and chemokines in vaginal secretions. Furthermore, IL-17A -/- mice had impaired T h 1 cell responses after challenge/reexposure, with significantly lower proportions of vaginal IFN-γ + CD4 + T cells. The impaired T h 1 cell responses in IL-17A -/- mice coincided with smaller populations of IFN-γ + CD4 + tissue resident memory T (T RM ) cells in the genital tract postimmunization. Taken together, these findings describe a novel role for IL-17A in regulating antiviral IFN-γ + T h 1 cell immunity in the vaginal tract. This strategy could be exploited to enhance antiviral immunity following HSV-2 vaccination. IMPORTANCE T helper type 1 (T h 1) immunity, specifically interferon gamma (IFN-γ) production by CD4 + T cells, is critical for protection against genital herpesvirus (HSV-2) infection, and

  1. The effects of garlic-supplemented diets on skin mucosal immune responses, stress resistance and growth performance of the Caspian roach (Rutilus rutilus) fry.

    Science.gov (United States)

    Ghehdarijani, Mahbubeh Salmanian; Hajimoradloo, Abdolmajid; Ghorbani, Rasol; Roohi, Zahra

    2016-02-01

    This study was conducted to evaluate the effects of garlic supplementation on some skin mucus immune parameters, mucus antimicrobial activity and growth performance of the Caspian roach (Rutilus rutilus caspicus) fry. Fish (1 ± 0.07 g) were divided into four groups fed diets containing 0 (control), 5, 10 and 15 g kg(-1) garlic for 8 weeks. The results showed that there was a significant increase in weight gain and specific growth rate in those fish fed garlic diets compared with the control (P garlic dosage. At the end of trial, the epidermal mucus protein level, alkaline phosphatase and antimicrobial activity against 2 g-negative bacteria (Escherichia coli and Serratia marcescens) and gram-positive bacteria (Streptococcus faecium and Micrococcus luteus) were measured. Skin mucus alkaline phosphatase, protein levels and antimicrobial activity were increased following garlic administration, and the bacterial growth inhibition zones were significantly elevated in garlic-fed fish (P garlic beneficially affects the skin mucus immune parameters and growth performance of the Caspian roach fry. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Identification of novel immune and barrier genes in atopic dermatitis by means of laser capture microdissection

    DEFF Research Database (Denmark)

    Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin

    2015-01-01

    are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...

  3. Oral delivery of Bacillus subtilis spore expressing enolase of Clonorchis sinensis in rat model: induce systemic and local mucosal immune responses and has no side effect on liver function.

    Science.gov (United States)

    Yu, Jinyun; Chen, Tingjin; Xie, Zhizhi; Liang, Pei; Qu, Honglin; Shang, Mei; Mao, Qiang; Ning, Dan; Tang, Zeli; Shi, Mengchen; Zhou, Lina; Huang, Yan; Yu, Xinbing

    2015-07-01

    Caused by the consumption of raw or undercooked freshwater fish containing infective metacercariae of Clonorchis sinensis, human clonorchiasis remains a major public health problem in China. In previous study, we had expressed enolase from C. sinensis (CsENO) on the surface of Bacillus subtilis spore and the recombinant spore induced a pronounced protection in terms of reduced worm burden and eggs per gram feces, suggesting B. subtilis spore as an ideal vehicle for antigen delivery by oral treatment and CsENO as a promising vaccine candidate against clonorchiasis. In the current study, we detected CsENO-specific IgG and IgA levels both in serum and in intestinal mucus from rats orally administrated with B. subtilis spore surface expressing CsENO by ELISA. Lysozyme levels in serum and in intestinal mucus were analyzed too. In addition, IgA-secreting cells in intestine epithelium of the rats were detected by immunohistochemistry assay. The intestinal villi lengths of duodenum, jejunum, and ileum were also measured. Rats orally treated with B. subtilis spore or normal saline were used as controls. Our results showed that, compared with the control groups, oral administration of B. subtilis spore expressing CsENO induced both systemic and local mucosal immune response. The recombinant spores also enhanced non-specific immune response in rats. The spores had no side effect on liver function. Moreover, it might facilitate food utilization and digestion of the rats. Our work will pave the way to clarify the involved mechanisms of protective efficacy elicited by B. subtilis spore expressing CsENO and encourage us to carry out more assessment trails of the oral treated spore to develop vaccine against clonorchiasis.

  4. Airway Mucosal Immune-suppression in Neonates of Mothers Receiving A(H1N1)pnd09 Vaccination During Pregnancy

    DEFF Research Database (Denmark)

    Pedersen, Susanne Brix; Bischoff, Anne L.; Folsgaard, Nilofar V.

    2015-01-01

    , IL-5, IL-13, eotaxin-1, eotaxin-3, TARC, MDC, IL-17, IL-1 beta, IL-8, transforming growth factor beta (TGF)-beta 1, IL-10 and IL-2. Infections were monitored the first year of life by daily diary cards and clinical controls. Results: Neonates of mothers vaccinated during pregnancy had significant up...... significant and positive association to up-regulation of TGF-beta 1 levels (P = 0.0003) and significant negative association to other mediators. The study was not powered to study differences in the incidence of infections in early infancy which did not differ between the study groups. Conclusion: Influenza A......(H1N1) pnd09 vaccination during pregnancy up-regulates TGF-beta 1 and down-regulates key mediators of the protective immunity....

  5. Role of sex hormones and the vaginal microbiome in susceptibility and mucosal immunity to HIV-1 in the female genital tract.

    Science.gov (United States)

    Vitali, Danielle; Wessels, Jocelyn M; Kaushic, Charu

    2017-09-12

    While the prevalence of Human immunodeficiency virus-1 (HIV-1) infection has stabilized globally, it continues to be the leading cause of death among women of reproductive age. The majority of new infections are transmitted heterosexually, and women have consistently been found to be more susceptible to HIV-1 infection during heterosexual intercourse compared to men. This emphasizes the need for a deeper understanding of how the microenvironment in the female genital tract (FGT) could influence HIV-1 acquisition. This short review focuses on our current understanding of the interplay between estrogen, progesterone, and the cervicovaginal microbiome and their immunomodulatory effects on the FGT. The role of hormonal contraceptives and bacterial vaginosis on tissue inflammation, T cell immunity and HIV-1 susceptibility is discussed. Taken together, this review provides valuable information for the future development of multi-purpose interventions to prevent HIV-1 infection in women.

  6. Radiation induced oral mucositis

    Directory of Open Access Journals (Sweden)

    P S Satheesh Kumar

    2009-01-01

    Full Text Available Patients receiving radiotherapy or chemotherapy will receive some degree of oral mucositis The incidence of oral mucositis was especially high in patients: (i With primary tumors in the oral cavity, oropharynx, or nasopharynx; (ii who also received concomitant chemotherapy; (iii who received a total dose over 5,000 cGy; and (iv who were treated with altered fractionation radiation schedules. Radiation-induced oral mucositis affects the quality of life of the patients and the family concerned. The present day management of oral mucositis is mostly palliative and or supportive care. The newer guidelines are suggesting Palifermin, which is the first active mucositis drug as well as Amifostine, for radiation protection and cryotherapy. The current management should focus more on palliative measures, such as pain management, nutritional support, and maintenance, of good oral hygiene

  7. The Centers for Disease Control and Prevention definition of mucosal barrier injury-associated bloodstream infection improves accurate detection of preventable bacteremia rates at a pediatric cancer center in a low- to middle-income country.

    Science.gov (United States)

    Torres, Dara; González, Miriam L; Loera, Adriana; Aguilera, Marco; Relyea, George; Aristizabal, Paula; Caniza, Miguela A

    2016-04-01

    The US National Healthcare Safety Network has provided a definition of mucosal barrier injury-associated, laboratory-confirmed bloodstream infection (MBI-LCBI) to improve infection surveillance. To date there is little information about its influence in pediatric oncology centers in low- to middle-income countries. To determine the influence of the definition on the rate of central line-associated bloodstream infection (CLABSI) and compare the clinical characteristics of MBI versus non-MBI LCBI cases. We retrospectively applied the National Healthcare Safety Network definition to all CLABSIs recorded at a pediatric oncology center in Tijuana, Mexico, from January 2011 through December 2014. CLABSI events were reclassified according to the MBI-LCBI definition. Clinical characteristics and outcomes of MBI and non-MBI CLABSIs were compared. Of 55 CLABSI events, 44% (24 out of 55) qualified as MBI-LCBIs; all were MBI-LCBI subcategory 1 (intestinal flora pathogens). After the number of MBI-LCBI cases was removed from the numerator, the CLABSI rate during the study period decreased from 5.72-3.22 infections per 1,000 central line days. Patients with MBI-LCBI were significantly younger than non-MBI-LCBI patients (P = .029) and had a significantly greater frequency of neutropenia (100% vs 39%; P = .001) and chemotherapy exposure (87% vs 58%; P = .020) and significantly longer median hospitalization (34 vs 23 days; P = .008). A substantial proportion of CLABSI events at our pediatric cancer center met the MBI-LCBI criteria. Our results support separate monitoring and reporting of MBI and non-MBI-LCBIs in low- to middle-income countries to allow accurate detection and tracking of preventable (non-MBI) bloodstream infections. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  8. Encapsulation of an EP67-Conjugated CTL Peptide Vaccine in Nanoscale Biodegradable Particles Increases the Efficacy of Respiratory Immunization and Affects the Magnitude and Memory Subsets of Vaccine-Generated Mucosal and Systemic CD8+ T Cells in a Diameter-Dependent Manner.

    Science.gov (United States)

    Karuturi, Bala V K; Tallapaka, Shailendra B; Yeapuri, Pravin; Curran, Stephen M; Sanderson, Sam D; Vetro, Joseph A

    2017-05-01

    The diameter of biodegradable particles used to coencapsulate immunostimulants and subunit vaccines affects the magnitude of memory CD8 + T cells generated by systemic immunization. Possible effects on the magnitude of CD8 + T cells generated by mucosal immunization or memory subsets that potentially correlate more strongly with protection against certain pathogens, however, are unknown. In this study, we conjugated our novel host-derived mucosal immunostimulant, EP67, to the protective MCMV CTL epitope, pp89, through a lysosomal protease-labile double arginine linker (pp89-RR-EP67) and encapsulated in PLGA 50:50 micro- or nanoparticles. We then compared total magnitude, effector/central memory (CD127/KRLG1/CD62L), and IFN-γ/TNF-α/IL-2 secreting subsets of pp89-specific CD8 + T cells as well as protection of naive female BALB/c mice against primary respiratory infection with MCMV 21 days after respiratory immunization. We found that decreasing the diameter of encapsulating particle from ∼5.4 μm to ∼350 nm (i) increased the magnitude of pp89-specific CD8 + T cells in the lungs and spleen; (ii) partially changed CD127/KLRG1 effector memory subsets in the lungs but not the spleen; (iii) changed CD127/KRLG1/CD62L effector/central memory subsets in the spleen; (iv) changed pp89-responsive IFN-γ/TNF-α/IL-2 secreting subsets in the lungs and spleen; (v) did not affect the extent to which encapsulation increased efficacy against primary MCMV respiratory infection over unencapsulated pp89-RR-EP67. Thus, although not observed under our current experimental conditions with MCMV, varying the diameter of nanoscale biodegradable particles may increase the efficacy of mucosal immunization with coencapsulated immunostimulant/subunit vaccines against certain pathogens by selectively increasing memory subset(s) of CD8 + T cells that correlate the strongest with protection.

  9. New frontiers in mucositis.

    Science.gov (United States)

    Peterson, Douglas E; Keefe, Dorothy M; Sonis, Stephen T

    2012-01-01

    Mucositis is among the most debilitating side effects of radiotherapy, chemotherapy, and targeted anticancer therapy. Research continues to escalate regarding key issues such as etiopathology, incidence and severity across different mucosae, relationships between mucosal and nonmucosal toxicities, and risk factors. This approach is being translated into enhanced management strategies. Recent technology advances provide an important foundation for this continuum. For example, evolution of applied genomics is fostering development of new algorithms to rapidly screen genomewide single-nucleotide polymorphisms (SNPs) for patient-associated risk prediction. This modeling will permit individual tailoring of the most effective, least toxic treatment in the future. The evolution of novel cancer therapeutics is changing the mucositis toxicity profile. These agents can be associated with unique mechanisms of mucosal damage. Additional research is needed to optimally manage toxicity caused by agents such as mammalian target of rapamycin (mTOR) inhibitors and tyrosine kinase inhibitors, without reducing antitumor effect. There has similarly been heightened attention across the health professions regarding clinical practice guidelines for mucositis management in the years following the first published guidelines in 2004. New opportunities exist to more effectively interface this collective guideline portfolio by capitalizing upon novel technologies such as an Internet-based Wiki platform. Substantive progress thus continues across many domains associated with mucosal injury in oncology patients. In addition to enhancing oncology patient care, these advances are being integrated into high-impact educational and scientific venues including the National Cancer Institute Physician Data Query (PDQ) portfolio as well as a new Gordon Research Conference on mucosal health and disease scheduled for June 2013.

  10. Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

    International Nuclear Information System (INIS)

    Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

    2012-01-01

    Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

  11. The Bile Acid Receptor GPBAR-1 (TGR5) Modulates Integrity of Intestinal Barrier and Immune Response to Experimental Colitis

    Science.gov (United States)

    Cipriani, Sabrina; Mencarelli, Andrea; Chini, Maria Giovanna; Distrutti, Eleonora; Renga, Barbara; Bifulco, Giuseppe; Baldelli, Franco; Donini, Annibale; Fiorucci, Stefano

    2011-01-01

    Background GP-BAR1, a member G protein coupled receptor superfamily, is a cell surface bile acid-activated receptor highly expressed in the ileum and colon. In monocytes, ligation of GP-BAR1 by secondary bile acids results in a cAMP-dependent attenuation of cytokine generation. Aims To investigate the role GP-BAR1 in regulating intestinal homeostasis and inflammation-driven immune dysfunction in rodent models of colitis. Methods Colitis was induced in wild type and GP-BAR1−/− mice by DSS and TNBS administration. Potential GP-BAR1 agonists were identified by in silico screening and computational docking studies. Results GP-BAR1−/− mice develop an abnormal morphology of colonic mucous cells and an altered molecular architecture of epithelial tight junctions with increased expression and abnormal subcellular distribution of zonulin 1 resulting in increased intestinal permeability and susceptibility to develop severe colitis in response to DSS at early stage of life. By in silico screening and docking studies we identified ciprofloxacin as a GP-BAR1 ligand. In monocytes, ciprofloxacin increases cAMP concentrations and attenuates TNFα release induced by TLR4 ligation in a GP-BAR1 dependent manner. Treating mice rendered colitic by TNBS with ciprofloxacin and oleanolic acid, a well characterized GP-BAR1 ligand, abrogates signs and symptoms of colitis. Colonic expression of GP-BAR1 mRNA increases in rodent models of colitis and tissues from Crohn's disease patients. Flow cytometry analysis demonstrates that ≈90% of CD14+ cells isolated from the lamina propria of TNBS-treated mice stained positively for GP-BAR1. Conclusions GP-BAR1 regulates intestinal barrier structure. Its expression increases in rodent models of colitis and Crohn's disease. Ciprofloxacin is a GP-BAR1 ligand. PMID:22046243

  12. The bile acid receptor GPBAR-1 (TGR5 modulates integrity of intestinal barrier and immune response to experimental colitis.

    Directory of Open Access Journals (Sweden)

    Sabrina Cipriani

    Full Text Available BACKGROUND: GP-BAR1, a member G protein coupled receptor superfamily, is a cell surface bile acid-activated receptor highly expressed in the ileum and colon. In monocytes, ligation of GP-BAR1 by secondary bile acids results in a cAMP-dependent attenuation of cytokine generation. AIMS: To investigate the role GP-BAR1 in regulating intestinal homeostasis and inflammation-driven immune dysfunction in rodent models of colitis. METHODS: Colitis was induced in wild type and GP-BAR1(-/- mice by DSS and TNBS administration. Potential GP-BAR1 agonists were identified by in silico screening and computational docking studies. RESULTS: GP-BAR1(-/- mice develop an abnormal morphology of colonic mucous cells and an altered molecular architecture of epithelial tight junctions with increased expression and abnormal subcellular distribution of zonulin 1 resulting in increased intestinal permeability and susceptibility to develop severe colitis in response to DSS at early stage of life. By in silico screening and docking studies we identified ciprofloxacin as a GP-BAR1 ligand. In monocytes, ciprofloxacin increases cAMP concentrations and attenuates TNFα release induced by TLR4 ligation in a GP-BAR1 dependent manner. Treating mice rendered colitic by TNBS with ciprofloxacin and oleanolic acid, a well characterized GP-BAR1 ligand, abrogates signs and symptoms of colitis. Colonic expression of GP-BAR1 mRNA increases in rodent models of colitis and tissues from Crohn's disease patients. Flow cytometry analysis demonstrates that ≈90% of CD14+ cells isolated from the lamina propria of TNBS-treated mice stained positively for GP-BAR1. CONCLUSIONS: GP-BAR1 regulates intestinal barrier structure. Its expression increases in rodent models of colitis and Crohn's disease. Ciprofloxacin is a GP-BAR1 ligand.

  13. Bacteria in the vaginal microbiome alter the innate immune response and barrier properties of the human vaginal epithelia in a species-specific manner.

    Science.gov (United States)

    Doerflinger, Sylvie Y; Throop, Andrea L; Herbst-Kralovetz, Melissa M

    2014-06-15

    Bacterial vaginosis increases the susceptibility to sexually transmitted infections and negatively affects women's reproductive health. To investigate host-vaginal microbiota interactions and the impact on immune barrier function, we colonized 3-dimensional (3-D) human vaginal epithelial cells with 2 predominant species of vaginal microbiota (Lactobacillus iners and Lactobacillus crispatus) or 2 prevalent bacteria associated with bacterial vaginosis (Atopobium vaginae and Prevotella bivia). Colonization of 3-D vaginal epithelial cell aggregates with vaginal microbiota was observed with direct attachment to host cell surface with no cytotoxicity. A. vaginae infection yielded increased expression membrane-associated mucins and evoked a robust proinflammatory, immune response in 3-D vaginal epithelial cells (ie, expression of CCL20, hBD-2, interleukin 1β, interleukin 6, interleukin 8, and tumor necrosis factor α) that can negatively affect barrier function. However, P. bivia and L. crispatus did not significantly upregulate pattern-recognition receptor-signaling, mucin expression, antimicrobial peptides/defensins, or proinflammatory cytokines in 3-D vaginal epithelial cell aggregates. Notably, L. iners induced pattern-recognition receptor-signaling activity, but no change was observed in mucin expression or secretion of interleukin 6 and interleukin 8. We identified unique species-specific immune signatures from vaginal epithelial cells elicited by colonization with commensal and bacterial vaginosis-associated bacteria. A. vaginae elicited a signature that is consistent with significant disruption of immune barrier properties, potentially resulting in enhanced susceptibility to sexually transmitted infections during bacterial vaginosis. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Effects of feminine hygiene products on the vaginal mucosal biome

    Directory of Open Access Journals (Sweden)

    Raina N. Fichorova

    2013-02-01

    Full Text Available Background: Over-the-counter (OTC feminine hygiene products come with little warning about possible side effects. This study evaluates in-vitro their effects on Lactobacillus crispatus, which is dominant in the normal vaginal microbiota and helps maintain a healthy mucosal barrier essential for normal reproductive function and prevention of sexually transmitted infections and gynecologic cancer. Methods: A feminine moisturizer (Vagisil, personal lubricant, and douche were purchased OTC. A topical spermicide (nonoxynol-9 known to alter the vaginal immune barrier was used as a control. L. crispatus was incubated with each product for 2 and 24h and then seeded on agar for colony forming units (CFU. Human vaginal epithelial cells were exposed to products in the presence or absence of L. crispatus for 24h, followed by epithelium-associated CFU enumeration. Interleukin-8 was immunoassayed and ANOVA was used for statistical evaluation. Results: Nonoxynol-9 and Vagisil suppressed Lactobacillus growth at 2h and killed all bacteria at 24h. The lubricant decreased bacterial growth insignificantly at 2h but killed all at 24h. The douche did not have a significant effect. At full strength, all products suppressed epithelial viability and all, except the douche, suppressed epithelial-associated CFU. When applied at non-toxic dose in the absence of bacteria, the douche and moisturizer induced an increase of IL-8, suggesting a potential to initiate inflammatory reaction. In the presence of L. crispatus, the proinflammatory effects of the douche and moisturizer were countered, and IL-8 production was inhibited in the presence of the other products. Conclusion: Some OTC vaginal products may be harmful to L. crispatus and alter the vaginal immune environment. Illustrated through these results, L. crispatus is essential in the preservation of the function of vaginal epithelial cells in the presence of some feminine hygiene products. More research should be invested

  15. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco

    1996-06-01

    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  16. The intestinal barrier function and its involvement in digestive disease

    Directory of Open Access Journals (Sweden)

    Eloísa Salvo-Romero

    2015-11-01

    Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

  17. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  18. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  19. Use of inactivated E.Coli enterotoxins to enhance respiratory mucosal adjuvanticity during vaccination in swine

    Science.gov (United States)

    In order to augment responses to respiratory vaccines in swine, various adjuvants were intranasally co-administered with an antigen to pigs. Detoxified E. coli enterotoxins LTK63 and LTR72 enhanced mucosal and systemic immunity to the model peptide, exhibiting their efficacy as mucosal adjuvants for...

  20. Host responses to Candida albicans: Th17 cells and mucosal candidiasis

    OpenAIRE

    Conti, Heather R.; Gaffen, Sarah L.

    2010-01-01

    Candida albicans causes mucosal and disseminated candidiasis, which represent serious problems for the rapidly expanding immunocompromised population. Until recently, Th1-mediated immunity was thought to confer the primary protection, particularly for oral candidiasis. However, emerging data indicate that the newly-defined Th17 compartment appears to play the predominant role in mucosal candidiasis.

