WorldWideScience

Sample records for mouse skin keratinocyte

  1. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice

    2015-01-01

    . In comparison, blood -derived in vitro differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in mouse skin through induction of a proliferative response in the mouse keratinocytes. This article is protected......In atopic dermatitis (AD), the inflammatory response between skin infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice...... through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  2. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    International Nuclear Information System (INIS)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao

    1996-01-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0 o C for 20 min and at 5 o C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0 o C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0 o C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author)

  3. The effect of cold stress on UVB injury in mouse skin and cultured keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Ota, Toshiaki; Hanada, Katsumi; Hashimoto, Isao [Hirosaki Univ., Aomori (Japan). School of Medicine

    1996-12-01

    The effect of cold stress on skin damage caused by UVB irradiation was investigated both in vivo and in vitro. Ear skin of mice that had been exposed to cold stress at 0{sup o}C for 20 min and at 5{sup o}C for 24 h was exposed to UVB radiation. Sunburn cell production was less in mice exposed to the lower temperature. In addition, the effect of cold stress on the survival rate of UVB-irradiated rat keratinocytes was examined in a cytoxicity test, with the results showing that keratinocytes exposed to cold stress of 0{sup o}C had a higher survival rate than control cells. To pursue a promising clue for explaining the result, we examined metallothionein (MT) production in rat keratinocytes that had been exposed to cold stress at 0{sup o}C. Microfluorometric quantification showed a positive correlation between the time course and the intensity of immunofluorescence for MT, indicating that the molecule is inducible by exposure to cold stress in our experimental system. These results suggest that epidermal cells that have been exposed to cold stress maintain a higher resistance to UV radiation than nonexposed controls in vivo and in vitro, and that MT with radical-scavenging activity might contribute, at least in part, to photoprotection against UVB-induced oxidative damage in mammalian skin. (Author).

  4. Correlation of initiating potency of skin carcinogens with potency to induce resistance to terminal differentiation in cultured mouse keratinocytes

    International Nuclear Information System (INIS)

    Kilkenny, A.E.; Morgan, D.; Spangler, E.F.; Yuspa, S.H.

    1985-01-01

    The induction by chemical carcinogens of resistance to terminal differentiation in cultured mouse keratinocytes has been proposed to represent a cellular change associated with the initiation phase of skin carcinogenesis. Previous results with this culture model indicated that the number of differentiation-resistant foci was correlated with the dose and known potency for several chemical carcinogens. Assay conditions were optimized to provide quantitative results for screening a variety of carcinogens for their potency as inducers of foci resistant to terminal differentiation. Eight skin initiators of varying potency and from different chemical classes and ultraviolet light were studied for their activity to induce this alteration in cultured epidermal cells from newborn BALB/c mice. There was an excellent positive correlation for the potency of these agents as initiators in vivo and as inducers of altered differentiation in vitro. The induction of resistant foci was independent of the relative cytotoxic effects of each agent except where cytotoxicity was extensive and reduced the number of foci. The results support the hypothesis that initiation of carcinogenesis in skin results in an alteration in the program of epidermal cell differentiation. The results also suggest that the assay is useful for identifying relative potency classes (strong, moderate, weak) of initiating agents

  5. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  6. Low levels of glutathione are sufficient for survival of keratinocytes after UV irradiation and for healing of mouse skin wounds.

    Science.gov (United States)

    Telorack, Michèle; Abplanalp, Jeannette; Werner, Sabine

    2016-08-01

    Reduced levels of the cellular antioxidant glutathione are associated with premature skin aging, cancer and impaired wound healing, but the in vivo functions of glutathione in the skin remain largely unknown. Therefore, we analyzed mice lacking the modifier subunit of the glutamate cysteine ligase (Gclm), the enzyme that catalyzes the rate-limiting step of glutathione biosynthesis. Glutathione levels in the skin of these mice were reduced by 70 %. However, neither skin development and homeostasis, nor UVA- or UVB-induced apoptosis in the epidermis were affected. Histomorphometric analysis of excisional wounds did not reveal wound healing abnormalities in young Gclm-deficient mice, while the area of hyperproliferative epithelium as well as keratinocyte proliferation were affected in aged mice. These findings suggest that low levels of glutathione are sufficient for wound repair in young mice, but become rate-limiting upon aging.

  7. Fibre optic confocal imaging (FOCI) of keratinocytes, blood vessels and nerves in hairless mouse skin in vivo

    Science.gov (United States)

    BUSSAU, L. J.; VO, L. T.; DELANEY, P. M.; PAPWORTH, G. D.; BARKLA, D. H.; KING, R. G.

    1998-01-01

    Fibre optic confocal imaging (FOCI) enabled subsurface fluorescence microscopy of the skin of hairless mice in vivo. Application of acridine orange enabled imaging of the layers of the epidermis. The corneocytes of the stratum corneum, the keratinocytes in the basal layers and redundant hair follicles were visualised at depths greater than 100 μm. Cellular and nuclear membranes of keratinocytes of the skin were visualised by the use of acridine orange and DIOC5(3). Imaging of the skin after injection of FITC-dextran revealed an extensive network of blood vessels with a size range up to 20 μm. Blood cells could be seen moving through dermal vessels and the blood circulation through the dermal vascular bed was video-taped. The fluorescent dye 4-di-2-ASP showed the presence of nerves fibres around the hair follicles and subsurface blood vessels. Comparison was made between images obtained in vivo using FOCI and in vitro scanning electron microscopy and conventional histology. FOCI offers the potential to study dynamic events in vivo, such as blood flow, skin growth, nerve regeneration and many pathological processes, in ways which have not previously been possible. PMID:9643419

  8. Humanized Mouse Model of Skin Inflammation Is Characterized by Disturbed Keratinocyte Differentiation and Influx of IL-17A Producing T Cells

    Science.gov (United States)

    de Oliveira, Vivian L.; Keijsers, Romy R. M. C.; van de Kerkhof, Peter C. M.; Seyger, Marieke M. B.; Fasse, Esther; Svensson, Lars; Latta, Markus; Norsgaard, Hanne; Labuda, Tord; Hupkens, Pieter; van Erp, Piet E. J.; Joosten, Irma; Koenen, Hans J. P. M.

    2012-01-01

    Humanized mouse models offer a challenging possibility to study human cell function in vivo. In the huPBL-SCID-huSkin allograft model human skin is transplanted onto immunodeficient mice and allowed to heal. Thereafter allogeneic human peripheral blood mononuclear cells are infused intra peritoneally to induce T cell mediated inflammation and microvessel destruction of the human skin. This model has great potential for in vivo study of human immune cells in (skin) inflammatory processes and for preclinical screening of systemically administered immunomodulating agents. Here we studied the inflammatory skin response of human keratinocytes and human T cells and the concomitant systemic human T cell response. As new findings in the inflamed human skin of the huPBL-SCID-huSkin model we here identified: 1. Parameters of dermal pathology that enable precise quantification of the local skin inflammatory response exemplified by acanthosis, increased expression of human β-defensin-2, Elafin, K16, Ki67 and reduced expression of K10 by microscopy and immunohistochemistry. 2. Induction of human cytokines and chemokines using quantitative real-time PCR. 3. Influx of inflammation associated IL-17A-producing human CD4+ and CD8+ T cells as well as immunoregulatory CD4+Foxp3+ cells using immunohistochemistry and -fluorescence, suggesting that active immune regulation is taking place locally in the inflamed skin. 4. Systemic responses that revealed activated and proliferating human CD4+ and CD8+ T cells that acquired homing marker expression of CD62L and CLA. Finally, we demonstrated the value of the newly identified parameters by showing significant changes upon systemic treatment with the T cell inhibitory agents cyclosporine-A and rapamycin. In summary, here we equipped the huPBL-SCID-huSkin humanized mouse model with relevant tools not only to quantify the inflammatory dermal response, but also to monitor the peripheral immune status. This combined approach will gain our

  9. Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2015-06-01

    Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

  10. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    2010-08-01

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  11. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  12. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  13. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  14. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  15. Increased oxidative stress and antioxidant expression in mouse keratinocytes following exposure to paraquat

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Gray, Joshua P.; Shakarjian, Michael P.; Laskin, Debra L.; Heck, Diane E.; Laskin, Jeffrey D.

    2008-01-01

    Paraquat (1,1'-dimethyl-4,4'-bipyridinium) is a widely used herbicide known to induce skin toxicity. This is thought to be due to oxidative stress resulting from the generation of cytotoxic reactive oxygen intermediates (ROI) during paraquat redox cycling. The skin contains a diverse array of antioxidant enzymes which protect against oxidative stress including superoxide dismutase (SOD), catalase, glutathione peroxidase-1 (GPx-1), heme oxygenase-1 (HO-1), metallothionein-2 (MT-2), and glutathione-S-transferases (GST). In the present studies we compared paraquat redox cycling in primary cultures of undifferentiated and differentiated mouse keratinocytes and determined if this was associated with oxidative stress and altered expression of antioxidant enzymes. We found that paraquat readily undergoes redox cycling in both undifferentiated and differentiated keratinocytes, generating superoxide anion and hydrogen peroxide as well as increased protein oxidation which was greater in differentiated cells. Paraquat treatment also resulted in increased expression of HO-1, Cu,Zn-SOD, catalase, GSTP1, GSTA3 and GSTA4. However, no major differences in expression of these enzymes were evident between undifferentiated and differentiated cells. In contrast, expression of GSTA1-2 was significantly greater in differentiated relative to undifferentiated cells after paraquat treatment. No changes in expression of MT-2, Mn-SOD, GPx-1, GSTM1 or the microsomal GST's mGST1, mGST2 and mGST3, were observed in response to paraquat. These data demonstrate that paraquat induces oxidative stress in keratinocytes leading to increased expression of antioxidant genes. These intracellular proteins may be important in protecting the skin from paraquat-mediated cytotoxicity

  16. Chimeric Human Skin Substitute Tissue: A Novel Treatment Option for the Delivery of Autologous Keratinocytes.

    Science.gov (United States)

    Rasmussen, Cathy A; Allen-Hoffmann, B Lynn

    2012-04-01

    For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.

  17. Cdc42 expression in keratinocytes is required for the maintenance of the basement membrane in skin

    DEFF Research Database (Denmark)

    Wu, Xunwei; Quondamatteo, Fabio; Brakebusch, Cord

    2006-01-01

    , structure and number of hemidesomosomes were not significantly changed in the Cdc42 mutant skin compared with the control mice and no blister formation was observed in mutant skin. These data indicate that Cdc42 in keratinocytes is important for maintenance of the basement membrane of skin....... process, which requires directed secretion, deposition and organization of basement membrane components at the basal side of epithelial cells. In the current study, we analyzed the maintenance of skin basement membrane in mice with a keratinocyte-restricted deletion of the Cdc42 gene. In the absence...

  18. Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.

    Science.gov (United States)

    Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab

    2011-03-01

    OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.

  19. Role of Stat in Skin Carcinogenesis: Insights Gained from Relevant Mouse Models

    International Nuclear Information System (INIS)

    Macias, E.; Rao, D.; DiGiovanni, J.; DiGiovanni, J.; DiGiovanni, J.

    2013-01-01

    Signal transducer and activator of transcription 3 (Stat) is a cytoplasmic protein that is activated in response to cytokines and growth factors and acts as a transcription factor. Stat plays critical roles in various biological activities including cell proliferation, migration, and survival. Studies using keratinocyte-specific Stat-deficient mice have revealed that Stat plays an important role in skin homeostasis including keratinocyte migration, wound healing, and hair follicle growth. Use of both constitutive and inducible keratinocyte-specific Stat-deficient mouse models has demonstrated that Stat is required for both the initiation and promotion stages of multistage skin carcinogenesis. Further studies using a transgenic mouse model with a gain of function mutant of Stat (Stat3C) expressed in the basal layer of the epidermis revealed a novel role for Stat in skin tumor progression. Studies using similar Stat-deficient and gain-of-function mouse models have indicated its similar roles in ultraviolet B (UVB) radiation-mediated skin carcinogenesis. This paper summarizes the use of these various mouse models for studying the role and underlying mechanisms for the function of Stat in skin carcinogenesis. Given its significant role throughout the skin carcinogenesis process, Stat is an attractive target for skin cancer prevention and treatment.

  20. Suppression of skin inflammation in keratinocytes and acute/chronic disease models by caffeic acid phenethyl ester.

    Science.gov (United States)

    Lim, Kyung-Min; Bae, SeungJin; Koo, Jung Eun; Kim, Eun-Sun; Bae, Ok-Nam; Lee, Joo Young

    2015-04-01

    Skin inflammation plays a central role in the pathophysiology and symptoms of diverse chronic skin diseases including atopic dermatitis (AD). In this study, we examined if caffeic acid phenethyl ester (CAPE), a skin-permeable bioactive compound from propolis, was protective against skin inflammation using in vitro cell system and in vivo animal disease models. CAPE suppressed TNF-α-induced NF-κB activation and expression of inflammatory cytokines in human keratinocytes (HaCaT). The potency and efficacy of CAPE were superior to those of a non-phenethyl derivative, caffeic acid. Consistently, topical treatment of CAPE (0.5 %) attenuated 12-O-tetradecanoylphorbol-13-acetate(TPA)-induced skin inflammation on mouse ear as CAPE reduced ear swelling and histologic inflammation scores. CAPE suppressed increased expression of pro-inflammatory molecules such as TNF-α, cyclooxygenase-2 and inducible NO synthase in TPA-stimulated skin. TPA-induced phosphorylation of IκB and ERK was blocked by CAPE suggesting that protective effects of CAPE on skin inflammation is attributed to inhibition of NF-κB activation. Most importantly, in an oxazolone-induced chronic dermatitis model, topical application of CAPE (0.5 and 1 %) was effective in alleviating AD-like symptoms such as increases of trans-epidermal water loss, skin thickening and serum IgE as well as histologic inflammation assessment. Collectively, our results propose CAPE as a promising candidate for a novel topical drug for skin inflammatory diseases.

  1. Aldefluor protocol to sort keratinocytes stem cells from skin

    OpenAIRE

    Noronha, Samuel Marcos Ribeiro; Gragnani, Alfredo; Pereira, Thiago Antônio Calado; Correa, Silvana Aparecida Alves; Bonucci, Jessica; Ferreira, Lydia Masako

    2017-01-01

    Abstract Purpose: To investigate the use Aldefluor® and N, N - Dimethylaminobenzaldehyde (DEAB) to design a protocol to sort keratinocyte stem cells from cultured keratinocytes from burned patients. Methods: Activated Aldefluor® aliquots were prepared and maintained at temperature between 2 to 8°C, or stored at -20°C. Next, the cells were collected following the standard protocol of sample preparation. Results: Best results were obtained with Aldefluor® 1.5µl and DEAB 15 µl for 1 x 106 c...

  2. Mustard vesicants alter expression of the endocannabinoid system in mouse skin

    International Nuclear Information System (INIS)

    Wohlman, Irene M.; Composto, Gabriella M.; Heck, Diane E.; Heindel, Ned D.; Lacey, C. Jeffrey; Guillon, Christophe D.; Casillas, Robert P.; Croutch, Claire R.; Gerecke, Donald R.; Laskin, Debra L.; Joseph, Laurie B.; Laskin, Jeffrey D.

    2016-01-01

    Vesicants including sulfur mustard (SM) and nitrogen mustard (NM) are bifunctional alkylating agents that cause skin inflammation, edema and blistering. This is associated with alterations in keratinocyte growth and differentiation. Endogenous cannabinoids, including N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoyl glycerol (2-AG), are important in regulating inflammation, keratinocyte proliferation and wound healing. Their activity is mediated by binding to cannabinoid receptors 1 and 2 (CB1 and CB2), as well as peroxisome proliferator-activated receptor alpha (PPARα). Levels of endocannabinoids are regulated by fatty acid amide hydrolase (FAAH). We found that CB1, CB2, PPARα and FAAH were all constitutively expressed in mouse epidermis and dermal appendages. Topical administration of NM or SM, at concentrations that induce tissue injury, resulted in upregulation of FAAH, CB1, CB2 and PPARα, a response that persisted throughout the wound healing process. Inhibitors of FAAH including a novel class of vanillyl alcohol carbamates were found to be highly effective in suppressing vesicant-induced inflammation in mouse skin. Taken together, these data indicate that the endocannabinoid system is important in regulating skin homeostasis and that inhibitors of FAAH may be useful as medical countermeasures against vesicants. - Highlights: • Sulfur mustard and nitrogen mustard are potent skin vesicants. • The endocannabinoid system regulates keratinocyte growth and differentiation. • Vesicants are potent inducers of the endocannabinoid system in mouse skin. • Endocannabinoid proteins upregulated are FAAH, CB1, CB2 and PPARα. • FAAH inhibitors suppress vesicant-induced inflammation in mouse skin.

  3. Mustard vesicants alter expression of the endocannabinoid system in mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Wohlman, Irene M.; Composto, Gabriella M. [Department of Pharmacology and Toxicology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Heindel, Ned D.; Lacey, C. Jeffrey; Guillon, Christophe D. [Department of Chemistry, Lehigh University, Bethlehem, PA (United States); Casillas, Robert P.; Croutch, Claire R. [MRIGlobal, Kansas City, MO (United States); Gerecke, Donald R.; Laskin, Debra L.; Joseph, Laurie B. [Department of Pharmacology and Toxicology, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Health, Rutgers University School of Public Health, Piscataway, NJ (United States)

    2016-07-15

    Vesicants including sulfur mustard (SM) and nitrogen mustard (NM) are bifunctional alkylating agents that cause skin inflammation, edema and blistering. This is associated with alterations in keratinocyte growth and differentiation. Endogenous cannabinoids, including N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoyl glycerol (2-AG), are important in regulating inflammation, keratinocyte proliferation and wound healing. Their activity is mediated by binding to cannabinoid receptors 1 and 2 (CB1 and CB2), as well as peroxisome proliferator-activated receptor alpha (PPARα). Levels of endocannabinoids are regulated by fatty acid amide hydrolase (FAAH). We found that CB1, CB2, PPARα and FAAH were all constitutively expressed in mouse epidermis and dermal appendages. Topical administration of NM or SM, at concentrations that induce tissue injury, resulted in upregulation of FAAH, CB1, CB2 and PPARα, a response that persisted throughout the wound healing process. Inhibitors of FAAH including a novel class of vanillyl alcohol carbamates were found to be highly effective in suppressing vesicant-induced inflammation in mouse skin. Taken together, these data indicate that the endocannabinoid system is important in regulating skin homeostasis and that inhibitors of FAAH may be useful as medical countermeasures against vesicants. - Highlights: • Sulfur mustard and nitrogen mustard are potent skin vesicants. • The endocannabinoid system regulates keratinocyte growth and differentiation. • Vesicants are potent inducers of the endocannabinoid system in mouse skin. • Endocannabinoid proteins upregulated are FAAH, CB1, CB2 and PPARα. • FAAH inhibitors suppress vesicant-induced inflammation in mouse skin.