  1. Prior mucosal exposure to heterologous cells alters the pathogenesis of cell-associated mucosal feline immunodeficiency virus challenge

    Directory of Open Access Journals (Sweden)

    Leavell Sarah

    2010-05-01

    Full Text Available Abstract Background Several lines of research suggest that exposure to cellular material can alter the susceptibility to infection by HIV-1. Because sexual contact often includes exposure to cellular material, we hypothesized that repeated mucosal exposure to heterologous cells would induce an immune response that would alter the susceptibility to mucosal infection. Using the feline immunodeficiency virus (FIV model of HIV-1 mucosal transmission, the cervicovaginal mucosa was exposed once weekly for 12 weeks to 5,000 heterologous cells or media (control and then cats were vaginally challenged with cell-associated or cell-free FIV. Results Exposure to heterologous cells decreased the percentage of lymphocytes in the mucosal and systemic lymph nodes (LN expressing L-selectin as well as the percentage of CD4+ CD25+ T cells. These shifts were associated with enhanced ex-vivo proliferative responses to heterologous cells. Following mucosal challenge with cell-associated, but not cell-free, FIV, proviral burden was reduced by 64% in cats previously exposed to heterologous cells as compared to media exposed controls. Conclusions The pathogenesis and/or the threshold for mucosal infection by infected cells (but not cell-free virus can be modulated by mucosal exposure to uninfected heterologous cells.

  2. Delivery of antigen to nasal-associated lymphoid tissue microfold cells through secretory IgA targeting local dendritic cells confers protective immunity.

    Science.gov (United States)

    Rochereau, Nicolas; Pavot, Vincent; Verrier, Bernard; Jospin, Fabienne; Ensinas, Agathe; Genin, Christian; Corthésy, Blaise; Paul, Stéphane

    2016-01-01

    Transmission of mucosal pathogens relies on their ability to bind to the surfaces of epithelial cells, to cross this thin barrier, and to gain access to target cells and tissues, leading to systemic infection. This implies that pathogen-specific immunity at mucosal sites is critical for the control of infectious agents using these routes to enter the body. Although mucosal delivery would ensure the best onset of protective immunity, most of the candidate vaccines are administered through the parenteral route. The present study evaluates the feasibility of delivering the chemically bound p24gag (referred to as p24 in the text) HIV antigen through secretory IgA (SIgA) in nasal mucosae in mice. We show that SIgA interacts specifically with mucosal microfold cells present in the nasal-associated lymphoid tissue. p24-SIgA complexes are quickly taken up in the nasal cavity and selectively engulfed by mucosal dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin-positive dendritic cells. Nasal immunization with p24-SIgA elicits both a strong humoral and cellular immune response against p24 at the systemic and mucosal levels. This ensures effective protection against intranasal challenge with recombinant vaccinia virus encoding p24. This study represents the first example that underscores the remarkable potential of SIgA to serve as a carrier for a protein antigen in a mucosal vaccine approach targeting the nasal environment. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  3. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2015-01-01

    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health.

  4. Systemic activation of the immune system in HIV infection: The role of the immune complexes (hypothesis).

    Science.gov (United States)

    Korolevskaya, Larisa B; Shmagel, Konstantin V; Shmagel, Nadezhda G; Saidakova, Evgeniya V

    2016-03-01

    Currently, immune activation is proven to be the basis for the HIV infection pathogenesis and a strong predictor of the disease progression. Among the causes of systemic immune activation the virus and its products, related infectious agents, pro-inflammatory cytokines, and regulatory CD4+ T cells' decrease are considered. Recently microbial translocation (bacterial products yield into the bloodstream as a result of the gastrointestinal tract mucosal barrier integrity damage) became the most popular hypothesis. Previously, we have found an association between immune complexes present in the bloodstream of HIV infected patients and the T cell activation. On this basis, we propose a significantly modified hypothesis of immune activation in HIV infection. It is based on the immune complexes' participation in the immunocompetent cells' activation. Immune complexes are continuously formed in the chronic phase of the infection. Together with TLR-ligands (viral antigens, bacterial products coming from the damaged gut) present in the bloodstream they interact with macrophages. As a result macrophages are transformed into the type II activated forms. These macrophages block IL-12 production and start synthesizing IL-10. High level of this cytokine slows down the development of the full-scale Th1-response. The anti-viral reactions are shifted towards the serogenesis. Newly synthesized antibodies' binding to viral antigens leads to continuous formation of the immune complexes capable of interacting with antigen-presenting cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. The joint power of sex and stress to modulate brain-gut-microbiota axis and intestinal barrier homeostasis: implications for irritable bowel syndrome.

    Science.gov (United States)

    Pigrau, M; Rodiño-Janeiro, B K; Casado-Bedmar, M; Lobo, B; Vicario, M; Santos, J; Alonso-Cotoner, C

    2016-04-01

    Intestinal homeostasis is a dynamic process that takes place at the interface between the lumen and the mucosa of the gastrointestinal tract, where a constant scrutiny for antigens and toxins derived from food and microorganisms is carried out by the vast gut-associated immune system. Intestinal homeostasis is preserved by the ability of the mucus layer and the mucosal barrier to keep the passage of small-sized and antigenic molecules across the epithelium highly selective. When combined and preserved, immune surveillance and barrier's selective permeability, the host capacity of preventing the development of intestinal inflammation is optimized, and viceversa. In addition, the brain-gut-microbiome axis, a multidirectional communication system that integrates distant and local regulatory networks through neural, immunological, metabolic, and hormonal signaling pathways, also regulates intestinal function. Dysfunction of the brain-gut-microbiome axis may induce the loss of gut mucosal homeostasis, leading to uncontrolled permeation of toxins and immunogenic particles, increasing the risk of appearance of intestinal inflammation, mucosal damage, and gut disorders. Irritable bowel syndrome is prevalent stress-sensitive gastrointestinal disorder that shows a female predominance. Interestingly, the role of stress, sex and gonadal hormones in the regulation of intestinal mucosal and the brain-gut-microbiome axis functioning is being increasingly recognized. We aim to critically review the evidence linking sex, and stress to intestinal barrier and brain-gut-microbiome axis dysfunction and the implications for irritable bowel syndrome. © 2015 John Wiley & Sons Ltd.

  6. Immunosuppressive Tryptophan Catabolism and Gut Mucosal Dysfunction Following Early HIV Infection

    NARCIS (Netherlands)

    Jenabian, Mohammad-Ali; El-Far, Mohamed; Vyboh, Kishanda; Kema, Ido; Costiniuk, Cecilia T.; Thomas, Rejean; Baril, Jean-Guy; LeBlanc, Roger; Kanagaratham, Cynthia; Radzioch, Danuta; Allam, Ossama; Ahmad, Ali; Lebouche, Bertrand; Tremblay, Cecile; Ancuta, Petronela; Routy, Jean-Pierre

    2015-01-01

    Background. Tryptophan (Trp) catabolism into kynurenine (Kyn) contributes to immune dysfunction in chronic human immunodeficiency virus (HIV) infection. To better define the relationship between Trp catabolism, inflammation, gut mucosal dysfunction, and the role of early antiretroviral therapy

  7. Live bacterial delivery systems for development of mucosal vaccines

    NARCIS (Netherlands)

    Thole, J.E.R.; Dalen, P.J. van; Havenith, C.E.G.; Pouwels, P.H.; Seegers, J.F.M.L.; Tielen, F.D.; Zee, M.D. van der; Zegers, N.D.; Shaw, M.

    2000-01-01

    By expression of foreign antigens in attenuated strains derived from bacterial pathogens and in non-pathogenic commensal bacteria, recombinant vaccines are being developed that aim to stimulate mucosal immunity. Recent advances in the pathogenesis and molecular biology of these bacteria have allowed

  8. Induction of Mucosal Homing Virus-Specific CD8+ T Lymphocytes by Attenuated Simian Immunodeficiency Virus

    OpenAIRE

    Cromwell, Mandy A.; Veazey, Ronald S.; Altman, John D.; Mansfield, Keith G.; Glickman, Rhona; Allen, Todd M.; Watkins, David I.; Lackner, Andrew A.; Johnson, R. Paul

    2000-01-01

    Induction of virus-specific T-cell responses in mucosal as well as systemic compartments of the immune system is likely to be a critical feature of an effective AIDS vaccine. We investigated whether virus-specific CD8+ lymphocytes induced in rhesus macaques by immunization with attenuated simian immunodeficiency virus (SIV), an approach that is highly effective in eliciting protection against mucosal challenge, express the mucosa-homing receptor α4β7 and traffic to the intestinal mucosa. SIV-...

  9. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8(+) T cell priming in response to intravaginal immunization.

    Science.gov (United States)

    Seavey, Matthew M; Mosmann, Tim R

    2009-04-14

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8(+) T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APCs) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8(+) T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8(+) T cell priming after insemination or vaginal vaccination.

  10. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8+ T cell priming in response to intravaginal immunization

    Science.gov (United States)

    Seavey, Matthew M.; Mosmann, Tim R.

    2010-01-01

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8+ T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APC) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8+ T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8+ T cell priming after insemination or vaginal vaccination. PMID:19428849

  11. New Pathways for Alimentary Mucositis

    Directory of Open Access Journals (Sweden)

    Joanne M. Bowen

    2008-01-01

    Full Text Available Alimentary mucositis is a major dose-limiting toxicity associated with anticancer treatment. It is responsible for reducing patient quality of life and represents a significant economic burden in oncology. The pathobiology of alimentary mucositis is extremely complex, and an increased understanding of mechanisms and pathway interactions is required to rationally design improved therapies. This review describes the latest advances in defining mechanisms of alimentary mucositis pathobiology in the context of pathway activation. It focuses particularly on the recent genome-wide analyses of regimen-related mucosal injury and the identification of specific regulatory pathways implicated in mucositis development. This review also discusses the currently known alimentary mucositis risk factors and the development of novel treatments. Suggestions for future research directions have been raised.

  12. Comparative Immunogenicity of HIV-1 gp140 Vaccine Delivered by Parenteral, and Mucosal Routes in Female Volunteers; MUCOVAC2, A Randomized Two Centre Study.

    Directory of Open Access Journals (Sweden)

    Catherine A Cosgrove

    Full Text Available Defining optimal routes for induction of mucosal immunity represents an important research priority for the HIV-1 vaccine field. In particular, it remains unclear whether mucosal routes of immunization can improve mucosal immune responses.In this randomized two center phase I clinical trial we evaluated the systemic and mucosal immune response to a candidate HIV-1 Clade C CN54gp140 envelope glycoprotein vaccine administered by intramuscular (IM, intranasal (IN and intravaginal (IVAG routes of administration in HIV negative female volunteers. IM immunizations were co-administered with Glucopyranosyl Lipid Adjuvant (GLA, IN immunizations with 0.5% chitosan and IVAG immunizations were administered in an aqueous gel.Three IM immunizations of CN54 gp140 at either 20 or 100 μg elicited significantly greater systemic and mucosal antibodies than either IN or IVAG immunizations. Following additional intramuscular boosting we observed an anamnestic antibody response in nasally primed subjects. Modest neutralizing responses were detected against closely matched tier 1 clade C virus in the IM groups. Interestingly, the strongest CD4 T-cell responses were detected after IN and not IM immunization.These data show that parenteral immunization elicits systemic and mucosal antibodies in women. Interestingly IN immunization was an effective prime for IM boost, while IVAG administration had no detectable impact on systemic or mucosal responses despite IM priming.EudraCT 2010-019103-27 and the UK Clinical Research Network (UKCRN Number 11679.

  13. Mucosal melanosis associated with chemoembolization

    Directory of Open Access Journals (Sweden)

    Ali Alkan

    2015-06-01

    Full Text Available Mucosal lesions due to underlying disease or drug toxicity, are important part of oncology practice. Patient with a diagnosis of hepatocellular carcinoma was treated with chemoembolisation. She presented with new onset of mucosal hyperpigmented lesion all through her oral cavity. Biopsy was consistent with mucosal melanosis, which was associated with the chemotherapeutics used in the chemoembolisation procedure. Lesion progressively improved without any treatment. Here we present an mucosal melanosis experience after chemoembolisation. J Clin Exp Invest 2015; 6 (2: 189-191

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  15. Mucosal immunology and virology

    National Research Council Canada - National Science Library

    Tyring, Stephen

    2006-01-01

    .... A third chapter focuses on the proximal end of the gastrointestinal tract (i.e. the oral cavity). The mucosal immunology and virology of the distal end of the gastrointestinal tract is covered in the chapter on the anogenital mucosa. Mucosa-associated lymphoid tissue (MALT) plays a role in protection against all viral (and other) infections except those that enter the body via a bite (e.g. yellow fever or dengue from a mosquito or rabies from a dog) or an injection or transfusion (e.g. HIV, Hepatitis B). ...

  16. Control of creatine metabolism by HIF is an endogenous mechanism of barrier regulation in colitis.

    Science.gov (United States)

    Glover, Louise E; Bowers, Brittelle E; Saeedi, Bejan; Ehrentraut, Stefan F; Campbell, Eric L; Bayless, Amanda J; Dobrinskikh, Evgenia; Kendrick, Agnieszka A; Kelly, Caleb J; Burgess, Adrianne; Miller, Lauren; Kominsky, Douglas J; Jedlicka, Paul; Colgan, Sean P

    2013-12-03

    Mucosal surfaces of the lower gastrointestinal tract are subject to frequent, pronounced fluctuations in oxygen tension, particularly during inflammation. Adaptive responses to hypoxia are orchestrated largely by the hypoxia-inducible transcription factors (HIFs). As HIF-1α and HIF-2α are coexpressed in mucosal epithelia that constitute the barrier between the lumen and the underlying immune milieu, we sought to define the discrete contribution of HIF-1 and HIF-2 transactivation pathways to intestinal epithelial cell homeostasis. The present study identifies creatine kinases (CKs), key metabolic enzymes for rapid ATP generation via the phosphocreatine-creatine kinase (PCr/CK) system, as a unique gene family that is coordinately regulated by HIF. Cytosolic CKs are expressed in a HIF-2-dependent manner in vitro and localize to apical intestinal epithelial cell adherens junctions, where they are critical for junction assembly and epithelial integrity. Supplementation with dietary creatine markedly ameliorated both disease severity and inflammatory responses in colitis models. Further, enzymes of the PCr/CK metabolic shuttle demonstrate dysregulated mucosal expression in a subset of ulcerative colitis and Crohn disease patients. These findings establish a role for HIF-regulated CK in epithelial homeostasis and reveal a fundamental link between cellular bioenergetics and mucosal barrier.

  17. Pilot study of lithium to restore intestinal barrier function in severe graft-versus-host disease.

    Directory of Open Access Journals (Sweden)

    Gideon Steinbach

    Full Text Available Severe intestinal graft-vs-host disease (GVHD after allogeneic hematopoietic cell transplantation (HCT causes mucosal ulceration and induces innate and adaptive immune responses that amplify and perpetuate GVHD and the associated barrier dysfunction. Pharmacological agents to target mucosal barrier dysfunction in GVHD are needed. We hypothesized that induction of Wnt signaling by lithium, an inhibitor of glycogen synthase kinase (GSK3, would potentiate intestinal crypt proliferation and mucosal repair and that inhibition of GSK3 in inflammatory cells would attenuate the deregulated inflammatory response to mucosal injury. We conducted an observational pilot study to provide data for the potential design of a randomized study of lithium. Twenty patients with steroid refractory intestinal GVHD meeting enrollment criteria were given oral lithium carbonate. GVHD was otherwise treated per current practice, including 2 mg/kg per day of prednisone equivalent. Seventeen patients had extensive mucosal denudation (extreme endoscopic grade 3 in the duodenum or colon. We observed that 8 of 12 patients (67% had a complete remission (CR of GVHD and survived more than 1 year (median 5 years when lithium administration was started promptly within 3 days of endoscopic diagnosis of denuded mucosa. When lithium was started promptly and less than 7 days from salvage therapy for refractory GVHD, 8 of 10 patients (80% had a CR and survived more than 1 year. In perspective, a review of 1447 consecutive adult HCT patients in the preceding 6 years at our cancer center showed 0% one-year survival in 27 patients with stage 3-4 intestinal GVHD and grade 3 endoscopic appearance in the duodenum or colon. Toxicities included fatigue, somnolence, confusion or blunted affect in 50% of the patients. The favorable outcomes in patients who received prompt lithium therapy appear to support the future conduct of a randomized study of lithium for management of severe GVHD with

  18. Enhancement of Mucosal Immunogenicity of Viral Vectored Vaccines by the NKT Cell Agonist Alpha-Galactosylceramide as Adjuvant

    Directory of Open Access Journals (Sweden)

    Shailbala Singh

    2014-10-01

    Full Text Available Gene-based vaccination strategies, specifically viral vectors encoding vaccine immunogens are effective at priming strong immune responses. Mucosal routes offer practical advantages for vaccination by ease of needle-free administration, and immunogen delivery at readily accessible oral/nasal sites to efficiently induce immunity at distant gut and genital tissues. However, since mucosal tissues are inherently tolerant for induction of immune responses, incorporation of adjuvants for optimal mucosal vaccination strategies is important. We report here the effectiveness of alpha-galactosylceramide (α-GalCer, a synthetic glycolipid agonist of natural killer T (NKT cells, as an adjuvant for enhancing immunogenicity of vaccine antigens delivered using viral vectors by mucosal routes in murine and nonhuman primate models. Significant improvement in adaptive immune responses in systemic and mucosal tissues was observed by including α-GalCer adjuvant for intranasal immunization of mice with vesicular stomatitis virus vector encoding the model antigen ovalbumin and adenoviral vectors expressing HIV env and Gag antigens. Activation of NKT cells in systemic and mucosal tissues along with significant increases in adaptive immune responses were observed in rhesus macaques immunized by intranasal and sublingual routes with protein or adenovirus vectored antigens when combined with α-GalCer adjuvant. These results support the utility of α-GalCer adjuvant for enhancing immunogenicity of mucosal vaccines delivered using viral vectors.

  19. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis

    NARCIS (Netherlands)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    Scope: Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on

  20. Hypoxia, innate immunity and infection in the lung.

    LENUS (Irish Health Repository)

    Schaible, Bettina

    2012-02-01

    The mucosal surface of the lung is the key interface between the external atmosphere and the bloodstream. Normally, this well oxygenated tissue is maintained in state of sterility by a number of innate immune processes. These include a physical and dynamic mucus barrier, the production of microbiocidal peptides and the expression of specific pattern recognition receptors on alveolar epithelial cells and resident macrophages and dendritic cells which recognise microbial structures and initiate innate immune responses which promote the clearance of potentially infectious agents. In a range of diseases, the mucosal surface of the lung experiences decreased oxygen tension leading to localised areas of prominent hypoxia which can impact upon innate immune and subsequent infectious and inflammatory processes. Under these conditions, the lung is generally more susceptible to infection and subsequent inflammation. In the current review, we will discuss recent data pertaining to the role of hypoxia in regulating both host and pathogen in the lung during pulmonary disease and how this contributes to innate immunity, infection and inflammation.

  1. Corruption of innate immunity by bacterial proteases.

    Science.gov (United States)

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  2. Mucosal vaccination by adenoviruses displaying reovirus sigma 1

    Energy Technology Data Exchange (ETDEWEB)

    Weaver, Eric A. [Department of Internal Medicine, Division of Infectious Diseases, Translational Immunovirology and Biodefense Program, Mayo Clinic, Rochester, MN 55902 (United States); Camacho, Zenaido T. [Department of Cell Biology, Department of Natural Sciences, Western New Mexico University, Silver City, NM 88062 (United States); Hillestad, Matthew L. [Nephrology Training Program, Mayo Clinic, Rochester, MN 55902 (United States); Crosby, Catherine M.; Turner, Mallory A.; Guenzel, Adam J.; Fadel, Hind J. [Virology and Gene Therapy Graduate Program, Mayo Clinic, Rochester, MN 55902 (United States); Mercier, George T. [Department of Physics, University of Houston, Houston, TX 77004 (United States); Barry, Michael A., E-mail: mab@mayo.edu [Department of Internal Medicine, Division of Infectious Diseases, Translational Immunovirology and Biodefense Program, Mayo Clinic, Rochester, MN 55902 (United States); Department of Immunology and Department of Molecular Medicine, Mayo Clinic, Rochester, MN 55902 (United States)

    2015-08-15

    We developed adenovirus serotype 5 (Ad5) vectors displaying the sigma 1 protein from reovirus as mucosal vaccines. Ad5-sigma retargets to JAM-1 and sialic acid, but has 40-fold reduced gene delivery when compared to Ad5. While weaker at transduction, Ad5-sigma generates stronger T cell responses than Ad5 when used for mucosal immunization. In this work, new Ad5-fiber-sigma vectors were generated by varying the number of fiber β-spiral shaft repeats (R) between the fiber tail and sigma. Increasing chimera length led to decreasing insertion of these proteinsAd5 virions. Ad-R3 and R14 vectors effectively targeted JAM-1 in vitro while R20 did not. When wereused to immunize mice by the intranasal route, Ad5-R3-sigma produced higher serum and vaginal antibody responses than Ad5. These data suggest optimized Ad-sigma vectors may be useful vectors for mucosal vaccination. - Highlights: • Constructed adenoviruses (Ads) displaying different reovirus sigma 1 fusion proteins. • Progressively longer chimeras were more poorly encapsidated onto Ad virions. • Ad5-R3-sigma mediated better systemic and mucosal immune responses than Ad5.

  3. Mucosal vaccination by adenoviruses displaying reovirus sigma 1

    International Nuclear Information System (INIS)

    Weaver, Eric A.; Camacho, Zenaido T.; Hillestad, Matthew L.; Crosby, Catherine M.; Turner, Mallory A.; Guenzel, Adam J.; Fadel, Hind J.; Mercier, George T.; Barry, Michael A.