  4. Allogeneic cultured keratinocytes vs. cadaveric skin to cover wide-mesh autogenous split-thickness skin grafts.

    Science.gov (United States)

    Monstrey, S; Beele, H; Kettler, M; Van Landuyt, K; Blondeel, P; Matton, G; Naeyaert, J M

    1999-09-01

    Improved shock therapy has extended the limits of survival in patients with massive burns, and nowadays skin coverage has become the major problem in burn management. The use of mesh skin grafts is still the simplest technique to expand the amount of available donor skin. However, very wide-mesh skin grafts take a very long time to heal, often resulting in unaesthetic scar formation. On the other hand, allogeneic cultured keratinocytes have been reported as a natural source of growth factors and thus could be useful to improve wound healing of these wide-mesh grafts. A clinical study was performed to compare the use of cryopreserved allogeneic cultured keratinocytes vs. the traditional cadaveric skin as a double layer over widely expanded autogenous skin grafts. This procedure was performed in 18 pairs of full-thickness burn wounds (with similar depth and location) in 11 severely burned patients. Early clinical evaluation was made at 2, 3, and 4 to 5 weeks. Parameters such as epithelialization, granulation tissue formation, infection, and scar formation were evaluated. Biopsies were taken to compare the histological characteristics of the epidermis, the epidermal-dermal junction, and the dermis. Late evaluations were performed at 6 and 12 months regarding color, softness, thickness, and subjective feeling of the scar tissue. Aside from a faster (p keratinocyte group at 2 weeks, there were no statistically different results in any of the early evaluated parameters, neither clinically nor histologically. At long-term follow-up, clinical results and scar characteristics were not significantly different in the two compared groups. It is concluded from the results of this study that, during the early phase, epithelialization was faster with allogeneic cultured keratinocytes compared with cadaveric skin. However, taking into account the substantial difference in costs, the described use of cryopreserved allogeneic cultured keratinocytes as a double layer on meshed

  5. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  6. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  7. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Science.gov (United States)

    Noguchi, Fumihito; Nakajima, Takeshi; Inui, Shigeki; Reddy, Janardan K; Itami, Satoshi

    2014-01-01

    MED1 (Mediator complex subunit 1) is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/-)) that develop epidermal hyperplasia. Herein, to investigate the function(s) of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/-) and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/-) mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/-) mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/-) keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/-) keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/-) keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/-) keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/-) mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/-) mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/-) mice, indicating a decreased contribution of hair

  8. Alteration of skin wound healing in keratinocyte-specific mediator complex subunit 1 null mice.

    Directory of Open Access Journals (Sweden)

    Fumihito Noguchi

    Full Text Available MED1 (Mediator complex subunit 1 is a co-activator of various transcription factors that function in multiple transcriptional pathways. We have already established keratinocyte-specific MED1 null mice (Med1(epi-/- that develop epidermal hyperplasia. Herein, to investigate the function(s of MED1 in skin wound healing, full-thickness skin wounds were generated in Med1(epi-/- and age-matched wild-type mice and the healing process was analyzed. Macroscopic wound closure and the re-epithelialization rate were accelerated in 8-week-old Med1(epi-/- mice compared with age-matched wild-type mice. Increased lengths of migrating epithelial tongues and numbers of Ki67-positive cells at the wounded epidermis were observed in 8-week-old Med1(epi-/- mice, whereas wound contraction and the area of α-SMA-positive myofibroblasts in the granulation tissue were unaffected. Migration was enhanced in Med1(epi-/- keratinocytes compared with wild-type keratinocytes in vitro. Immunoblotting revealed that the expression of follistatin was significantly decreased in Med1(epi-/- keratinocytes. Moreover, the mitogen-activated protein kinase pathway was enhanced before and after treatment of Med1(epi-/- keratinocytes with activin A in vitro. Cell-cycle analysis showed an increased ratio of S phase cells after activin A treatment of Med1(epi-/- keratinocytes compared with wild-type keratinocytes. These findings indicate that the activin-follistatin system is involved in this acceleration of skin wound healing in 8-week-old Med1(epi-/- mice. On the other hand, skin wound healing in 6-month-old Med1(epi-/- mice was significantly delayed with decreased numbers of Ki67-positive cells at the wounded epidermis as well as BrdU-positive label retaining cells in hair follicles compared with age-matched wild-type mice. These results agree with our previous observation that hair follicle bulge stem cells are reduced in older Med1(epi-/- mice, indicating a decreased contribution of hair

  9. Cell lineage mapping of taste bud cells and keratinocytes in the mouse tongue and soft palate.

    Science.gov (United States)

    Okubo, Tadashi; Clark, Cheryl; Hogan, Brigid L M

    2009-02-01

    The epithelium of the mouse tongue and soft palate consists of at least three distinct epithelial cell populations: basal cells, keratinized cells organized into filiform and fungiform papillae, and taste receptor cells present in tight clusters known as taste buds in the fungiform and circumvallate papillae and soft palate. All three cell types develop from the simple epithelium of the embryonic tongue and palate, and are continually replaced in the adult by cell turnover. Previous studies using pulse-chase tritiated thymidine labeling in the adult mouse provided evidence for a high rate of cell turnover in the keratinocytes (5-7 days) and taste buds (10 days). However, little is known about the localization and phenotype of the long-term stem or progenitor cells that give rise to the mature taste bud cells and surrounding keratinocytes in these gustatory tissues. Here, we make use of a tamoxifen-inducible K14-CreER transgene and the ROSA26 LacZ reporter allele to lineage trace the mature keratinocytes and taste bud cells of the early postnatal and adult mouse tongue and soft palate. Our results support the hypothesis that both the pore keratinocytes and receptor cells of the taste bud are derived from a common K14(+)K5(+)Trp63(+)Sox2(+) population of bipotential progenitor cells located outside the taste bud. The results are also compatible with models in which the keratinocytes of the filiform and fungiform papillae are derived from basal progenitor cells localized at the base of these structures.

  10. The effect of keratinocytes on the biomechanical characteristics and pore microstructure of tissue engineered skin using deep dermal fibroblasts.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-12-01

    Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Attenuation of UVR-induced vitamin D3 synthesis in a mouse model deleted for keratinocyte lathosterol 5-desaturase.

    Science.gov (United States)

    Makarova, Anastasia M; Pasta, Saloni; Watson, Gordon; Shackleton, Cedric; Epstein, Ervin H

    2017-07-01

    The lower risk of some internal cancers at lower latitudes has been linked to greater sun exposure and consequent higher levels of ultraviolet radiation (UVR)-produced vitamin D 3 (D 3 ). To separate the experimental effects of sunlight and of all forms of D 3 , a mouse in which UVR does not produce D 3 would be useful. To this end we have generated mice carrying a modified allele of sterol C5-desaturase (Sc5d), the gene encoding the enzyme that converts lathosterol to 7-dehydrocholesterol (7-DHC), such that Sc5d expression can be inactivated using the Cre/lox site-specific recombination system. By crossing to mice with tissue-specific expression of Cre or CreER 2 (Cre/estrogen receptor), we generated two lines of transgenic mice. One line has constitutive keratinocyte-specific inactivation of Sc5d (Sc5d k14KO ). The other line (Sc5d k14KOi ) has tamoxifen-inducible keratinocyte-specific inactivation of Sc5d. Mice deleted for keratinocyte Sc5d lose the ability to increase circulating D 3 following UVR exposure of the skin. Thus, unlike in control mice, acute UVR exposure did not affect circulating D 3 level in inducible Sc5d k14KOi mice. Keratinocyte-specific inactivation of Sc5d was proven by sterol measurement in hair - in control animals lathosterol and cholesta-7,24-dien-3β-ol, the target molecules of SC5D in the sterol biosynthetic pathways, together constituted a mean of 10% of total sterols; in the conditional knockout mice these sterols constituted a mean of 56% of total sterols. The constitutive knockout mice had an even greater increase, with lathosterol and cholesta-7,24-dien-3β-ol accounting for 80% of total sterols. In conclusion, the dominant presence of the 7-DHC precursors in hair of conditional animals and the lack of increased circulating D 3 following exposure to UVR reflect attenuated production of the D 3 photochemical precursor 7-DHC and, consequently, of D 3 itself. These animals provide a useful new tool for investigating the role of D 3

  12. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  13. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  14. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  15. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    International Nuclear Information System (INIS)

    Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

    2013-01-01

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

  16. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  17. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  18. Skin and hair follicle integrity is crucially dependent on beta 1 integrin expression on keratinocytes

    DEFF Research Database (Denmark)

    Brakebusch, C; Grose, R; Quondamatteo, F

    2000-01-01

    developed severe hair loss due to a reduced proliferation of hair matrix cells and severe hair follicle abnormalities. Eventually, the malformed hair follicles were removed by infiltrating macrophages. The epidermis of the back skin became hyperthickened, the basal keratinocytes showed reduced expression......, the integrity of the basement membrane surrounding the beta 1-deficient hair follicle was not affected. Finally, the dermis became fibrotic. These results demonstrate an important role of beta 1 integrins in hair follicle morphogenesis, in the processing of basement membrane components, in the maintenance...

  19. Enhancement of keratinocyte performance in the production of tissue-engineered skin using a low-calcium medium.

    Science.gov (United States)

    Hernon, Catherine A; Harrison, Caroline A; Thornton, Daniel J A; MacNeil, Sheila

    2007-01-01

    The success of laboratory-expanded autologous keratinocytes for the treatment of severe burn injuries is often compromised by their lack of dermal remnants and failure to establish a secure dermo-epidermal junction on the wound bed. We have developed a tissue-engineered skin substitute for in vivo use, based on a sterilized donor human dermis seeded with autologous keratinocytes and fibroblasts. However, culture rates are currently too slow for clinical use in acute burns. Our aim in this study was to increase the rate of production of tissue-engineered skin. Two approaches were explored: one using a commercial low-calcium media and the other supplementing well-established media for keratinocyte culture with the calcium-chelating agent ethylene glutamine tetra-acetic acid (EGTA). Using commercial low-calcium media for both the initial cell culture and subsequent culture of tissue-engineered skin did not produce tissue suitable for clinical use. However, it was possible to enhance the initial proliferation of keratinocytes and to increase their horizontal migration in tissue-engineered skin by supplementing established culture medium with 0.04 mM EGTA without sacrificing epidermal attachment and differentiation. Enhancement of keratinocyte migration with EGTA was also maximal in the absence of fibroblasts or basement membrane.

  20. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  1. Sacha Inchi Oil (Plukenetia volubilis L.), effect on adherence of Staphylococus aureus to human skin explant and keratinocytes in vitro.

    Science.gov (United States)

    Gonzalez-Aspajo, German; Belkhelfa, Haouaria; Haddioui-Hbabi, Laïla; Bourdy, Geneviève; Deharo, Eric

    2015-08-02

    Plukenetia volubilis L. (Euphorbiaceae) is a domesticated vine distributed from the high-altitude Andean rain forest to the lowlands of the Peruvian Amazon. Oil from the cold-pressed seeds, sold under the commercial name of Sacha Inchi Oil (SIO) is actually much in favour because it contains a high percentage of omega 3 and omega 6, and is hence used as a dietary supplement. SIO is also used traditionally for skin care, in order to maintain skin softness, and for the treatment of wounds, insect bites and skin infections, in a tropical context where the skin is frequently damaged. This study was designed in order to verify whether the traditional use of SIO for skin care would have any impact on Staphylococcus aureus growth and skin adherence, as S. aureus is involved in many skin pathologies (impetigo, folliculitis, furuncles and subcutaneous abscesses) being one if the main pathogens that can be found on the skin. Therefore, our objective was to assess SIO bactericidal activity and interference with adherence to human skin explants and the keratinocyte cell line. Cytotoxicity on that cells was also determined. The activity of SIO was compared to coconut oil (CocO), which is widely used for skin care but has different unsaturated fatty acids contents. Laboratory testing with certified oil, determined antibacterial activity against radio labelled S. aureus. Cytotoxic effects were measured with XTT on keratinocyte cells and with neutral red on human skin explants; phenol was used as cytotoxic control. Adherence assays were carried out by mixing H3-labelled S. aureus bacteria with keratinocyte cells and human skin explants, incubated with oils 2h before (to determine the inhibition of adherence, assimilated to a preventive effect) or 2h after the contact of the biological material with S. aureus (to assess the detachment of the bacteria, assimilated to a curative effect). Residual radioactivity measured after washings made it possible to determine the adherence

  2. Characterization of Fetal Keratinocytes, Showing Enhanced Stem Cell-Like Properties: A Potential Source of Cells for Skin Reconstruction

    Directory of Open Access Journals (Sweden)

    Kenneth K.B. Tan

    2014-08-01

    Full Text Available Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  3. Dysregulation of suppressor of cytokine signaling 3 in keratinocytes causes skin inflammation mediated by interleukin-20 receptor-related cytokines.

    Directory of Open Access Journals (Sweden)

    Ayako Uto-Konomi

    Full Text Available Homeostatic regulation of epidermal keratinocytes is controlled by the local cytokine milieu. However, a role for suppressor of cytokine signaling (SOCS, a negative feedback regulator of cytokine networks, in skin homeostasis remains unclear. Keratinocyte specific deletion of Socs3 (Socs3 cKO caused severe skin inflammation with hyper-production of IgE, epidermal hyperplasia, and S100A8/9 expression, although Socs1 deletion caused no inflammation. The inflamed skin showed constitutive STAT3 activation and up-regulation of IL-6 and IL-20 receptor (IL-20R related cytokines, IL-19, IL-20 and IL-24. Disease development was rescued by deletion of the Il6 gene, but not by the deletion of Il23, Il4r, or Rag1 genes. The expression of IL-6 in Socs3 cKO keratinocytes increased expression of IL-20R-related cytokines that further facilitated STAT3 hyperactivation, epidermal hyperplasia and neutrophilia. These results demonstrate that skin homeostasis is strictly regulated by the IL-6-STAT3-SOCS3 axis. Moreover, the SOCS3-mediated negative feedback loop in keratinocytes has a critical mechanistic role in the prevention of skin inflammation caused by hyperactivation of STAT3.

  4. Xenobiotic-metabolizing enzymes in the skin of rat, mouse, pig, guinea pig, man, and in human skin models.

    Science.gov (United States)

    Oesch, F; Fabian, E; Guth, K; Landsiedel, R

    2014-12-01

    The exposure of the skin to medical drugs, skin care products, cosmetics, and other chemicals renders information on xenobiotic-metabolizing enzymes (XME) in the skin highly interesting. Since the use of freshly excised human skin for experimental investigations meets with ethical and practical limitations, information on XME in models comes in the focus including non-human mammalian species and in vitro skin models. This review attempts to summarize the information available in the open scientific literature on XME in the skin of human, rat, mouse, guinea pig, and pig as well as human primary skin cells, human cell lines, and reconstructed human skin models. The most salient outcome is that much more research on cutaneous XME is needed for solid metabolism-dependent efficacy and safety predictions, and the cutaneous metabolism comparisons have to be viewed with caution. Keeping this fully in mind at least with respect to some cutaneous XME, some models may tentatively be considered to approximate reasonable closeness to human skin. For dermal absorption and for skin irritation among many contributing XME, esterase activity is of special importance, which in pig skin, some human cell lines, and reconstructed skin models appears reasonably close to human skin. With respect to genotoxicity and sensitization, activating XME are not yet judgeable, but reactive metabolite-reducing XME in primary human keratinocytes and several reconstructed human skin models appear reasonably close to human skin. For a more detailed delineation and discussion of the severe limitations see the "Overview and Conclusions" section in the end of this review.

  5. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  6. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  7. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  8. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  9. Performance of a novel keratinocyte-based reporter cell line to screen skin sensitizers in vitro

    International Nuclear Information System (INIS)

    Emter, Roger; Ellis, Graham; Natsch, Andreas

    2010-01-01

    In vitro tests are needed to replace animal tests to screen for the skin sensitization potential of chemicals. Skin sensitizers are electrophilic molecules and the Nrf2-electrophile-sensing pathway comprising the repressor protein Keap1, the transcription factor Nrf2 and the antioxidant response element (ARE) is emerging as a toxicity pathway induced by skin sensitizers. Previously, we screened a large set of chemicals in the reporter cell line AREc32, which contains an eight-fold repeat of the rat GSTA2 ARE-sequence upstream of a luciferase reporter gene in the human breast cancer cell line MCF7. This approach was now further developed to bring it closer to the conditions in the human skin and to propose a fully standardized assay. To this end, a luciferase reporter gene under control of a single copy of the ARE-element of the human AKR1C2 gene was stably inserted into HaCaT keratinocytes. A standard operating procedure was developed whereby chemicals are routinely tested at 12 concentrations in triplicate for significant induction of gene activity. We report results from this novel assay on (i) a list of reference chemicals published by ECVAM, (ii) the ICCVAM list of chemicals for validation of alternative endpoints in the LLNA and (iii) on a more general list of 67 chemicals derived from the ICCVAM database. For comparison, peptide reactivity data are presented for the same chemicals. The results indicate a good predictive value of this approach for hazard identification. Its technical simplicity, the high-throughput format and the good predictivity may make this assay a candidate for rapid validation to meet the tight deadline to replace animal tests for skin sensitization by 2013 set by the European authorities.

  10. The Benefit of Microskin in Combination With Autologous Keratinocyte Suspension to Treat Full Skin Loss In Vivo.

    Science.gov (United States)

    Yuru, Shang; Dawei, Li; Chuanan, Shen; Kai, Yin; Li, Ma; Longzhu, Li; Dongxu, Zhao; Wenfeng, Cheng

    Patients with extensive deep burns often lack enough autologous skin to cover the wounds. This study explores a new method using microskin in combination with autologous keratinocytes in the treatment of extensive deep burn. Wounds in the combination group were treated with automicroskin at an area expansion ratio of 20:1 (wound area to automicroskin area) and autologous keratinocyte suspension, which were compared with the following treatments: no autotransplant, only allografts (control group); autologous keratinocyte suspension only (keratinocyte only group); automicroskin at an area expansion ratio of 20:1 (20:1 group); and automicroskin at an area expansion ratio of 10:1 (10:1 group, positive control). The authors used epithelialization rate (epithelialized area on day 21 divided by original wound area), hematoxylin and eosin staining, laminin, and type IV collagen immunohistochemistry to assess wound healing. The epithelialization rate of combination group (74.2% ± 8.0%) was similar to that of 10: 1 group (84.3% ± 11.9%, P = .085) and significantly (P < .05) higher than that of 20:1 group (59.2% ± 10.8%), keratinocyte only group (53.8% ± 11.5%), and control group (22.7% ± 5.5%). The hematoxylin and eosin staining and immunohistochemistry showed the epithelialization in the combination group was better than that in the keratinocyte only group and control group. Microskin in combination with autologous keratinocyte suspension can promote the reepithelialization of full-thickness wounds and reduce the requirements for automircoskin, and it is a useful option in the treatment of extensive deep burns.

  11. SOCS3 inhibits the pathological effects of IL-22 in non-melanoma skin tumor-derived keratinocytes.

    Science.gov (United States)

    Madonna, Stefania; Scarponi, Claudia; Morelli, Martina; Sestito, Rosanna; Scognamiglio, Pasqualina Liana; Marasco, Daniela; Albanesi, Cristina

    2017-04-11

    Basal cell carcinomas (BCC) and squamous-cell carcinomas (SCC) are common malignancies in humans, caused by neoplastic transformation of keratinocytes of the basal or suprabasal layers of epidermis, respectively. Tumor-infiltrating lymphocytes (TILs) are frequently found in BCC and SCC, and functionally promote epithelial carcinogenesis. TILs secreting IL-22, in particular, participate to BCC and SCC growth by inducing keratinocyte proliferation and migration, as well as the expression of inflammatory, anti-apoptotic and pro-angiogenic genes.In this study, we identified SOCS3 as a valid candidate to be manipulated for suppressing tumorigenic functions in BCC and SCC. We found that SOCS3 and SOCS1 expression was reduced in vivo, in tumor lesions of BCC and SCC, as compared to other skin inflammatory conditions such as psoriasis, despite the high number of IL-22-secreting TILs. Moreover, IL-22 was not able to induce in vitro the transcriptional expression of SOCS3 in BCC-or SCC-derived keratinocytes, contrarily to healthy cells. Aimed at rescuing SOCS3 activity in these tumor contexts, a SOCS3-derived peptide, named KIR-ESS, was synthesized, and its ability in suppressing IL-22-induced responses was evaluated in healthy and transformed keratinocytes. We found that KIR-ESS peptide efficiently suppressed the IL-22 molecular signaling in keratinocytes, by acting on STAT3 and Erk1/2 cascade, as well as on the expression of STAT3-dependent downstream genes. Interestingly, after treatment with peptide, both healthy and transformed keratinocytes could no longer aberrantly proliferate and migrate in response to IL-22. Finally, treatment of athymic nude mice bearing SCC xenografts with KIR-ESS peptide concomitantly reduced tumor growth and activated STAT3 levels. As a whole, these data provides the rationale for the use in BCC and SCC skin tumors of SOCS3 mimetics, being able to inhibit the deleterious effects of IL-22 in these contexts.

  12. Full-thickness skin wound healing using autologous keratinocytes and dermal fibroblasts with fibrin: bilayered versus single-layered substitute.

    Science.gov (United States)

    Idrus, Ruszymah Bt Hj; Rameli, Mohd Adha bin P; Low, Kiat Cheong; Law, Jia Xian; Chua, Kien Hui; Latiff, Mazlyzam Bin Abdul; Saim, Aminuddin Bin

    2014-04-01

    Split-skin grafting (SSG) is the gold standard treatment for full-thickness skin defects. For certain patients, however, an extensive skin lesion resulted in inadequacies of the donor site. Tissue engineering offers an alternative approach by using a very small portion of an individual's skin to harvest cells for propagation and biomaterials to support the cells for implantation. The objective of this study was to determine the effectiveness of autologous bilayered tissue-engineered skin (BTES) and single-layer tissue-engineered skin composed of only keratinocytes (SLTES-K) or fibroblasts (SLTES-F) as alternatives for full-thickness wound healing in a sheep model. Full-thickness skin biopsies were harvested from adult sheep. Isolated fibroblasts were cultured using medium Ham's F12: Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, whereas the keratinocytes were cultured using Define Keratinocytes Serum Free Medium. The BTES, SLTES-K, and SLTES-F were constructed using autologous fibrin as a biomaterial. Eight full-thickness wounds were created on the dorsum of the body of the sheep. On 4 wounds, polyvinyl chloride rings were used as chambers to prevent cell migration at the edge. The wounds were observed at days 7, 14, and 21. After 3 weeks of implantation, the sheep were euthanized and the skins were harvested. The excised tissues were fixed in formalin for histological examination via hematoxylin-eosin, Masson trichrome, and elastin van Gieson staining. The results showed that BTES, SLTES-K, and SLTES-F promote wound healing in nonchambered and chambered wounds, and BTES demonstrated the best healing potential. In conclusion, BTES proved to be an effective tissue-engineered construct that can promote the healing of full-thickness skin lesions. With the support of further clinical trials, this procedure could be an alternative to SSG for patients with partial- and full-thickness burns.

  13. Isolation, identification, and pathological effects of beach sand bacterial extract on human skin keratinocytes in vitro

    Directory of Open Access Journals (Sweden)

    Fazli Subhan

    2018-01-01

    Full Text Available Background Beaches are recreational spots for people. However, beach sand contains harmful microbes that affect human health, and there are no established methods for either sampling and identifying beach-borne pathogens or managing the quality of beach sand. Method This study was conducted with the aim of improving human safety at beaches and augmenting the quality of the beach experience. Beach sand was used as a resource to isolate bacteria due to its distinctive features and the biodiversity of the beach sand biota. A selected bacterial isolate termed FSRS was identified as Pseudomonas stutzeri using 16S rRNA sequencing and phylogenetic analysis, and the sequence was deposited in the NCBI GenBank database under the accession number MF599548. The isolated P. stutzeri bacterium was cultured in Luria–Bertani growth medium, and a crude extract was prepared using ethyl acetate to examine the potential pathogenic effect of P. stutzeri on human skin. A human skin keratinocyte cell line (HaCaT was used to assess cell adhesion, cell viability, and cell proliferation using a morphological analysis and a WST-1 assay. Result The crude P. stutzeri extract inhibited cell adhesion and decreased cell viability in HaCaT cells. We concluded that the crude extract of P. stutzeri FSRS had a strong pathological effect on human skin cells. Discussion Beach visitors frequently get skin infections, but the exact cause of the infections is yet to be determined. The beach sand bacterium P. stutzeri may, therefore, be responsible for some of the dermatological problems experienced by people visiting the beach.

  14. C/EBPalpha and C/EBPbeta are required for Sebocyte differentiation and stratified squamous differentiation in adult mouse skin.

    Directory of Open Access Journals (Sweden)

    John S House

    Full Text Available C/EBPalpha and C/EBPbeta are bZIP transcription factors that are highly expressed in the interfollicular epidermis and sebaceous glands of skin and yet germ line deletion of either family member alone has only mild or no effect on keratinocyte biology and their role in sebocyte biology has never been examined. To address possible functional redundancies and reveal functional roles of C/EBPalpha and C/EBPbeta in postnatal skin, mouse models were developed in which either family member could be acutely ablated alone or together in the epidermis and sebaceous glands of adult mice. Acute removal of either C/EBPalpha or C/EBPbeta alone in adult mouse skin revealed modest to no discernable changes in epidermis or sebaceous glands. In contrast, co-ablation of C/EBPalpha and C/EBPbeta in postnatal epidermis resulted in disruption of stratified squamous differentiation characterized by hyperproliferation of basal and suprabasal keratinocytes and a defective basal to spinous keratinocyte transition involving an expanded basal compartment and a diminished and delayed spinous compartment. Acute co-ablation of C/EBPalpha and C/EBPbeta in sebaceous glands resulted in severe morphological defects, and sebocyte differentiation was blocked as determined by lack of sebum production and reduced expression of stearoyl-CoA desaturase (SCD3 and melanocortin 5 receptor (MC5R, two markers of terminal sebocyte differentiation. Specialized sebocytes of Meibomian glands and preputial glands were also affected. Our results indicate that in adult mouse skin, C/EBPalpha and C/EBPbeta are critically involved in regulating sebocyte differentiation and epidermal homeostasis involving the basal to spinous keratinocyte transition and basal cell cycle withdrawal.

  15. CRISPR-assisted receptor deletion reveals distinct roles for ERBB2 and ERBB3 in skin keratinocytes.

    Science.gov (United States)

    Dahlhoff, Maik; Gaborit, Nadège; Bultmann, Sebastian; Leonhardt, Heinrich; Yarden, Yosef; Schneider, Marlon R

    2017-10-01

    While the epidermal growth factor receptor (EGFR) is an established regulator of skin development and homeostasis, the functions of the related tyrosine kinase receptors ERBB2 and ERBB3 in this tissue have only recently been examined. Previously reported, skin-specific deletion of each of these receptors in mice resulted in similar defects in keratinocyte proliferation and migration, resulting in impaired wound healing and tumorigenesis. Because both ERBB2 and ERBB3 are targets for treating an array of cancer types, it is important to examine the consequences of receptor inhibition in human keratinocytes. Here, we employed the CRISPR/Cas9 technology to generate HaCaT cells (an established human keratinocyte cell line) lacking ERBB2 or ERBB3. HaCaT clones lacking ERBB2 or ERBB3 showed comparable reductions in cell proliferation as assessed by BrdU staining. Apoptosis, in contrast, was reduced in ERBB3-deficient HaCaT cells only. Assessment of cell migration using a wound healing (scratch) assay showed that the closure of the wound gaps was completed by 48 h in mock and in ERBB3 knockout clones. In contrast, this process was considerably delayed in ERBB2 knockout clones, and a complete closure of the gap in the latter cells did not occur before 72 h. In conclusion, both ERBB2 and ERBB3 are essential for normal proliferation of skin keratinocytes, but in contrast to ERBB3, ERBB2 is essential for migration of human keratinocytes. These observations might bear significance to patient adverse effects of therapeutic agents targeting ERBB2 and ERBB3. © 2017 Federation of European Biochemical Societies.

  16. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  17. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  18. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  19. Interleukin-1α Induction in Human Keratinocytes (HaCaT: An In Vitro Model for Chemoprevention in Skin

    Directory of Open Access Journals (Sweden)

    T. Magcwebeba

    2012-01-01

    Full Text Available Long-term exposure to UV irradiation and toxic chemicals is associated with chronic inflammation that contributes to skin cancer development with interleukin-1 alpha (IL-1α, constitutively produced by keratinocytes, playing a pivotal role in skin inflammation. The aim of this study was to investigate the modulation of IL-1α production in the HaCaT keratinocyte cell line. Phorbol 12-myristate 13-acetate failed to induce IL-1α in HaCaT cells, and this might be associated with the specific deficiency known to affect downstream signalling of the MEK/ERK pathway in these cells. The calcium ionophore, ionomycin, slightly enhanced the production of intracellular (icIL-1α, but this resulted in a necrotic release at higher concentrations. UV-B exposure significantly increased the production of icIL-1α in a dose-dependent manner with a maximal induction exhibited at 24 h with minimal necrotic and apoptotic effects. Validation of the HaCaT cell model indicated that the nonsteroidal anti-inflammatory drug (NSAID, ibuprofen, and the glucocorticoid, dexamethasone, inhibited icIL-1α production, and this was associated with a slight inhibition of cell viability. The UV-B-induced keratinocyte cell model provides an in vitro system that could, apart from phorbol ester-like compounds, be utilised as a screening assay in identifying skin irritants and/or therapeutic topical agents via the modulation of IL-1α production.

  20. Ultraviolet-evoked prostaglandin biosynthesis in varying stages of keratinocyte differentiation in guinea pig skin

    Energy Technology Data Exchange (ETDEWEB)

    Karmali, R A; Safai, B

    1984-09-01

    Prostaglandin (PG) production by guinea pig epidermal cells was evaluated at various incubation intervals in normal and UV-exposed cultures. Prostaglandins have been implicated as mediators of the early phase of erythema in skin exposed to sunlight or UV-radiation. Using a density gradient centrifugation procedure, the epidermal cells were fractionated according to the various maturation stages of epidermal keratinocytes: high-density epidermal cells (HDEC) consisting of round, less mature cells; low-density epidermal cells (LDEC) consisting of polygonal keratinized cells; and intermediate-density epidermal cells (IDEC) consisting of both HDEC and LDEC. When cultures of 1 X 10(6) cells were incubated at 37 degrees C in 5% CO/sub 2/ the highest concentrations of five PG moieties measured were present in supernatants from the LDEC cultures as compared to those of IDEC or HDEC. Levels of PGF 2 alpha were much higher than the rest, which were found in the order PGF2 alpha greater than PGE2 greater than PGE1 greater than 6-keto-PGF1 alpha greater than thromboxane (TX)B2. UV-irradiation induced increases in all but TXA2 production. These results identify and quantitate five compounds produced as a result of exaggerated activity of the cyclooxygenase induced by UV-irradiation.

  1. Upregulation of cathepsin S in psoriatic keratinocytes.

    Science.gov (United States)

    Schönefuss, Alexander; Wendt, Wiebke; Schattling, Benjamin; Schulten, Roxane; Hoffmann, Klaus; Stuecker, Markus; Tigges, Christian; Lübbert, Hermann; Stichel, Christine

    2010-08-01

    Cathepsin S (CATS) is a cysteine protease, well known for its role in MHC class II-mediated antigen presentation and extracellular matrix degradation. Disturbance of the expression or metabolism of this protease is a concomitant feature of several diseases. Given this importance we studied the localization and regulation of CATS expression in normal and pathological human/mouse skin. In normal human skin CATS-immunostaining is mainly present in the dermis and is localized in macrophages, Langerhans, T- and endothelial cells, but absent in keratinocytes. In all analyzed pathological skin biopsies, i.e. atopic dermatitis, actinic keratosis and psoriasis, CATS staining is strongly increased in the dermis. But only in psoriasis, CATS-immunostaining is also detectable in keratinocytes. We show that cocultivation with T-cells as well as treatment with cytokines can trigger expression and secretion of CATS, which is involved in MHC II processing in keratinocytes. Our data provide first evidence that CATS expression (i) is selectively induced in psoriatic keratinocytes, (ii) is triggered by T-cells and (iii) might be involved in keratinocytic MHC class II expression, the processing of the MHC class II-associated invariant chain and remodeling of the extracellular matrix. This paper expands our knowledge on the important role of keratinocytes in dermatological disease.

  2. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  3. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  4. Mouse Models of the Skin: Models to Define Mechanisms of Skin Carcinogenesis

    International Nuclear Information System (INIS)

    Wheeler, D. L.; Verma, A. K.; Denning, M. F.

    2013-01-01

    The multistep model of mouse skin carcinogenesis has facilitated identification of irreversible genetic events of initiation and progression, and epigenetic events of tumor promotion. Mouse skin tumor initiation can be accomplished by a single exposure to a sufficiently small dose of a carcinogen, and this step is rapid and irreversible. However, promotion of skin tumor formation requires a repeated and prolonged exposure to a promoter, and that tumor promotion is reversible. Investigations focused on the mechanisms of mouse carcinogenesis have resulted in the identifications of potential molecular targets of cancer induction and progression useful in planning strategies for human cancer prevention trials. This special issue contains eight papers that focus on mouse models used to study individual proteins expressed in the mouse skin and the role they play in differentiation, tissue homeostasis, skin carcinogenesis, and chemo prevention of skin cancer.

  5. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Senthilkumar, P.K.; Robertson, L.W.; Ludewig, G.

    2012-01-01

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  6. Diffusion of [2-14C]diazepam across hairless mouse skin and human skin

    International Nuclear Information System (INIS)

    Koch, R.L.; Palicharla, P.; Groves, M.J.

    1987-01-01

    The objectives of this study were to investigate the absorption of diazepam applied topically to the hairless mouse in vivo and to determine the diffusion of diazepam across isolated hairless mouse skin and human skin. [ 14 C]Diazepam was readily absorbed after topical administration to the intact hairless mouse, a total of 75.8% of the 14 C-label applied being recovered in urine and feces. Diazepam was found to diffuse across human and hairless mouse skin unchanged in experiments with twin-chambered diffusion cells. The variation in diffusion rate or the flux for both human and mouse tissues was greater among specimens than between duplicate or triplicate trials for a single specimen. Fluxes for mouse skin (stratum corneum, epidermis, and dermis) were greater than for human skin (stratum corneum and epidermis): 0.35-0.61 microgram/cm2/h for mouse skin vs 0.24-0.42 microgram/cm2/h for human skin. The permeability coefficients for mouse skin ranged from 1.4-2.4 X 10(-2)cm/h compared with 0.8-1.4 X 10(-2)cm/h for human skin. Although human stratum corneum is almost twice the thickness of that of the hairless mouse, the diffusion coefficients for human skin were 3-12 times greater (0.76-3.31 X 10(-6) cm2/h for human skin vs 0.12-0.27 X 10(-6) cm2/h for hairless mouse) because of a shorter lag time for diffusion across human skin. These differences between the diffusion coefficients and diffusion rates (or permeability coefficients) suggest that the presence of the dermis may present some barrier properties. In vitro the dermis may require complete saturation before the diazepam can be detected in the receiving chamber

  7. How Does Chronic Cigarette Smoke Exposure Affect Human Skin? A Global Proteomics Study in Primary Human Keratinocytes.

    Science.gov (United States)

    Rajagopalan, Pavithra; Nanjappa, Vishalakshi; Raja, Remya; Jain, Ankit P; Mangalaparthi, Kiran K; Sathe, Gajanan J; Babu, Niraj; Patel, Krishna; Cavusoglu, Nükhet; Soeur, Jeremie; Pandey, Akhilesh; Roy, Nita; Breton, Lionel; Chatterjee, Aditi; Misra, Namita; Gowda, Harsha

    2016-11-01

    Cigarette smoking has been associated with multiple negative effects on human skin. Long-term physiological effects of cigarette smoke are through chronic and not acute exposure. Molecular alterations due to chronic exposure to cigarette smoke remain unclear. Primary human skin keratinocytes chronically exposed to cigarette smoke condensate (CSC) showed a decreased wound-healing capacity with an increased expression of NRF2 and MMP9. Using quantitative proteomics, we identified 4728 proteins, of which 105 proteins were overexpressed (≥2-fold) and 41 proteins were downregulated (≤2-fold) in primary skin keratinocytes chronically exposed to CSC. We observed an alteration in the expression of several proteins involved in maintenance of epithelial barrier integrity, including keratin 80 (5.3 fold, p value 2.5 × 10 -7 ), cystatin A (3.6-fold, p value 3.2 × 10 -3 ), and periplakin (2.4-fold, p value 1.2 × 10 -8 ). Increased expression of proteins associated with skin hydration, including caspase 14 (2.2-fold, p value 4.7 × 10 -2 ) and filaggrin (3.6-fold, p value 5.4 × 10 -7 ), was also observed. In addition, we report differential expression of several proteins, including adipogenesis regulatory factor (2.5-fold, p value 1.3 × 10 -3 ) and histone H1.0 (2.5-fold, p value 6.3 × 10 -3 ) that have not been reported earlier. Bioinformatics analyses demonstrated that proteins differentially expressed in response to CSC are largely related to oxidative stress, maintenance of skin integrity, and anti-inflammatory responses. Importantly, treatment with vitamin E, a widely used antioxidant, could partially rescue adverse effects of CSC exposure in primary skin keratinocytes. The utility of antioxidant-based new dermatological formulations in delaying or preventing skin aging and oxidative damages caused by chronic cigarette smoke exposure warrants further clinical investigations and multi-omics research.

  8. Should dermal scald burns in children be covered with autologous skin grafts or with allogeneic cultivated keratinocytes?--"The Viennese concept".

    Science.gov (United States)

    Rab, Matthias; Koller, Rupert; Ruzicka, Margot; Burda, Gudrun; Kamolz, Lars Peter; Bierochs, Bettina; Meissl, Guenther; Frey, Manfred

    2005-08-01

    The treatment of scald burns in children is still under discussion. The aim of the present study was to evaluate an optimised treatment regime for scald burns in children. Between 1997 and 2002, 124 children underwent surgical intervention due to burn injuries. Thirty-six out of these 124 children were enrolled into the evaluation of our recent treatment protocol. Twenty-two children with scald burns covering an average body surface area (TBSA) of 18.5% were treated by early excision and coverage with allogeneic keratinocytes in case of partial thickness lesions (keratinocyte group). Fourteen children with a TBSA of 17.2% were treated with autologous skin grafts alone (skin graft group). Both groups were comparable according to age, burn depth and affected TBSA. The complete clinical follow-up examination of at least 17 months was performed in 12 out of 22 children of the keratinocyte group and in 9 out of 14 patients of the comparative group. Visible scar formations were classified according to the Vancouver Scar Scale (VSS) in each patient. The use of allogeneic keratinocytes led to complete epithelialisation within 12 days in 20 of the 22 cases. No secondary skin grafting procedures had to be done. Skin take rate at the sixth postoperative day was 100% in the skin graft group. Blood transfusions were administered intraoperatively according to the clinical need of the patients by the responsible anaesthesiologist. The mean volume of blood, which had to be transfused was 63.9 ml in the keratinocyte group and significantly lower than the volume of 151.4 ml, which was administered in the skin graft group (p=0.04). At follow up the VSS observed in areas covered by keratinocytes was 2.33 on the average and therefore, significantly lower than the VSS of 5.22 in skin grafted areas of the comparative group (p=0.04). In children the use of cultivated keratinocytes in partial thickness scald burns is a procedure, which renders constantly reliable results. It minimizes the

  9. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  10. Heterogeneity of [3H]phorbol 12,13-dibutyrate binding in primary mouse keratinocytes at different stages of maturation

    International Nuclear Information System (INIS)

    Dunn, J.A.; Jeng, A.Y.; Yuspa, S.H.; Blumberg, P.M.

    1985-01-01

    Mouse keratinocytes respond heterogeneously to phorbol esters with distinct subpopulations stimulated to proliferate or induced to differentiate. The maturation state of the epidermal cell at the time of exposure may determine its response. The binding of phorbol esters to primary mouse keratinocytes was studied under culture conditions selecting for proliferating cells or differentiating cells. [20- 3 H]-12-Deoxyphorbol 13-isobutyrate ([ 3 H]-DPB) bound to both types of cells at one class of binding sites. The dissociation constant (Kd) for [ 3 H]DPB in the proliferative cells was 69 nM and the binding at saturation (Bmax) was 1.3 pmol/mg of protein. The corresponding values in the differentiative cells were 96 nM and 1.5 pmol/mg of protein, respectively. In contrast to the results obtained with [ 3 H]DPB, [20- 3 H]phorbol 12,13-dibutyrate ([ 3 H]PDBU) bound to both cell types in a heterogeneous fashion. The site for [ 3 H]DPB binding seemed to correspond to the higher affinity [ 3 H]PDBU binding site. The major difference in the cells grown in the medium containing 1.2 mM CaCl 2 was an increase in the Bmax of the lower affinity binding site with the other three parameters remaining similar. The state of epidermal differentiation thus appears to modulate the amount of the lower affinity binding sites for phorbol esters

  11. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  12. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Zhang, Donna D.; Wondrak, Georg T.

    2018-01-01

    Environmental exposure to solar ultraviolet (UV) radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2)-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana). Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-)]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA)-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches. PMID:29636694

  13. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  14. Significance of Ubiad1 for Epidermal Keratinocytes Involves More Than CoQ10 Synthesis: Implications for Skin Aging

    Directory of Open Access Journals (Sweden)

    Florian Labarrade

    2018-01-01

    Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.

  15. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  16. Keratinocytes propagated in serum-free, feeder-free culture conditions fail to form stratified epidermis in a reconstituted skin model.

    Directory of Open Access Journals (Sweden)

    Rebecca Lamb

    Full Text Available Primary human epidermal stem cells isolated from skin tissues and subsequently expanded in tissue culture are used for human therapeutic use to reconstitute skin on patients and to generate artificial skin in culture for academic and commercial research. Classically, epidermal cells, known as keratinocytes, required fibroblast feeder support and serum-containing media for serial propagation. In alignment with global efforts to remove potential animal contaminants, many serum-free, feeder-free culture methods have been developed that support derivation and growth of these cells in 2-dimensional culture. Here we show that keratinocytes grown continually in serum-free and feeder-free conditions were unable to form into a stratified, mature epidermis in a skin equivalent model. This is not due to loss of cell potential as keratinocytes propagated in serum-free, feeder-free conditions retain their ability to form stratified epidermis when re-introduced to classic serum-containing media. Extracellular calcium supplementation failed to improve epidermis development. In contrast, the addition of serum to commercial, growth media developed for serum-free expansion of keratinocytes facilitated 3-dimensional stratification in our skin equivalent model. Moreover, the addition of heat-inactivated serum improved the epidermis structure and thickness, suggesting that serum contains factors that both aid and inhibit stratification.

  17. Transfer of a two-tiered keratinocyte assay: IL-18 production by NCTC2544 to determine the skin sensitizing capacity and epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2013-01-01

    . The two tiered approach may offer an unique opportunity to provide an alternative method to the Local Lymph Node Assay (LLNA). These assays are both based on the use of human keratinocytes, which have been shown over the last two decades, to play a key role in all phases of skin sensitization....

  18. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  19. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  20. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  1. Human lactoferrin stimulates skin keratinocyte function and wound re-epithelialization.

    Science.gov (United States)

    Tang, L; Wu, J J; Ma, Q; Cui, T; Andreopoulos, F M; Gil, J; Valdes, J; Davis, S C; Li, J

    2010-07-01

    Human lactoferrin (hLF), a member of the transferrin family, is known for its antimicrobial and anti-inflammatory effects. Recent studies on various nonskin cell lines indicate that hLF may have a stimulatory effect on cell proliferation. To study the potential role of hLF in wound re-epithelialization. The effects of hLF on cell growth, migration, attachment and survival were assessed, with a rice-derived recombinant hLF (holo-rhLF), using proliferation analysis, scratch migration assay, calcein-AM/propidium iodide staining and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) method, respectively. The mechanisms of hLF on cell proliferation and migration were explored using specific pathway inhibitors. The involvement of lactoferrin receptor low-density lipoprotein receptor-related protein 1 (LRP1) was examined with RNA interference technique. An in vivo swine second-degree burn wound model was also used to assess wound re-epithelialization. Studies revealed that holo-rhLF significantly stimulated keratinocyte proliferation which could be blocked by mitogen-activated protein kinase (MAPK) kinase 1 inhibitor. Holo-rhLF also showed strong promoting effects on keratinocyte migration, which could be blocked by either inhibition of the MAPK, Src and Rho/ROCK pathways, or downregulation of the LRP1 receptor. With cells under starving or 12-O-tetradecanoylphorbol-13-acetate exposure, the addition of holo-rhLF was found greatly to increase cell viability and inhibit cell apoptosis. Additionally, holo-rhLF significantly increased the rate of wound re-epithelialization in swine second-degree burn wounds. Our studies demonstrate the direct effects of holo-rhLF on wound re-epithelialization including the enhancement of keratinocyte proliferation and migration as well as the protection of cells from apoptosis. The data strongly indicate its potential therapeutic applications in wound healing.

  2. Overexpression of galectin-7 in mouse epidermis leads to loss of cell junctions and defective skin repair.

    Directory of Open Access Journals (Sweden)

    Gaëlle Gendronneau

    Full Text Available The proteins of the galectin family are implicated in many cellular processes, including cell interactions, polarity, intracellular trafficking, and signal transduction. In human and mouse, galectin-7 is almost exclusively expressed in stratified epithelia, notably in the epidermis. Galectin-7 expression is also altered in several human tumors of epithelial origin. This study aimed at dissecting the consequences of galectin-7 overexpression on epidermis structure and functions in vivo.We established transgenic mice specifically overexpressing galectin-7 in the basal epidermal keratinocytes and analyzed the consequences on untreated skin and after UVB irradiation or mechanical injury.The intercellular cohesion of the epidermis is impaired in transgenic animals, with gaps developing between adjacent keratinocytes, associated with loss of adherens junctions. The epidermal architecture is aberrant with perturbations in the multilayered cellular organisation of the tissue, and structural defects in the basement membrane. These transgenic animals displayed a reduced re-epithelialisation potential following superficial wound, due to a defective collective migration of keratinocytes. Finally, a single mild dose of UVB induced an abnormal apoptotic response in the transgenic epidermis.These results indicate that an excess of galectin-7 leads to a destabilisation of adherens junctions associated with defects in epidermal repair. As this phenotype shares similarities with that of galectin-7 null mutant mice, we conclude that a critical level of this protein is required for maintaining proper epidermal homeostasis. This study brings new insight into the mode of action of galectins in normal and pathological situations.