    2015-01-01

    We developed adenovirus serotype 5 (Ad5) vectors displaying the sigma 1 protein from reovirus as mucosal vaccines. Ad5-sigma retargets to JAM-1 and sialic acid, but has 40-fold reduced gene delivery when compared to Ad5. While weaker at transduction, Ad5-sigma generates stronger T cell responses than Ad5 when used for mucosal immunization. In this work, new Ad5-fiber-sigma vectors were generated by varying the number of fiber β-spiral shaft repeats (R) between the fiber tail and sigma. Increasing chimera length led to decreasing insertion of these proteinsAd5 virions. Ad-R3 and R14 vectors effectively targeted JAM-1 in vitro while R20 did not. When wereused to immunize mice by the intranasal route, Ad5-R3-sigma produced higher serum and vaginal antibody responses than Ad5. These data suggest optimized Ad-sigma vectors may be useful vectors for mucosal vaccination. - Highlights: • Constructed adenoviruses (Ads) displaying different reovirus sigma 1 fusion proteins. • Progressively longer chimeras were more poorly encapsidated onto Ad virions. • Ad5-R3-sigma mediated better systemic and mucosal immune responses than Ad5

  4. A diet containing whey protein, glutamine, and TGFbeta modulates gut protein metabolism during chemotherapy-induced mucositis in rats.

    Science.gov (United States)

    Boukhettala, Nabile; Ibrahim, Ayman; Claeyssens, Sophie; Faure, Magali; Le Pessot, Florence; Vuichoud, Jacques; Lavoinne, Alain; Breuillé, Denis; Déchelotte, Pierre; Coëffier, Moïse

    2010-08-01

    Mucositis, a common side effect of chemotherapy, is characterized by compromised digestive function, barrier integrity and immune competence. Our aim was to evaluate the impact of a specifically designed diet Clinutren Protect (CP), which contains whey proteins, TGFbeta-rich casein, and free glutamine, on mucositis in rats. Mucositis was induced by three consecutive injections (day 0, day 1, day 2) of methotrexate (2.5 mg/kg). Rats had free access to CP or placebo diets from days -7 to 9. In the placebo diet, whey proteins and TGFbeta-rich casein were replaced by TGFbeta-free casein and glutamine by alanine. Intestinal parameters were assessed at day 3 and 9. Values, expressed as mean +/- SEM, were compared using two-way ANOVA. At day 3, villus height was markedly decreased in the placebo (296 +/- 11 microm) and CP groups (360 +/- 10 microm) compared with controls (464 +/- 27 microm), but more markedly in the placebo as compared to CP group. The intestinal damage score was also reduced in the CP compared with the placebo group. Glutathione content increased in the CP compared with the placebo group (2.2 +/- 0.2 vs. 1.7 +/- 0.2 micromol/g tissue). Gut protein metabolism was more affected in the placebo than in the CP group. The fractional synthesis rate was decreased in the placebo group (93.8 +/- 4.9%/day) compared with controls (121.5 +/- 12.1, P < 0.05), but not in the CP group (106.0 +/- 13.1). In addition, at day 9, rats exhibited improved body weight and food intake recovery in the CP compared to the placebo group. Clinutren Protect feeding reduces intestinal injury in the acute phase of methotrexate-induced mucositis in rats and improves recovery.

  5. Molecular Signatures of Immune Activation and Epithelial Barrier Remodeling Are Enhanced during the Luteal Phase of the Menstrual Cycle: Implications for HIV Susceptibility.

    Science.gov (United States)

    Birse, Kenzie; Arnold, Kelly B; Novak, Richard M; McCorrister, Stuart; Shaw, Souradet; Westmacott, Garrett R; Ball, Terry B; Lauffenburger, Douglas A; Burgener, Adam

    2015-09-01

    The variable infectivity and transmissibility of HIV/SHIV has been recently associated with the menstrual cycle, with particular susceptibility observed during the luteal phase in nonhuman primate models and ex vivo human explant cultures, but the mechanism is poorly understood. Here, we performed an unbiased, mass spectrometry-based proteomic analysis to better understand the mucosal immunological processes underpinning this observed susceptibility to HIV infection. Cervicovaginal lavage samples (n = 19) were collected, characterized as follicular or luteal phase using days since last menstrual period, and analyzed by tandem mass spectrometry. Biological insights from these data were gained using a spectrum of computational methods, including hierarchical clustering, pathway analysis, gene set enrichment analysis, and partial least-squares discriminant analysis with LASSO feature selection. Of the 384 proteins identified, 43 were differentially abundant between phases (P HIV. Recent studies have discovered an enhanced susceptibility to HIV infection during the progesterone-dominant luteal phase of the menstrual cycle. However, the mechanism responsible for this enhanced susceptibility has not yet been determined. Understanding the source of this vulnerability will be important for designing efficacious HIV prevention technologies for women. Furthermore, these findings may also be extrapolated to better understand the impact of exogenous hormone application, such as the use of hormonal contraceptives, on HIV acquisition risk. Hormonal contraceptives are the most widely used contraceptive method in sub-Saharan Africa, the most HIV-burdened area of the world. For this reason, research conducted to better understand how hormones impact host immunity and susceptibility factors important for HIV infection is a global health priority. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Protein energy malnutrition alters mucosal IgA responses and reduces mucosal vaccine efficacy in mice.

    Science.gov (United States)

    Rho, Semi; Kim, Heejoo; Shim, Seung Hyun; Lee, Seung Young; Kim, Min Jung; Yang, Bo-Gie; Jang, Myoung Ho; Han, Byung Woo; Song, Man Ki; Czerkinsky, Cecil; Kim, Jae-Ouk

    2017-10-01

    Oral vaccine responsiveness is often lower in children from less developed countries. Childhood malnutrition may be associated with poor immune response to oral vaccines. The present study was designed to investigate whether protein energy malnutrition (PEM) impairs B cell immunity and ultimately reduces oral vaccine efficacy in a mouse model. Purified isocaloric diets containing low protein (1/10 the protein of the control diet) were used to determine the effect of PEM. PEM increased both nonspecific total IgA and oral antigen-specific IgA in serum without alteration of gut permeability. However, PEM decreased oral antigen-specific IgA in feces, which is consistent with decreased expression of polymeric Immunoglobulin receptor (pIgR) in the small intestine. Of note, polymeric IgA was predominant in serum under PEM. In addition, PEM altered B cell development status in the bone marrow and increased the frequency of IgA-secreting B cells, as well as IgA secretion by long-lived plasma cells in the small intestinal lamina propria. Moreover, PEM reduced the protective efficacy of the mucosally administered cholera vaccine and recombinant attenuated Salmonella enterica serovar Typhimurium vaccine in a mouse model. Our results suggest that PEM can impair mucosal immunity where IgA plays an important role in host protection and may partly explain the reduced efficacy of oral vaccines in malnourished subjects. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  7. Rupture, Invasion and Inflammatory Destruction of the Intestinal Barrier by Shigella: The Yin and Yang of Innate Immunity

    Directory of Open Access Journals (Sweden)

    Philippe J Sansonetti

    2006-01-01

    Full Text Available Shigella is a Gram-negative bacterial species of the family Enterobacteriaceae that causes bacillary dysentery in humans. This acute colitis reflects the capacity of the microorganism to disrupt, invade and cause the inflammatory destruction of the intestinal epithelium. The pathogenesis of the Shigella infection can be seen as a disruption of the homeostatic balance that protects the gut against inflammation in the presence of its commensal flora. This provides the unified view that enteroinvasive pathogens allow for the identification of key signalling molecules and pathways involved in the regulation of intestinal inflammation, and more generally, in the regulation of the innate and adaptive immune response.

  8. Mucosal application of gp140 encoding DNA polyplexes to different tissues results in altered immunological outcomes in mice.

    Directory of Open Access Journals (Sweden)

    Jamie F S Mann

    Full Text Available Increasing evidence suggests that mucosally targeted vaccines will enhance local humoral and cellular responses whilst still eliciting systemic immunity. We therefore investigated the capacity of nasal, sublingual or vaginal delivery of DNA-PEI polyplexes to prime immune responses prior to mucosal protein boost vaccination. Using a plasmid expressing the model antigen HIV CN54gp140 we show that each of these mucosal surfaces were permissive for DNA priming and production of antigen-specific antibody responses. The elicitation of systemic immune responses using nasally delivered polyplexed DNA followed by recombinant protein boost vaccination was equivalent to a systemic prime-boost regimen, but the mucosally applied modality had the advantage in that significant levels of antigen-specific IgA were detected in vaginal mucosal secretions. Moreover, mucosal vaccination elicited both local and systemic antigen-specific IgG(+ and IgA(+ antibody secreting cells. Finally, using an Influenza challenge model we found that a nasal or sublingual, but not vaginal, DNA prime/protein boost regimen protected against infectious challenge. These data demonstrate that mucosally applied plasmid DNA complexed to PEI followed by a mucosal protein boost generates sufficient antigen-specific humoral antibody production to protect from mucosal viral challenge.

  9. The commensal microbiota drives immune homeostasis

    Directory of Open Access Journals (Sweden)

    Marie-Claire eArrieta

    2012-03-01

    Full Text Available For millions of years, microbes have coexisted with eukaryotic cells at the mucosal surfaces of vertebrates in a complex, yet usually harmonious symbiosis. An ever-expanding number of reports describe how eliminating or shifting the intestinal microbiota has profound effects on the development and functionality of the mucosal and systemic immune systems. Here, we examine some of the mechanisms by which bacterial signals affect immune homeostasis. Focusing on the strategies that microbes use to keep our immune system healthy, as opposed to trying to correct the immune imbalances caused by dysbiosis, may prove to be a more astute and efficient way of treating immune-mediated disease.

  10. Mucosal healing in ulcerative colitis

    DEFF Research Database (Denmark)

    Seidelin, Jakob Benedict; Coskun, Mehmet; Nielsen, Ole Haagen

    2013-01-01

    . With the introduction of the tumor necrosis factor-alpha inhibitors for the treatment of UC, it has become increasingly evident that the disease course is influenced by whether or not the patient achieves mucosal healing. Thus, patients with mucosal healing have fewer flare-ups, a decreased risk of colectomy......, and a lower probability of developing colorectal cancer. Understanding the mechanisms of mucosal wound formation and wound healing in UC, and how they are affected therapeutically is therefore of importance for obtaining efficient treatment strategies holding the potential of changing the disease course of UC....... This review is focused on the pathophysiological mechanism of mucosal wound formation in UC as well as the known mechanisms of intestinal wound healing. Regarding the latter topic, pathways of both wound healing intrinsic to epithelial cells and the wound-healing mechanisms involving interaction between...

  11. Cutaneous and mucosal pain syndromes

    Directory of Open Access Journals (Sweden)

    Siddappa K

    2002-01-01

    Full Text Available The cutaneous and mucosal pain syndromes are characterized by pain, burning sensation, numbness or paraesthesia of a particular part of the skin or mucosal surface without any visible signs. They are usually sensory disorders, sometimes with a great deal of psychologic overlay. In this article various conditions have been listed and are described. The possible causative mechanisms are discussed when they are applicable and the outline of their management is described.

  12. Irradiation mucositis and oral flora

    International Nuclear Information System (INIS)

    Spijkervet, F.K.L.

    1989-01-01

    This study, which is motivated by the substantial morbidity of local signs of mucositis and generalized symptoms that result from mucositis induced by therapeutic irradiation, has the following objectives: To investigate if it is possible to prevent irradiation mucositis via oral flora elimination, and, if it is true that flora plays a role in irradiation mucositis, what fraction of the oral flora may be involved; to evaluate oral Gram-negative bacillary carriage; to investigate the possibility to eradicate Gram-negative bacilli from the oral cavity; to evaluate oral yeast carriage; to investigate the possibility to eradicate yeasts stomatitis and the 'selectivity' of elimination of flora. Two methods are described for monitoring alterations of mucositis of the oral cavity and changes in oral flora. Chlorhexidine has been tested as the commonly used prophylaxis. The effect of chlorhexidine 0.1% rinses on oral flora and mucositis has been studied in a prospective placebo controlled double blind randomized programme. The results of the influence of saliva on the antimicrobial activity of chlorhexidine and the results of selective elimination of oral flora in irradiated patients who have head and neck cancer are reported. Salivary inactivation of the topical antimicrobials used for selective elimination of oral flora has been studied and the results are reported. Finally, the objectives that have been achieved (or not) are delineated. The significance of the results of the study are discussed in terms of published information and further lines of research are suggested. (author). 559 refs.; 29 figs.; 20 tabs

  13. The Immune System in Irritable Bowel Syndrome

    Science.gov (United States)

    Cremon, Cesare; Carini, Giovanni; Bellacosa, Lara; Zecchi, Lisa; De Giorgio, Roberto; Corinaldesi, Roberto; Stanghellini, Vincenzo

    2011-01-01

    The potential relevance of systemic and gastrointestinal immune activation in the pathophysiology and symptom generation in the irritable bowel syndrome (IBS) is supported by a number of observations. Infectious gastroenteritis is the strongest risk factor for the development of IBS and increased rates of IBS-like symptoms have been detected in patients with inflammatory bowel disease in remission or in celiac disease patients on a gluten free diet. The number of T cells and mast cells in the small and large intestine of patients with IBS is increased in a large proportion of patients with IBS over healthy controls. Mediators released by immune cells and likely from other non-immune competent cells impact on the function of enteric and sensory afferent nerves as well as on epithelial tight junctions controlling mucosal barrier of recipient animals, isolated human gut tissues or cell culture systems. Antibodies against microbiota antigens (bacterial flagellin), and increased levels of cytokines have been detected systemically in the peripheral blood advocating the existence of abnormal host-microbial interactions and systemic immune responses. Nonetheless, there is wide overlap of data obtained in healthy controls; in addition, the subsets of patients showing immune activation have yet to be clearly identified. Gender, age, geographic differences, genetic predisposition, diet and differences in the intestinal microbiota likely play a role and further research has to be done to clarify their relevance as potential mechanisms in the described immune system dysregulation. Immune activation has stimulated interest for the potential identification of biomarkers useful for clinical and research purposes and the development of novel therapeutic approaches. PMID:22148103

  14. Molecular players involved in the interaction between beneficial bacteria and the immune system

    Directory of Open Access Journals (Sweden)

    Arancha eHevia

    2015-11-01

    Full Text Available The human gastrointestinal tract is a very complex ecosystem, in which there is a continuous interaction between nutrients, host cells, and microorganisms. The gut microbiota comprises trillions of microbes that have been selected during evolution on the basis of their functionality and capacity to survive in, and adapt to, the intestinal environment. Host bacteria and our immune system constantly sense and react to one another. In this regard, commensal microbes contribute to gut homeostasis, whereas the necessary responses are triggered against enteropathogens. Some representatives of our gut microbiota have beneficial effects on human health. Some of the most important roles of these microbes are to help to maintain the integrity of the mucosal barrier, to provide nutrients such as vitamins, or to protect against pathogens. In addition, the interaction between commensal microbiota and the mucosal immune system is crucial for proper immune function. This process is mainly performed via the pattern recognition receptors of epithelial cells, such as Toll-like or Nod-like receptors, which are able to recognize the molecular effectors that are produced by intestinal microbes. These effectors mediate processes that can ameliorate certain inflammatory gut disorders, discriminate between beneficial and pathogenic bacteria, or increase the number of immune cells or their pattern recognition receptors. This review intends to summarize the molecular players produced by probiotic bacteria, notably Lactobacillus and Bifidobacterium strains, but also other very promising potential probiotics, which affect the human immune system.

  15. Are you experienced? Understanding bladder innate immunity in the context of recurrent urinary tract infection

    Science.gov (United States)

    O’Brien, Valerie P.; Hannan, Thomas J.; Schaeffer, Anthony J.; Hultgren, Scott J.

    2015-01-01

    Purpose of review Recurrent urinary tract infection (rUTI) is a serious clinical problem, yet effective therapeutic options are limited, especially against multidrug-resistant uropathogens. In this review, we explore the development of a clinically relevant model of rUTI in previously infected mice and review recent developments in bladder innate immunity that may affect susceptibility to rUTI. Recent findings Chronic bladder inflammation during prolonged bacterial cystitis in mice causes bladder mucosal remodelling that sensitizes the host to rUTI. Although constitutive defenses help prevent bacterial colonization of the urinary bladder, once infection occurs, induced cytokine and myeloid cell responses predominate and the balance of immune cell defense and bladder immunopathology is critical for determining disease outcome, in both naïve and experienced mice. In particular, the maintenance of the epithelial barrier appears to be essential for preventing severe infection. Summary The innate immune response plays a key role in determining susceptibility to rUTI. Future studies should be directed towards understanding how the innate immune response changes as a result of bladder mucosal remodelling in previously infected mice, and validating these findings in human clinical specimens. New therapeutics targeting the immune response should selectively target the induced innate responses that cause bladder immunopathology, while leaving protective defenses intact. PMID:25517222

  16. Pulmonary delivery of an inulin-stabilized influenza subunit vaccine prepared by spray-freeze drying induces systemic, mucosal humoral as well as cell-mediated immune responses in BALB/c mice

    NARCIS (Netherlands)

    Amorij, J-P.; Saluja, V.; Petersen, A.H.; Hinrichs, W.L.J.; Huckriede, A.; Frijlink, H.W.

    2007-01-01

    In this study pulmonary vaccination with a new influenza subunit vaccine powder was evaluated. Vaccine powder was produced by spray-freeze drying (SFD) using the oligosaccharide inulin as stabilizer. Immune responses after pulmonary vaccination of BALB/c mice with vaccine powder were determined and

  17. The Commensal Microbiota Drives Immune Homeostasis

    OpenAIRE

    Arrieta, Marie-Claire; Finlay, Barton Brett

    2012-01-01

    For millions of years, microbes have coexisted with eukaryotic cells at the mucosal surfaces of vertebrates in a complex, yet usually harmonious symbiosis. An ever-expanding number of reports describe how eliminating or shifting the intestinal microbiota has profound effects on the development and functionality of the mucosal and systemic immune systems. Here, we examine some of the mechanisms by which bacterial signals affect immune homeostasis. Focusing on the strategies that microbes use t...

  18. Role of helminths in regulating mucosal inflammation.

    Science.gov (United States)

    Weinstock, Joel V; Summers, Robert W; Elliott, David E

    2005-09-01

    The rapid rise in prevalence of ulcerative colitis (UC) and Crohn's disease (CD) in highly developed countries suggests that environmental change engenders risk for inflammatory bowel disease (IBD). Eradication of parasitic worms (helminths) through increased hygiene may be one such change that has led to increased prevalence of these diseases. Helminths alter host mucosal and systemic immunity, inhibiting dysregulated inflammatory responses. Animals exposed to helminths are protected from experimental colitis, encephalitis, and diabetes. Patients with CD or UC improve when exposed to whipworm. Lamina propria (LP) mononuclear cells from helminth-colonized mice make less interleukin (IL)-12 p40 and IFN-gamma, but more IL-4, IL-13, IL-10, TGF-beta, and PGE(2) compared to LP mononuclear cells from naive mice. Systemic immune responses show similar skewing toward Th2 and regulatory cytokine production in worm-colonized animal models and humans. Recent reports suggest that helminths induce regulatory T cell activity. These effects by once ubiquitous organisms may have protected individuals from many of the emerging immune-mediated illnesses like IBD, multiple sclerosis, type I diabetes, and asthma.

  19. Cervical Intraepithelial Neoplasia Is Associated With Genital Tract Mucosal Inflammation

    Science.gov (United States)

    Mhatre, Mohak; McAndrew, Thomas; Carpenter, Colleen; Burk, Robert D.; Einstein, Mark H.; Herold, Betsy C.

    2013-01-01

    Background Clinical studies demonstrate increased prevalence of human papillomavirus (HPV)-associated disease in HIV-infected individuals and an increased risk of HIV acquisition in HPV-infected individuals. The mechanisms underlying this synergy are not defined. We hypothesize that women with cervical intraepithelial neoplasia (CIN) will exhibit changes in soluble mucosal immunity that may promote HPV persistence and facilitate HIV infection. Methods The concentrations of immune mediators and endogenous anti-Escherichia coli activity in genital tract secretions collected by cervicovaginal lavage were compared in HIV-negative women with high-risk HPV-positive (HRHPV+) CIN-3 (n = 37), HRHPV+ CIN-1 (n = 12), or PAP-negative control subjects (n = 57). Results Compared with control subjects, women with CIN-3 or CIN-1 displayed significantly higher levels of proinflammatory cytokines including interleukin (IL)-1α, IL-1β, and IL-8 (P < 0.002) and significantly lower levels of anti-inflammatory mediators and antimicrobial peptides, including IL-1 receptor antagonist, secretory leukocyte protease inhibitor (P < 0.01), and human β defensins 2 and 3 (P < 0.02). There was no significant difference in endogenous anti-E. coli activity after controlling for age and sample storage time. Conclusion HRHPV+ CIN is characterized by changes in soluble mucosal immunity that could contribute to HPV persistence. The observed mucosal inflammation suggests a mechanism that may also contribute to the epidemiologic link between persistent HPV and HIV. PMID:22801340

  20. Toxicological Effects of Nickel Chloride on IgA+ B Cells and sIgA, IgA, IgG, IgM in the Intestinal Mucosal Immunity in Broilers

    Directory of Open Access Journals (Sweden)

    Bangyuan Wu

    2014-08-01

    Full Text Available The objective of this study was to investigate the toxicological effects of dietary NiCl2 on IgA+ B cells and the immunoglobulins including sIgA, IgA, IgG and IgM in the small intestine and cecal tonsil of broilers by the methods of immunohistochemistry and enzyme-linked immunosorbent assay (ELISA. Two hundred and forty one-day-old avian broilers were randomly divided into four groups and fed on a control diet and three experimental diets supplemented with 300, 600, and 900 mg/kg NiCl2 for 42 days. Compared with the control group, the IgA+ B cell number and the sIgA, IgA, IgG, and IgM contents in the NiCl2-treated groups were significantly decreased (p < 0.05 or p < 0.01. It was concluded that dietary NiCl2 in the excess of 300 mg/kg had negative effects on the IgA+ B cell number and the abovementioned immunoglobulin contents in the small intestine and the cecal tonsil. NiCl2-reduced sIgA, IgA, IgG and IgM contents is due to decrease in the population and/or the activation of B cell. The results suggest that NiCl2 at high levels has intestinal mucosal humoral immunotoxicity in animals.

  1. Functional and structural characteristics of secretory IgA antibodies elicited by mucosal vaccines against influenza virus.