  3. Radiosensitization of mouse skin by oxygen and depletion of glutathione

    International Nuclear Information System (INIS)

    Stevens, Graham; Joiner, Michael; Joiner, Barbara; Johns, Helen; Denekamp, Juliana

    1995-01-01

    Purpose: To determine the oxygen enhancement ratio (OER) and shape of the oxygen sensitization curve of mouse foot skin, the extent to which glutathione (GSH) depletion radiosensitized skin, and the dependence of such sensitization on the ambient oxygen tension. Methods and Materials: The feet of WHT mice were irradiated with single doses of 240 kVp x-rays while mice were exposed to carbogen or gases with oxygen/nitrogen mixtures containing 8-100% O 2 . The anoxic response was obtained by occluding the blood supply to the leg of anesthetized mice with a tourniquet, surrounding the foot with nitrogen, and allowing the mice to breathe 10% O 2 . Further experiments were performed to assess the efficacy of this method to obtain an anoxic response. Radiosensitivity of skin was assessed using the acute skin-reaction assay. Glutathione levels were modified using two schedules of dl-buthionine sulphoximine (BSO) and diethylmaleate (DEM), which were considered to produce extensive and intermediate levels of GSH depletion in the skin of the foot during irradiation. Results: Carbogen caused the greatest radiosensitization of skin, with a reproducible enhancement of 2.2 relative to the anoxic response. The OER of 2.2 is lower than other reports for mouse skin. This may indicate that the extremes of oxygenation were not produced, although there was no direct evidence for this. When skin radiosensitivity was plotted against the logarithm of the oxygen tension in the ambient gas, a sigmoid curve with a K value of 17-21% O 2 in the ambient gas was obtained. Depletion of GSH caused minimal radiosensitization when skin was irradiated under anoxic or well-oxygenated conditions. Radiosensitization by GSH depletion was maximal at intermediate oxygen tensions of 10-21% O 2 in the ambient gas. Increasing the extent of GSH depletion led to increasing radiosensitization, with sensitization enhancement ratios of 1.2 and 1.1, respectively, for extensive and intermediate levels of GSH

  4. Laser capture microdissection-based in vivo genomic profiling of wound keratinocytes identifies similarities and differences to squamous cell carcinoma

    DEFF Research Database (Denmark)

    Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh

    2003-01-01

    keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...

  5. Molecular Mechanisms of Mouse Skin Tumor Promotion

    International Nuclear Information System (INIS)

    Rundhaug, Joyce E.; Fischer, Susan M.

    2010-01-01

    Multiple molecular mechanisms are involved in the promotion of skin carcinogenesis. Induction of sustained proliferation and epidermal hyperplasia by direct activation of mitotic signaling pathways or indirectly in response to chronic wounding and/or inflammation, or due to a block in terminal differentiation or resistance to apoptosis is necessary to allow clonal expansion of initiated cells with DNA mutations to form skin tumors. The mitotic pathways include activation of epidermal growth factor receptor and Ras/Raf/mitogen-activated protein kinase signaling. Chronic inflammation results in inflammatory cell secretion of growth factors and cytokines such as tumor necrosis factor-α and interleukins, as well as production of reactive oxygen species, all of which can stimulate proliferation. Persistent activation of these pathways leads to tumor promotion

  6. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  7. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  8. Protective effect of indole-3-pyruvate against ultraviolet b-induced damage to cultured HaCaT keratinocytes and the skin of hairless mice.

    Directory of Open Access Journals (Sweden)

    Reiji Aoki

    Full Text Available Previous investigations demonstrated that pyruvate protects human keratinocytes against cell damage stemming from exposure to ultraviolet B (UVB radiation. This study endeavoured to elucidate the protective capacity of aromatic pyruvates (e.g., phenylpyruvate (PPyr, 4-hydroxyphenylpyruvate (HPPyr, and indole-3-pyruvate (IPyr against UVB-induced injury to skin cells, both in vitro and in vivo. Cultured human HaCaT keratinocytes were irradiated with UVB light (60 mJ/cm2 and maintained with or without test compounds (1-25 mM.In addition, the dorsal skin of hairless mice (HR-1 was treated with test compounds (10 μmol and exposed to UVB light (1 J/cm2 twice [corrected]. The ability of the test compounds to ameliorate UVB-induced cytotoxicity and inflammation was then assessed. Aromatic pyruvates reduced cytotoxicity in UVB-irradiated HaCaT keratinocytes, and also diminished the expression of interleukin 1β (IL-1β and interleukin 6 (IL-6. IPyr was more efficacious than either PPyr or HPPyr. Furthermore, only IPyr inhibited cyclooxygenase-2 (Cox-2 expression at both the mRNA and the protein level in UVB-treated keratinocytes. Topical application of IPyr to the dorsal skin of hairless mice reduced the severity of UVB-induced skin lesions, the augmentation of dermal thickness, and transepithelial water loss. Overproduction of IL-1β and IL-6 in response to UVB radiation was also suppressed in vivo by the topical administration of IPyr. These data strongly suggest that IPyr might find utility as a UVB-blocking reagent in therapeutic strategies to lessen UVB-induced inflammatory skin damage.

  9. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  10. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2018-03-01

    Full Text Available Environmental exposure to solar ultraviolet (UV radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana. Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches.

  11. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  12. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    Energy Technology Data Exchange (ETDEWEB)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C. [Athens Univ. (Greece). School of Medicine

    1996-06-28

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 {+-} 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK).

  13. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    Deliconstantinos, G.; Villiotou, V.; Stavrides, J.C.

    1996-01-01

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  14. cFLIP Regulates Skin Homeostasis and Protects against TNF-Induced Keratinocyte Apoptosis

    Directory of Open Access Journals (Sweden)

    Diana Panayotova-Dimitrova

    2013-10-01

    Full Text Available FADD, caspase-8, and cFLIP regulate the outcome of cell death signaling. Mice that constitutively lack these molecules die at an early embryonic age, whereas tissue-specific constitutive deletion of FADD or caspase-8 results in inflammatory skin disease caused by increased necroptosis. The function of cFLIP in the skin in vivo is unknown. In contrast to tissue-specific caspase-8 knockout, we show that mice constitutively lacking cFLIP in the epidermis die around embryonic days 10 and 11. When cFLIP expression was abrogated in adult skin of cFLIPfl/fl-K14CreERtam mice, severe inflammation of the skin with concomitant caspase activation and apoptotic, but not necroptotic, cell death developed. Apoptosis was dependent of autocrine tumor necrosis factor production triggered by loss of cFLIP. In addition, epidermal cFLIP protein was lost in patients with severe drug reactions associated with epidermal apoptosis. Our data demonstrate the importance of cFLIP for the integrity of the epidermis and for silencing of spontaneous skin inflammation.

  15. Oncogenic Radiation Abscopal Effects In Vivo: Interrogating Mouse Skin

    Energy Technology Data Exchange (ETDEWEB)

    Mancuso, Mariateresa, E-mail: mariateresa.mancuso@enea.it [Laboratory of Radiation Biology and Biomedicine, Agenzia Nazionale per le Nuove Tecnologie, l' Energia e lo Sviluppo Economico Sostenibile (ENEA), Casaccia Research Centre, Rome (Italy); Leonardi, Simona [Laboratory of Radiation Biology and Biomedicine, Agenzia Nazionale per le Nuove Tecnologie, l' Energia e lo Sviluppo Economico Sostenibile (ENEA), Casaccia Research Centre, Rome (Italy); Giardullo, Paola; Pasquali, Emanuela [Department of Radiation Physics, Guglielmo Marconi University, Rome (Italy); Tanori, Mirella [Laboratory of Radiation Biology and Biomedicine, Agenzia Nazionale per le Nuove Tecnologie, l' Energia e lo Sviluppo Economico Sostenibile (ENEA), Casaccia Research Centre, Rome (Italy); De Stefano, Ilaria [Department of Radiation Physics, Guglielmo Marconi University, Rome (Italy); Casciati, Arianna [Laboratory of Radiation Biology and Biomedicine, Agenzia Nazionale per le Nuove Tecnologie, l' Energia e lo Sviluppo Economico Sostenibile (ENEA), Casaccia Research Centre, Rome (Italy); Naus, Christian C. [Department of Cellular and Physiological Sciences, The Life Sciences Institute, University of British Columbia, Vancouver, British Columbia (Canada); Pazzaglia, Simonetta; Saran, Anna [Laboratory of Radiation Biology and Biomedicine, Agenzia Nazionale per le Nuove Tecnologie, l' Energia e lo Sviluppo Economico Sostenibile (ENEA), Casaccia Research Centre, Rome (Italy)

    2013-08-01

    Purpose: To investigate the tissue dependence in transmission of abscopal radiation signals and their oncogenic consequences in a radiosensitive mouse model and to explore the involvement of gap junction intercellular communication (GJIC) in mediating radiation tumorigenesis in off-target mouse skin. Methods and Materials: Patched1 heterozygous (Ptch1{sup +/−}) mice were irradiated at postnatal day 2 (P2) with 10 Gy of x-rays. Individual lead cylinders were used to protect the anterior two-thirds of the body, whereas the hindmost part was directly exposed to radiation. To test the role of GJICs and their major constituent connexin43 (Cx43), crosses between Ptch1{sup +/−} and Cx43{sup +/−} mice were similarly irradiated. These mouse groups were monitored for their lifetime, and skin basal cell carcinomas (BCCs) were counted and recorded. Early responses to DNA damage - Double Strand Breaks (DSBs) and apoptosis - were also evaluated in shielded and directly irradiated skin areas. Results: We report abscopal tumor induction in the shielded skin of Ptch1{sup +/−} mice after partial-body irradiation. Endpoints were induction of early nodular BCC-like tumors and macroscopic infiltrative BCCs. Abscopal tumorigenesis was significantly modulated by Cx43 status, namely, Cx43 reduction was associated with decreased levels of DNA damage and oncogenesis in out-of-field skin, suggesting a key role of GJIC in transmission of oncogenic radiation signals to unhit skin. Conclusions: Our results further characterize the nature of abscopal responses and the implications they have on pathologic processes in different tissues, including their possible underlying mechanistic bases.

  16. Oncogenic Radiation Abscopal Effects In Vivo: Interrogating Mouse Skin

    International Nuclear Information System (INIS)

    Mancuso, Mariateresa; Leonardi, Simona; Giardullo, Paola; Pasquali, Emanuela; Tanori, Mirella; De Stefano, Ilaria; Casciati, Arianna; Naus, Christian C.; Pazzaglia, Simonetta; Saran, Anna

    2013-01-01

    Purpose: To investigate the tissue dependence in transmission of abscopal radiation signals and their oncogenic consequences in a radiosensitive mouse model and to explore the involvement of gap junction intercellular communication (GJIC) in mediating radiation tumorigenesis in off-target mouse skin. Methods and Materials: Patched1 heterozygous (Ptch1 +/− ) mice were irradiated at postnatal day 2 (P2) with 10 Gy of x-rays. Individual lead cylinders were used to protect the anterior two-thirds of the body, whereas the hindmost part was directly exposed to radiation. To test the role of GJICs and their major constituent connexin43 (Cx43), crosses between Ptch1 +/− and Cx43 +/− mice were similarly irradiated. These mouse groups were monitored for their lifetime, and skin basal cell carcinomas (BCCs) were counted and recorded. Early responses to DNA damage - Double Strand Breaks (DSBs) and apoptosis - were also evaluated in shielded and directly irradiated skin areas. Results: We report abscopal tumor induction in the shielded skin of Ptch1 +/− mice after partial-body irradiation. Endpoints were induction of early nodular BCC-like tumors and macroscopic infiltrative BCCs. Abscopal tumorigenesis was significantly modulated by Cx43 status, namely, Cx43 reduction was associated with decreased levels of DNA damage and oncogenesis in out-of-field skin, suggesting a key role of GJIC in transmission of oncogenic radiation signals to unhit skin. Conclusions: Our results further characterize the nature of abscopal responses and the implications they have on pathologic processes in different tissues, including their possible underlying mechanistic bases

  17. Oxidative stress drives CD8+ T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  18. Mesenchymal stem cells ameliorate impaired wound healing through enhancing keratinocyte functions in diabetic foot ulcerations on the plantar skin of rats.

    Science.gov (United States)

    Kato, Jiro; Kamiya, Hideki; Himeno, Tatsuhito; Shibata, Taiga; Kondo, Masaki; Okawa, Tetsuji; Fujiya, Atsushi; Fukami, Ayako; Uenishi, Eita; Seino, Yusuke; Tsunekawa, Shin; Hamada, Yoji; Naruse, Keiko; Oiso, Yutaka; Nakamura, Jiro

    2014-01-01

    Although the initial healing stage involves a re-epithelialization in humans, diabetic foot ulceration (DFU) has been investigated using rodent models with wounds on the thigh skin, in which a wound contraction is initiated. In this study, we established a rodent model of DFU on the plantar skin and evaluated the therapeutic efficacy of bone-marrow-derived mesenchymal stem cells (BM-MSCs) in this model. The wounds made on the hind paws or thighs of streptozotocin induced diabetic or control rats were treated with BM-MSCs. Expression levels of phosphorylated focal adhesion kinase (pFAK), matrix metaroprotease (MMP)-2, EGF, and IGF-1, were evaluated in human keratinocytes, which were cultured in conditioned media of BM-MSCs (MSC-CM) with high glucose levels. Re-epithelialization initiated the healing process on the plantar, but not on the thigh, skin. The therapy utilizing BM-MSCs ameliorated the delayed healing in diabetic rats. In the keratinocytes cultured with MSC-CM, the decreased pFAK levels in the high glucose condition were restored, and the MMP2, EGF, and IGF-1 levels increased. Our study established a novel rat DFU model. The impaired healing process in diabetic rats was ameliorated by transplantation of BM-MSCs. This amelioration might be accounted for by the modification of keratinocyte functions. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  20. Chemosensory Information Processing between Keratinocytes and Trigeminal Neurons

    Science.gov (United States)

    Sondersorg, Anna Christina; Busse, Daniela; Kyereme, Jessica; Rothermel, Markus; Neufang, Gitta; Gisselmann, Günter; Hatt, Hanns; Conrad, Heike

    2014-01-01

    Trigeminal fibers terminate within the facial mucosa and skin and transmit tactile, proprioceptive, chemical, and nociceptive sensations. Trigeminal sensations can arise from the direct stimulation of intraepithelial free nerve endings or indirectly through information transmission from adjacent cells at the peripheral innervation area. For mechanical and thermal cues, communication processes between skin cells and somatosensory neurons have already been suggested. High concentrations of most odors typically provoke trigeminal sensations in vivo but surprisingly fail to activate trigeminal neuron monocultures. This fact favors the hypothesis that epithelial cells may participate in chemodetection and subsequently transmit signals to neighboring trigeminal fibers. Keratinocytes, the major cell type of the epidermis, express various receptors that enable reactions to multiple environmental stimuli. Here, using a co-culture approach, we show for the first time that exposure to the odorant chemicals induces a chemical communication between human HaCaT keratinocytes and mouse trigeminal neurons. Moreover, a supernatant analysis of stimulated keratinocytes and subsequent blocking experiments with pyrodoxalphosphate-6-azophenyl-2′,4′-disulfonate revealed that ATP serves as the mediating transmitter molecule released from skin cells after odor stimulation. We show that the ATP release resulting from Javanol® stimulation of keratinocytes was mediated by pannexins. Consequently, keratinocytes act as chemosensors linking the environment and the trigeminal system via ATP signaling. PMID:24790106

  1. Growth regulation in X-irradiated mouse skin

    International Nuclear Information System (INIS)

    Elgjo, K.; Devik, F.

    1978-01-01

    Extracts of hairless mouse skin were tested for their content of epidermal G 1 inhibitor and G 2 inhibitor at daily intervals after X-irradiation with 4 500 or 2 250 rad. After either dose the skin extracts lacked G 1 inhibitory activity on days 5 and 6 respectively after irradiation. This coincided with the time when the epidermal mitotic rate again became normal and started a period of over-shoot. The time interval of 5 to 6 days corresponds to the turnover time of the differentiating cells in hairless mouse back epidermis. The findings indicate that the proliferating cells in epidermis can respond to changes in local chalone concentration, even after X-irradiation at the tested doses, and that the irradiated epidermal cell population still retains some important properties inherent in a cybernetically regulated system. The local G 2 -inhibitory activity also varied after irradiation, but these variations could not be directly related to the corresponding mitotic rates. (author)

  2. Differential role of basal keratinocytes in UV-induced immunosuppression and skin cancer

    NARCIS (Netherlands)

    J. Jans (Judith); G.A. Garinis (George); W. Schul; A. van Oudenaren (Adri); M.J. Moorhouse (Michael); M. Smid (Marcel); Y.-G. Sert (Yurda-Gul); A. van der Velde (Albertina); Y.M. Rijksen (Yvonne); F.R. de Gruijl (Frank); P.J. van der Spek (Peter); A. Yasui (Akira); J.H.J. Hoeijmakers (Jan); P.J. Leenen (Pieter); G.T.J. van der Horst (Gijsbertus)

    2006-01-01

    textabstractCyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4PPs) comprise major UV-induced photolesions. If left unrepaired, these lesions can induce mutations and skin cancer, which is facilitated by UV-induced immunosuppression. Yet the contribution of lesion and cell type

  3. Metabolism of skin-absorbed resveratrol into its glucuronized form in mouse skin.

    Directory of Open Access Journals (Sweden)

    Itsuo Murakami

    Full Text Available Resveratrol (RESV is a plant polyphenol, which is thought to have beneficial metabolic effects in laboratory animals as well as in humans. Following oral administration, RESV is immediately catabolized, resulting in low bioavailability. This study compared RESV metabolites and their tissue distribution after oral uptake and skin absorption. Metabolomic analysis of various mouse tissues revealed that RESV can be absorbed and metabolized through skin. We detected sulfated and glucuronidated RESV metabolites, as well as dihydroresveratrol. These metabolites are thought to have lower pharmacological activity than RESV. Similar quantities of most RESV metabolites were observed 4 h after oral or skin administration, except that glucuronidated RESV metabolites were more abundant in skin after topical RESV application than after oral administration. This result is consistent with our finding of glucuronidated RESV metabolites in cultured skin cells. RESV applied to mouse ears significantly suppressed inflammation in the TPA inflammation model. The skin absorption route could be a complementary, potent way to achieve therapeutic effects with RESV.

  4. Differential responses of cells from human skin keratinocyte and bovine mammary epithelium to attack by pore-forming Staphylococcus aureus alpha-toxin.

    Science.gov (United States)

    Suriyaphol, Gunnaporn; Sarikaputi, Meena; Suriyaphol, Prapat

    2009-11-01

    Human skin keratinocytes HaCat attacked by Staphylococcus aureus alpha-toxin showed a transient drop of cellular ATP levels whereas in toxin-perforated bovine mammary epithelial cells (BMEC), the ATP levels dropped more slowly. Morphologically, during the ATP level depletion, HaCat cell developed a spacious intracellular vacuole together with the transient influx of trypan blue. WST-1 signal, which tested the function of mitochondrial enzyme in viable cells, also decreased concomitantly. On the other hand, BMEC excluded trypan blue and vacuolation was not observed throughout the experiment. We conclude that mammary epithelial cells resist the toxin better than keratinocytes. This is the first report showing that alpha-toxin enhances transient membrane permeability to large molecules, temporary vacuole formation and the transient defect of mitochondrial enzyme in viable cells without cell lysis.

  5. Filaggrin-dependent secretion of sphingomyelinase protects against staphylococcal α-toxin-induced keratinocyte death.

    Science.gov (United States)

    Brauweiler, Anne M; Bin, Lianghua; Kim, Byung Eui; Oyoshi, Michiko K; Geha, Raif S; Goleva, Elena; Leung, Donald Y M

    2013-02-01

    The skin of patients with atopic dermatitis (AD) has defects in keratinocyte differentiation, particularly in expression of the epidermal barrier protein filaggrin. AD skin lesions are often exacerbated by Staphylococcus aureus-mediated secretion of the virulence factor α-toxin. It is unknown whether lack of keratinocyte differentiation predisposes to enhanced lethality from staphylococcal toxins. We investigated whether keratinocyte differentiation and filaggrin expression protect against cell death induced by staphylococcal α-toxin. Filaggrin-deficient primary keratinocytes were generated through small interfering RNA gene knockdown. RNA expression was determined by using real-time PCR. Cell death was determined by using the lactate dehydrogenase assay. Keratinocyte cell survival in filaggrin-deficient (ft/ft) mouse skin biopsies was determined based on Keratin 5 staining. α-Toxin heptamer formation and acid sphingomyelinase expression were determined by means of immunoblotting. We found that filaggrin expression, occurring as the result of keratinocyte differentiation, significantly inhibits staphylococcal α-toxin-mediated pathogenicity. Furthermore, filaggrin plays a crucial role in protecting cells by mediating the secretion of sphingomyelinase, an enzyme that reduces the number of α-toxin binding sites on the keratinocyte surface. Finally, we determined that sphingomyelinase enzymatic activity directly prevents α-toxin binding and protects keratinocytes against α-toxin-induced cytotoxicity. The current study introduces the novel concept that S aureus α-toxin preferentially targets and destroys filaggrin-deficient keratinocytes. It also provides a mechanism to explain the increased propensity for S aureus-mediated exacerbation of AD skin disease. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  6. Analysis of a Mouse Skin Model of Tuberous Sclerosis Complex.

    Directory of Open Access Journals (Sweden)

    Yanan Guo

    Full Text Available Tuberous Sclerosis Complex (TSC is an autosomal dominant tumor suppressor gene syndrome in which patients develop several types of tumors, including facial angiofibroma, subungual fibroma, Shagreen patch, angiomyolipomas, and lymphangioleiomyomatosis. It is due to inactivating mutations in TSC1 or TSC2. We sought to generate a mouse model of one or more of these tumor types by targeting deletion of the Tsc1 gene to fibroblasts using the Fsp-Cre allele. Mutant, Tsc1ccFsp-Cre+ mice survived a median of nearly a year, and developed tumors in multiple sites but did not develop angiomyolipoma or lymphangioleiomyomatosis. They did develop a prominent skin phenotype with marked thickening of the dermis with accumulation of mast cells, that was minimally responsive to systemic rapamycin therapy, and was quite different from the pathology seen in human TSC skin lesions. Recombination and loss of Tsc1 was demonstrated in skin fibroblasts in vivo and in cultured skin fibroblasts. Loss of Tsc1 in fibroblasts in mice does not lead to a model of angiomyolipoma or lymphangioleiomyomatosis.

  7. Varying the morphology of silver nanoparticles results in differential toxicity against micro-organisms, HaCaT keratinocytes and affects skin deposition.

    Science.gov (United States)

    Holmes, Amy M; Lim, Julian; Studier, Hauke; Roberts, Michael S

    2016-12-01

    The use of silver nanoparticles (Ag NPs) within the healthcare sector and consumer products is rapidly increasing. There are now a range of diverse-shaped Ag NPs that are commercially available and many of the products containing nanosilver are topically applied to human skin. Currently, there is limited data on the extent to which the antimicrobial efficacy and cytotoxicity of Ag NPs is related to their shape and how the shape of the Ag NPs affects their distribution in both intact and burn wounded human skin after topical application. In this study, we related the relative Ag NP cytotoxicity to potential skin pathogens and HaCaT keratinocytes in vitro with the shape of the Ag NPs. We employed multiphoton fluorescence lifetime imaging to map the distribution of the native and unlabeled Ag NPs after topical application to both intact and burn wounded human skin using the localized surface plasmon resonance signal of the Ag NPs. Truncated plate shaped Ag NPs led to the highest cytotoxicity against both bacteria (IC 50 ranges from 31.25 to 125 μg/mL depending on the bacterial species) and HaCaT keratinocytes (IC 50 78.65 μg/mL [95%CI 63.88, 96.83]) thus both with similar orders of magnitude. All Ag NPs were less cytotoxic than solutions of silver nitrate (IC 50 of 7.85 μg/mL [95%CI 1.49, 14.69]). Plate-shaped Ag NPs displayed the highest substantivity within the superficial layers of the stratum corneum when topically applied to intact skin and the highest deposition into the wound bed when applied to burned ex vivo human skin relative to other Ag NP shapes.

  8. Radical Scavenging Activity-Based and AP-1-Targeted Anti-Inflammatory Effects of Lutein in Macrophage-Like and Skin Keratinocytic Cells

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2013-01-01

    Full Text Available Lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. Although the anti-inflammatory effects of lutein have previously been described, the mechanism of its anti-inflammatory action has not been fully elucidated. Therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin-derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. Lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(IL- 6 from LPS-treated macrophages, upregulation of cyclooxygenase-(COX- 2 from interferon-γ/tumor necrosis-factor-(TNF- α-treated HaCaT cells, and the enhancement of matrix-metallopeptidase-(MMP- 9 level in UV-irradiated keratinocytes. By evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox-sensitive AP-1 pathway by suppressing the activation of p38 and c-Jun-N-terminal kinase (JNK. Evaluation of the radical and ROS scavenging activities further revealed that lutein was able to act as a strong anti-oxidant. Taken together, our findings strongly suggest that lutein-mediated AP-1 suppression and anti-inflammatory activity are the result of its strong antioxidative and p38/JNK inhibitory activities. These findings can be applied for the preparation of anti-inflammatory and cosmetic remedies for inflammatory diseases of the skin.

  9. Two-tiered keratinocyte assay: IL-18 production by NCTC2544 cells to determine the skin sensitizing capacity and an epidermal equivalent assay to determine sensitizer potency

    DEFF Research Database (Denmark)

    Teunis, Marc; Corsini, Emanuela; Smits, Mieke

    2012-01-01

    the use of animals. The aim of the EU FP6 Integrated Project Sens-it-iv was to develop and optimize an integrated testing strategy consisting of in vitro, human cell based assays which will closely mimic sensitization mechanisms in vivo. These assays should be an alternative approach to the LLNA. The NCTC...... method to the LLNA. Both assays are based on the use of human keratinocytes, which have been shown, over the last two decades, to play a key role in all phases of skin sensitization. First, 4 known chemicals were tested during a transferability study in which 6 laboratories participated. Three...

  10. Evaluation of seven sunscreens on hairless mouse skin

    International Nuclear Information System (INIS)

    Walter, J.F.

    1981-01-01

    The ability of seven sunscreens to protect against ultraviolet (UV)--induced inhibition of epidermal DNA synthesis was evaluated in vivo using a hairless mouse model. There were statistically significant differences among sunscreens in their ability to prevent UV-B (290 to 320 nm) inhibition of DNA synthesis. The protective factor (PF) of a sunscreen was arbitrarily defined as the ratio of the dose required to inhibit DNA synthesis by 50% with and without a sunscreen. The following PF values were determined: Coppertone 4, 4.4; Sundown Extra Protection, 8.4; Supershade 15, 21.0; Eclipse 15, 22.2; Blockout 15, 22.4; and Bain de Soleil 15, 27.6. Zinc oxide ointment protected against any significant suppression of DNA synthesis at all UV-B doses used. There was a relatively good correlation between the PF and the sun protection factor (SPF) claimed for each sunscreen by the manufacturer. However, the PF values determined in mouse skin were generally higher than the SPF values measured in human skin. Further studies are needed to determine if sunscreen substantivity (resistance to removal by water) can be evaluated by this technique

  11. Xenobiotica-metabolizing enzymes in the skin of rat, mouse, pig, guinea pig, man, and in human skin models.

    Science.gov (United States)

    Oesch, F; Fabian, E; Landsiedel, Robert

    2018-06-18

    -metabolite-reducing XME in primary human keratinocytes and several reconstructed human skin models appear reasonably close to human skin. For a more detailed delineation and discussion of the severe limitations see the Conclusions section in the end of this review.

  12. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21)NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Science.gov (United States)

    Di Grazia, Antonio; Cappiello, Floriana; Imanishi, Akiko; Mastrofrancesco, Arianna; Picardo, Mauro; Paus, Ralf; Mangoni, Maria Luisa

    2015-01-01

    One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs) produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21)NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells) over a wide range of peptide concentrations (0.025-4 μM), and this notably more efficiently than human cathelicidin (LL-37). This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21)NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21)NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  13. The Frog Skin-Derived Antimicrobial Peptide Esculentin-1a(1-21NH2 Promotes the Migration of Human HaCaT Keratinocytes in an EGF Receptor-Dependent Manner: A Novel Promoter of Human Skin Wound Healing?

    Directory of Open Access Journals (Sweden)

    Antonio Di Grazia

    Full Text Available One of the many functions of skin is to protect the organism against a wide range of pathogens. Antimicrobial peptides (AMPs produced by the skin epithelium provide an effective chemical shield against microbial pathogens. However, whereas antibacterial/antifungal activities of AMPs have been extensively characterized, much less is known regarding their wound healing-modulatory properties. By using an in vitro re-epithelialisation assay employing special cell-culture inserts, we detected that a derivative of the frog-skin AMP esculentin-1a, named esculentin-1a(1-21NH2, significantly stimulates migration of immortalized human keratinocytes (HaCaT cells over a wide range of peptide concentrations (0.025-4 μM, and this notably more efficiently than human cathelicidin (LL-37. This activity is preserved in primary human epidermal keratinocytes. By using appropriate inhibitors and an enzyme-linked immunosorbent assay we found that the peptide-induced cell migration involves activation of the epidermal growth factor receptor and STAT3 protein. These results suggest that esculentin-1a(1-21NH2 now deserves to be tested in standard wound healing assays as a novel candidate promoter of skin re-epithelialisation. The established ability of esculentin-1a(1-21NH2 to kill microbes without harming mammalian cells, namely its high anti-Pseudomonal activity, makes this AMP a particularly attractive candidate wound healing promoter, especially in the management of chronic, often Pseudomonas-infected, skin ulcers.

  14. Staphylococcus aureus keratinocyte invasion is mediated by integrin-linked kinase and Rac1.

    Science.gov (United States)

    Sayedyahossein, Samar; Xu, Stacey X; Rudkouskaya, Alena; McGavin, Martin J; McCormick, John K; Dagnino, Lina

    2015-02-01

    Staphylococcus aureus is a major component of the skin microbiota and causes a large number of serious infections. S. aureus first interacts with epidermal keratinocytes to breach the epidermal barrier through mechanisms not fully understood. By use of primary keratinocytes from mice with epidermis-restricted Ilk gene inactivation and control integrin-linked kinase (ILK)-expressing littermates, we investigated the role of ILK in epidermal S. aureus invasion. Heat-killed, but not live, bacteria were internalized to Rab5- and Rab7-positive phagosomes, and incubation with keratinocyte growth factor increased their uptake 2.5-fold. ILK-deficient mouse keratinocytes internalized bacteria 2- to 4-fold less efficiently than normal cells. The reduced invasion by live S. aureus of ILK-deficient cells was restored in the presence of exogenous, constitutively active Rac1. Thus, Rac1 functions downstream from ILK during invasion. Further, invasion by S. aureus of Rac1-deficient cells was 2.5-fold lower than in normal cells. Paradoxically, staphylococcal cutaneous penetration of mouse skin explants with ILK-deficient epidermis was 35-fold higher than that of normal skin, indicating defects in epidermal barrier function in the absence of ILK. Thus, we identified an ILK-Rac1 pathway essential for bacterial invasion of keratinocytes, and established ILK as a key contributor to prevent invasive staphylococcal cutaneous infection. © FASEB.

  15. Regulation of Hsp27 and Hsp70 expression in human and mouse skin construct models by caveolae following exposure to the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide

    International Nuclear Information System (INIS)

    Black, Adrienne T.; Hayden, Patrick J.; Casillas, Robert P.; Heck, Diane E.; Gerecke, Donald R.; Sinko, Patrick J.; Laskin, Debra L.; Laskin, Jeffrey D.

    2011-01-01

    Dermal exposure to the vesicant sulfur mustard causes marked inflammation and tissue damage. Basal keratinocytes appear to be a major target of sulfur mustard. In the present studies, mechanisms mediating skin toxicity were examined using a mouse skin construct model and a full-thickness human skin equivalent (EpiDerm-FT TM ). In both systems, administration of the model sulfur mustard vesicant, 2-chloroethyl ethyl sulfide (CEES, 100-1000 μM) at the air surface induced mRNA and protein expression of heat shock proteins 27 and 70 (Hsp27 and Hsp70). CEES treatment also resulted in increased expression of caveolin-1, the major structural component of caveolae. Immunohistochemistry revealed that Hsp27, Hsp70 and caveolin-1 were localized in basal and suprabasal layers of the epidermis. Caveolin-1 was also detected in fibroblasts in the dermal component of the full thickness human skin equivalent. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that Hsp27 and Hsp70 were localized in caveolae. Treatment of mouse keratinocytes with filipin III or methyl-β-cyclodextrin, which disrupt caveolar structure, markedly suppressed CEES-induced Hsp27 and Hsp70 mRNA and protein expression. CEES treatment is known to activate JNK and p38 MAP kinases; in mouse keratinocytes, inhibition of these enzymes suppressed CEES-induced expression of Hsp27 and Hsp70. These data suggest that MAP kinases regulate Hsp 27 and Hsp70; moreover, caveolae-mediated regulation of heat shock protein expression may be important in the pathophysiology of vesicant-induced skin toxicity.

  16. EPR detection of free radicals in UV-irradiated skin: mouse versus human

    International Nuclear Information System (INIS)

    Jurkiewicz, B.A.; Buettner, G.R.

    1996-01-01

    Ultraviolet radiation produces free radicals in Skh-1 mouse skin, contributing to photoaging and carcinogenesis. If a mouse model is a general indicator of free radical processes in human skin photobiology, then radical production observed in mouse and human skin should be directly comparative. In this work we show that UV radiation (λ > 300 nm, 14 μW/cm 2 UVB; 3.5 mW/cm 2 UVA) increases the ascorbate free radical (Asc) electron paramagnetic resonance (EPR) signal in both Skh-1 mouse skin (45%) and human facial skin biopsies (340%). Visible light (λ > 400 nm; 0.23 mW/cm 2 UVA) also increased the Ascsignal in human skin samples (45%) but did not increase baseline mouse Asc, indicating that human skin is more susceptible to free radical formation and that a chromophore for visible light may be present. Using EPR spin-trapping techniques, UV radiation produced spin adducts consistent with trapping lipid alkyl radicals in mouse skin (α-[4-pyridyl 1-oxide]-N-tert-butyl nitrone/alkyl radical adduct; a N = 15.56 G and a H 2.70 G) and lipid alkoxyl radicals in human skin (5,5-dimethylpyrroline -1-oxide/alkoxyl radical adduct; a N = 14.54 G and a H = 16.0 G). Topical application of the iron chelator Desferal to human skin significantly decreases these radicals (∼50%), indicating a role for iron in lipid peroxidation. (Author)

  17. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin

    Science.gov (United States)

    Cai, Qing; Ren, Qu; Wei, Lizhao

    2015-01-01

    Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25–3.12 μM) has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes. PMID:26382065

  18. Red Light Combined with Blue Light Irradiation Regulates Proliferation and Apoptosis in Skin Keratinocytes in Combination with Low Concentrations of Curcumin.

    Directory of Open Access Journals (Sweden)

    Tianhui Niu

    Full Text Available Curcumin is a widely known natural phytochemical from plant Curcuma longa. In recent years, curcumin has received increasing attention because of its capability to induce apoptosis and inhibit cell proliferation as well as its anti-inflammatory properties in different cancer cells. However, the therapeutic benefits of curcumin are severely hampered due to its particularly low absorption via trans-dermal or oral bioavailability. Phototherapy with visible light is gaining more and more support in dermatological therapy. Red light is part of the visible light spectrum, which is able to deeply penetrate the skin to about 6 mm, and directly affect the fibroblast of the skin dermis. Blue light is UV-free irradiation which is fit for treating chronic inflammation diseases. In this study, we show that curcumin at low concentrations (1.25-3.12 μM has a strong anti-proliferative effect on TNF-α-induced psoriasis-like inflammation when applied in combination with light-emitting-diode devices. The treatment was especially effective when LED blue light at 405 nm was combined with red light at 630 or 660 nm, which markedly amplified the anti-proliferative and apoptosis-inducing effects of curcumin. The experimental results demonstrated that this treatment reduced the viability of human skin keratinocytes, decreased cell proliferation, induced apoptosis, inhibited NF-κB activity and activated caspase-8 and caspase-9 while preserving the cell membrane integrity. Moreover, the combined treatment also down-regulated the phosphorylation level of Akt and ERK. Taken together, our results indicated that the combination of curcumin with LED blue light united red light irradiation can attain a higher efficiency of regulating proliferation and apoptosis in skin keratinocytes.

  19. Modulation of keratinocyte expression of antioxidants by 4-hydroxynonenal, a lipid peroxidation end product

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Ruijin [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Heck, Diane E. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Mishin, Vladimir; Black, Adrienne T. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Shakarjian, Michael P. [Environmental Health Science, New York Medical College, Valhalla, NY (United States); Kong, Ah-Ng Tony; Laskin, Debra L. [Pharmacology and Toxicology and Pharmaceutics, Ernest Mario School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Laskin, Jeffrey D., E-mail: jlaskin@eohsi.rutgers.edu [Environmental and Occupational Medicine, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ (United States)

    2014-03-01

    4-Hydroxynonenal (4-HNE) is a lipid peroxidation end product generated in response to oxidative stress in the skin. Keratinocytes contain an array of antioxidant enzymes which protect against oxidative stress. In these studies, we characterized 4-HNE-induced changes in antioxidant expression in mouse keratinocytes. Treatment of primary mouse keratinocytes and PAM 212 keratinocytes with 4-HNE increased mRNA expression for heme oxygenase-1 (HO-1), catalase, NADPH:quinone oxidoreductase (NQO1) and glutathione S-transferase (GST) A1-2, GSTA3 and GSTA4. In both cell types, HO-1 was the most sensitive, increasing 86–98 fold within 6 h. Further characterization of the effects of 4-HNE on HO-1 demonstrated concentration- and time-dependent increases in mRNA and protein expression which were maximum after 6 h with 30 μM. 4-HNE stimulated keratinocyte Erk1/2, JNK and p38 MAP kinases, as well as PI3 kinase. Inhibition of these enzymes suppressed 4-HNE-induced HO-1 mRNA and protein expression. 4-HNE also activated Nrf2 by inducing its translocation to the nucleus. 4-HNE was markedly less effective in inducing HO-1 mRNA and protein in keratinocytes from Nrf2 −/− mice, when compared to wild type mice, indicating that Nrf2 also regulates 4-HNE-induced signaling. Western blot analysis of caveolar membrane fractions isolated by sucrose density centrifugation demonstrated that 4-HNE-induced HO-1 is localized in keratinocyte caveolae. Treatment of the cells with methyl-β-cyclodextrin, which disrupts caveolar structure, suppressed 4-HNE-induced HO-1. These findings indicate that 4-HNE modulates expression of antioxidant enzymes in keratinocytes, and that this can occur by different mechanisms. Changes in expression of keratinocyte antioxidants may be important in protecting the skin from oxidative stress. - Highlights: • Lipid peroxidation generates 4-hydroxynonenal, a reactive aldehyde. • 4-HNE induces antioxidant proteins in mouse keratinocytes. • Induction of

  20. Differential Activation of Human Keratinocytes by Leishmania Species Causing Localized or Disseminated Disease.

    Science.gov (United States)

    Scorza, Breanna M; Wacker, Mark A; Messingham, Kelly; Kim, Peter; Klingelhutz, Aloysius; Fairley, Janet; Wilson, Mary E

    2017-10-01

    All Leishmania species parasites are introduced into mammalian skin through a sand fly bite, but different species cause distinct clinical outcomes. Mouse studies suggest that early responses are critical determinants of subsequent adaptive immunity in leishmaniasis, yet few studies address the role of keratinocytes, the most abundant cell in the epidermis. We hypothesized that Leishmania infection causes keratinocytes to produce immunomodulatory factors that influence the outcome of infection. Incubation of primary or immortalized human keratinocytes with Leishmania infantum or Leishmania major, which cause visceral or cutaneous leishmaniasis, respectively, elicited dramatically different responses. Keratinocytes incubated with L. infantum significantly increased expression of proinflammatory genes for IL-6, IL-8, tumor necrosis factor, and IL-1B, whereas keratinocytes exposed to several L. major isolates did not. Furthermore, keratinocyte-monocyte co-incubation studies across a 4 µM semipermeable membrane suggested that L. infantum-exposed keratinocytes release soluble factors that enhance monocyte control of intracellular L. infantum replication (P Leishmania species that may affect the course of disease. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Mouse skin damages caused by fractionated irradiation with carbon ions

    Energy Technology Data Exchange (ETDEWEB)

    Ando, K; Chen, Y J; Ohira, C; Nojima, K; Ando, S; Kobayashi, N; Ohbuchi, T; Shimizu, W [Space and Particle Radiation Science Research Group, Chiba (Japan); Koike, S; Kanai, T [National Inst. of Radiological Sciences, Chiba (Japan). Div. of Accelerator Physics

    1997-09-01

    We have investigated carbon-dose responses of early and late skin damages after daily fractionations to the mouse leg. Depilated legs were irradiated with 7 different positions within 290 MeV/u carbon beams. Fractionation schedules were 1, 2, 4 and 8 daily fractions. Skin reaction was scored every other day for 32 days. Five highest scores in individual mice were averaged, and used as averaged peak reaction. The isoeffect doses to produce an averaged peak skin reaction of 3.0 (moist desquamation) on dose-response curves were calculated with 95% confidence limit. The isoeffect dose for control gamma rays constantly increased with an increase in the number of fraction. The isoeffect doses in low LET carbon ions of 14- and 20 keV/{mu}m also increased up to 4 fractions, but did not increase when 4 fractions increased to 8 fractions. The saturation of isoeffect dose was more prominently observed for 40 keV/{mu}m in such that the isoeffect doses did not change among 2, 4 and 8 fractions. The isoeffect doses for LET higher than 50 keV/{mu}m were smaller than those for lower LET. However, the isoeffect doses for 50-, 60-, 80- and 100 keV/{mu} steadily increased with an increase in the number of fraction and did not show any saturation up to 8 fractions. Relation between LET and RBE was linear for all fractionation schedules. The slope of regression line in 4 fractions was steepest, and significantly (P<0.05) different from that in 1 fraction. (orig.)

  2. Mouse skin damages caused by fractionated irradiation with carbon ions

    International Nuclear Information System (INIS)

    Ando, K.; Chen, Y.J.; Ohira, C.; Nojima, K.; Ando, S.; Kobayashi, N.; Ohbuchi, T.; Shimizu, W.; Koike, S.; Kanai, T.