    Science.gov (United States)

    Suzuki, Tadaki; Ainai, Akira; Hasegawa, Hideki

    2017-09-18

    Mucosal tissues are major targets for pathogens. The secretions covering mucosal surfaces contain several types of molecules that protect the host from infection. Among these, mucosal immunoglobulins, including secretory IgA (S-IgA) antibodies, are the major contributor to pathogen-specific immune responses. IgA is the primary antibody class found in many external secretions and has unique structural and functional features not observed in other antibody classes. Recently, extensive efforts have been made to develop novel vaccines that induce immunity via the mucosal route. S-IgA is a key molecule that underpins the mechanism of action of these mucosal vaccines. Thus, precise characterization of S-IgA induced by mucosal vaccines is important, if the latter are to be used successfully in a clinical setting. Intensive studies identified the fundamental characteristics of S-IgA, which was first discovered almost half a century ago. However, S-IgA itself has not gained much attention of late, despite its importance to mucosal immunity; therefore, some important questions remain. This review summarizes the current understanding of the molecular characteristics of S-IgA and its role in intranasal mucosal vaccines against influenza virus infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Season of birth shapes neonatal immune function

    DEFF Research Database (Denmark)

    Thysen, Anna Hammerich; Rasmussen, Morten Arendt; Kreiner-Møller, Eskil

    2016-01-01

    Birth season has been reported to be a risk factor for several immune-mediated diseases. We hypothesized that this association is mediated by differential changes in neonatal immune phenotype and function with birth season. We sought to investigate the influence of season of birth on cord blood...... immune cell subsets and inflammatory mediators in neonatal airways. Cord blood was phenotyped for 26 different immune cell subsets, and at 1 month of age, 20 cytokines and chemokines were quantified in airway mucosal lining fluid. Multivariate partial least squares discriminant analyses were applied...... to determine whether certain immune profiles dominate by birth season, and correlations between individual cord blood immune cells and early airway immune mediators were defined. We found a birth season-related fluctuation in neonatal immune cell subsets and in early-life airway mucosal immune function...

  3. Cyclic GMP-AMP Displays Mucosal Adjuvant Activity in Mice

    OpenAIRE

    Škrnjug, Ivana; Guzmán, Carlos Alberto; Ruecker, Christine

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice....

  4. Increased melatonin in oral mucosal tissue of oral lichen planus (OLP) patients: A possible link between melatonin and its role in oral mucosal inflammation.

    Science.gov (United States)

    Luengtrakoon, Kirawut; Wannakasemsuk, Worraned; Vichitrananda, Vilasinee; Klanrit, Poramaporn; Hormdee, Doosadee; Noisombut, Rajda; Chaiyarit, Ponlatham

    2017-06-01

    The existence of extra-pineal melatonin has been observed in various tissues. No prior studies of melatonin in human oral mucosal tissue under the condition of chronic inflammation have been reported. The aim of this study was to investigate the presence of melatonin in oral mucosal tissue of patients with oral lichen planus (OLP) which was considered as a chronic inflammatory immune-mediated disease causing oral mucosal damage and ulcerations. Sections from formalin-fixed and paraffin-embedded oral mucosal tissue of OLP patients (n=30), and control subjects (n=30) were used in this study. Immunohistochemical staining was performed and the semiquantitative scoring system was used to assess the levels of arylalkylamine-N-acetyltransferase (AANAT: a rate-limiting enzyme in the biosynthesis pathway of melatonin), melatonin, and melatonin receptor 1 (MT1) in oral mucosa of OLP patients and normal oral mucosa of control subjects. AANAT, melatonin, and MT1were detected in oral mucosal tissue of OLP patients and control subjects. Immunostaining scores of AANAT, melatonin, and MT1 in oral mucosal tissue of OLP patients were significantly higher than those in control subjects (p=0.002, poral mucosal tissue of OLP patients imply that chronic inflammation may induce the local biosynthesis of melatonin via AANAT, and may enhance the action of melatonin via MT1. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Enhanced mucosal reactions in AIDS patients receiving oropharyngeal irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Watkins, E.B.; Findlay, P.; Gelmann, E.; Lane, H.C.; Zabell, A.

    1987-09-01

    The oropharynx and hypopharynx are common sites of involvement in AIDS patients with mucocutaneous Kaposi's sarcoma. The radiotherapist is often asked to intervene with these patients due to problems with pain, difficulty in swallowing, or impending airway obstruction. We have noted an unexpected decrease in normal tissue tolerance of the oropharyngeal mucosa to irradiation in AIDS patients treated in our department. Data on 12 patients with AIDS and Kaposi's sarcoma receiving oropharyngeal irradiation are presented here. Doses ranged from 1000 cGy to 1800 cGy delivered in 150-300 cGy fractions. Seven of eight patients receiving doses of 1200 cGy or more developed some degree of mucositis, four of these developed mucositis severe enough to require termination of treatment. All patients in this study received some form of systemic therapy during the course of their disease, but no influence on mucosal response to irradiation was noted. Four patients received total body skin electron treatments, but no effect on degree of mucositis was seen. Presence or absence of oral candidiasis was not an obvious factor in the radiation response of the oral mucosa in these patients. T4 counts were done on 9 of the 12 patients. Although the timing of the T4 counts was quite variable, no correlation with immune status and degree of mucositis was found. The degree of mucositis seen in these patients occurred at doses much lower than expected based on normal tissue tolerances seen in other patient populations receiving head and neck irradiations. We believe that the ability of the oral mucosa to repair radiation damage is somehow altered in patients with AIDS.

  6. The identification of plant lectins with mucosal adjuvant activity

    Science.gov (United States)

    Lavelle, E C; Grant, G; Pusztai, A; Pfüller, U; O'hagan, D T

    2001-01-01

    To date, the most potent mucosal vaccine adjuvants to be identified have been bacterial toxins. The present data demonstrate that the type 2 ribosome-inactivating protein (type 2 RIP), mistletoe lectin I (ML-I) is a strong mucosal adjuvant of plant origin. A number of plant lectins were investigated as intranasal (i.n.) coadjuvants for a bystander protein, ovalbumin (OVA). As a positive control, a potent mucosal adjuvant, cholera toxin (CT), was used. Co-administration of ML-I or CT with OVA stimulated high titres of OVA-specific serum immunoglobulin G (IgG) in addition to OVA-specific IgA in mucosal secretions. CT and ML-I were also strongly immunogenic, inducing high titres of specific serum IgG and specific IgA at mucosal sites. None of the other plant lectins investigated significantly boosted the response to co-administered OVA. Immunization with phytohaemagglutinin (PHA) plus OVA elicited a lectin-specific response but did not stimulate an enhanced response to OVA compared with the antigen alone. Intranasal delivery of tomato lectin (LEA) elicited a strong lectin-specific systemic and mucosal antibody response but only weakly potentiated the response to co-delivered OVA. In contrast, administration of wheatgerm agglutinin (WGA) or Ulex europaeus lectin 1 (UEA-I) with OVA stimulated a serum IgG response to OVA while the lectin-specific responses (particularly for WGA) were relatively low. Thus, there was not a direct correlation between immunogenicity and adjuvanticity although the strongest adjuvants (CT, ML-I) were also highly immunogenic. PMID:11168640

  7. Enhanced mucosal reactions in AIDS patients receiving oropharyngeal irradiation

    International Nuclear Information System (INIS)

    Watkins, E.B.; Findlay, P.; Gelmann, E.; Lane, H.C.; Zabell, A.

    1987-01-01

    The oropharynx and hypopharynx are common sites of involvement in AIDS patients with mucocutaneous Kaposi's sarcoma. The radiotherapist is often asked to intervene with these patients due to problems with pain, difficulty in swallowing, or impending airway obstruction. We have noted an unexpected decrease in normal tissue tolerance of the oropharyngeal mucosa to irradiation in AIDS patients treated in our department. Data on 12 patients with AIDS and Kaposi's sarcoma receiving oropharyngeal irradiation are presented here. Doses ranged from 1000 cGy to 1800 cGy delivered in 150-300 cGy fractions. Seven of eight patients receiving doses of 1200 cGy or more developed some degree of mucositis, four of these developed mucositis severe enough to require termination of treatment. All patients in this study received some form of systemic therapy during the course of their disease, but no influence on mucosal response to irradiation was noted. Four patients received total body skin electron treatments, but no effect on degree of mucositis was seen. Presence or absence of oral candidiasis was not an obvious factor in the radiation response of the oral mucosa in these patients. T4 counts were done on 9 of the 12 patients. Although the timing of the T4 counts was quite variable, no correlation with immune status and degree of mucositis was found. The degree of mucositis seen in these patients occurred at doses much lower than expected based on normal tissue tolerances seen in other patient populations receiving head and neck irradiations. We believe that the ability of the oral mucosa to repair radiation damage is somehow altered in patients with AIDS

  8. The plasma levels of soluble ST2 as a marker of gut mucosal damage in early HIV infection

    Science.gov (United States)

    Mehraj, Vikram; Jenabian, Mohammad-Ali; Ponte, Rosalie; Lebouché, Bertrand; Costiniuk, Cecilia; Thomas, Réjean; Baril, Jean-Guy; LeBlanc, Roger; Cox, Joseph; Tremblay, Cécile; Routy, Jean-Pierre

    2016-01-01

    Objective: Following tissue barrier breaches, interleukin-33 (IL-33) is released as an ‘alarmin’ to induce inflammation. Soluble suppression of tumorigenicity 2 (sST2), as an IL-33 decoy receptor, contributes to limit inflammation. We assessed the relationship between the IL-33/ST2 axis and markers of gut mucosal damage in patients with early (EHI) and chronic HIV infection (CHI) and elite controllers. Design: Analyses on patients with EHI and CHI were conducted to determine IL-33/sST2 changes over time. Methods: IL-33 and sST2 levels were measured in plasma. Correlations between sST2 levels and plasma viral load, CD4+ and CD8+ T-cell counts, expression of T-cell activation/exhaustion markers, gut mucosal damage, microbial translocation and inflammation markers, as well as kynurenine/tryptophan ratio were assessed. Results: Plasma sST2 levels were elevated in EHI compared with untreated CHI and uninfected controls, whereas IL-33 levels were comparable in all groups. In EHI, sST2 levels were positively correlated with the CD8+ T-cell count and the percentage of T cells expressing activation and exhaustion markers, but not with viral load or CD4+ T-cell count. Plasma sST2 levels also correlated with plasma levels of gut mucosal damage, microbial translocation and kynurenine/tryptophan ratio and for some markers of inflammation. Prospective analyses showed that early antiretroviral therapy had no impact on sST2 levels, whereas longer treatment duration initiated during CHI normalized sST2. Conclusion: As sST2 levels were elevated in EHI and were correlated with CD8+ T-cell count, immune activation, and microbial translocation, sST2 may serve as a marker of disease progression, gut damage and may directly contribute to HIV pathogenesis. PMID:27045377

  9. Cyclic GMP-AMP displays mucosal adjuvant activity in mice.

    Directory of Open Access Journals (Sweden)

    Ivana Škrnjug

    Full Text Available The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity--a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines.

  10. Cyclic GMP-AMP displays mucosal adjuvant activity in mice.

    Science.gov (United States)

    Škrnjug, Ivana; Guzmán, Carlos Alberto; Rueckert, Christine; Ruecker, Christine

    2014-01-01

    The recently discovered mammalian enzyme cyclic GMP-AMP synthase produces cyclic GMP-AMP (cGAMP) after being activated by pathogen-derived cytosolic double stranded DNA. The product can stimulate STING-dependent interferon type I signaling. Here, we explore the efficacy of cGAMP as a mucosal adjuvant in mice. We show that cGAMP can enhance the adaptive immune response to the model antigen ovalbumin. It promotes antigen specific IgG and a balanced Th1/Th2 lymphocyte response in immunized mice. A characteristic of the cGAMP-induced immune response is the slightly reduced induction of interleukin-17 as a hallmark of Th17 activity--a distinct feature that is not observed with other cyclic di-nucleotide adjuvants. We further characterize the innate immune stimulation activity in vitro on murine bone marrow-derived dendritic cells and human dendritic cells. The observed results suggest the consideration of cGAMP as a candidate mucosal adjuvant for human vaccines.

  11. Respuesta inmune mucosal inducida por proteoliposoma y cocleato derivados de N. meningitidis serogrupo B

    Directory of Open Access Journals (Sweden)

    Judith del Campo

    2009-08-01

    Full Text Available Mucosal vaccination offers attractive advantages to conventional systemic vaccination. Most pathogens enter or establish infection at mucosal surfaces. This represents an enormous challenge for vaccine development. Nevertheless, the availability of safe and effective adjuvants that function mucosally is the major limitation. Therefore, we investigated the impact of mucosal immunization with the Neisseria meningitidis B proteoliposome (AFPL1, Adjuvant Finlay Proteoliposome 1 and its-derived cochleate (Co, AFCo1. They contain multiple PAMPs as immunopotentiators and have delivery system ability as well as Th1 polarization activity. Groups of female mice were immunized by nasal, oral, intravaginal, or intramuscular routes with three doses with AFPL1/AFCo1 alone or containing ovalbumin or glycoprotein (g D2 from Herpes Simplex Virus type 2 (HSV-2. High levels of specific IgG antibodies were detected in sera of mice vaccinated with either route. However, specific IgA antibodies were produced in saliva and vaginal wash only following mucosal delivering. The polarization to a Th1 pattern was confirmed by testing the induction of IgG2a/IgG2c antibody, positive delayed-type hypersensitivity reactions, and gIFN production. Additionally, AFCo1gD2 showed practically no vaginal HSV-2 replication and 100% protection against lethal vaginal HSV-2 challenge. In conclusion, the results support the use of AFCo1 as potent Th1 adjuvant for mucosal vaccines, particularly for nasal route.

  12. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  13. Role of Lactobacilli and Lactoferrin in the Mucosal Cervicovaginal Defense

    Directory of Open Access Journals (Sweden)

    Piera Valenti

    2018-03-01

    Full Text Available The innate defense system of the female mucosal genital tract involves a close and complex interaction among the healthy vaginal microbiota, different cells, and various proteins that protect the host from pathogens. Vaginal lactobacilli and lactoferrin represent two essential actors in the vaginal environment. Lactobacilli represent the dominant bacterial species able to prevent facultative and obligate anaerobes outnumber in vaginal microbiota maintaining healthy microbial homeostasis. Several mechanisms underlie the protection exerted by lactobacilli: competition for nutrients and tissue adherence, reduction of the vaginal pH, modulation of immunity, and production of bioactive compounds. Among bioactive factors of cervicovaginal mucosa, lactoferrin, an iron-binding cationic glycoprotein, is a multifunctional glycoprotein with antibacterial, antifungal, antiviral, and antiparasitic activities, recently emerging as an important modulator of inflammation. Lactobacilli and lactoferrin are largely under the influence of female hormones and of paracrine production of various cytokines. Lactoferrin is strongly increased in lower genital tract mucosal fluid of women affected by Neisseria gonorrheae, Chlamydia trachomatis, and Trichomonas vaginalis infections promoting both innate and adaptive immune responses. In vaginal dysbiosis characterized by low amounts of vaginal lactobacilli and increased levels of endogenous anaerobic bacteria, the increase in lactoferrin could act as an immune modulator assuming the role normally played by the healthy microbiota in vaginal mucosa. Then lactoferrin and lactobacilli may be considered as biomarkers of altered microbial homeostasis at vaginal level. Considering the shortage of effective treatments to counteract recurrent and/or antibiotic-resistant bacterial infections, the intravaginal administration of lactobacilli and lactoferrin could be a novel efficient therapeutic strategy and a valuable tool to restore

  14. Sex hormones and mucosal wound healing.

    Science.gov (United States)

    Engeland, Christopher G; Sabzehei, Bahareh; Marucha, Phillip T

    2009-07-01

    Wound healing studies, which have chiefly examined dermal tissues, have reported a female advantage in healing rates. In contrast, our laboratory recently demonstrated women heal mucosal wounds more slowly than men. We hypothesized sex hormones influence wound healing rates, possibly through their modulating effects on inflammation. This study involved 329 younger subjects aged 18-43 (165 women, 164 men) and 93 older subjects aged 50-88 (60 women, 33 men). A 3.5mm diameter wound was created on the hard oral palate and videographed daily to assess wound closure. Blood collected at the time of wounding was used to assess circulating testosterone, progesterone and estradiol levels, and in vitro cytokine production in response to LPS. No strong associations were observed between healing times and estradiol or progesterone levels. However, in younger subjects, lower testosterone levels related to faster wound closure. Conversely, in older women higher testosterone levels related to (1) lower inflammatory responses; and (2) faster healing times. No such relationships were seen in older men, or in women taking oral contraceptives or hormone replacement therapy [HRT]. Older women (50-54 years) not yet experiencing menopause healed similarly to younger women and dissimilarly from age-matched post-menopausal women. This suggests that the deleterious effects of aging on wound healing occur secondary to the effects of menopause. Supporting this, there was evidence in post-menopausal women that HRT augmented wound closure. Overall, this study suggests that human mucosal healing rates are modulated by testosterone levels. Based upon when between-group differences were observed, testosterone may impact upon the proliferative phase of healing which involves immune processes such as re-epithelialization and angiogenesis.

  15. The Molecular Immunology of Mucositis: Implications for Evidence-Based Research in Alternative and Complementary Palliative Treatments

    Directory of Open Access Journals (Sweden)

    Francesco Chiappelli

    2005-01-01

    Full Text Available The terms ‘mucositis’ and ‘stomatitis’ are often used interchangeably. Mucositis, however, pertains to pharyngeal-esophago-gastrointestinal inflammation that manifests as red, burn-like sores or ulcerations throughout the mouth. Stomatitis is an inflammation of the oral tissues proper, which can present with or without sores, and is made worse by poor dental hygiene. Mucositis is observed in a variety of immunosuppressed patients, but is most often consequential to cancer therapy. It appears as early as the third day of intervention, and is usually established by Day 7 of treatment. Mucositis increases mortality and morbidity and contributes to rising health care costs. The precise immune components involved in the etiology of mucositis are unclear, but evidence-based research (EBR data has shown that applications of granulocyte–macrophage-colony stimulating factor prevent the onset or the exacerbation of oropharyngeal mucositis. The molecular implications of this observation are discussed from the perspective of future developments of complementary and alternative treatments for this condition. It must be emphasized that this article is meant to be neither a review on mucositis and the various treatments for it, nor a discussion paper on its underlying molecular immunology. It is a statement of the implications of EBR for CAM-based interventions for mucositis. It explores and discusses the specific domain of molecular immunology in the context of mucositis and its direct implications for EBR research in CAM-based treatments for mucositis.

  16. Oral and intestinal mucositis - causes and possible treatments.

    Science.gov (United States)

    Duncan, M; Grant, G

    2003-11-01

    Chemotherapy and radiotherapy, whilst highly effective in the treatment of neoplasia, can also cause damage to healthy tissue. In particular, the alimentary tract may be badly affected. Severe inflammation, lesioning and ulceration can occur. Patients may experience intense pain, nausea and gastro-enteritis. They are also highly susceptible to infection. The disorder (mucositis) is a dose-limiting toxicity of therapy and affects around 500 000 patients world-wide annually. Oral and intestinal mucositis is multi-factorial in nature. The disruption or loss of rapidly dividing epithelial progenitor cells is a trigger for the onset of the disorder. However, the actual dysfunction that manifests and its severity and duration are greatly influenced by changes in other cell populations, immune responses and the effects of oral/gut flora. This complexity has hampered the development of effective palliative or preventative measures. Recent studies have concentrated on the use of bioactive/growth factors, hormones or interleukins to modify epithelial metabolism and reduce the susceptibility of the tract to mucositis. Some of these treatments appear to have considerable potential and are at present under clinical evaluation. This overview deals with the cellular changes and host responses that may lead to the development of mucositis of the oral cavity and gastrointestinal tract, and the potential of existing and novel palliative measures to limit or prevent the disorder. Presently available treatments do not prevent mucositis, but can limit its severity if used in combination. Poor oral health and existing epithelial damage predispose patients to mucositis. The elimination of dental problems or the minimization of existing damage to the alimentary tract, prior to the commencement of therapy, lowers their susceptibility. Measures that reduce the flora of the tract, before therapy, can also be helpful. Increased production of free radicals and the induction of inflammation are

  17. Gastric Mucosal Erosions - Radiologic evaluation -

    International Nuclear Information System (INIS)

    Kim, Seung Hyup

    1985-01-01

    70 cases of gastric mucosal erosions were diagnosed by double contrast upper gastrointestinal examinations and endoscopic findings. Analyzing the radiologic findings of these 70 cases of gastric mucosal erosions, the following results were obtained. 1. Among the total 70 cases, 65 cases were typical varioliform erosions showing central depressions and surrounding mucosal elevations. Remaining 5 cases were erosions of acute phase having multiple irregular depressions without surrounding elevations. 2. The gastric antrum was involved alone or in part in all cases. Duodenal bulb was involved with gastric antrum in 4 cases. 3. The majority of the cases had multiple erosions. There were only 2 cases of single erosion. 4. In 65 cases of varioliform erosions; 1) The diameter of the surrounding elevations varied from 3 to 20 mm with the majority (47 cases) between 6 and 10 mm. 2) In general, the surrounding elevations with sharp margin on double contrast films were also clearly demonstrated on compression films but those with faint margin were not. 3) The size of the central barium collections varied from pinpoint to 10 mm with the majority under 5 mm. The shape of the central barium collections in majority of the cases were round with a few cases of linear, triangular or star-shape. 5. In 5 cases of acute phase erosions; 1) All the 5 cases were females. 2) On double contrast radiography, all the cases showed multiple irregular depressed lesions without surrounding elevations. 3) 1 case had the history of hematemesis. 4) In 1 case, there was marked radiological improvement on follow-up study of 2 months interval. 6. In 23 cases, there were coexistent diseases with gastric mucosal erosions. These were 13 cases of duodenal bulb ulcers,7 cases of benign gastric ulcers and 3 others

  18. Cryopreservation of Human Mucosal Leukocytes.

    Directory of Open Access Journals (Sweden)

    Sean M Hughes

    Full Text Available Understanding how leukocytes in the cervicovaginal and colorectal mucosae respond to pathogens, and how medical interventions affect these responses, is important for developing better tools to prevent HIV and other sexually transmitted infections. An effective cryopreservation protocol for these cells following their isolation will make studying them more feasible.To find an optimal cryopreservation protocol for mucosal mononuclear leukocytes, we compared cryopreservation media and procedures using human vaginal leukocytes and confirmed our results with endocervical and colorectal leukocytes. Specifically, we measured the recovery of viable vaginal T cells and macrophages after cryopreservation with different cryopreservation media and handling procedures. We found several cryopreservation media that led to recoveries above 75%. Limiting the number and volume of washes increased the fraction of cells recovered by 10-15%, possibly due to the small cell numbers in mucosal samples. We confirmed that our cryopreservation protocol also works well for both endocervical and colorectal leukocytes. Cryopreserved leukocytes had slightly increased cytokine responses to antigenic stimulation relative to the same cells tested fresh. Additionally, we tested whether it is better to cryopreserve endocervical cells on the cytobrush or in suspension.Leukocytes from cervicovaginal and colorectal tissues can be cryopreserved with good recovery of functional, viable cells using several different cryopreservation media. The number and volume of washes has an experimentally meaningful effect on the percentage of cells recovered. We provide a detailed, step-by-step protocol with best practices for cryopreservation of mucosal leukocytes.