    1997-01-01

    We have investigated carbon-dose responses of early and late skin damages after daily fractionations to the mouse leg. Depilated legs were irradiated with 7 different positions within 290 MeV/u carbon beams. Fractionation schedules were 1, 2, 4 and 8 daily fractions. Skin reaction was scored every other day for 32 days. Five highest scores in individual mice were averaged, and used as averaged peak reaction. The isoeffect doses to produce an averaged peak skin reaction of 3.0 (moist desquamation) on dose-response curves were calculated with 95% confidence limit. The isoeffect dose for control gamma rays constantly increased with an increase in the number of fraction. The isoeffect doses in low LET carbon ions of 14- and 20 keV/μm also increased up to 4 fractions, but did not increase when 4 fractions increased to 8 fractions. The saturation of isoeffect dose was more prominently observed for 40 keV/μm in such that the isoeffect doses did not change among 2, 4 and 8 fractions. The isoeffect doses for LET higher than 50 keV/μm were smaller than those for lower LET. However, the isoeffect doses for 50-, 60-, 80- and 100 keV/μ steadily increased with an increase in the number of fraction and did not show any saturation up to 8 fractions. Relation between LET and RBE was linear for all fractionation schedules. The slope of regression line in 4 fractions was steepest, and significantly (P<0.05) different from that in 1 fraction. (orig.)

  3. Ionizing Radiation Affects Gene Expression in Mouse Skin and Bone

    Science.gov (United States)

    Terada, Masahiro; Tahimic, Candice; Sowa, Marianne B.; Schreurs, Ann-Sofie; Shirazi-Fard, Yasaman; Alwood, Joshua; Globus, Ruth K.

    2017-01-01

    Future long-duration space exploration beyond low earth orbit will increase human exposure to space radiation and microgravity conditions as well as associated risks to skeletal health. In animal studies, radiation exposure (greater than 1 Gy) is associated with pathological changes in bone structure, enhanced bone resorption, reduced bone formation and decreased bone mineral density, which can lead to skeletal fragility. Definitive measurements and detection of bone loss typically require large and specialized equipment which can make their application to long duration space missions logistically challenging. Towards the goal of developing non-invasive and less complicated monitoring methods to predict astronauts' health during spaceflight, we examined whether radiation induced gene expression changes in skin may be predictive of the responses of skeletal tissue to radiation exposure. We examined oxidative stress and growth arrest pathways in mouse skin and long bones by measuring gene expression levels via quantitative polymerase chain reaction (qPCR) after exposure to total body irradiation (IR). To investigate the effects of irradiation on gene expression, we used skin and femora (cortical shaft) from the following treatment groups: control (normally loaded, sham-irradiated), and IR (0.5 Gy 56Fe 600 MeV/n and 0.5 Gy 1H 150 MeV/n), euthanized at one and 11 days post-irradiation (IR). To determine the extent of bone loss, tibiae were harvested and cancellous microarchitecture in the proximal tibia quantified ex vivo using microcomputed tomography (microCT). Statistical analysis was performed using Student's t-test. At one day post-IR, expression of FGF18 in skin was significantly greater (3.8X) than sham-irradiated controls, but did not differ at 11 days post IR. Expression levels of other genes associated with antioxidant response (Nfe2l2, FoxO3 and Sod1) and the cell cycle (Trp53, Cdkn1a, Gadd45g) did not significantly differ between the control and IR groups

  4. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    Science.gov (United States)

    ZHAO, HENGGUANG; LI, SHUANG; LUO, FULING; TAN, QIAN; LI, HUI; ZHOU, WEIKANG

    2015-01-01

    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  5. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  6. Modulation of accelerated repopulation in mouse skin during daily irradiation

    International Nuclear Information System (INIS)

    Trott, K.-R.; Shirazi, A.; Heasman, F.

    1999-01-01

    Background and purpose: The timing of acceleration of repopulation in the epidermis during daily irradiation is related to the development of skin erythema and epidermal hypoplasia. Therefore, the relationship between impairment of the epidermal barrier function, the dermal inflammatory response and epidermal hypoplasia with the acceleration of repopulation was investigated.Materials and purpose: Skin fields of approximately 1 cm 2 on the thighs of TUC mice were given five daily fractions of 3 Gy in each week followed by top-up doses at the end of the first, the second, or the third week to determine residual epidermal tolerance and to calculate repopulation rates in weeks 1, 2, or 3. Systemic modulation of repopulation was attempted by daily indomethacine during fractionated irradiation whereas tape stripping or UV-B exposure before the start of fractionated irradiation attempted local modulation. In parallel experiments, the water permeability coefficient of the epidermis was determined ex vivo by studying transepidermal transport of tritiated water.Results: Without modulation, no repopulation was found in the first week of daily fractionation but repopulation compensated 30% of the dose given in week two and 70% of the dose given in week three. Only tape stripping before the start of fractionated irradiation accelerated repopulation in week one. UV-B had no effect on repopulation although it stimulated proliferation as much as tape stripping. Indomethacin did not suppress acceleration of repopulation. A significant increase in transepidermal water loss was found but only after repopulation had already accelerated.Conclusions: Acceleration of repopulation in mouse epidermis during daily-fractionated irradiation is not related to the simultaneous development of an inflammatory response. Also, the loss of the epidermal barrier function is not involved in the development of the acceleration response, which rather seems to be triggered directly by the decreased

  7. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  8. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    Goebel, C.; Hewitt, N.J.; Kunze, G.; Wenker, M.; Hein, D.W.; Beck, H.; Skare, J.

    2009-01-01

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for K m and V max . In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  9. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  10. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  11. Photoeffects of near ultraviolet light upon a polycyclic aromatic hydrocarbon exposed to mouse skin microsomes

    International Nuclear Information System (INIS)

    Peirano, W.B.

    1991-01-01

    Near ultraviolet (UV) light has been reported to both enhance and inhibit the tumor incidence in mice dermally exposed to benzo(a)pyrene (BaP) or polycyclic aromatic hydrocarbon (PAH) mixtures. Near UV light interacts with PAHs producing a variety of oxygenated products such as phenols, endoperoxides and quinones. However, little is known about BaP products formed from near UV irradiation of BaP-exposed mouse skin. Therefore, 14 C-BaP was incubated with 3-methylcholanthrene (3-MC) induced C 3 H/HeJ and DBA/2J mouse skin microsomes with or without a 365 nm light source. The results indicated that the concurrent 365 nm light irradiation of induced mouse skin microsomes and BaP greatly enhanced the total conversion of BaP to its products, approximately 3-fold for the C 3 H/HeJ and approximately 7-fold for the DBA/2J mouse microsomes, compared to the induced mouse skin microsomes and BaP alone. HPLC analyses of organic extracts indicated a more than additive enhancement of the formation of most of the individual cochromatographed BaP metabolites due to the combined interaction of 365 nm light with BaP and skin microsomes. Similar interactions were observed using benz(a)anthracene (BaA) in this system. These data show that near UV light alters the metabolic profile of PAHs produced by mouse skin microsomes

  12. Thalidomide increases human keratinocyte migration and proliferation.

    Science.gov (United States)

    Nasca, M R; O'Toole, E A; Palicharla, P; West, D P; Woodley, D T

    1999-11-01

    Thalidomide is reported to have therapeutic utility in the treatment of pyoderma gangrenosum, Behçet's disease, aphthous ulcers, and skin wounds. We investigated the effect of thalidomide on human keratinocyte proliferation and migration, two early and critical events in the re-epithelialization of skin wounds. Thalidomide at concentrations less than 1 microM did not affect keratinocyte viability. Using a thymidine incorporation assay, we found that thalidomide, at therapeutic concentrations, induced more than a 2. 5-fold increase in the proliferative potential of the cells. Keratinocyte migration was assessed by two independent motility assays: a colloidal gold assay and an in vitro scratch assay. At optimal concentrations, thalidomide increased keratinocyte migration on a collagen matrix more than 2-fold in the colloidal gold assay and more than 3-fold in the scratch assay over control. Although pro-migratory, thalidomide did not alter the level of metalloproteinase-9 secreted into culture medium. Thalidomide did, however, induce a 2-4-fold increase in keratinocyte-derived interleukin-8, a pro-migratory cellular autocrine factor. Human keratinocyte migration and proliferation are essential for re-epithelialization of skin wounds. Interleukin-8 increases human keratinocyte migration and proliferation and is chemotactic for keratinocytes. Therefore, thalidomide may modulate keratinocyte proliferation and motility by a chemokine-dependent pathway.

  13. EGFR Activation and Ultraviolet Light‐Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Taghrid B. El-Abaseri

    2007-01-01

    Full Text Available The epidermal growth factor receptor (EGFR regulates the proliferation of keratinocytes through multiple mechanisms that differ depending on the localization of the cell within the skin. Ultraviolet (UV irradiation, the main etiologic factor in the development of skin cancer, also activates the receptor. In this review, we discuss how the UV-induced activation of EGFR regulates the response of the skin to UV. UV-induced EGFR activation increases keratinocyte proliferation, suppresses apoptosis, and augments and accelerates epidermal hyperplasia in response to UV. Pharmacological inhibition of the UV-induced activation of EGFR in a genetically initiated mouse skin tumorigenesis model suppresses tumorigenesis and the activation of mitogen-activated protein (MAP kinases and phosphatidyl inositol-3-kinase (PI3K/AKT signaling pathways. EGFR has pleiotropic, complex, and cell-type-specific functions in cutaneous keratinocytes; suggesting that the receptor is an appropriate target for the development of molecularly targeted therapies for skin cancer and other pathologies.

  14. Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.; Rissmann, R.; van der Coelen, D.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

    2009-01-01

    The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which

  15. Unscheduled DNA synthesis after β-irradiation of mouse skin in situ

    International Nuclear Information System (INIS)

    Ootsuyama, Akira; Tanooka, Hiroshi

    1986-01-01

    The skin of ICR mouse was irradiated with β-rays from 90 Sr- 90 Y with surface doses up to 30 krad. Unscheduled DNA synthesis (UDS) was measured by autoradiography after labeling the skin with radioactive thymidine using the forceps-clamping method. The level of UDS in epithelial cells of the skin was detected as an increasing function of radiation dose. Fibroblastic cells, compared with epithelial cells and hair follicle cells at the same depth of the skin, showed a lower level of UDS, indicating a lower DNA repair activity in fibroblasts. Cancer risk of the skin was discussed. (Auth.)

  16. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  17. Chronic ionizing radiation exposure as a tumor promoter in mouse skin

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Trivedi, A.

    1992-01-01

    We have tested a chronic exposure to 90 Y beta-radiation as a tumor promoter in mouse skin previously exposed to a chemical tumor initiator. Three different tests of radiation as a stage I tumor promoter, in skin subsequently given chemical stage II promotion, all indicated that the beta-radiation acted as a weak stage I skin tumor promoter. It showed no action as either a stage II or complete tumor promoter. (author)

  18. Histochemical Localization of Glutathione Dependent NBT-Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective Localization of the glutathione dependent Nitroblue tetrazolium (NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated. Methods The fresh frozen tissue sections (8m thickness) were prepared and incubated in medium containing NBT, reduced glutathione (GSH) and phosphate buffer. The staining for GSH was performed with mercury orange. Results  The activity of the NBT-reductase in mouse skin has been found to be localized in the areas rich in glutathione and actively proliferating area of the skin. Conclusion The activity of the NBT-reductase seems to be dependent on the glutathione contents.

  19. Leptin promotes wound healing in the skin.

    Directory of Open Access Journals (Sweden)

    Susumu Tadokoro

    Full Text Available Leptin, a 16 kDa anti-obesity hormone, exhibits various physiological properties. Interestingly, skin wound healing was proven to delay in leptin-deficient ob/ob mice. However, little is known on the mechanisms of this phenomenon. In this study, we attempted to elucidate a role of leptin in wound healing of skin.Immunohistochemical analysis was performed to confirm the expression of the leptin receptor (Ob-R in human and mouse skin. Leptin was topically administered to chemical wounds created in mouse back skin along with sustained-release absorbable hydrogel. The process of wound repair was histologically observed and the area of ulceration was measured over time. The effect of leptin on the proliferation, differentiation and migration of human epidermal keratinocytes was investigated.Ob-R was expressed in epidermal cells of human and mouse skin. Topical administration of leptin significantly promoted wound healing. Histological analysis showed more blood vessels in the dermal connective tissues in the leptin-treated group. The proliferation, differentiation/function and migration of human epidermal keratinocytes were enhanced by exogenous leptin.Topically administered leptin was proven to promote wound healing in the skin by accelerating proliferation, differentiation/function and migration of epidermal keratinocytes and enhancing angiogenesis around the wounded area. These results strongly suggest that topical administration of leptin may be useful as a treatment to promote wound healing in the skin.

  20. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  1. Bathing in carbon dioxide-enriched water alters protein expression in keratinocytes of skin tissue in rats

    Science.gov (United States)

    Kälsch, Julia; Pott, Leona L.; Takeda, Atsushi; Kumamoto, Hideo; Möllmann, Dorothe; Canbay, Ali; Sitek, Barbara; Baba, Hideo A.

    2017-04-01

    Beneficial effects of balneotherapy using naturally occurring carbonated water (CO2 enriched) have been known since the Middle Ages. Although this therapy is clinically applied for peripheral artery disease and skin disorder, the underlying mechanisms are not fully elucidated.

  2. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  3. A comparative study of spray keratinocytes and autologous meshed split-thickness skin graft in the treatment of acute burn injuries.

    Science.gov (United States)

    Sood, Rajiv; Roggy, David Edward; Zieger, Madeline Jane; Nazim, Muhammad; Hartman, Brett Colby; Gibbs, Jeff Thomas

    2015-02-01

    ReCell (Avita Medical, Northridge, CA) is an autologous cell harvesting (ACH) device that enables a thin split-thickness skin biopsy to be processed to produce a cell population that includes a mixed population of keratinocytes, melanocytes, Langerhans cells, and papillary dermal fibroblasts for immediate delivery via a spray applicator onto a prepared skin surface. In this Institutional Review Board-approved US Food and Drug Administration phase 2 study, the authors prospectively evaluated the treatment of partial-thickness burns in patients with two 320 cm2 areas, 1 area treated with the ACH device and the other with a meshed split-thickness skin graft (MSTSG) as a control. The authors compared the treatment areas for graft take, pigmentation, and color match to surrounding healthy tissue, scarring, and pain. In this preliminary study, 10 patients were treated with this protocol. Eight patients had 100% take to both treatment areas and 2 patients had significant non-take and graft loss attributable to underexcised wound beds and difficulty with the spray applicator. Pigmentation and color match ratings were identical at week 52 and the Modified Vancouver Scar Scale scores were comparable. One subject rated the autologous cell harvesting site as having a better appearance, while the remaining subjects rated their ACH and MSTSG sites' appearances as being comparable. In early follow-up visits, pain ratings were slightly elevated in the ACH group due to graft healing; however, in visits following week 2, pain ratings at the ACH and MSTSG sites were rated similarly by all patients. This preliminary report describes an early experience with the ACH device and the treatment of partial-thickness burn injuries. In this 10-patient series, patients benefitted from having a decreased donor site size and comparable outcomes with MSTSG treatment. While this preliminary underpowered study has provided positive results, there is a learning curve with choosing the proper wound

  4. Differential tumor biology effects of double-initiation in a mouse skin chemical carcinogenesis model comparing wild type versus protein kinase Cepsilon overexpression mice.

    Science.gov (United States)

    Li, Yafan; Wheeler, Deric L; Ananthaswamy, Honnavara N; Verma, Ajit K; Oberley, Terry D

    2007-12-01

    Our previous studies showed that protein kinase Cepsilon (PKCepsilon) verexpression in mouse skin resulted in metastatic squamous cell carcinoma (SCC) elicited by single 7,12-dimethylbenz(a)anthracene (DMBA)-initiation and 12-O-tetradecanoylphorbol-13-acetate (TPA)-promotion in the absence of preceding papilloma formation as is typically observed in wild type mice. The present study demonstrates that double-DMBA initiation modulates tumor incidence, multiplicity, and latency period in both wild type and PKCepsilon overexpression transgenic (PKCepsilon-Tg) mice. After 17 weeks (wks) of tumor promotion, a reduction in papilloma multiplicity was observed in double- versus single-DMBA initiated wild type mice. Papilloma multiplicity was inversely correlated with cell death indices of interfollicular keratinocytes, indicating decreased papilloma formation was caused by increased cell death and suggesting the origin of papillomas is in interfollicular epidermis. Double-initiated PKCepsilon-Tg mice had accelerated carcinoma formation and cancer incidence in comparison to single-initiated PKCepsilon-Tg mice. Morphologic analysis of mouse skin following double initiation and tumor promotion showed a similar if not identical series of events to those previously observed following single initiation and tumor promotion: putative preneoplastic cells were observed arising from hyperplastic hair follicles (HFs) with subsequent cancer cell infiltration into the dermis. Single-initiated PKCepsilon-Tg mice exhibited increased mitosis in epidermal cells of HFs during tumor promotion.

  5. RhoA is dispensable for skin development, but crucial for contraction and directed migration of keratinocytes

    DEFF Research Database (Denmark)

    Jackson, Ben; Peyrollier, Karine; Pedersen, Esben

    2011-01-01

    RhoA is a small guanosine-5'-triphosphatase (GTPase) suggested to be essential for cytokinesis, stress fiber formation, and epithelial cell-cell contacts. In skin, loss of RhoA was suggested to underlie pemphigus skin blistering. To analyze RhoA function in vivo, we generated mice with a keratino......RhoA is a small guanosine-5'-triphosphatase (GTPase) suggested to be essential for cytokinesis, stress fiber formation, and epithelial cell-cell contacts. In skin, loss of RhoA was suggested to underlie pemphigus skin blistering. To analyze RhoA function in vivo, we generated mice......-cell contacts. Furthermore we observed increased cell spreading due to impaired RhoA-ROCK (Rho-associated protein kinase)-MLC phosphatase-MLC-mediated cell contraction, independent of Rac1. Rho-inhibiting toxins further increased multinucleation of RhoA-null cells but had no significant effect on spreading......, suggesting that RhoB and RhoC have partially overlapping functions with RhoA. Loss of RhoA decreased directed cell migration in vitro caused by reduced migration speed and directional persistence. These defects were not related to the decreased cell contraction and were independent of ROCK, as ROCK...

  6. Hair follicle defects and squamous cell carcinoma formation in Smad4 conditional knockout mouse skin.

    Science.gov (United States)

    Qiao, W; Li, A G; Owens, P; Xu, X; Wang, X-J; Deng, C-X

    2006-01-12

    Smad4 is the common mediator for TGFbeta signals, which play important functions in many biological processes. To study the role of Smad4 in skin development and epidermal tumorigenesis, we disrupted this gene in skin using the Cre-loxP approach. We showed that absence of Smad4 blocked hair follicle differentiation and cycling, leading to a progressive hair loss of mutant (MT) mice. MT hair follicles exhibited diminished expression of Lef1, and increased proliferative cells in the outer root sheath. Additionally, the skin of MT mice exhibited increased proliferation of basal keratinocytes and epidermal hyperplasia. Furthermore, we provide evidence that the absence of Smad4 resulted in a block of both TGFbeta and bone morphogenetic protein (BMP) signaling pathways, including p21, a well-known cyclin-dependent kinase inhibitor. Consequently, all MT mice developed spontaneous malignant skin tumors from 3 months to 13 months of age. The majority of tumors are malignant squamous cell carcinomas. A most notable finding is that tumorigenesis is accompanied by inactivation of phosphatase and tensin homolog deleted on chromosome 10 (Pten), activation of AKT, fast proliferation and nuclear accumulation of cyclin D1. These observations revealed the essential functions of Smad4-mediated signals in repressing skin tumor formation through the TGFbeta/BMP pathway, which interacts with the Pten signaling pathway.

  7. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  8. In vitro and in vivo transdermal delivery capacity of quantum dots through mouse skin

    International Nuclear Information System (INIS)

    Chu Maoquan; Wu Qiang; Wang Jiaxu; Hou Shengke; Miao Yi; Peng Jinliang; Sun Ye

    2007-01-01

    CdTe quantum dots (QDs) with red fluorescence have been used to study their transdermal delivery capacity through mouse skin. The results showed that the QDs could permeate through skin, either separated from or still attached to live mice. Although the fluorescence emitted by the QDs could only be found in the skin and muscle cells located under the mouse skins coated with QDs, an inductive coupled plasma atomic emission spectrometry (ICP-AES) study indicated that the main organs, such as the heart, liver, spleen, lung, kidney and brain, all contained a significant quantity of Cd atoms. Moreover, these Cd atoms could remain in vivo for at least one week. As a control, the concentration of Cd atoms in normal mice not coated with QDs was very low

  9. RNA isolation for transcriptomics of human and mouse small skin biopsies

    Directory of Open Access Journals (Sweden)

    Breit Timo M

    2011-10-01

    Full Text Available Abstract Background Isolation of RNA from skin biopsies presents a challenge, due to the tough nature of skin tissue and a high presence of RNases. As we lacked the dedicated equipment, i.e. homogenizer or bead-beater, needed for the available RNA from skin isolation methods, we adapted and tested our zebrafish single-embryo RNA-isolation protocol for RNA isolation from skin punch biopsies. Findings We tested our new RNA-isolation protocol in two experiments: a large-scale study with 97 human skin samples, and a small study with 16 mouse skin samples. Human skin was sampled with 4.0 mm biopsy punches and for the mouse skin different punch diameter sizes were tested; 1.0, 1.5, 2.0, and 2.5 mm. The average RNA yield in human samples was 1.5 μg with an average RNA quality RIN value of 8.1. For the mouse biopsies, the average RNA yield was 2.4 μg with an average RIN value of 7.5. For 96% of the human biopsies and 100% of the mouse biopsies we obtained enough high-quality RNA. The RNA samples were successfully tested in a transcriptomics analysis using the Affymetrix and Roche NimbleGen platforms. Conclusions Using our new RNA-isolation protocol, we were able to consistently isolate high-quality RNA, which is apt for further transcriptomics analysis. Furthermore, this method is already useable on biopsy material obtained with a punch diameter as small as 1.5 mm.

  10. Permeation of antigen protein-conjugated nanoparticles and live bacteria through microneedle-treated mouse skin

    Directory of Open Access Journals (Sweden)

    Kumar A

    2011-06-01

    Full Text Available Amit Kumar, Xinran Li, Michael A Sandoval, B Leticia Rodriguez, Brian R Sloat, Zhengrong CuiUniversity of Texas at Austin, College of Pharmacy, Pharmaceutics Division, Austin, TX, USABackground: The present study was designed to evaluate the extent to which pretreatment with microneedles can enhance skin permeation of nanoparticles in vitro and in vivo. Permeation of live bacteria, which are physically nanoparticles or microparticles, through mouse skin pretreated with microneedles was also studied to evaluate the potential risk of microbial infection.Methods and results: It was found that pretreatment of mouse skin with microneedles allowed permeation of solid lipid nanoparticles, size 230 nm, with ovalbumin conjugated on their surface. Transcutaneous immunization in a mouse skin area pretreated with microneedles with ovalbumin nanoparticles induced a stronger antiovalbumin antibody response than using ovalbumin alone. The dose of ovalbumin antigen determined whether microneedle-mediated transcutaneous immunization with ovalbumin nanoparticles induced a stronger immune response than subcutaneous injection of the same ovalbumin nanoparticles. Microneedle treatment permitted skin permeation of live Escherichia coli, but the extent of the permeation was not greater than that enabled by hypodermic injection.Conclusion: Transcutaneous immunization on a microneedle-treated skin area with antigens carried by nanoparticles can potentially induce a strong immune response, and the risk of bacterial infection associated with microneedle treatment is no greater than that with a hypodermic injection.Keywords: antibody responses, safety of microneedles, transepidermal water loss

  11. Permeation of antigen protein-conjugated nanoparticles and live bacteria through microneedle-treated mouse skin

    Science.gov (United States)

    Kumar, Amit; Li, Xinran; Sandoval, Michael A; Rodriguez, B Leticia; Sloat, Brian R; Cui, Zhengrong

    2011-01-01

    Background: The present study was designed to evaluate the extent to which pretreatment with microneedles can enhance skin permeation of nanoparticles in vitro and in vivo. Permeation of live bacteria, which are physically nanoparticles or microparticles, through mouse skin pretreated with microneedles was also studied to evaluate the potential risk of microbial infection. Methods and results: It was found that pretreatment of mouse skin with microneedles allowed permeation of solid lipid nanoparticles, size 230 nm, with ovalbumin conjugated on their surface. Transcutaneous immunization in a mouse skin area pretreated with microneedles with ovalbumin nanoparticles induced a stronger antiovalbumin antibody response than using ovalbumin alone. The dose of ovalbumin antigen determined whether microneedle-mediated transcutaneous immunization with ovalbumin nanoparticles induced a stronger immune response than subcutaneous injection of the same ovalbumin nanoparticles. Microneedle treatment permitted skin permeation of live Escherichia coli, but the extent of the permeation was not greater than that enabled by hypodermic injection. Conclusion: Transcutaneous immunization on a microneedle-treated skin area with antigens carried by nanoparticles can potentially induce a strong immune response, and the risk of bacterial infection associated with microneedle treatment is no greater than that with a hypodermic injection. PMID:21753877

  12. Expression and significance of Bax protein in model of radiation injury in mouse skin

    International Nuclear Information System (INIS)

    Feng Yizhong; Mo Yahong

    2002-01-01

    Objective: The study is to find some valuable criteria for diagnosis and treatment of radiation injury in skin. Methods: The expression of Bax protein was studied by SP immunohistochemistry in 40 cases of model of radiation injury in mouse skin. Their relationship relating to radiation dose was also investigated. Results: The expression rates of Bax were 30%, 30%, 70%, 70% in 5 Gy group, 15 Gy group, 30 Gy group, 45 Gy group respectively. There was no significant correlation between the expression of Bax and radiation groups. Conclusions: The experiment shows that radiation can increase the expression of Bax protein which might be related to poor healing in radiation skin injury

  13. Non-stochastic effects of different energy beta emitters on pig and mouse skin

    International Nuclear Information System (INIS)

    Peel, D.M.; Hopewell, J.W.; Hansen, L.S.; Coggle, J.E.; Charles, M.W.; Wells, J.

    1982-01-01

    In this collaborative study skin areas of various sizes were irradiated with different energy beta emitters. In the post-irradiation period fields were examined for erythema, desquamation, ulceration and dermal necrosis. The aim of the study is to determine the threshold doses for the different biological reactions as a function of the energy of the radiation and the size of skin field irradiated. At St. Bartholomew's Hospital and Oxford the irradiation of mouse and pig skin was carried out using strontium-90 and thulium-170 sources. In addition, mice were irradiated with thallium-204, a slightly lower energy beta emitter than thulium. (author)

  14. Protective effects of black rice bran against chemically-induced inflammation of mouse skin

    Science.gov (United States)

    We investigated the inhibitory effects of black rice (cv. LK1-3-6-12-1-1) bran against 12-O-tetradecanolylphorbol-13-acetate (TPA)-induced skin edema and 2,4-dinitroflurobenzene (DNFB)-induced allergic contact dermatitis (ACD) in inflammatory mouse models. We also determined the effects of the bran...

  15. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    Syring, C.; Maenig, H.J.; Von Versen, R.; Bruck, J.

    1999-01-01

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  16. Changes in the radiation sensitivity of mouse skin during fractionated and prolonged treatments

    International Nuclear Information System (INIS)

    Ruifrok, A.C.C.; Mason, K.A.; Hunter, N.; Thames, H.D.

    1994-01-01

    Reactions of the skin of the right thigh of mice were used as an experimental model to test possible changes in the radiosensitivity of mouse skin, as represented by changes in the linear-quadratic (LQ) model parameters α and β, as a function of fractionation interval and overall treatment time. In the first series of experiments, variable numbers of 3-Gy fractions with intervals of 6, 24 or 48 h were applied, followed by top-up doses to increase the skin damage to a level that could be scored. The results showed that mouse skin is more sensitive to 3-Gy fractions applied with 48-h intervals than to 3-Gy fractions applied with 6- or 24-h intervals. In the second series of experiments we used single-dose or fractonated test treatments for previously unirradiated mice and mice treated with priming doses of 10, 20 or 30 Gy given 1-18 days before the test treatment. The sensitivity appeared to be higher after intervals of 14-18 days than after 1-10 days after priming treatments of 20 and 30 Gy. The increased sensitivity 18 days after 20 Gy was mainly the result of an increase in the β component of the LQ model; higher values of α were also determined. We conclude that the radiosensitivity of mouse skin is higher during a radiation-induced proliferative response. 28 refs., 3 figs., 7 tabs

  17. Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

    International Nuclear Information System (INIS)

    Tong, Ying; Smith, M.A.; Tucker, S.B.

    1997-01-01

    Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

  18. D-aspartic acid in aged mouse skin and lens

    International Nuclear Information System (INIS)

    Fujii, Noriko; Muraoka, Shiro; Harada, Kaoru; Tamanoi, Itsuro; Joshima, Hisamasa; Kashima, Masatoshi.

    1987-01-01

    D-aspartic acid (D-Asp) was detected in the skin and lens from naturally aged mice. An analysis of the amino acid composition indicated that D-Asp did not derive from collagen. An immunological analysis using Oucterlony's agar diffusion method also confirmed that the protein containing D-Asp was not a serum protein. The process producing D-Asp is regarded as one other than racemization because the life span of mice is not long enough to permit D-Asp by racemization. Continuous low-dose-rate gamma-irradiation (37R per day) for 102 to 112 days did not increase significantly the amount of D-Asp in skin and lens of mice. (author)

  19. The biodisposition and hypertrichotic effects of bimatoprost in mouse skin

    Science.gov (United States)

    Woodward, David F; Tang, Elaine S-H; Attar, Mayssa; Wang, Jenny W

    2013-01-01

    Studies on bimatoprost were performed with two objectives: (i) to determine whether bimatoprost possesses hair growth-stimulating properties beyond eyelash hypertrichosis and (ii) to investigate the biodisposition of bimatoprost in skin for the first time. Bimatoprost, at the dose used clinically for eyelash growth (0.03%) and given once daily for 14 days, increased pelage hair growth in C57/black 6 mice. This occurred as a much earlier onset of new hair growth in shaved mice and the time taken to achieve complete hair regrowth, according to photographic documentation and visual assessment. Bimatoprost biodisposition in the skin was determined at three concentrations: 0.01%, 0.03% and 0.06%. Dose-dependent Cmax values were obtained (3.41, 6.74, 12.3 μg/g tissue), and cutaneous bimatoprost was well maintained for 24 h following a single dose. Bimatoprost was recovered from the skin only as the intact molecule, with no detectable levels of metabolites. Thus, bimatoprost produces hypertrichosis as the intact molecule. PMID:23278986

  20. The circadian clock controls sunburn apoptosis and erythema in mouse skin.

    Science.gov (United States)

    Gaddameedhi, Shobhan; Selby, Christopher P; Kemp, Michael G; Ye, Rui; Sancar, Aziz

    2015-04-01

    Epidemiological studies of humans and experimental studies with mouse models suggest that sunburn resulting from exposure to excessive UV light and damage to DNA confers an increased risk for melanoma and non-melanoma skin cancer. Previous reports have shown that both nucleotide excision repair, which is the sole pathway in humans for removing UV photoproducts, and DNA replication are regulated by the circadian clock in mouse skin. Furthermore, the timing of UV exposure during the circadian cycle has been shown to affect skin carcinogenesis in mice. Because sunburn and skin cancer are causally related, we investigated UV-induced sunburn apoptosis and erythema in mouse skin as a function of circadian time. Interestingly, we observed that sunburn apoptosis, inflammatory cytokine induction, and erythema were maximal following an acute early-morning exposure to UV and minimal following an afternoon exposure. Early-morning exposure to UV also produced maximal activation of ataxia telangiectasia mutated and Rad3-related (Atr)-mediated DNA damage checkpoint signaling, including activation of the tumor suppressor p53, which is known to control the process of sunburn apoptosis. These data provide early evidence that the circadian clock has an important role in the erythemal response in UV-irradiated skin. The early morning is when DNA repair is at a minimum, and thus the acute responses likely are associated with unrepaired DNA damage. The prior report that mice are more susceptible to skin cancer induction following chronic irradiation in the AM, when p53 levels are maximally induced, is discussed in terms of the mutational inactivation of p53 during chronic irradiation.

  1. Loss of catalase increases malignant mouse keratinocyte cell growth through activation of the stress activated JNK pathway.

    Science.gov (United States)

    Hanke, Neale T; Finch, Joanne S; Bowden, G Timothy

    2008-05-01

    A cell line that produces mouse squamous cell carcinoma (6M90) was modified to develop a cell line with an introduced Tet-responsive catalase transgene (MTOC2). We have previously reported that the overexpressed catalase in the MTOC2 cells reverses the malignant phenotype in part by decreasing epidermal growth factor receptor (EGFR) signaling. With this work we expanded the investigation into the differences between these two cell lines. We found that the decreased EGFR pathway activity of the MTOC2 cells is not because of reduced autocrine secretion of an epidermal growth factor (EGF) ligand but rather because of lower basal receptor activity. Phosphorylated levels of the mitogen-activated protein kinase (MAPK) members JNK and p38 were both higher in the 6M90 cells with low catalase when compared with the MTOC2 cell line. Although treatment with an EGFR inhibitor, AG1478, blocked the increased activity of JNK in the 6M90 cells, a similar effect was not observed for p38. Basal levels of downstream c-jun transcription were also found to be higher in the 6M90 cells versus MTOC2 cells. Activated p38 was found to down-regulate the JNK MAPK pathway in the 6M90 cells. However, the 6M90 cells contain constitutively high levels of phosphorylated JNK, generating higher levels of phosphorylated c-jun and total c-jun than those in the MTOC2 cells. Inhibition of JNK activity in the 6M90 cells reduced AP-1 transcription and cell proliferation. The data confirm the inhibitory effects of catalase on tumor cell growth, specifically through a ligand-independent decrease in the stress activated JNK pathway. (c) 2007 Wiley-Liss, Inc.

  2. Biogenic silica fibre promotes carcinogenesis in mouse skin.

    Science.gov (United States)

    Bhatt, T; Coombs, M; O'Neill, C

    1984-10-15

    Silica fibres derived from plants are common contaminants of human diet in certain regions of the world where oesophageal cancer reaches extremely high incidences. We show here that one of these types of fibre (derived from Phalaris canariensis L) promotes the occurrence of tumours in the skin of mice initiated with a polycyclic carcinogen. Three experiments are described. In the first, the grain which bears these fibres was added to the diet. This did not result in any abnormality in any part of the gastrointestinal tract, but there was a significant induction of tumours in the skin around the mouth and nose; these were the areas of the body surface which most frequently came into contact with the grain. In the second experiment, the mice were separated from the grain by an intervening wire gauze barrier; a similar number of tumours appeared on initiated mice treated in this way. In this case, contact now occurred most frequently on the dorsal surface, which was rubbed against the gauze barrier, and it was on this surface that the tumours appeared. No tumours appeared if the grain was removed. In the third experiment, pure fibres were isolated from the surface of the grain and boiled in strong nitric acid so as to remove any organic material. When these acid-cleaned fibres were applied to the initiated skin with light pressure, they promoted carcinogenesis in the same way as croton oil. In each experiment the majority of tumours produced were benign neoplasms, together with at least one squamous carcinoma. It seems possible that the size and shape of these fibres are the critical properties determining their promoting activity. Their mean diameter is 15 microns, their modal length close to 200 microns, and they are sharply pointed with a tip diameter of 0.5 micron.

  3. Flavanone silibinin treatment attenuates nitrogen mustard-induced toxic effects in mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Anil K.; Tewari-Singh, Neera; Inturi, Swetha; Kumar, Dileep [Department of Pharmaceutical Sciences, University of Colorado Anschutz Medical Campus, Aurora, CO 80045 (United States); Orlicky, David J. [Department of Pathology, University of Colorado Anschutz Medical Campus, Aurora, CO 80045 (United States); Agarwal, Chapla [Department of Pharmaceutical Sciences, University of Colorado Anschutz Medical Campus, Aurora, CO 80045 (United States); White, Carl W. [Department of Pediatrics, University of Colorado Anschutz Medical Campus, Aurora, CO 80045USA (United States); Agarwal, Rajesh, E-mail: Rajesh.Agarwal@UCDenver.edu [Department of Pharmaceutical Sciences, University of Colorado Anschutz Medical Campus, Aurora, CO 80045 (United States)

    2015-05-15

    Currently, there is no effective antidote to prevent skin injuries by sulfur mustard (SM) and nitrogen mustard (NM), which are vesicating agents with potential relevance to chemical warfare, terrorist attacks, or industrial/laboratory accidents. Our earlier report has demonstrated the therapeutic efficacy of silibinin, a natural flavanone, in reversing monofunctional alkylating SM analog 2-chloroethyl ethyl sulfide-induced toxic effects in mouse skin. To translate this effect to a bifunctional alkylating vesicant, herein, efficacy studies were carried out with NM. Topical application of silibinin (1 or 2 mg) 30 min after NM exposure on the dorsal skin of male SKH-1 hairless mice significantly decreased NM-induced toxic lesions at 24, 72 or 120 h post-exposure. Specifically, silibinin treatment resulted in dose-dependent reduction of NM-induced increase in epidermal thickness, dead and denuded epidermis, parakeratosis and microvesication. Higher silibinin dose also caused a 79% and 51%reversal in NM-induced increases in myeloperoxidase activity and COX-2 levels, respectively. Furthermore, silibinin completely prevented NM-induced H2A.X phosphorylation, indicating reversal of DNA damage which could be an oxidative DNA damage as evidenced by high levels of 8-oxodG in NM-exposed mouse skin that was significantly reversed by silibinin. Together, these findings suggest that attenuation of NM-induced skin injury by silibinin is due to its effects on the pathways associated with DNA damage, inflammation, vesication and oxidative stress. In conclusion, results presented here support the optimization of silibinin as an effective treatment of skin injury by vesicants. - Highlights: • Silibinin treatment attenuated nitrogen mustard (NM)-induced skin injury. • Silibinin affects pathways associated with DNA damage, inflammation and vesication. • The efficacy of silibinin could also be associated with oxidative stress. • These results support testing and optimization of

  4. Quantitative measurements of oxidative stress in mouse skin induced by X-ray irradiation

    International Nuclear Information System (INIS)

    Chi, Cuiping; Tanaka, Ryoko; Okuda, Yohei; Ikota, Nobuo; Ozawa, Toshihiko; Anzai, Kazunori; Yamamoto, Haruhiko; Urano, Shiro

    2005-01-01

    To find efficient methods to evaluate oxidative stress in mouse skin caused by X-ray irradiation, several markers and methodologies were examined. Hairless mice were irradiated with 50 Gy X-rays and skin homogenates or skin strips were prepared. Lipid peroxidation was measured using the skin homogenate as the level of thiobarbituric acid reactive substances. The level of lipid peroxidation increased with time after irradiation and was twice that of the control at 78 h. Electron spin resonance (ESR) spectra of skin strips showed a clear signal for the ascorbyl radical, which increased with time after irradiation in a manner similar to that of lipid peroxidation. To measure levels of glutathione (GSH) and its oxidized forms (GSSG) simultaneously, two high performance liquid chromatography (HPLC) methods, sample derivatization with 1-fluoro-2,4-dinitrobenzene and detection with a UV detector (method A) and no derivatization and detection with an electrochemical detector (method B), were compared and the latter was found to be better. No significant change was observed within 24 h after irradiation in the levels of GSH and GSSG measured by method B. The GSH/GSSG ratio may be a less sensitive parameter for the evaluation of acute oxidative stress caused by X-ray irradiation in the skin. Monitoring the ascorbyl radical seems to be a good way to evaluate oxidative stress in skin in vivo. (author)

  5. UV irradiation to mouse skin decreases hippocampal neurogenesis and synaptic protein expression via HPA axis activation.

    Science.gov (United States)

    Han, Mira; Ban, Jae-Jun; Bae, Jung-Soo; Shin, Chang-Yup; Lee, Dong Hun; Chung, Jin Ho

    2017-11-14

    The skin senses external environment, including ultraviolet light (UV). Hippocampus is a brain region that is responsible for memory and emotion. However, changes in hippocampus by UV irradiation to the skin have not been studied. In this study, after 2 weeks of UV irradiation to the mouse skin, we examined molecular changes related to cognitive functions in the hippocampus and activation of the hypothalamic-pituitary-adrenal (HPA) axis. UV exposure to the skin decreased doublecortin-positive immature neurons and synaptic proteins, including N-methyl-D-aspartate receptor 2 A and postsynaptic density protein-95, in the hippocampus. Moreover, we observed that UV irradiation to the skin down-regulated brain-derived neurotrophic factor expression and ERK signaling in the hippocampus, which are known to modulate neurogenesis and synaptic plasticity. The cutaneous and central HPA axes were activated by UV, which resulted in significant increases in serum levels of corticosterone. Subsequently, UV irradiation to the skin activated the glucocorticoid-signaling pathway in the hippocampal dentate gyrus. Interestingly, after 6 weeks of UV irradiation, mice showed depression-like behavior in the tail suspension test. Taken together, our data suggest that repeated UV exposure through the skin may negatively affect hippocampal neurogenesis and synaptic plasticity along with HPA axis activation.

  6. Control of cell division and radiation injury in mouse skin

    International Nuclear Information System (INIS)

    Yamaguchi, Takeo

    1974-01-01

    The method for determining the inhibitors of cell division (chalone-adrenalin system) in the irradiated epidermis and blood was developed using the epidermis of mouse ear conch during the cure of wounds (in vivo), and the epidermis cultured for a long period (in vitro). The whole body was irradiated with 200KV, 20 mA x-rays of 96 R/min filtered by 0.5 mmCu + 0.5 mmAl. Chalone, which is a physiologically intrinsic substance to control the proliferation, inhibits the DNA synthesis. From changes in cell division with time, chalone in the epidermis is considered to inhibit each process from G 2 to M, from G 2 to S, from G 1 to S. Adrenalin is indispensable when epidermal chalone acts the inhibition of cell division. Chalone activities in the epidermis irradiated with almost lethal doses were decreased. Factors to inhibit the proliferation of the epidermis by the potentiation of chalone and adrenalin are present in sera of animals irradiated to x-rays. (Serizawa, K.)

  7. Mouse allergen-specific immunoglobulin G4 and risk of mouse skin test sensitivity

    NARCIS (Netherlands)

    Matsui, E. C.; Diette, G. B.; Krop, E. J. M.; Aalberse, R. C.; Smith, A. L.; Eggleston, P. A.

    2006-01-01

    High serum levels of cat-specific IgG and IgG4 are associated with protection against allergic sensitization to cat, but whether this association applies to other animal allergens remains unclear. To determine if high levels of mouse-specific IgG and IgG4 are associated with a decreased risk of

  8. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  9. Curcumin Stimulates the Antioxidant Mechanisms in Mouse Skin Exposed to Fractionated γ-Irradiation

    Directory of Open Access Journals (Sweden)

    Ganesh Chandra Jagetia

    2015-01-01

    Full Text Available Fractionated irradiation is one of the important radiotherapy regimens to treat different types of neoplasia. Despite of the immense therapeutic gains accrued by delivering fractionated irradiation to tumors, the radiation burden on skin increases significantly. Low doses of irradiation to skin adversely affect its molecular and metabolic status. The use of antioxidant/s may help to alleviate the radiation-induced changes in the skin and allow delivering a higher dose of radiation to attain better therapeutic gains. Curcumin is an antioxidant and a free radical scavenging dietary supplement, commonly used as a flavoring agent in curries. Therefore, the effect of 100 mg/kg body weight curcumin was studied on the antioxidant status of mice skin exposed to a total dose of 10, 20 and 40 Gy γ-radiation below the rib cage delivered as a single fraction of 2 Gy per day for 5, 10 or 20 days. Skin biopsies from both the curcumin treated or untreated irradiated groups were collected for the biochemical estimations at various post-irradiation times. The irradiation of animals caused a dose dependent decline in the glutathione concentration, glutathione peroxidase, and superoxide dismutase activities and increased the lipid peroxidation in the irradiated skin. Curcumin treatment before irradiation resulted in a significant rise in the glutathione concentration and activities of both the glutathione peroxidase and superoxide dismutase enzymes in mouse skin, whereas lipid peroxidation declined significantly. The present study indicates that curcumin treatment increased the antioxidant status of mouse exposed to different doses of fractionated γ-radiation.