  19. Aluminum enhances inflammation and decreases mucosal healing in experimental colitis in mice

    Science.gov (United States)

    Pineton de Chambrun, G; Body-Malapel, M; Frey-Wagner, I; Djouina, M; Deknuydt, F; Atrott, K; Esquerre, N; Altare, F; Neut, C; Arrieta, M C; Kanneganti, T-D; Rogler, G; Colombel, J-F; Cortot, A; Desreumaux, P; Vignal, C

    2014-01-01

    The increasing incidence of inflammatory bowel diseases (IBDs) in developing countries has highlighted the critical role of environmental pollutants as causative factors in their pathophysiology. Despite its ubiquity and immune toxicity, the impact of aluminum in the gut is not known. This study aimed to evaluate the effects of environmentally relevant intoxication with aluminum in murine models of colitis and to explore the underlying mechanisms. Oral administration of aluminum worsened intestinal inflammation in mice with 2,4,6-trinitrobenzene sulfonic acid- and dextran sodium sulfate-induced colitis and chronic colitis in interleukin 10-negative (IL10−/−) mice. Aluminum increased the intensity and duration of macroscopic and histologic inflammation, colonic myeloperoxidase activity, inflammatory cytokines expression, and decreased the epithelial cell renewal compared with control animals. Under basal conditions, aluminum impaired intestinal barrier function. In vitro, aluminum induced granuloma formation and synergized with lipopolysaccharide to stimulate inflammatory cytokines expression by epithelial cells. Deleterious effects of aluminum on intestinal inflammation and mucosal repair strongly suggest that aluminum might be an environmental IBD risk factor. PMID:24129165

  20. Evasion of mucosal defenses during Aeromonas hydrophila infection of channel catfish (Ictalurus punctatus) skin

    Science.gov (United States)

    The mucosal surfaces of fish serve as the first-line of defense against the myriad of aquatic pathogens present in the aquatic environment. The immune repertoire functioning at these interfaces is still poorly understood. The skin, in particular, must process signals from several fronts, sensing and...

  1. Epithelial Cell Inflammasomes in Intestinal Immunity and Inflammation

    Directory of Open Access Journals (Sweden)

    Andrea C. Lei-Leston

    2017-09-01

    Full Text Available Pattern recognition receptors (PRR, such as NOD-like receptors (NLRs, sense conserved microbial signatures, and host danger signals leading to the coordination of appropriate immune responses. Upon activation, a subset of NLR initiate the assembly of a multimeric protein complex known as the inflammasome, which processes pro-inflammatory cytokines and mediates a specialized form of cell death known as pyroptosis. The identification of inflammasome-associated genes as inflammatory bowel disease susceptibility genes implicates a role for the inflammasome in intestinal inflammation. Despite the fact that the functional importance of inflammasomes within immune cells has been well established, the contribution of inflammasome expression in non-hematopoietic cells remains comparatively understudied. Given that intestinal epithelial cells (IEC act as a barrier between the host and the intestinal microbiota, inflammasome expression by these cells is likely important for intestinal immune homeostasis. Accumulating evidence suggests that the inflammasome plays a key role in shaping epithelial responses at the host–lumen interface with many inflammasome components highly expressed by IEC. Recent studies have exposed functional roles of IEC inflammasomes in mucosal immune defense, inflammation, and tumorigenesis. In this review, we present the main features of the predominant inflammasomes and their effector mechanisms contributing to intestinal homeostasis and inflammation. We also discuss existing controversies in the field and open questions related to their implications in disease. A comprehensive understanding of the molecular basis of intestinal inflammasome signaling could hold therapeutic potential for clinical translation.

  2. Acute mucosal pathogenesis of feline immunodeficiency virus is independent of viral dose in vaginally infected cats

    Directory of Open Access Journals (Sweden)

    Egan Erin A

    2010-01-01

    Full Text Available Abstract Background The mucosal pathogenesis of HIV has been shown to be an important feature of infection and disease progression. HIV-1 infection causes depletion of intestinal lamina propria CD4+ T cells (LPL, therefore, intestinal CD4+ T cell preservation may be a useful correlate of protection in evaluating vaccine candidates. Vaccine studies employing the cat/FIV and macaque/SIV models frequently use high doses of parenterally administered challenge virus to ensure high plasma viremia in control animals. However, it is unclear if loss of mucosal T cells would occur regardless of initial viral inoculum dose. The objective of this study was to determine the acute effect of viral dose on mucosal leukocytes and associated innate and adaptive immune responses. Results Cats were vaginally inoculated with a high, middle or low dose of cell-associated and cell-free FIV. PBMC, serum and plasma were assessed every two weeks with tissues assessed eight weeks following infection. We found that irrespective of mucosally administered viral dose, FIV infection was induced in all cats. However, viremia was present in only half of the cats, and viral dose was unrelated to the development of viremia. Importantly, regardless of viral dose, all cats experienced significant losses of intestinal CD4+ LPL and CD8+ intraepithelial lymphocytes (IEL. Innate immune responses by CD56+CD3- NK cells correlated with aviremia and apparent occult infection but did not protect mucosal T cells. CD4+ and CD8+ T cells in viremic cats were more likely to produce cytokines in response to Gag stimulation, whereas aviremic cats T cells tended to produce cytokines in response to Env stimulation. However, while cell-mediated immune responses in aviremic cats may have helped reduce viral replication, they could not be correlated to the levels of viremia. Robust production of anti-FIV antibodies was positively correlated with the magnitude of viremia. Conclusions Our results indicate

  3. Vaccination against Salmonella Infection: the Mucosal Way.

    Science.gov (United States)

    Gayet, Rémi; Bioley, Gilles; Rochereau, Nicolas; Paul, Stéphane; Corthésy, Blaise

    2017-09-01

    Salmonella enterica subspecies enterica includes several serovars infecting both humans and other animals and leading to typhoid fever or gastroenteritis. The high prevalence of associated morbidity and mortality, together with an increased emergence of multidrug-resistant strains, is a current global health issue that has prompted the development of vaccination strategies that confer protection against most serovars. Currently available systemic vaccine approaches have major limitations, including a reduced effectiveness in young children and a lack of cross-protection among different strains. Having studied host-pathogen interactions, microbiologists and immunologists argue in favor of topical gastrointestinal administration for improvement in vaccine efficacy. Here, recent advances in this field are summarized, including mechanisms of bacterial uptake at the intestinal epithelium, the assessment of protective host immunity, and improved animal models that closely mimic infection in humans. The pros and cons of existing vaccines are presented, along with recent progress made with novel formulations. Finally, new candidate antigens and their relevance in the refined design of anti- Salmonella vaccines are discussed, along with antigen vectorization strategies such as nanoparticles or secretory immunoglobulins, with a focus on potentiating mucosal vaccine efficacy. Copyright © 2017 American Society for Microbiology.

  4. [Recurrent pulmonary infection and oral mucosal ulcer].

    Science.gov (United States)

    Kuang, Fei-Mei; Tang, Lan-Lan; Zhang, Hui; Xie, Min; Yang, Ming-Hua; Yang, Liang-Chun; Yu, Yan; Cao, Li-Zhi

    2017-04-01

    An 8-year-old girl who had experienced intermittent cough and fever over a 3 year period, was admitted after experiencing a recurrence for one month. One year ago the patient experienced a recurrent oral mucosal ulcer. Physical examination showed vitiligo in the skin of the upper right back. Routine blood tests and immune function tests performed in other hospitals had shown normal results. Multiple lung CT scans showed pulmonary infection. The patient had recurrent fever and cough and persistent presence of some lesions after anti-infective therapy. The antitubercular therapy was ineffective. Routine blood tests after admission showed agranulocytosis. Gene detection was performed and she was diagnosed with dyskeratosis congenita caused by homozygous mutation in RTEL1. Patients with dyskeratosis congenita with RTEL1 gene mutation tend to develop pulmonary complications. Since RTEL1 gene sequence is highly variable with many mutation sites and patterns and can be inherited via autosomal dominant or recessive inheritance, this disease often has various clinical manifestations, which may lead to missed diagnosis or misdiagnosis. For children with unexplained recurrent pulmonary infection, examinations of the oral cavity, skin, and nails and toes should be taken and routine blood tests should be performed to exclude dyskeratosis congenita. There are no specific therapies for dyskeratosis congenita at present, and when bone marrow failure and pulmonary failure occur, hematopoietic stem cell transplantation and lung transplantation are the only therapies. Androgen and its derivatives are effective in some patients. Drugs targeting the telomere may be promising for patients with dyskeratosis congenita.

  5. Aryl hydrocarbon receptor and intestinal immunity.

    Science.gov (United States)

    Lamas, Bruno; Natividad, Jane M; Sokol, Harry

    2018-04-07

    Aryl hydrocarbon receptor (AhR) is a member of the basic helix-loop-helix-(bHLH) superfamily of transcription factors, which are associated with cellular responses to environmental stimuli, such as xenobiotics and oxygen levels. Unlike other members of bHLH, AhR is the only bHLH transcription factor that is known to be ligand activated. Early AhR studies focused on understanding the role of AhR in mediating the toxicity and carcinogenesis properties of the prototypic ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In recent years, however, it has become apparent that, in addition to its toxicological involvement, AhR is highly receptive to a wide array of endogenous and exogenous ligands, and that its activation leads to a myriad of key host physiological functions. In this study, we review the current understanding of the functions of AhR in the mucosal immune system with a focus on its role in intestinal barrier function and intestinal immune cells, as well as in intestinal homeostasis.

  6. Voice disorders in mucosal leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Ana Cristina Nunes Ruas

    Full Text Available INTRODUCTION: Leishmaniasis is considered as one of the six most important infectious diseases because of its high detection coefficient and ability to produce deformities. In most cases, mucosal leishmaniasis (ML occurs as a consequence of cutaneous leishmaniasis. If left untreated, mucosal lesions can leave sequelae, interfering in the swallowing, breathing, voice and speech processes and requiring rehabilitation. OBJECTIVE: To describe the anatomical characteristics and voice quality of ML patients. MATERIALS AND METHODS: A descriptive transversal study was conducted in a cohort of ML patients treated at the Laboratory for Leishmaniasis Surveillance of the Evandro Chagas National Institute of Infectious Diseases-Fiocruz, between 2010 and 2013. The patients were submitted to otorhinolaryngologic clinical examination by endoscopy of the upper airways and digestive tract and to speech-language assessment through directed anamnesis, auditory perception, phonation times and vocal acoustic analysis. The variables of interest were epidemiologic (sex and age and clinic (lesion location, associated symptoms and voice quality. RESULTS: 26 patients under ML treatment and monitored by speech therapists were studied. 21 (81% were male and five (19% female, with ages ranging from 15 to 78 years (54.5+15.0 years. The lesions were distributed in the following structures 88.5% nasal, 38.5% oral, 34.6% pharyngeal and 19.2% laryngeal, with some patients presenting lesions in more than one anatomic site. The main complaint was nasal obstruction (73.1%, followed by dysphonia (38.5%, odynophagia (30.8% and dysphagia (26.9%. 23 patients (84.6% presented voice quality perturbations. Dysphonia was significantly associated to lesions in the larynx, pharynx and oral cavity. CONCLUSION: We observed that vocal quality perturbations are frequent in patients with mucosal leishmaniasis, even without laryngeal lesions; they are probably associated to disorders of some

  7. Intestinal barrier dysfunction develops at the onset of experimental autoimmune encephalomyelitis, and can be induced by adoptive transfer of auto-reactive T cells.

    Directory of Open Access Journals (Sweden)

    Mehrnaz Nouri

    Full Text Available Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with a pathogenesis involving a dysfunctional blood-brain barrier and myelin-specific, autoreactive T cells. Although the commensal microbiota seems to affect its pathogenesis, regulation of the interactions between luminal antigens and mucosal immune elements remains unclear. Herein, we investigated whether the intestinal mucosal barrier is also targeted in this disease. Experimental autoimmune encephalomyelitis (EAE, the prototypic animal model of MS, was induced either by active immunization or by adoptive transfer of autoreactive T cells isolated from these mice. We show increased intestinal permeability, overexpression of the tight junction protein zonulin and alterations in intestinal morphology (increased crypt depth and thickness of the submucosa and muscularis layers. These intestinal manifestations were seen at 7 days (i.e., preceding the onset of neurological symptoms and at 14 days (i.e., at the stage of paralysis after immunization. We also demonstrate an increased infiltration of proinflammatory Th1/Th17 cells and a reduced regulatory T cell number in the gut lamina propria, Peyer's patches and mesenteric lymph nodes. Adoptive transfer to healthy mice of encephalitogenic T cells, isolated from EAE-diseased animals, led to intestinal changes similar to those resulting from the immunization procedure. Our findings show that disruption of intestinal homeostasis is an early and immune-mediated event in EAE. We propose that this intestinal dysfunction may act to support disease progression, and thus represent a potential therapeutic target in MS. In particular, an increased understanding of the regulation of tight junctions at the blood-brain barrier and in the intestinal wall may be crucial for design of future innovative therapies.

  8. Intestinal Barrier Dysfunction Develops at the Onset of Experimental Autoimmune Encephalomyelitis, and Can Be Induced by Adoptive Transfer of Auto-Reactive T Cells

    Science.gov (United States)

    Nouri, Mehrnaz; Bredberg, Anders; Weström, Björn; Lavasani, Shahram

    2014-01-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating disease of the central nervous system with a pathogenesis involving a dysfunctional blood-brain barrier and myelin-specific, autoreactive T cells. Although the commensal microbiota seems to affect its pathogenesis, regulation of the interactions between luminal antigens and mucosal immune elements remains unclear. Herein, we investigated whether the intestinal mucosal barrier is also targeted in this disease. Experimental autoimmune encephalomyelitis (EAE), the prototypic animal model of MS, was induced either by active immunization or by adoptive transfer of autoreactive T cells isolated from these mice. We show increased intestinal permeability, overexpression of the tight junction protein zonulin and alterations in intestinal morphology (increased crypt depth and thickness of the submucosa and muscularis layers). These intestinal manifestations were seen at 7 days (i.e., preceding the onset of neurological symptoms) and at 14 days (i.e., at the stage of paralysis) after immunization. We also demonstrate an increased infiltration of proinflammatory Th1/Th17 cells and a reduced regulatory T cell number in the gut lamina propria, Peyer's patches and mesenteric lymph nodes. Adoptive transfer to healthy mice of encephalitogenic T cells, isolated from EAE-diseased animals, led to intestinal changes similar to those resulting from the immunization procedure. Our findings show that disruption of intestinal homeostasis is an early and immune-mediated event in EAE. We propose that this intestinal dysfunction may act to support disease progression, and thus represent a potential therapeutic target in MS. In particular, an increased understanding of the regulation of tight junctions at the blood-brain barrier and in the intestinal wall may be crucial for design of future innovative therapies. PMID:25184418

  9. Immunological effects of reduced mucosal integrity in the early life of BALB/c mice

    DEFF Research Database (Denmark)

    Bendtsen, Katja Maria Bangsgaard; Hansen, Camilla Hartmann Friis; Krych, Łukasz

    2017-01-01

    Certain stimuli at the gut barrier may be necessary in early life to establish a proper balance of immune tolerance. We evaluated a compromised barrier in juvenile mice in relation to microbiota and local and systemic immunity. BALB/c mice were treated with a low dose of dextran sulfate sodium (D...

  10. Arkansas community pharmacists' opinions on providing immunizations.

    Science.gov (United States)

    Pace, Anne C; Flowers, Schwanda K; Hastings, Jan K

    2010-10-01

    To determine community pharmacists' attitudes and knowledge on providing immunizations including perceived barriers to immunizing. The study also examined the percentage of Arkansas pharmacists providing immunizations and the utilization of student pharmacists. Survey. Arkansas community pharmacies from February to March 2009. Community pharmacists. Mailed survey. Perceived barriers to providing immunizations, pharmacists' attitudes regarding immunizations, number of immunization-certified pharmacists, immunization administration rates within the last year, and senior student pharmacists utilization. A total of 350 surveys were mailed, and 129 were returned. In all, 79% of the respondents believed administering immunizations has advanced or significantly advanced the profession. Being certified and attitude toward providing immunizations were correlated; 37% of the respondents held certification to immunize, of which 77% reported immunizing within the last year. Commonly reported barriers included time (76%) followed by reimbursement and legal liability. Only half the respondents realized fourth year student pharmacists could immunize and only 33% of certified pharmacists utilized student pharmacists to immunize. Pharmacists perceive many barriers to providing immunizations. Training student pharmacists to give immunizations may not result in them providing immunizations upon graduation. Additional education on overcoming potential barriers and using senior student pharmacists to administer immunizations is needed.

  11. Effects of Mycotoxins on Mucosal Microbial Infection and Related Pathogenesis

    Science.gov (United States)

    Park, Seong-Hwan; Kim, Dongwook; Kim, Juil; Moon, Yuseok

    2015-01-01

    Mycotoxins are fungal secondary metabolites detected in many agricultural commodities and water-damaged indoor environments. Susceptibility to mucosal infectious diseases is closely associated with immune dysfunction caused by mycotoxin exposure in humans and other animals. Many mycotoxins suppress immune function by decreasing the proliferation of activated lymphocytes, impairing phagocytic function of macrophages, and suppressing cytokine production, but some induce hypersensitive responses in different dose regimes. The present review describes various mycotoxin responses to infectious pathogens that trigger mucosa-associated diseases in the gastrointestinal and respiratory tracts of humans and other animals. In particular, it focuses on the effects of mycotoxin exposure on invasion, pathogen clearance, the production of cytokines and immunoglobulins, and the prognostic implications of interactions between infectious pathogens and mycotoxin exposure. PMID:26529017

  12. Temporal and spatial interplay of microbiota and intestinal mucosa drive establishment of immune homeostasis in conventionalized mice

    NARCIS (Netherlands)

    Aidy, El S.; Baarlen, van P.; Derrien, M.; Lindenbergh-Kortleve, D.J.; Hooiveld, G.J.; Levenez, F.; Dore, J.; Dekker, J.; Samsom, J.N.; Nieuwenhuis, E.E.S.; Kleerebezem, M.

    2012-01-01

    During colonization of germfree mice with the total fecal microbial community of their conventionally born and raised siblings (conventionalization), the intestinal mucosal immune system initiates and maintains a balanced immune response. However, the genetic regulation of these balanced,

  13. Mucus as a Barrier to Drug Delivery

    DEFF Research Database (Denmark)

    Bøgh, Marie; Nielsen, Hanne Mørck

    2015-01-01

    Viscoelastic mucus lines all mucosal surfaces of the body and forms a potential barrier to mucosal drug delivery. Mucus is mainly composed of water and mucins; high-molecular weight glycoproteins forming an entangled network. Consequently, mucus forms a steric barrier and due to its negative charge...... barrier to drug delivery. Current knowledge of mucus characteristics and barrier properties, as achieved by state-of-the-art methodologies, is the topic of this MiniReview emphasizing the gastrointestinal mucus and an overall focus on oral drug delivery. Cell culture-based in vitro models are well......, studies of peptide and protein drug diffusion in and through mucus and studies of mucus-penetrating nanoparticles are included to illustrate the mucus as a potentially important barrier to obtain sufficient bioavailability of orally administered drugs, and thus an important parameter to address...

  14. Multifunctional particle-constituted microneedle arrays as cutaneous or mucosal vaccine adjuvant-delivery systems

    Science.gov (United States)

    Wang, Xueting; Wang, Ning; Li, Ning; Zhen, Yuanyuan; Wang, Ting

    2016-01-01

    ABSTRACT To overcome drawbacks of current injection vaccines, such as causing needle phobia, needing health professionals for inoculation, and generating dangerous sharps wastes, researchers have designed novel vaccines that are combined with various microneedle arrays (MAs), in particular, with the multifunctional particle-constructed MAs (MPMAs). MPMAs prove able to enhance vaccine stability through incorporating vaccine ingredients in the carrier, and can be painlessly inoculated by minimally trained workers or by self-administration, leaving behind no metal needle pollution while eliciting robust systemic and mucosal immunity to antigens, thanks to delivering vaccines to cutaneous or mucosal compartments enriched in professional antigen-presenting cells (APCs). Especially, MPMAs can be easily integrated with functional molecules fulfilling targeting vaccine delivery or controlling immune response toward a Th1 or Th2 pathway to generate desired immunity against pathogens. Herein, we introduce the latest research and development of various MPMAs which are a novel but promising vaccine adjuvant delivery system (VADS). PMID:27159879

  15. Gut microbiota utilize immunoglobulin A for mucosal colonization.

    Science.gov (United States)

    Donaldson, G P; Ladinsky, M S; Yu, K B; Sanders, J G; Yoo, B B; Chou, W-C; Conner, M E; Earl, A M; Knight, R; Bjorkman, P J; Mazmanian, S K

    2018-05-18

    The immune system responds vigorously to microbial infection while permitting lifelong colonization by the microbiome. Mechanisms that facilitate the establishment and stability of the gut microbiota remain poorly described. We found that a regulatory system in the prominent human commensal Bacteroides fragilis modulates its surface architecture to invite binding of immunoglobulin A (IgA) in mice. Specific immune recognition facilitated bacterial adherence to cultured intestinal epithelial cells and intimate association with the gut mucosal surface in vivo. The IgA response was required for B. fragilis (and other commensal species) to occupy a defined mucosal niche that mediates stable colonization of the gut through exclusion of exogenous competitors. Therefore, in addition to its role in pathogen clearance, we propose that IgA responses can be co-opted by the microbiome to engender robust host-microbial symbiosis. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  16. Environmental modulation of mucosal immunity : Opportunities in respiratory viral infections

    NARCIS (Netherlands)

    Schijf, M.A.

    2013-01-01

    The exact cause of severe disease in children during primary RSV infections is not completely clear. There is a link with viral load, but differences virus strains do not seem to be the major reason why in some children the disease manifests as a mild cold while others suffer from a severe lower

  17. Mucosal immune response in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja

    Control of fish diseases is a great concern in aquaculture because of losses in the production. Drug choices for the treatment of common infectious diseases are becoming increasingly limited and expensive and, in some cases, unavailable due to the emergence of drug resistance in bacteria and fungi....... This is why number of biological compounds, as an alternative to the drugs, has been used to reduce the risk of diseases and improve fish welfare by enhancement of non-specific defence system. Among them, ß-glucans, naturally occurring polysaccharides found in the cell wall of plants, bacteria and fungi...

  18. Crohn’s disease: Mucosal immunology and immune modulating therapy

    NARCIS (Netherlands)

    Peters, C.P.

    2014-01-01

    Crohn’s disease (CD) and ulcerative colitis (UC) are debilitating chronic diseases that affect millions of people worldwide, profoundly impacting patient quality of life and incurring large costs in terms of treatment and lost productivity. While current interventions ameliorate disease symptoms,

  19. Review: Gp-340/DMBT1 in mucosal innate immunity

    DEFF Research Database (Denmark)

    Madsen, Jens; Mollenhauer, Jan; Holmskov, Uffe

    2010-01-01

    ) is secreted into broncho-alveolar surface lining fluid whereas DMBT(SAG) is present in the saliva. The two molecules were shown to be identical and both interact with and agglutinate several Gram-negative and Gram-positive bacteria including Streptococcus mutans, a bacterium responsible for caries in the oral...

  20. BISPHOSPHONATE - RELATED MUCOSITIS (BRM: A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Pavel Stanimirov

    2017-03-01

    Full Text Available Bisphosphonates (BPs are the most widely used and effective antiresorptive agents for the treatment of diseases in which there is an increase in osteoclastic resorption, including post-menopausal osteoporosis, Paget’s disease, and tumor-associated osteolysis. Oral and maxillofacial surgeons are well aware of the side effects of bisphosphonates and mainly with bisphosphonate-related osteonecrosis of the jaws (BRONJ. Less known are the mucosal lesions associated with the use of these agents. In the scientific literature, there are only few reports of mucosal lesions due to the direct contact of the oral form of BPs with the mucosa (bisphosphonate-related mucositis. They are mostly related to improper use of bisphosphonate tablets that are chewed, sucked or allowed to melt in the mouth before swallowing. Lesions are atypical and need to be differentiated from other mucosal erosions. We present a case of bisphosphonate-related mucositis due to the improper use of alendronate.

  1. The Th17 Lineage: From Barrier Surfaces Homeostasis to Autoimmunity, Cancer, and HIV-1 Pathogenesis.

    Science.gov (United States)

    Wacleche, Vanessa Sue; Landay, Alan; Routy, Jean-Pierre; Ancuta, Petronela

    2017-10-19

    The T helper 17 (Th17) cells represent a subset of CD4+ T-cells with unique effector functions, developmental plasticity, and stem-cell features. Th17 cells bridge innate and adaptive immunity against fungal and bacterial infections at skin and mucosal barrier surfaces. Although Th17 cells have been extensively studied in the context of autoimmunity, their role in various other pathologies is underexplored and remains an area of open investigation. This review summarizes the history of Th17 cell discovery and the current knowledge relative to the beneficial role of Th17 cells in maintaining mucosal immunity homeostasis. We further discuss the concept of Th17 pathogenicity in the context of autoimmunity, cancer, and HIV infection, and we review the most recent discoveries on molecular mechanisms regulating HIV replication/persistence in pathogenic Th17 cells. Finally, we stress the need for novel fundamental research discovery-based Th17-specific therapeutic interventions to treat pathogenic conditions associated with Th17 abnormalities, including HIV infection.

  2. The Th17 Lineage: From Barrier Surfaces Homeostasis to Autoimmunity, Cancer, and HIV-1 Pathogenesis

    Directory of Open Access Journals (Sweden)

    Vanessa Sue Wacleche

    2017-10-01

    Full Text Available The T helper 17 (Th17 cells represent a subset of CD4+ T-cells with unique effector functions, developmental plasticity, and stem-cell features. Th17 cells bridge innate and adaptive immunity against fungal and bacterial infections at skin and mucosal barrier surfaces. Although Th17 cells have been extensively studied in the context of autoimmunity, their role in various other pathologies is underexplored and remains an area of open investigation. This review summarizes the history of Th17 cell discovery and the current knowledge relative to the beneficial role of Th17 cells in maintaining mucosal immunity homeostasis. We further discuss the concept of Th17 pathogenicity in the context of autoimmunity, cancer, and HIV infection, and we review the most recent discoveries on molecular mechanisms regulating HIV replication/persistence in pathogenic Th17 cells. Finally, we stress the need for novel fundamental research discovery-based Th17-specific therapeutic interventions to treat pathogenic conditions associated with Th17 abnormalities, including HIV infection.

  3. Gut Microbiota-Immune System Crosstalk and Pancreatic Disorders

    Directory of Open Access Journals (Sweden)

    D. Pagliari

    2018-01-01

    Full Text Available Gut microbiota is key to the development and modulation of the mucosal immune system. It plays a central role in several physiological functions, in the modulation of inflammatory signaling and in the protection against infections. In healthy states, there is a perfect balance between commensal and pathogens, and microbiota and the immune system interact to maintain gut homeostasis. The alteration of such balance, called dysbiosis, determines an intestinal bacterial overgrowth which leads to the disruption of the intestinal barrier with systemic translocation of pathogens. The pancreas does not possess its own microbiota, and it is believed that inflammatory and neoplastic processes affecting the gland may be linked to intestinal dysbiosis. Increasing research evidence testifies a correlation between intestinal dysbiosis and various pancreatic disorders, but it remains unclear whether dysbiosis is the cause or an effect. The analysis of specific alterations in the microbiome profile may permit to develop novel tools for the early detection of several pancreatic disorders, utilizing samples, such as blood, saliva, and stools. Future studies will have to elucidate the mechanisms by which gut microbiota is modulated and how it tunes the immune system, in order to be able to develop innovative treatment strategies for pancreatic disorders.

  4. Unpolarized release of vaccinia virus and HIV antigen by colchicine treatment enhances intranasal HIV antigen expression and mucosal humoral responses.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available The induction of a strong mucosal immune response is essential to building successful HIV vaccines. Highly attenuated recombinant HIV vaccinia virus can be administered mucosally, but even high doses of immunization have been found unable to induce strong mucosal antibody responses. In order to solve this problem, we studied the interactions of recombinant HIV vaccinia virus Tiantan strain (rVTT-gagpol in mucosal epithelial cells (specifically Caco-2 cell layers and in BALB/c mice. We evaluated the impact of this virus on HIV antigen delivery and specific immune responses. The results demonstrated that rVTT-gagpol was able to infect Caco-2 cell layers and both the nasal and lung epithelia in BALB/c mice. The progeny viruses and expressed p24 were released mainly from apical surfaces. In BALB/c mice, the infection was limited to the respiratory system and was not observed in the blood. This showed that polarized distribution limited antigen delivery into the whole body and thus limited immune response. To see if this could be improved upon, we stimulated unpolarized budding of the virus and HIV antigens by treating both Caco-2 cells and BALB/c mice with colchicine. We found that, in BALB/c mice, the degree of infection and antigen expression in the epithelia went up. As a result, specific immune responses increased correspondingly. Together, these data suggest that polarized budding limits antigen delivery and immune responses, but unpolarized distribution can increase antigen expression and delivery and thus enhance specific immune responses. This conclusion can be used to optimize mucosal HIV vaccine strategies.

  5. Commensal Lactobacillus Controls Immune Tolerance during Acute Liver Injury in Mice

    Directory of Open Access Journals (Sweden)

    Nobuhiro Nakamoto

    2017-10-01

    Full Text Available Summary: Gut-derived microbial antigens trigger the innate immune system during acute liver injury. During recovery, regulatory immunity plays a role in suppressing inflammation; however, the precise mechanism underlying this process remains obscure. Here, we find that recruitment of immune-regulatory classical dendritic cells (cDCs is crucial for liver tolerance in concanavalin A-induced acute liver injury. Acute liver injury resulted in enrichment of commensal Lactobacillus in the gut. Notably, Lactobacillus activated IL-22 production by gut innate lymphoid cells and raised systemic IL-22 levels. Gut-derived IL-22 enhanced mucosal barrier function and promoted the recruitment of regulatory cDCs to the liver. These cDCs produced IL-10 and TGF-β through TLR9 activation, preventing further liver inflammation. Collectively, our results indicate that beneficial gut microbes influence tolerogenic immune responses in the liver. Therefore, modulation of the gut microbiota might be a potential option to regulate liver tolerance. : Nakamoto et.al. find that Lactobacillus accumulates in the gut and activates IL-22 production by innate lymphoid cells during acute liver injury. Gut-derived IL-22 contributes to liver tolerance via induction of regulatory DCs. Keywords: immune tolerance, dendritic cell, innate lymphoid cell, acute liver injury, interleukin-10, interleukin-22, microbiota, dysbiosis

  6. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    Science.gov (United States)

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  7. Acceptability and feasibility of repeated mucosal specimen collection in clinical trial participants in Kenya.

    Directory of Open Access Journals (Sweden)

    Gloria Omosa-Manyonyi

    Full Text Available Mucosal specimens are essential to evaluate compartmentalized immune responses to HIV vaccine candidates and other mucosally targeted investigational products. We studied the acceptability and feasibility of repeated mucosal sampling in East African clinical trial participants at low risk of HIV and other sexually transmitted infections.The Kenya AIDS Vaccine Initiative (KAVI enrolled participants into three Phase 1 trials of preventive HIV candidate vaccines in 2011-2012 at two clinical research centers in Nairobi. After informed consent to a mucosal sub-study, participants were asked to undergo collection of mucosal secretions (saliva, oral fluids, semen, cervico-vaginal and rectal, but could opt out of any collection at any visit. Specimens were collected at baseline and two additional time points. A tolerability questionnaire was administered at the final sub-study visit. Of 105 trial participants, 27 of 34 women (79% and 62 of 71 men (87% enrolled in the mucosal sub-study. Nearly all sub-study participants gave saliva and oral fluids at all visits. Semen was collected from about half the participating men (47-48% at all visits. Cervico-vaginal secretions were collected by Softcup from about two thirds of women (63% at baseline, increasing to 78% at the following visits, with similar numbers for cervical secretion collection by Merocel sponge; about half of women (52% gave cervico-vaginal samples at all visits. Rectal secretions were collected with Merocel sponge from about a quarter of both men and women (24% at all 3 visits, with 16% of men and 19% of women giving rectal samples at all visits.Repeated mucosal sampling in clinical trial participants in Kenya is feasible, with a good proportion of participants consenting to most sampling methods with the exception of rectal samples. Experienced staff members of both sexes and trained counselors with standardized messaging may improve acceptance of rectal sampling.

  8. A metaproteomic approach to study human-microbial ecosystems at the mucosal luminal interface.

    Directory of Open Access Journals (Sweden)

    Xiaoxiao Li

    Full Text Available Aberrant interactions between the host and the intestinal bacteria are thought to contribute to the pathogenesis of many digestive diseases. However, studying the complex ecosystem at the human mucosal-luminal interface (MLI is challenging and requires an integrative systems biology approach. Therefore, we developed a novel method integrating lavage sampling of the human mucosal surface, high-throughput proteomics, and a unique suite of bioinformatic and statistical analyses. Shotgun proteomic analysis of secreted proteins recovered from the MLI confirmed the presence of both human and bacterial components. To profile the MLI metaproteome, we collected 205 mucosal lavage samples from 38 healthy subjects, and subjected them to high-throughput proteomics. The spectral data were subjected to a rigorous data processing pipeline to optimize suitability for quantitation and analysis, and then were evaluated using a set of biostatistical tools. Compared to the mucosal transcriptome, the MLI metaproteome was enriched for extracellular proteins involved in response to stimulus and immune system processes. Analysis of the metaproteome revealed significant individual-related as well as anatomic region-related (biogeographic features. Quantitative shotgun proteomics established the identity and confirmed the biogeographic association of 49 proteins (including 3 functional protein networks demarcating the proximal and distal colon. This robust and integrated proteomic approach is thus effective for identifying functional features of the human mucosal ecosystem, and a fresh understanding of the basic biology and disease processes at the MLI.

  9. Modulation of immune homeostasis by commensal bacteria

    Science.gov (United States)

    Ivanov, Ivaylo I.; Littman, Dan R.

    2011-01-01

    Intestinal bacteria form a resident community that has co-evolved with the mammalian host. In addition to playing important roles in digestion and harvesting energy, commensal bacteria are crucial for the proper functioning of mucosal immune defenses. Most of these functions have been attributed to the presence of large numbers of “innocuous” resident bacteria that dilute or occupy niches for intestinal pathogens or induce innate immune responses that sequester bacteria in the lumen, thus quenching excessive activation of the mucosal immune system. However it has recently become obvious that commensal bacteria are not simply beneficial bystanders, but are important modulators of intestinal immune homeostasis and that the composition of the microbiota is a major factor in pre-determining the type and robustness of mucosal immune responses. Here we review specific examples of individual members of the microbiota that modify innate and adaptive immune responses, and we focus on potential mechanisms by which such species-specific signals are generated and transmitted to the host immune system. PMID:21215684

  10. Immunoprophylaxis of infectious diseases in children: achievements and problems. Anti-vaccine movement as a barrier factor in immunization of the population

    Directory of Open Access Journals (Sweden)

    V.I. Dmytruk

    2017-09-01

    Full Text Available The article presents data on the state of immunization against major vaccine-controlled infections in international and regional subnational aspects. Some factors of worsening the epidemiological situation in Ukraine and the role of vaccination in the surveillance for infections that are controlled by means of specific immunoprophylaxis are identified. The features and causes of the anti-vaccine movement and possible ways of counteracting it are highlighted.

  11. A regenerative approach towards mucosal fenestration closure

    Science.gov (United States)

    Gandi, Padma; Anumala, Naveen; Reddy, Amarender; Viswa Chandra, Rampalli

    2013-01-01

    Mucosal fenestration is an opening or an interstice through the oral mucosa. A lesion which occurs with greater frequency than generally realised, its occurrence is attributed to a myriad of causes. Mucogingival procedures including connective tissue grafts, free gingival grafts and lateral pedicle grafts are generally considered to be the treatment of choice in the closure of a mucosal fenestration. More often, these procedures are performed in conjunction with other procedures such as periradicular surgery and with bone grafts. However, the concomitant use of gingival grafts and bone grafts in mucosal fenestrations secondary to infections in sites exhibiting severe bone loss is highly debatable. In this article, we report two cases of mucosal fenestrations secondary to trauma and their management by regenerative periodontal surgery with the placement of guided tissue regeneration membrane and bone graft. The final outcome was a complete closure of the fenestration in both the cases. PMID:23749826

  12. Transgenic Killer Commensal Bacteria as Mucosal Protectants

    Directory of Open Access Journals (Sweden)

    Luciano Polonelli

    2001-01-01

    Full Text Available As first line of defense against the majority of infections and primary site for their transmission, mucosal surfaces of the oral cavity and genitourinary, gastrointestinal, and respiratory tracts represent the most suitable sites to deliver protective agents for the prevention of infectious diseases. Mucosal protection is important not only for life threatening diseases but also for opportunistic infections which currently represent a serious burden in terms of morbidity, mortality, and cost of cures. Candida albicans is among the most prevalent causes of mucosal infections not only in immuno- compromised patients, such as HIV-infected subjects who are frequently affected by oral and esophageal candidiasis, but also in otherwise healthy individuals, as in the case of acute vaginitis. Unfortunately, current strategies for mucosal protection against candidiasis are severely limited by the lack of effective vaccines and the relative paucity and toxicity of commercially available antifungal drugs. An additional option has been reported in a recent

  13. Stress, Nutrition, and Intestinal Immune Responses in Pigs — A Review

    Directory of Open Access Journals (Sweden)

    In Kyu Lee

    2016-08-01

    Full Text Available Modern livestock production became highly intensive and large scaled to increase production efficiency. This production environment could add stressors affecting the health and growth of animals. Major stressors can include environment (air quality and temperature, nutrition, and infection. These stressors can reduce growth performance and alter immune systems at systemic and local levels including the gastrointestinal tract. Heat stress increases the permeability, oxidative stress, and inflammatory responses in the gut. Nutritional stress from fasting, antinutritional compounds, and toxins induces the leakage and destruction of the tight junction proteins in the gut. Fasting is shown to suppress pro-inflammatory cytokines, whereas deoxynivalenol increases the recruitment of intestinal pro-inflammatory cytokines and the level of lymphocytes in the gut. Pathogenic and viral infections such as Enterotoxigenic E. coli (ETEC and porcine epidemic diarrhea virus can lead to loosening the intestinal epithelial barrier. On the other hand, supplementation of Lactobacillus or Saccharaomyces reduced infectious stress by ETEC. It was noted that major stressors altered the permeability of intestinal barriers and profiles of genes and proteins of pro-inflammatory cytokines and chemokines in mucosal system in pigs. However, it is not sufficient to fully explain the mechanism of the gut immune system in pigs under stress conditions. Correlation and interaction of gut and systemic immune system under major stressors should be better defined to overcome aforementioned obstacles.

  14. Duox2-induced innate immune responses in the respiratory epithelium and intranasal delivery of Duox2 DNA using polymer that mediates immunization.

    Science.gov (United States)

    Jeon, Yung Jin; Kim, Hyun Jik

    2018-05-01

    Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.

  15. Oral delivery of prolyl hydroxylase inhibitor: AKB-4924 promotes localized mucosal healing in a mouse model of colitis.

    Science.gov (United States)

    Marks, Ellen; Goggins, Bridie J; Cardona, Jocelle; Cole, Siobhan; Minahan, Kyra; Mateer, Sean; Walker, Marjorie M; Shalwitz, Robert; Keely, Simon

    2015-02-01

    Pharmacological induction of hypoxia-inducible factor (HIF), a global transcriptional regulator of the hypoxic response, by prolyl hydroxylase inhibitors (PHDi) is protective in murine models of colitis, and epithelial cells are critical for the observed therapeutic efficacy. Because systemic HIF activation may lead to potentially negative off-target effects, we hypothesized that targeting epithelial HIF through oral delivery of PHDi would be sufficient to protect against colitis in a mouse model. Using a chemically induced trinitrobenzene sulfonic acid murine model of colitis, we compared the efficacy of oral and intraperitoneal (i.p.) delivery of the PHDi; AKB-4924 in preventing colitis, as measured by endoscopy, histology, barrier integrity, and immune profiling. Furthermore, we measured potential off-target effects, examining HIF and HIF target genes in the heart and kidney, as well as erythropoietin and hematocrit levels. Oral administration of AKB-4924 exhibited mucosal protection comparable i.p. dosing. Oral delivery of PHDi led to reduced colonic epithelial HIF stabilization compared with i.p. delivery, but this was still sufficient to induce transcription of downstream HIF targets. Furthermore, oral delivery of PHDi led to reduced stabilization of HIF and activation of HIF targets in extraintestinal organs. Oral delivery of PHDi therapies to this intestinal mucosa protects against colitis in animal models and represents a potential therapeutic strategy for inflammatory bowel disease, which also precludes unwanted extraintestinal effects.

  16. Immunity to poliovirus after infection and vaccination

    NARCIS (Netherlands)

    Herremans, Martina Maria Petronella Theresia

    1999-01-01

    The aim of this thesis was defined as the study of the contribution of IPV vaccination to the induction of a) protection against poliovirus infection and b) mucosal immunity.We have described the development of new immunological tools for the rapid detection of poliovirus-specific antibodies and

  17. Medroxyprogesterone acetate and levonorgestrel increase genital mucosal permeability and enhance susceptibility to genital herpes simplex virus type 2 infection.

    Science.gov (United States)

    Quispe Calla, N E; Vicetti Miguel, R D; Boyaka, P N; Hall-Stoodley, L; Kaur, B; Trout, W; Pavelko, S D; Cherpes, T L

    2016-11-01

    Depot-medroxyprogesterone acetate (DMPA) is a hormonal contraceptive especially popular in areas with high prevalence of HIV and other sexually transmitted infections (STI). Although observational studies identify DMPA as an important STI risk factor, mechanisms underlying this connection are undefined. Levonorgestrel (LNG) is another progestin used for hormonal contraception, but its effect on STI susceptibility is much less explored. Using a mouse model of genital herpes simplex virus type 2 (HSV-2) infection, we herein found that DMPA and LNG similarly reduced genital expression of the desmosomal cadherin desmoglein-1α (DSG1α), enhanced access of inflammatory cells to genital tissue by increasing mucosal epithelial permeability, and increased susceptibility to viral infection. Additional studies with uninfected mice revealed that DMPA-mediated increases in mucosal permeability promoted tissue inflammation by facilitating endogenous vaginal microbiota invasion. Conversely, concomitant treatment of mice with DMPA and intravaginal estrogen restored mucosal barrier function and prevented HSV-2 infection. Evaluating ectocervical biopsy tissue from women before and 1 month after initiating DMPA remarkably revealed that inflammation and barrier protection were altered by treatment identically to changes seen in progestin-treated mice. Together, our work reveals DMPA and LNG diminish the genital mucosal barrier; a first-line defense against all STI, but may offer foundation for new contraceptive strategies less compromising of barrier protection.

  18. Effect of Forsythia suspensa extract and chito-oligosaccharide alone or in combination on performance, intestinal barrier function, antioxidant capacity and immune characteristics of weaned piglets.

    Science.gov (United States)

    Zhao, Panfeng; Piao, Xiangshu; Zeng, Zhikai; Li, Ping; Xu, Xiao; Wang, Hongliang

    2017-06-01

    We investigated the effects of Forsythia suspensa extract (FSE) and chito-oligosaccharide (COS), alone or together, on performance and health status of weaned piglets. The treatments included a basal diet and three diets with 160 mg/kg COS, 100 mg/kg FSE, or 100 mg/kg FSE and 160 mg/kg COS. Supplementation with COS or FSE alone improved (P antioxidant capacity and glutathione peroxidase activities and lower serum endotoxin (P concentrations, generated higher (P concentration, peripheral blood lymphocyte proliferation and serum-specific ovalbumin antibody level than the basal diet. No differences in oxidative injury and immunity indices were detected on day 28. The combined FSE and COS produced similar results compared with FSE or COS when given alone. These data indicate FSE or COS can increase performance by modulating intestinal permeability, antioxidant status and immune function in younger pigs. There appears to be similar advantage in feeding the additives in combination over those obtained from feeding them separately. © 2016 Japanese Society of Animal Science.

  19. Physiological, Pathological, and Therapeutic Implications of Zonulin-Mediated Intestinal Barrier Modulation

    Science.gov (United States)

    Fasano, Alessio

    2008-01-01

    The anatomical and functional arrangement of the gastrointestinal tract suggests that this organ, beside its digestive and absorptive functions, regulates the trafficking of macromolecules between the environment and the host through a barrier mechanism. Under physiological circumstances, this trafficking is safeguarded by the competency of intercellular tight junctions, structures whose physiological modulation is mediated by, among others, the recently described protein zonulin. To prevent harm and minimize inflammation, the same paracellular pathway, in concert with the gut-associated lymphoid tissue and the neuroendocrine network, controls the equilibrium between tolerance and immunity to nonself antigens. The zonulin pathway has been exploited to deliver drugs, macromolecules, or vaccines that normally would not be absorbed through the gastrointestinal mucosal barrier. However, if the tightly regulated trafficking of macromolecules is jeopardized secondary to prolonged zonulin up-regulation, the excessive flow of nonself antigens in the intestinal submucosa can cause both intestinal and extraintestinal autoimmune disorders in genetically susceptible individuals. This new paradigm subverts traditional theories underlying the development of autoimmunity, which are based on molecular mimicry and/or the bystander effect, and suggests that the autoimmune process can be arrested if the interplay between genes and environmental triggers is prevented by re-establishing intestinal barrier competency. Understanding the role of zonulin-dependent intestinal barrier dysfunction in the pathogenesis of autoimmune diseases is an area of translational research that encompasses many fields. PMID:18832585

  20. Systemic and Mucosal Antibody Responses to Soluble and Nanoparticle-Conjugated Antigens Administered Intranasally

    Directory of Open Access Journals (Sweden)

    Savannah E. Howe

    2016-10-01

    Full Text Available Nanoparticles (NPs are increasingly being used for drug delivery, as well as antigen carriers and immunostimulants for the purpose of developing vaccines. In this work, we examined how intranasal (i.n. priming followed by i.n. or subcutaneous (s.c. boosting immunization affects the humoral immune response to chicken ovalbumin (Ova and Ova conjugated to 20 nm NPs (NP-Ova. We show that i.n. priming with 20 mg of soluble Ova, a dose known to trigger oral tolerance when administered via gastric gavage, induced substantial systemic IgG1 and IgG2c, as well as mucosal antibodies. These responses were further boosted following a s.c. immunization with Ova and complete Freund’s adjuvant (Ova+CFA. In contrast, 100 µg of Ova delivered via NPs induced an IgG1-dominated systemic response, and primed the intestinal mucosa for secretion of IgA. Following a secondary s.c. or i.n. immunization with Ova+CFA or NP-Ova, systemic IgG1 titers significantly increased, and serum IgG2c and intestinal antibodies were induced in mice primed nasally with NP-Ova. Only Ova- and NP-Ova-primed mice that were s.c.-boosted exhibited substantial systemic and mucosal titers for up to 6 months after priming, whereas the antibodies of i.n.-boosted mice declined over time. Our results indicate that although the amount of Ova delivered by NPs was 1000-fold less than Ova delivered in soluble form, the antigen-specific antibody responses, both systemic and mucosal, are essentially identical by 6 months following the initial priming immunization. Additionally, both i.n.- and s.c.-boosting strategies for NP-Ova-primed mice were capable of inducing a polarized Th1/Th2 immune response, as well as intestinal antibodies; however, it is only by using a heterogeneous prime-boost strategy that long-lasting antibody responses were initiated. These results provide valuable insight for future mucosal vaccine development, as well as furthering our understanding of mucosal antibody responses.

  1. Honey Bee Antiviral Immune Barriers as Affected by Multiple Stress Factors: A Novel Paradigm to Interpret Colony Health Decline and Collapse

    Directory of Open Access Journals (Sweden)

    Francesco Nazzi

    2018-03-01

    Full Text Available Any attempt to outline a logical framework in which to interpret the honey bee health decline and its contribution to elevated colony losses should recognize the importance of the multifactorial nature of the responsible syndrome and provide a functional model as a basis for defining and testing working hypotheses. We propose that covert infections by deformed wing virus (DWV represent a sword of Damocles permanently threatening the survival of honey bee colonies and suggest that any factor affecting the honey bee’s antiviral defenses can turn this pathogen into a killer. Here we discuss the available experimental evidence in the framework of a model based on honey bee immune competence as affected by multiple stress factors that is proposed as a conceptual tool for analyzing bee mortality and its underlying mechanisms.

  2. Novel approach to gastric mucosal defect repair using fresh amniotic membrane allograft in dogs (experimental study).

    Science.gov (United States)

    Farghali, Haithem A; AbdElKader, Naglaa A; Khattab, Marwa S; AbuBakr, Huda O

    2017-10-18

    -epithelial, epithelial, and post-epithelial normal gastric mucosal barriers.

  3. Gastric mucosal defence mechanism during stress of pyloric obstruction in albino rats.

    Science.gov (United States)

    Somasundaram, K; Ganguly, A K

    1987-04-01

    1. The integrity of the gastric mucosa and its ability to secrete mucus are believed to be essential for protection of gastric mucosa against ulceration induced by aggressive factors active in any stress situation. This study involves a three-compartmental analysis of gastric mucosal barrier in pylorus-ligated albino rats. 2. Quantitative analyses of histologically identifiable gastric mucosal epithelial neutral glycoproteins and gastric adherent mucus from oxyntic and pyloric gland areas, and components of non-dialysable mucosubstances in gastric secretion were made under stress of pyloric obstruction for 4, 8, and 16 h durations. Epithelial mucin was identified by periodic acid-Schiff (PAS) staining technique and assessed from the ratio of gastric mucosal thickness to the depth of PAS positive materials in it. The remaining visible mucus adhered to the gastric mucosa was estimated by Alcian blue binding technique. The results were compared with that of identical control groups. 3. A significant reduction in mucosal epithelial PAS positive materials after 8 or 16 h of pylorus ligation was observed. 4. The Alcian blue binding capacity of the pyloric gland area was increased significantly after 4 h of pylorus ligation, while after 8 or 16 h it was reduced in both oxyntic and pyloric gland areas. 5. Significant reductions in the rate of gastric secretion and volume, as well as concentration of the components of non-dialysable mucosubstances, were observed, indicating decreased synthesis of mucus glycoproteins. 6. Disruption of the mucosal barrier may have occurred due to decreased mucus synthesis and acid-pepsin accumulation; both could be due to stress associated with gastric distension. 7. The present findings confirm the role of mucus in protecting the underlying gastric epithelium during stress. The adherent mucus offers a first line of defence and epithelial mucus a second line of defence.

  4. Treg cell-IgA axis in maintenance of host immune homeostasis with microbiota

    OpenAIRE

    Feng, Ting; Elson, Charles O.; Cong, Yingzi

    2010-01-01

    The intestine is the home to a vast diversity of microbiota and a complex of mucosal immune system. Multiple regulatory mechanisms control host immune responses to microbiota and maintain intestinal immune homeostasis. This mini review will provide evidence indicating a Treg cell-IgA axis and such axis playing a major role in maintenance of intestinal homeostasis.

  5. Moms, babies, and bugs in immune development [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Katie Alexander

    2017-12-01

    Full Text Available Bacteria and mammals have co-evolved with one another over millennia, and it has become impossible to interpret mucosal immunity without taking the microbiota into consideration. In fact, the primary role of the mucosal immune system is regulating homeostasis and the host relationship with the microbiota. Bacteria are no longer seen as simply invading pathogens, but rather a necessary component to one’s own immune response. On the one hand, the microbiota is a vital educator of immune cells and initiator of beneficial responses; but, on the other, dysbiosis of microbiota constituents are associated with inflammation and autoimmune disorders. In this review, we will consider recent advances in the understanding of how the microbiota influences host mucosal immunity, particularly the initial development of the immune response and its implications.

  6. Interdependency of EGF and GLP-2 Signaling in Attenuating Mucosal Atrophy in a Mouse Model of Parenteral Nutrition

    DEFF Research Database (Denmark)

    Feng, Yongjia; Demehri, Farok R; Xiao, Weidong

    2017-01-01

    BACKGROUND & AIMS: Total parenteral nutrition (TPN), a crucial treatment for patients who cannot receive enteral nutrition, is associated with mucosal atrophy, barrier dysfunction, and infectious complications. Glucagon-like peptide-2 (GLP-2) and epidermal growth factor (EGF) improve intestinal...... deprived of enteral nutrition. METHODS: Adult C57BL/6J, IEC-Egfr(knock out (KO)) and IEC-pik3r1(KO) mice receiving TPN or enteral nutrition were treated with EGF or GLP-2 alone or in combination with reciprocal receptor inhibitors, GLP-2(3-33) or gefitinib. Jejunum was collected and mucosal atrophy and IEC...

  7. Assessment and protection of esophageal mucosal integrity in patients with heartburn without esophagitis.

    Science.gov (United States)

    Woodland, Philip; Lee, Chung; Duraisamy, Yasotha; Duraysami, Yasotha; Farré, Ricard; Dettmar, Peter; Sifrim, Daniel

    2013-04-01

    Intact esophageal mucosal integrity is essential to prevent symptoms during gastroesophageal reflux events. Approximately 70% of patients with heartburn have macroscopically normal esophageal mucosa. In patients with heartburn, persistent functional impairment of esophageal mucosal barrier integrity may underlie remaining symptoms. Topical protection of a functionally vulnerable mucosa may be an attractive therapeutic strategy. We aimed to evaluate esophageal mucosal functional integrity in patients with heartburn without esophagitis, and test the feasibility of an alginate-based topical mucosal protection. Three distal esophageal biopsies were obtained from 22 patients with heartburn symptoms, and 22 control subjects. In mini-Ussing chambers, the change in transepithelial electrical resistance (TER) of biopsies when exposed to neutral, weakly acidic, and acidic solutions was measured. The experiment was repeated in a further 10 patients after pretreatment of biopsies with sodium alginate, viscous control, or liquid control "protectant" solutions. Biopsy exposure to neutral solution caused no change in TER. Exposure to weakly acidic and acidic solutions caused a greater reduction in TER in patients than in controls (weakly acid -7.2% (95% confidence interval (CI) -9.9 to -4.5) vs. 3.2% (-2.2 to 8.6), Pheartburn without esophagitis shows distinct vulnerability to acid and weakly acidic exposures. Experiments in vitro suggest that such vulnerable mucosa may be protected by application of an alginate-containing topical solution.

  8. T cell immunity to influenza in older adults: A pathophysiological framework for development of more effective vaccines

    Directory of Open Access Journals (Sweden)

    Janet E McElhaney

    2016-02-01

    Full Text Available One of the most profound public health consequences of immune senescence is reflected in an increased susceptibility to influenza and other acute respiratory illnesses, as well as a loss of influenza vaccine effectiveness in older people. Common medical conditions and mental and psychosocial health issues as well as degree of frailty and functional dependence accelerate changes associated with immune senescence. All contribute to the increased risk for complications of influenza infection including pneumonias, heart diseases and strokes that lead to hospitalization, disability and death in the over 65 population. Changes in mucosal barrier mechanisms and both innate and adaptive immune functions converge in the reduced response to influenza infection, and lead to a loss of antibody-mediated protection against influenza with age. The interactions of immune senescence and reduced adaptive immune responses, persistent cytomegalovirus infection, inflammaging (chronic elevation of inflammatory cytokines, and dysregulated cytokine production, pose major challenges to the development of vaccines designed to improve T-cell mediated immunity. In older adults, the goal of vaccination is more realistically targeted to providing clinical protection against disease rather than to inducing sterilizing immunity to infection. Standard assays of antibody titres correlate with protection against influenza illness but do not detect important changes in cellular immune mechanisms that correlate with vaccine-mediated protection against influenza in older people. This article will discuss: i the burden of influenza in older adults and how this relates to changes in T cell function, ii age-related changes in different T cell subsets and immunologic targets for improved influenza vaccine efficacy in older, and iii the development of correlates of clinical protection against influenza disease to expedite the process of new vaccine development for the 65 and older

  9. The mucosal firewalls against commensal intestinal microbes.

    Science.gov (United States)

    Macpherson, Andrew J; Slack, Emma; Geuking, Markus B; McCoy, Kathy D

    2009-07-01

    Mammals coexist with an extremely dense microbiota in the lower intestine. Despite the constant challenge of small numbers of microbes penetrating the intestinal surface epithelium, it is very unusual for these organisms to cause disease. In this review article, we present the different mucosal firewalls that contain and allow mutualism with the intestinal microbiota.

  10. Management of mucositis in oral irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Feber, T. [Cookridge Hospital, Leeds (United Kingdom)

    1996-10-01

    Mucositis significantly affects quality of life and tolerance of treatment in oral irradiation. Effective management of this complication is therefore very important. However, there is a scarcity of up-to-date oral care protocols, with most centres using ritualized regimens. The literature on oral rinses in radiation mucositis is at best inconclusive and at worst confusing. In this study, patients undergoing radical radiotherapy treatment (55-60 Gy in 4 weeks) to more than 50% of the oral cavity and oropharynx were randomized to a research based oral care protocol with either saline 0.9% or hydrogen peroxide 3.5 volumes (HP) as rinses. The results of this study show that, on average, the group receiving saline rinses appeared to do better on some outcomes than the group receiving HP. This suggests that frequent mechanical cleansing of the mouth may be more important than the antiseptic properties of a mouthwash. Antiseptic mouthwashes may be contra-indicated in radiation mucositis. In order to determine best practice in mucositis management, multicentre, multidisciplinary trials should be conducted. (Author).

  11. Management of mucositis in oral irradiation

    International Nuclear Information System (INIS)

    Feber, T.

    1996-01-01

    Mucositis significantly affects quality of life and tolerance of treatment in oral irradiation. Effective management of this complication is therefore very important. However, there is a scarcity of up-to-date oral care protocols, with most centres using ritualized regimens. The literature on oral rinses in radiation mucositis is at best inconclusive and at worst confusing. In this study, patients undergoing radical radiotherapy treatment (55-60 Gy in 4 weeks) to more than 50% of the oral cavity and oropharynx were randomized to a research based oral care protocol with either saline 0.9% or hydrogen peroxide 3.5 volumes (HP) as rinses. The results of this study show that, on average, the group receiving saline rinses appeared to do better on some outcomes than the group receiving HP. This suggests that frequent mechanical cleansing of the mouth may be more important than the antiseptic properties of a mouthwash. Antiseptic mouthwashes may be contra-indicated in radiation mucositis. In order to determine best practice in mucositis management, multicentre, multidisciplinary trials should be conducted. (Author)

  12. Nutrition and Gut Mucositis in Pediatric Oncology

    DEFF Research Database (Denmark)

    Pontoppidan, Peter Erik Lotko

    Childhood malignancies are the second most common cause of death in children. A major limitation of current therapies is the high toxicity. Alimentary tract toxicity (mucositis) is associated with increased risk of complication such as infections that may lead to death. In relation to HSCT, mucos...

  13. Can the oral microflora affect oral ulcerative mucositis?

    NARCIS (Netherlands)

    Laheij, A.M.G.A.; de Soet, J.J.

    2014-01-01

    Purpose of review: Oral mucositis is one of the most prevalent toxicities after hematopoietic stem cell transplantation. Mucositis is initiated by the chemotherapy or radiotherapy preceding the transplantation. It is commonly accepted that microorganisms play a role in the process of oral mucositis.

  14. Co-administration of cholera toxin and apple polyphenol extract as a novel and safe mucosal adjuvant strategy.

    Science.gov (United States)

    Yoshino, Naoto; Fujihashi, Kohtaro; Hagiwara, Yukari; Kanno, Hiroyuki; Takahashi, Kiyomi; Kobayashi, Ryoki; Inaba, Noriyuki; Noda, Masatoshi; Sato, Shigehiro

    2009-07-30

    Although native cholera toxin (CT) is an extremely effective adjuvant, its toxicity prevents its use in humans. We report here that apple polyphenol extract (APE), obtained from unripe apples, reduces CT-induced morphological changes and cAMP accumulation. Based upon this finding, we have attempted to design a novel, effective and safe mucosal vaccine by using CT with several dosages of APE as nasal adjuvants. Mice nasally immunized with OVA plus CT and an optimal dosage of APE showed significantly reduced levels of inflammatory responses as well as total and OVA-specific IgE antibodies when compared with mice given without APE. However, levels of both mucosal and systemic OVA-specific antibody responses were maintained. Further, APE significantly down-regulated accumulation of CT in the olfactory nerves and epithelium. In summary, an optimal dosage of APE would take full advantage of mucosal adjuvanticity of native CT without any toxicity for application in humans.

  15. Long-term air pollution exposure is associated with neuroinflammation, an altered innate immune response, disruption of the blood-brain barrier, ultrafine particulate deposition, and accumulation of amyloid beta-42 and alpha-synuclein in children and young adults.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Solt, Anna C; Henríquez-Roldán, Carlos; Torres-Jardón, Ricardo; Nuse, Bryan; Herritt, Lou; Villarreal-Calderón, Rafael; Osnaya, Norma; Stone, Ida; García, Raquel; Brooks, Diane M; González-Maciel, Angelica; Reynoso-Robles, Rafael; Delgado-Chávez, Ricardo; Reed, William

    2008-02-01

    Air pollution is a serious environmental problem. We investigated whether residency in cities with high air pollution is associated with neuroinflammation/neurodegeneration in healthy children and young adults who died suddenly. We measured mRNA cyclooxygenase-2, interleukin-1beta, and CD14 in target brain regions from low (n = 12) or highly exposed residents (n = 35) aged 25.1 +/- 1.5 years. Upregulation of cyclooxygenase-2, interleukin-1beta, and CD14 in olfactory bulb, frontal cortex, substantia nigrae and vagus nerves; disruption of the blood-brain barrier; endothelial activation, oxidative stress, and inflammatory cell trafficking were seen in highly exposed subjects. Amyloid beta42 (Abeta42) immunoreactivity was observed in 58.8% of apolipoprotein E (APOE) 3/3 < 25 y, and 100% of the APOE 4 subjects, whereas alpha-synuclein was seen in 23.5% of < 25 y subjects. Particulate material (PM) was seen in olfactory bulb neurons, and PM < 100 nm were observed in intraluminal erythrocytes from lung, frontal, and trigeminal ganglia capillaries. Exposure to air pollution causes neuroinflammation, an altered brain innate immune response, and accumulation of Abeta42 and alpha-synuclein starting in childhood. Exposure to air pollution should be considered a risk factor for Alzheimer's and Parkinson's diseases, and carriers of the APOE 4 allele could have a higher risk of developing Alzheimer's disease if they reside in a polluted environment.

  16. Immune response to H pylori

    Science.gov (United States)

    Suarez, Giovanni; Reyes, Victor E; Beswick, Ellen J

    2006-01-01

    The gastric mucosa separates the underlying tissue from the vast array of antigens that traffic through the stomach lumen. While the extreme pH of this environment is essential in aiding the activation of enzymes and food digestion, it also renders the gastric epithelium free from bacterial colonization, with the exception of one important human pathogen, H pylori. This bacterium has developed mechanisms to survive the harsh environment of the stomach, actively move through the mucosal layer, attach to the epithelium, evade immune responses, and achieve persistent colonization. While a hallmark of this infection is a marked inflammatory response with the infiltration of various immune cells into the infected gastric mucosa, the host immune response is unable to clear the infection and may actually contribute to the associated pathogenesis. Here, we review the host responses involved during infection with H pylori and how they are influenced by this bacterium. PMID:17007009

  17. T Helper 17 Promotes Induction of Antigen-Specific Gut-Mucosal Cytotoxic T Lymphocytes following Adenovirus Vector Vaccination

    Directory of Open Access Journals (Sweden)

    Masahisa Hemmi

    2017-11-01

    Full Text Available Few current vaccines can establish antigen (Ag-specific immune responses in both mucosal and systemic compartments. Therefore, development of vaccines providing defense against diverse infectious agents in both compartments is of high priority in global health. Intramuscular vaccination of an adenovirus vector (Adv has been shown to induce Ag-specific cytotoxic T lymphocytes (CTLs in both systemic and gut-mucosal compartments. We previously found that type I interferon (IFN signaling is required for induction of gut-mucosal, but not systemic, CTLs following vaccination; however, the molecular mechanism involving type I IFN signaling remains unknown. Here, we found that T helper 17 (Th17-polarizing cytokine expression was down-regulated in the inguinal lymph nodes (iLNs of Ifnar2−/− mice, resulting in the reduction of Ag-specific Th17 cells in the iLNs and gut mucosa of the mice. We also found that prior transfer of Th17 cells reversed the decrease in the number of Ag-specific gut-mucosal CTLs in Ifnar2−/− mice following Adv vaccination. Additionally, prior transfer of Th17 cells into wild-type mice enhanced the induction of Ag-specific CTLs in the gut mucosa, but not in systemic compartments, suggesting a gut mucosa-specific mechanism where Th17 cells regulate the magnitude of vaccine-elicited Ag-specific CTL responses. These data suggest that Th17 cells translate systemic type I IFN signaling into a gut-mucosal CTL response following vaccination, which could promote the development of promising Adv vaccines capable of establishing both systemic and gut-mucosal protective immunity.

  18. Helicobacter bilis Infection Alters Mucosal Bacteria and Modulates Colitis Development in Defined Microbiota Mice.

    Science.gov (United States)

    Atherly, Todd; Mosher, Curtis; Wang, Chong; Hostetter, Jesse; Proctor, Alexandra; Brand, Meghan W; Phillips, Gregory J; Wannemuehler, Michael; Jergens, Albert E

    2016-11-01

    Helicobacter bilis infection of C3H/HeN mice harboring the altered Schaedler flora (ASF) triggers progressive immune responsiveness and the development of colitis. We sought to investigate temporal alterations in community structure of a defined (ASF-colonized) microbiota in normal and inflamed murine intestines and to correlate microbiota changes to histopathologic lesions. The colonic mucosal microbiota of healthy mice and ASF mice colonized with H. bilis for 3, 6, or 12 weeks were investigated by fluorescence in situ hybridization targeting the 16S ribosomal RNA genes of total bacteria, group-specific organisms, and individual ASF bacterial species. Microbial profiling of ASF and H. bilis abundance was performed on cecal contents. Helicobacter bilis-colonized mice developed colitis associated with temporal changes in composition and spatial distribution of the mucosal microbiota. The number of total bacteria, ASF519, and helicobacter-positive bacteria were increased (P attachment, or by invasion, and this interaction is differentially expressed over time.

  19. Separate effects of irradiation and of graft-versus-host reaction on rat mucosal mast cells

    International Nuclear Information System (INIS)

    Cummins, A.G.; Munro, G.H.; Huntley, J.F.; Miller, H.R.P.; Ferguson, A.

    1989-01-01

    T cell mediated immune responses in the gut can produce enteropathy and malabsorption. The authors investigated the relevance of mucosal mast cells (MMC) to the mechanisms of this enteropathy by using graft-versus-host reaction (GvHR) in the rat as a model of mucosal delayed type hypersensitivity. x-irradiation, with or without GvHR, led to the virtual disappearance of jejunal MMC, undetectable jejunal rat mast cell protease (RMCPII) and very low levels of RMCPII in serum (all p<0.01 when compared with unirradiated controls). These experiments show that there is a modest expansion in jejunal MMC in unirradiated rats with semiallogeneic GvHR, whereas irradiation, alone or associated with GvHR, profoundly depletes MMC for at least two weeks. The enteropathy of GvHR can evolve in the virtual absence of MMC. (author)

  20. Physiological, pathological, and therapeutic implications of zonulin-mediated intestinal barrier modulation: living life on the edge of the wall.

    Science.gov (United States)

    Fasano, Alessio

    2008-11-01

    The anatomical and functional arrangement of the gastrointestinal tract suggests that this organ, beside its digestive and absorptive functions, regulates the trafficking of macromolecules between the environment and the host through a barrier mechanism. Under physiological circumstances, this trafficking is safeguarded by the competency of intercellular tight junctions, structures whose physiological modulation is mediated by, among others, the recently described protein zonulin. To prevent harm and minimize inflammation, the same paracellular pathway, in concert with the gut-associated lymphoid tissue and the neuroendocrine network, controls the equilibrium between tolerance and immunity to nonself antigens. The zonulin pathway has been exploited to deliver drugs, macromolecules, or vaccines that normally would not be absorbed through the gastrointestinal mucosal barrier. However, if the tightly regulated trafficking of macromolecules is jeopardized secondary to prolonged zonulin up-regulation, the excessive flow of nonself antigens in the intestinal submucosa can cause both intestinal and extraintestinal autoimmune disorders in genetically susceptible individuals. This new paradigm subverts traditional theories underlying the development of autoimmunity, which are based on molecular mimicry and/or the bystander effect, and suggests that the autoimmune process can be arrested if the interplay between genes and environmental triggers is prevented by re-establishing intestinal barrier competency. Understanding the role of zonulin-dependent intestinal barrier dysfunction in the pathogenesis of autoimmune diseases is an area of translational research that encompasses many fields.

  1. Gastroduodenal mucosal defence mechanisms and the action of non-steroidal anti-inflammatory agents.

    Science.gov (United States)

    Garner, A; Allen, A; Rowe, P H

    1987-01-01

    This review summarises gastroduodenal protective mechanisms, the actions of non-steroidal anti-inflammatory (NSAI) agents on mucus and HCO3 secretions, and the basis of gastric mucosal injury induced by acetylsalicylic and salicylic acids (ASA and SA). Resistance to autodigestion by acid and pepsin present in gastric juice is multifactorial involving pre-epithelial (mucus-bicarbonate barrier) and post-epithelial (blood flow, acid-base balance) factors in addition to properties of the surface cell layer per se. The latter includes mucosal re-epithelialisation, a property which appears particularly important with respect to recovery from acute injury. A range of NSAI agents (ASA, fenclofenac, ibuprofen and indomethacin) inhibit gastric HCO3 transport in isolated mucosal preparations. Inhibition of duodenal HCO3 transport has been demonstrated in response to indomethacin in vitro and in vivo. These effects on secretion can be antagonised by exogenous prostaglandins of the E series. The layer of secreted mucus gel overlying the epithelial surface is not affected by NSAI drugs in the short term. However a number of these agents have been shown to inhibit glycoprotein biosynthesis by the epithelial cells. Thus loss of this protective coat could be anticipated during chronic drug exposure since erosion of adherent mucus by luminal shear and proteolysis would not be compensated by continued secretion. Detailed analysis of the gastric mucosal injury induced by salicylates both in vitro and in vivo reveals that much of the damage previously attributed to ASA is in fact due to the metabolic product SA. In this respect it is concluded that mucosal injury caused by ASA is due to a combination of two factors.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Under Pressure: Interactions between Commensal Microbiota and the Teleost Immune System

    Directory of Open Access Journals (Sweden)

    Cecelia Kelly

    2017-05-01

    Full Text Available Commensal microorganisms inhabit every mucosal surface of teleost fish. At these surfaces, microorganisms directly and indirectly shape the teleost immune system. This review provides a comprehensive overview of how the microbiota and microbiota-derived products influence both the mucosal and systemic immune system of fish. The cross talk between the microbiota and the teleost immune system shifts significantly under stress or disease scenarios rendering commensals into opportunists or pathogens. Lessons learnt from germ-free fish models as well as from oral administration of live probiotics to fish highlight the vast impact that microbiota have on immune development, antibody production, mucosal homeostasis, and resistance to stress. Future studies should dissect the specific mechanisms by which different members of the fish microbiota and the metabolites they produce interact with pathogens, with other commensals, and with the teleost immune system.

  3. Involvement of Corticotropin-Releasing Factor and Receptors in Immune Cells in Irritable Bowel Syndrome

    Directory of Open Access Journals (Sweden)

    Mahanand Chatoo

    2018-02-01

    Full Text Available Irritable bowel syndrome (IBS is a common functional gastrointestinal disorder defined by ROME IV criteria as pain in the lower abdominal region, which is associated with altered bowel habit or defecation. The underlying mechanism of IBS is not completely understood. IBS seems to be a product of interactions between various factors with genetics, dietary/intestinal microbiota, low-grade inflammation, and stress playing a key role in the pathogenesis of this disease. The crosstalk between the immune system and stress in IBS mechanism is increasingly recognized. Corticotropin-releasing factor (CRF, a major mediator in the stress response, is involved in altered function in GI, including inflammatory processes, colonic transit time, contractile activity, defecation pattern, pain threshold, mucosal secretory function, and barrier functions. This mini review focuses on the recently establish local GI-CRF system, its involvement in modulating the immune response in IBS, and summarizes current IBS animal models and mapping of CRF, CRFR1, and CRFR2 expression in colon tissues. CRF and receptors might be a key molecule involving the immune and movement function via brain–gut axis in IBS.

  4. A novel role for the NLRC4 inflammasome in mucosal defenses against the fungal pathogen Candida albicans.

    Directory of Open Access Journals (Sweden)

    Jeffrey Tomalka

    2011-12-01

    Full Text Available Candida sp. are opportunistic fungal pathogens that colonize the skin and oral cavity and, when overgrown under permissive conditions, cause inflammation and disease. Previously, we identified a central role for the NLRP3 inflammasome in regulating IL-1β production and resistance to dissemination from oral infection with Candida albicans. Here we show that mucosal expression of NLRP3 and NLRC4 is induced by Candida infection, and up-regulation of these molecules is impaired in NLRP3 and NLRC4 deficient mice. Additionally, we reveal a role for the NLRC4 inflammasome in anti-fungal defenses. NLRC4 is important for control of mucosal Candida infection and impacts inflammatory cell recruitment to infected tissues, as well as protects against systemic dissemination of infection. Deficiency in either NLRC4 or NLRP3 results in severely attenuated pro-inflammatory and antimicrobial peptide responses in the oral cavity. Using bone marrow chimeric mouse models, we show that, in contrast to NLRP3 which limits the severity of infection when present in either the hematopoietic or stromal compartments, NLRC4 plays an important role in limiting mucosal candidiasis when functioning at the level of the mucosal stroma. Collectively, these studies reveal the tissue specific roles of the NLRP3 and NLRC4 inflammasome in innate immune responses against mucosal Candida infection.

  5. The Interaction among Microbiota, Immunity, and Genetic and Dietary Factors Is the Condicio Sine Qua Non Celiac Disease Can Develop

    Directory of Open Access Journals (Sweden)

    D. Pagliari

    2015-01-01

    Full Text Available Celiac disease (CD is an immune-mediated enteropathy, triggered by dietary wheat gluten and similar proteins of barley and rye in genetically susceptible individuals. This is a complex disorder involving both environmental and immune-genetic factors. The major genetic risk factor for CD is determined by HLA-DQ genes. Dysfunction of the innate and adaptive immune systems can conceivably cause impairment of mucosal barrier function and development of localized or systemic inflammatory and autoimmune processes. Exposure to gluten is the main environmental trigger responsible for the signs and symptoms of the disease, but exposure to gluten does not fully explain the manifestation of CD. Thus, both genetic determination and environmental exposure to gluten are necessary for the full manifestation of CD; neither of them is sufficient alone. Epidemiological and clinical data suggest that other environmental factors, including infections, alterations in the intestinal microbiota composition, and early feeding practices, might also play a role in disease development. Thus, this interaction is the condicio sine qua non celiac disease can develop. The breakdown of the interaction among microbiota, innate immunity, and genetic and dietary factors leads to disruption of homeostasis and inflammation; and tissue damage occurs. Focusing attention on this interaction and its breakdown may allow a better understanding of the CD pathogenesis and lead to novel translational avenues for preventing and treating this widespread disease.

  6. Effects of adding butyric acid to PN on gut-associated lymphoid tissue and mucosal immunoglobulin A levels.

    Science.gov (United States)

    Murakoshi, Satoshi; Fukatsu, Kazuhiko; Omata, Jiro; Moriya, Tomoyuki; Noguchi, Midori; Saitoh, Daizoh; Koyama, Isamu

    2011-07-01

    Parenteral nutrition (PN) causes intestinal mucosal atrophy, gut-associated lymphoid tissue (GALT) atrophy and dysfunction, leading to impaired mucosal immunity and increased susceptibility to infectious complications. Therefore, new PN formulations are needed to maintain mucosal immunity. Short-chain fatty acids have been demonstrated to exert beneficial effects on the intestinal mucosa. We examined the effects of adding butyric acid to PN on GALT lymphocyte numbers, phenotypes, mucosal immunoglobulin A (IgA) levels, and intestinal morphology in mice. Male Institute of Cancer Research mice (n = 103) were randomized to receive either standard PN (S-PN), butyric acid-supplemented PN (Bu-PN), or ad libitum chow (control) groups. The mice were fed these respective diets for 5 days. In experiment 1, cells were isolated from Peyer's patches (PPs) to determine lymphocyte numbers and phenotypes (αβTCR(+), γδTCR(+), CD4(+), CD8(+), B220(+) cells). IgA levels in small intestinal washings were also measured. In experiment 2, IgA levels in respiratory tract (bronchoalveolar and nasal) washings were measured. In experiment 3, small intestinal morphology was evaluated. Lymphocyte yields from PPs and small intestinal, bronchoalveolar, and nasal washing IgA levels were all significantly lower in the S-PN group than in the control group. Bu-PN moderately, but significantly, restored PP lymphocyte numbers, as well as intestinal and bronchoalveolar IgA levels, as compared with S-PN. Villous height and crypt depth in the small intestine were significantly decreased in the S-PN group vs the control group, however Bu-PN restored intestinal morphology. A new PN formula containing butyric acid is feasible and would ameliorate PN-induced impairment of mucosal immunity.

  7. SMAD regulatory networks construct a balanced immune system.

    Science.gov (United States)

    Malhotra, Nidhi; Kang, Joonsoo

    2013-05-01

    A balanced immune response requires combating infectious assaults while striving to maintain quiescence towards the self. One of the central players in this process is the pleiotropic cytokine transforming growth factor-β (TGF-β), whose deficiency results in spontaneous systemic autoimmunity in mice. The dominant function of TGF-β is to regulate the peripheral immune homeostasis, particularly in the microbe-rich and antigen-rich environment of the gut. To maintain intestinal integrity, the epithelial cells, myeloid cells and lymphocytes that inhabit the gut secrete TGF-β, which acts in both paracrine and autocrine fashions to activate its signal transducers, the SMAD transcription factors. The SMAD pathway regulates the production of IgA by B cells, maintains the protective mucosal barrier and promotes the balanced differentiation of CD4(+) T cells into inflammatory T helper type 17 cells and suppressive FOXP3(+) T regulatory cells. While encounters with pathogenic microbes activate SMAD proteins to evoke a protective inflammatory immune response, SMAD activation and synergism with immunoregulatory factors such as the vitamin A metabolite retinoic acid enforce immunosuppression toward commensal microbes and innocuous food antigens. Such complementary context-dependent functions of TGF-β are achieved by the co-operation of SMAD proteins with distinct dominant transcription activators and accessory chromatin modifiers. This review highlights recent advances in unravelling the molecular basis for the multi-faceted functions of TGF-β in the gut that are dictacted by fluid orchestrations of SMADs and their myriad partners. © 2013 Blackwell Publishing Ltd.

  8. Role of probiotics and functional foods in health: gut immune stimulation by two probiotic strains and a potential probiotic yoghurt.

    Science.gov (United States)

    Maldonado Galdeano, Carolina; Novotny Nuñez, Ivanna; Carmuega, Esteban; de Moreno de LeBlanc, Alejandra; Perdigón, Gabriela

    2015-01-01

    There are numerous reports that show the benefits on the health attributed to the probiotic consumptions. Most of the studies were performed using animal models and only some of them were validated in controlled human trials. The present review is divided in two sections. In the first section we describe how the probiotic microorganisms can interact with the intestinal epithelial cells that are the first line of cell in the mucosal site, focusing in the studies of two probiotic strains: Lactobacillus casei DN-114001 (actually Lactobacillus paracasei CNCMI-1518) and Lactobacillus casei CRL 431. Then we describe same beneficial effects attributed to probiotic administration and the administration of fermented milks containing these microorganisms or potential probiotic yoghurt, principally on the immune system and on the intestinal barrier in different experimental mouse models like enteropathogenic infection, malnutrition, cancer and intestinal inflammation.

  9. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    National Research Council Canada - National Science Library

    Guess, Jennifer L

    2005-01-01

    Human papillomavims (HPV) types infect the skin and mucosal epithelium. Lesions resulting from HPV infection can linger for months or years suggesting that HPV - presence goes unnoticed by the host immune system...

  10. Anti-allergic role of cholinergic neuronal pathway via α7 nicotinic ACh receptors on mucosal mast cells in a murine food allergy model.

    Directory of Open Access Journals (Sweden)

    Takeshi Yamamoto

    Full Text Available The prevalence of food allergy (FA has increased in developed countries over the past few decades. However, no effective drug therapies are currently available. Therefore, we investigated cholinergic anti-inflammatory pathway as a regulatory system to ameliorate disrupted mucosal immune homeostasis in the gut based on the pathophysiological elucidation of mucosal mast cells (MMCs in a murine FA model. BALB/c mice sensitized with ovalbumin received repeated oral ovalbumin for the development of FA. FA mice developed severe allergic diarrhea and exhibited enhanced type 2 helper T (Th2 cell immune responses in both systemic immunity and mucosal immunity, along with MMCs hyperplasia in the colon. MMCs were localized primarily in the strategic position of the mucosal epithelium. Furthermore, the allergic symptoms did not develop in p85α disrupted phosphoinositide-3 kinase-deficient mice that lacked mast cells in the gut. Vagal stimulation by 2-deoxy-D-glucose and drug treatment with nicotinic ACh receptor (nAChR agonists (nicotine and α7 nAChR agonist GTS-21 alleviated the allergic symptoms in the FA mice. Nicotine treatment suppressed MMCs hyperplasia, enhanced MPO and upregulated mRNA expression of Th1 and Th2 cytokines in the FA mice colon. MMCs, which are negatively regulated by α7 nAChRs, were often located in close proximity to cholinergic CGRP-immunoreactive nerve fibers in the FA mice colon. The present results reveal that the cholinergic neuroimmune interaction via α7 nAChRs on MMCs is largely involved in maintaining intestinal immune homeostasis and can be a target for a new therapy against mucosal immune diseases with homeostatic disturbances such as FA.

  11. Dermoscopic appearance of an amelanotic mucosal melanoma

    Science.gov (United States)

    Blum, Andreas; Beck-Zoul, Ulrike; Held, Laura; Haase, Sylvie

    2016-01-01

    Background Hypomelanotic or amelanotic melanomas are challenging to identify, especially at mucosal sites. The dermoscopic clues to the diagnosis of mucosal melanomas have been reported to be structureless zones with the presence of blue, gray, or white colors. Case A female in her seventies noted a new lesion on the inside of her right labia that first appeared two months prior. Her past medical history was significant for rheumatoid arthritis requiring ongoing treatment with methotrexate for 20 years and adalimumab for 10 years. After no response to two weeks of local treatment for suspected herpes simplex infection, her gynecologist performed a skin biopsy. Based on the histopathological diagnosis of an amelanotic melanoma (Breslow thickness of 1.3 mm) the patient was referred to dermatology for further assessment. Polarized dermoscopy revealed a distinct asymmetric, sharply demarcated homogenous white papule (4 × 5 mm) as well as polymorphous vessels. Conclusion Dermoscopy may aid in the diagnosis of amelanotic mucosal melanomas. Our case revealed a structureless white area and polymorphous vessels. Additional clues to the diagnosis were the advanced age of the patient and the clinical presentation of a new lesion. PMID:27867742

  12. Bladder Mucosal Graft Vaginoplasty: A Case Report.

    Science.gov (United States)

    Chiaramonte, Cinzia; Vestri, Elettra; Tripi, Flavia; Giannone, Antonino Giulio; Cimador, Marcello; Cataliotti, Ferdinando

    2018-06-18

    Female vaginoplasty reconstruction, by choice, is usually performed with adjacent tissue. However in some clinical conditions such as high urogenital confluence sinus, cloacal malformation with extreme vaginal hypoplasia, local tissue may not be available. When vaginal replacement is performed in pediatric patients intestinal segments is preferred to non-operative procedures that require continuative dilations. However mucus production, malignant transformation risk and diversion colitis are important side effects. We present a nouvel technique for vaginoplasty in a female child presenting with an isolated urogenital sinus malformation without virilization. The patient at 20 months underwent vaginoplasty using tubularized bladder mucosal graft. Surgical procedure was devoid of complications. Pubertal development occurred at age of 15. She underwent regular follow up until 18 years of age. At this age we performed clinical evaluation: absence of vaginal introitus stenosis and good cosmetic results were observed. Then she underwent vaginoscopy with multiple biopsies. Pathology examination of the bladder mucosal graft evidenced a normal structure of the mucosa, with a stratified squamous epithelium. Different techniques are taken into account for vaginal reconstruction according to the severity and to the type of malformation. We describe the use of bladder mucosal graft with favorable results after long term follow-up. Copyright © 2018. Published by Elsevier Inc.

  13. Dectin-1 isoforms contribute to distinct Th1/Th17 cell activation in mucosal candidiasis

    Science.gov (United States)

    Carvalho, Agostinho; Giovannini, Gloria; De Luca, Antonella; D'Angelo, Carmen; Casagrande, Andrea; Iannitti, Rossana G; Ricci, Giovanni; Cunha, Cristina; Romani, Luigina

    2012-01-01

    The recognition of β-glucans by dectin-1 has been shown to mediate cell activation, cytokine production and a variety of antifungal responses. Here, we report that the functional activity of dectin-1 in mucosal immunity to Candida albicans is influenced by the genetic background of the host. Dectin-1 was required for the proper control of gastrointestinal and vaginal candidiasis in C57BL/6, but not BALB/c mice; in fact, the latter showed increased resistance in the absence of dectin-1. The susceptibility of dectin-1-deficient C57BL/6 mice to infection was associated with defects in IL-17A and aryl hydrocarbon receptor-dependent IL-22 production and in adaptive Th1 responses. In contrast, the resistance of dectin-1-deficient BALB/c mice was associated with increased IL-17A and IL-22 production and the skewing towards Th1/Treg immune responses that provide immunological memory. Disparate canonical/noncanonical NF-κB signaling pathways downstream of dectin-1 were activated in the two different mouse strains. Thus, the net activity of dectin-1 in antifungal mucosal immunity is dependent on the host's genetic background, which affects both the innate cytokine production and the adaptive Th1/Th17 cell activation upon dectin-1 signaling. PMID:22543832

  14. Minocycline down-regulates topical mucosal inflammation during the application of microbicide candidates.

    Directory of Open Access Journals (Sweden)

    Liangzhu Li

    Full Text Available An effective anti-human immunodeficiency virus-1 (HIV-1 microbicide should exert its action in the absence of causing aberrant activation of topical immunity that will increase the risk of HIV acquisition. In the present study, we demonstrated that the vaginal application of cellulose sulfate (CS gel induced topical mucosal inflammatory responses; the addition of minocycline to CS gel could significantly attenuate the inflammation in a mice model. The combined gel of CS plus minocycline not only reduc