  10. Use of mouse thigh as a radiobiological model of radiation-induced skin reactions

    International Nuclear Information System (INIS)

    Smith, A.J.; Hagkyriakou, H.; Martin, R.F.

    2000-01-01

    Full text: The effects of radiation exposure on skin have been widely studied. One of the most useful and relatively easy methods for evaluating radiation-induced skin reactions is the mouse thigh model. This model is non-invasive and has the advantage of not requiring the use of anaesthetic. In the current adaptation of the mouse thigh model, female C3H/HeJ ARC mice (from the Animal Resource Centre, W.A.) were used. The mice were restrained in specially designed jigs where the right leg was held in place by a metal hook. Lead shielding ensured that only the right ventral thigh was exposed to the radiation beam. A 6MeV electron beam from a Varian 2100 Linac (20Gy / minute) was used, thus minimising the time for which the mice were restrained. Eight to twelve days after exposure to the radiation, the first skin reactions can be seen. These are scored according to a scale ranging from 0 (no visible reaction) to 3.5 (breakdown of the entire area with severe exudation). The skin reactions (erythema and moist desquamation) peak approximately 18-22 days after radiation exposure and may remain at peak for only 1-3 days. Therefore, the reactions need to be scored daily and this continues, generally until day 35, or until all moist desquamation has healed. The maximum score in a score versus time profile for each mouse in a group of 5-6 animals are averaged. Radiation-dose response data will be presented. Using the mouse thigh model, hair loss can also be measured (usually on about day 30-35) using a scale from 0-4, where 0 depicts no evident hair loss and 4 represents complete epilation. Leg contraction can also be measured as a late effect by comparison with the length of the unirradiated leg

  11. Skin barrier disruption by acetone: observations in a hairless mouse skin model

    NARCIS (Netherlands)

    Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

    2009-01-01

    To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term

  12. The acute effects of different energy beta-emitters on pig and mouse skin

    International Nuclear Information System (INIS)

    Hopewell, J.W.; Hamlet, R.; Wells, J.; Charles, M.W.

    1986-01-01

    Acute changes were studied in the skin of mice and pigs following irradiation with Sr 90 (Esub(max) 2.27 MeV), Tm 170 (Esub(max) 0.97 MeV) and Pm 147 (Esub(max) 0.225 MeV). Sr 90 irradiation in the pig and Sr 90 and Tm 170 exposure in the mouse resulted in a distinct field-size effect for sources of 5-22.5 mm diameter; ED 50 values for moist desquamation were 22.0-27.5 Gy from the 22.5 mm source and 75-90 Gy for the 5 mm source. Tm 170 irradiation in the pig produced no distinct area effect for sources of 5-19 mm diameter (ED 50 approx.= 80 Gy). Acute tissue breakdown was only achieved in pig and mouse skin by very high doses (ED 50 >= 140 Gy) from sources of 147 produced acute epithelial breakdown, only after high skin-surface doses (ED 50 550-725 Gy). Area-and energy-related changes can, in part be explained by an hypothesis based on repopulation of the epithelium in the irradiated area by the migration of either cells from the edge of that area and/or cells surviving at the base of hair follicles. Differences in the results in pig and mouse can be explained on the basis of the distribution of target cells in the epidermis at varying depths. (author)

  13. Mueller matrix polarimetry for characterizing microstructural variation of nude mouse skin during tissue optical clearing.

    Science.gov (United States)

    Chen, Dongsheng; Zeng, Nan; Xie, Qiaolin; He, Honghui; Tuchin, Valery V; Ma, Hui

    2017-08-01

    We investigate the polarization features corresponding to changes in the microstructure of nude mouse skin during immersion in a glycerol solution. By comparing the Mueller matrix imaging experiments and Monte Carlo simulations, we examine in detail how the Mueller matrix elements vary with the immersion time. The results indicate that the polarization features represented by Mueller matrix elements m22&m33&m44 and the absolute values of m34&m43 are sensitive to the immersion time. To gain a deeper insight on how the microstructures of the skin vary during the tissue optical clearing (TOC), we set up a sphere-cylinder birefringence model (SCBM) of the skin and carry on simulations corresponding to different TOC mechanisms. The good agreement between the experimental and simulated results confirm that Mueller matrix imaging combined with Monte Carlo simulation is potentially a powerful tool for revealing microscopic features of biological tissues.

  14. The response of mouse skin to re-irradiation with x-rays or fast neutrons

    International Nuclear Information System (INIS)

    Tsukiyama, Iwao; Egawa, Sunao; Kumazawa, Akiyoshi; Iino, Yuu.

    1986-01-01

    Effects of neutrons and x-rays on mouse skin which had been previously irradiated with x-rays were investigated. Two tattoo marks were placed in the hairless legs of mice at intervals of 15 mm. The legs were exposed to various doses of x-ray and neutrons to determine the relative biological effectiveness (RBE) using the contraction of the skin as an index. The RBE was 0.93 - 1.73. The legs of the mice were preexposed to 25 Gy of x-ray, and exposed 4 months later. The contraction of the skin began earlier than after the first irradiation. RBE was 2.18 - 2.47. This RBE was higher than that in untreated mice. These results suggest that previously irradiated normal tissues are much more sensitive to neutrons than to x-rays. (author)

  15. Y chromosome and vimentin used to trace the fate of allogeneic keratinocytes delivered to the wound by the recombined human/pig skin

    Czech Academy of Sciences Publication Activity Database

    Pokorná, Eva; Brož, L.; Veselý, Pavel; Matoušková, Eva

    2001-01-01

    Roč. 47, č. 4 (2001), s. 128-134 ISSN 0015-5500 R&D Projects: GA MZd IZ4368; GA MZd NK6126 Keywords : allogeneic keratinocytes * xenodermis * Y-chromosome FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.519, year: 2001

  16. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    NARCIS (Netherlands)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The skin of the mouse foot was used to study the effects of previous irradiation on the response to hyperthermia (44 degrees C), to irradiation, or to irradiation combined with hyperthermia (43 degrees C or 44 degrees C). Hyperthermia was applied by immersing the mouse foot into a hot waterbath and

  17. An Improved Mouse Model of Atopic Dermatitis and Suppression of Skin Lesions by an Inhibitor of Tec Family Kinases

    Directory of Open Access Journals (Sweden)

    Yuko Kawakami

    2007-01-01

    Conclusions: We established a highly efficient, highly reproducible protocol to induce skin lesions in NC/Nga mice and successfully applied it to show the efficacy of terreic acid in treating skin lesions. This mouse model of atopic dermatitis will be useful to study the pathogenetic processes of atopic dermatitis and to evaluate the efficacy of drug candidates.

  18. Preventive effect of Dioscorea japonica on squamous cell carcinoma of mouse skin involving down-regulation of prostaglandin E2 synthetic pathway.

    Science.gov (United States)

    Tsukayama, Izumi; Toda, Keisuke; Takeda, Yasunori; Mega, Takuto; Tanaka, Mitsuki; Kawakami, Yuki; Takahashi, Yoshitaka; Kimoto, Masumi; Yamamoto, Kei; Miki, Yoshimi; Murakami, Makoto; Suzuki-Yamamoto, Toshiko

    2018-03-01

    Hyperproduced prostaglandin E 2 by cyclooxygenase-2 and microsomal prostaglandin E synthase-1 evokes several pathophysiological responses such as inflammation and carcinogenesis. Our recent study demonstrated that Dioscorea japonica extract suppressed the expression of cyclooxygenase-2 and microsomal prostaglandin E synthase-1 and induced apoptosis in lung carcinoma A549 cells. In the present study, we investigated the effects of Dioscorea japonica on squamous cell carcinoma of mouse skin. Dioscorea japonica feeding and Dioscorea japonica extract topical application suppressed the expression of cyclooxygenase-2, microsomal prostaglandin E synthase-1, interleukin-1β and interleukin-6 and inhibited tumor formation, hyperplasia and inflammatory cell infiltration. Immunohistochemical analyses showed the immunoreactivities of cyclooxygenase-2 and microsomal prostaglandin E synthase-1 in tumor keratinocytes and stronger immunoreactivities of cyclooxygenase-2 and hematopoietic prostaglandin D synthase in epidermal dendritic cells (Langerhans cells). Treatment with Dioscorea japonica decreased the immunoreactivity of cyclooxygenase-2 and microsomal prostaglandin E synthase-1. These results indicate that Dioscorea japonica may have inhibitory effects on inflammation and carcinogenesis via suppression of the prostaglandin E 2 synthetic pathway.

  19. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin.

    Science.gov (United States)

    Li, Zhi; Gothard, Elizabeth; Coles, Mark C; Ambler, Carrie A

    2018-01-01

    In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s), by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  20. Photoreactivation of ultraviolet radiation-induced pyrimidine dimers in neonatal BALB/c mouse skin

    International Nuclear Information System (INIS)

    Ananthaswamy, H.N.; Fisher, M.S.

    1981-01-01

    The numbers of ultraviolet light (uv)-induced pyrimidine dimers in the DNA of neonatal BALB/c mouse skin were measured by assessing the sensitivity of the DNA to Micrococcus luteus uv endonuclease. Irradiation of neonatal BALB/c mice with FS40 sunlamps caused a dose-dependent induction of endonuclease-sensitive sites (pyrimidine dimers) in DNA extracted from back skin. Exposure of these uv-irradiated neonatal mice to photoreactivating (PR) light (cool white fluorescent lamp and incandescent lamp) caused a reduction in the number of pyrimidine dimers in the DNA, as revealed by a shift in low-molecular-weight DNA to high-molecular-weight DNA. In contrast, DNA profiles of the skin of either uv-irradiated mice or uv-irradiated mice kept in the dark for the same duration as those exposed to PR light did not show a loss of uv-induced endonuclease-sensitive sites. Furthermore, reversing the order of treatment, i.e., administering PR light first and then uv, did not produce a reduction in pyrimidine dimers. These results demonstrate that PR or uv-induced pyrimidine dimers occurs in neonatal BALB/c mouse skin. The optimal wavelength range for in vivo PR appears to be in the visible region of the spectrum (greater than 400 nm). Although dimer formation could be detected in both dermis and epidermis, PR occurred only in the dermis. Furthermore, the PR phenomenon could not be detected in the skin of adult mice from the same inbred strain

  1. Quantification of tumour initiating effect of jute batching oil and its distillates over mouse skin.

    Science.gov (United States)

    Agarwal, R; Kumar, S; Shukla, Y; Antony, M; Mehrotra, N K

    1985-09-30

    In order to identify the tumour initiating constituent(s) of a mineral oil, jute batching oil (JBO), used in the processing of jute fibres, it was fractionally distilled in various boiling range fractions. The latter were then subjected to in vivo assessment of their aryl hydrocarbon hydroxylase (AHH) inducing potential in mouse epidermis. Fractions with almost similar AHH inducing potential were regrouped and studied for their tumour initiating potential over mouse skin following two-stage initiation-promotion protocol and using 12-O-tetradecanoyl phorbol-13-acetate (TPA) as tumour promoter. It was noticed that: (1) JBO as initiator, provoked local development of benign skin tumours over mouse back; (2) fractions of JBO boiling below 335 degrees C and above 399 degrees C accounted for most of the tumour initiating potential of the oil; (3) the histological features of the tumours (i.e. benign papillomas and keratoacanthomas) initiated by these fractions were similar to those developed after being initiated with unfractionated or reconstituted JBO; (4) removal of these fractions from JBO may be attempted which could decontaminate the batch oil from most of its tumorigenic components and make it safer for industrial use.

  2. Systematic screening for skin, hair, and nail abnormalities in a large-scale knockout mouse program.

    Directory of Open Access Journals (Sweden)

    John P Sundberg

    Full Text Available The International Knockout Mouse Consortium was formed in 2007 to inactivate ("knockout" all protein-coding genes in the mouse genome in embryonic stem cells. Production and characterization of these mice, now underway, has generated and phenotyped 3,100 strains with knockout alleles. Skin and adnexa diseases are best defined at the gross clinical level and by histopathology. Representative retired breeders had skin collected from the back, abdomen, eyelids, muzzle, ears, tail, and lower limbs including the nails. To date, 169 novel mutant lines were reviewed and of these, only one was found to have a relatively minor sebaceous gland abnormality associated with follicular dystrophy. The B6N(Cg-Far2tm2b(KOMPWtsi/2J strain, had lesions affecting sebaceous glands with what appeared to be a secondary follicular dystrophy. A second line, B6N(Cg-Ppp1r9btm1.1(KOMPVlcg/J, had follicular dystrophy limited to many but not all mystacial vibrissae in heterozygous but not homozygous mutant mice, suggesting that this was a nonspecific background lesion. We discuss potential reasons for the low frequency of skin and adnexal phenotypes in mice from this project in comparison to those seen in human Mendelian diseases, and suggest alternative approaches to identification of human disease-relevant models.

  3. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    National Research Council Canada - National Science Library

    McCormack-Brown, Stephanie

    2008-01-01

    .... There is no published data on AL NP toxicity effects on human skin. This research used in vitro techniques to determine the cytotoxicity of AL NPs, sized 50, 80, and 120 nm, on human keratinocytes...

  4. Radioprotection of mouse skin by WR-2721: the critical influence of oxygen tension

    International Nuclear Information System (INIS)

    Denekamp, J.; Michael, B.D.; Rojas, A.; Stewart, F.A.

    1982-01-01

    The epidermal clone assay has been used to study the radioprotective effect of WR-2721 on mouse skin under different conditions of oxygenation and under anoxia. The skin has shown a progressive decrease in sensitivity as the inspired gas has changed from 100% oxygen towards 0% oxygen. Compared with mice breathning 100% oxygen, those breathing air are partially protected. The inspired oxygen concentration to give half the full oxygen effect is 10-12%. The radioprotecton observed with 400 mg/kg WR-2721 is markedly dependent on the ambient oxygen concentration. The protection factor is 1.1 or less in mice breathing 5%, 1% or 0% oxygen. Protection is maximal (1.95) in air and in 50% oxygen and diminishes to 1.6 at higher oxygen tensions

  5. Stokes shift spectroscopy for the early diagnosis of epithelial precancers in DMBA treated mouse skin carcinogenesis

    Science.gov (United States)

    Jeyasingh, Ebenezar; Singaravelu, Ganesan; Prakasarao, Aruna

    2018-02-01

    In this study, we aim to characterize the tissue transformation in dimethylbenz(a)anthracene (DMBA) treated mouse skin tumor model using stokes shift spectroscopy (SSS) technique for early detection of the neoplastic changes. Stokes shift (SS) spectra measured by scanning both excitation and emission wavelength simultaneously with a fixed wavelength of interval (Δλ=20 nm) in vivo from 33 DMBA treated animals and 6 control animals. The SS spectra of normal (n=6), hyperplasia (n=10), dysplasia (n=10), and WDSCC (n=13) of mice skin shows the distinct peaks around 300, 350, and 386 nm may be attributed to tryptophan, collagen, and NADH respectively. From the observed spectral differences and the ratio variables that resulted in better classification between groups, it is concluded that tryptophan, collagen, and NADH are the key fluorophores that undergo changes during tissue transformation process and hence they can be targeted as tumor markers for early neoplastic changes.

  6. Shining a Light on Black Holes in Keratinocytes.

    Science.gov (United States)

    Bowman, Shanna L; Marks, Michael S

    2018-03-01

    The mechanisms by which melanins are transferred from melanocytes and stored within keratinocytes to generate skin pigmentation are hotly debated. Correia et al. and Hurbain et al. provide evidence that melanin cores of melanosomes are secreted from melanocytes and taken up and stored within non-degradative membranous organelles in keratinocytes in the basal epidermis of human skin. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Deoxynivalenol induced mouse skin cell proliferation and inflammation via MAPK pathway

    International Nuclear Information System (INIS)

    Mishra, Sakshi; Tripathi, Anurag; Chaudhari, Bhushan P.; Dwivedi, Premendra D.; Pandey, Haushila P.; Das, Mukul

    2014-01-01

    Several toxicological manifestations of deoxynivalenol (DON), a mycotoxin, are well documented; however, dermal toxicity is not yet explored. The effect of topical application of DON to mice was studied using markers of skin proliferation, inflammation and tumor promotion. Single topical application of DON (84–672 nmol/mouse) significantly enhanced dermal hyperplasia and skin edema. DON (336 and 672 nmol) caused significant enhancement in [ 3 H]-thymidine uptake in DNA along with increased myeloperoxidase and ornithine decarboxylase activities, suggesting tissue inflammation and cell proliferation. Furthermore, DON (168 nmol) caused enhanced expression of RAS, and phosphorylation of PI3K/Akt, ERK, JNK and p38 MAPKs. DON exposure also showed activation of transcription factors, c-fos, c-jun and NF-κB along with phosphorylation of IkBα. Enhanced phosphorylation of NF-κB by DON caused over expression of target proteins, COX-2, cyclin D1 and iNOS in skin. Though a single topical application of DMBA followed by twice weekly application of DON (84 and 168 nmol) showed no tumorigenesis after 24 weeks, however, histopathological studies suggested hyperplasia of the epidermis and hypertrophy of hair follicles. Interestingly, intestine was also found to be affected as enlarged Peyer's patches were observed, suggesting inflammatory effects which were supported by elevation of inflammatory cytokines after 24 weeks of topical application of DON. These results suggest that DON induced cell proliferation in mouse skin is through the activation of MAPK signaling pathway involving transcription factors NFκB and AP-1, further leading to transcriptional activation of downstream target proteins c-fos, c-jun, cyclin D1, iNOS and COX-2 which might be responsible for its inflammatory potential. - Highlights: • Topical application of DON enhanced epidermal inflammation and cell proliferation. • DON follows PI3K/Akt/MAPK signaling cascade, with activation of AP-1 and NF

  8. Strain differences in mouse skin carcinogenesis experiments using ionizing radiation and the tumor promoter TPA

    International Nuclear Information System (INIS)

    Jaffe, D.R.; Bowden, G.T.

    1985-01-01

    Ionizing radiation has been shown to be a complete carcinogen in rodent skin when administered repeatedly. The initiating potential of ionizing radiation in mouse skin was tested in a classical two-stage protocol in both CD-1 and Sencar mice. Beta radiation (0.5, 1.5, 3.0 and 5.0 Gy) was administered by a strontium 90 applicator followed two weeks later by twice weekly application of 5 μg TPA. A statistical difference in the papilloma incidence between radiation initiated, TPA promoted versus non-initiated TPA promoted groups was not found (25-35% animals with papillomas and 0.35-0.45 papillomas per mouse at 65 weeks of promotion for both initiated and non-initiated mice). There appeared to be no strain differences between the CD-1 and Sencar in response to the initiating effects if ionizing radiation. This is in direct contrast to the studies showing Sencar mice to be much more sensitive than CD-1 to the initiating effects of chemical carcinogens

  9. Evaluation of Permacol as a cultured skin equivalent.

    Science.gov (United States)

    MacLeod, T M; Cambrey, A; Williams, G; Sanders, R; Green, C J

    2008-12-01

    Skin loss following severe burn requires prompt wound closure to avoid such complications as fluid and electrolyte imbalance, infection, immune suppression, and pain. In clinical situations in which insufficient donor skin is available, the development of cultured skin equivalents (dermal matrices seeded with keratinocytes and fibroblasts) may provide a useful alternative. The aim of this study was to assess the suitability of a porcine-derived dermal collagen matrix (Permacol) to function as a cultured skin equivalent in supporting the growth of keratinocytes in vitro and providing cover to full thickness wounds in the BALB C/nude mouse model. A histological comparison was against Glycerol treated-Ethylene Oxide Sterilised Porcine Dermis (Gly-EO Dermis) which has successfully been used as a cultured skin equivalent in previous studies. Both Gly-EO Dermis and to a lesser extent Permacol were able to support the growth of cultured keratinocytes following a 16-day period of cell culture, however, this study was only able to demonstrate the presence of an epidermal layer on Gly-EO dermis 2 weeks after grafting onto full-thickness wounds in the BALB C/nude mouse model.

  10. Novel 11β-hydroxysteroid dehydrogenase 1 inhibitors reduce cortisol levels in keratinocytes and improve dermal collagen content in human ex vivo skin after exposure to cortisone and UV.

    Directory of Open Access Journals (Sweden)

    Stéphanie M Boudon

    Full Text Available Activity and selectivity assessment of new bi-aryl amide 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1 inhibitors, prepared in a modular manner via Suzuki cross-coupling, are described. Several compounds inhibiting 11β-HSD1 at nanomolar concentrations were identified. Compounds 2b, 3e, 7b and 12e were shown to selectively inhibit 11β-HSD1 over 11β-HSD2, 17β-HSD1 and 17β-HSD2. These inhibitors also potently inhibited 11β-HSD1 activity in intact HEK-293 cells expressing the recombinant enzyme and in intact primary human keratinocytes expressing endogenous 11β-HSD1. Moreover, compounds 2b, 3e and 12e were tested for their activity in human skin biopsies. They were able to prevent, at least in part, both the cortisone- and the UV-mediated decreases in collagen content. Thus, inhibition of 11β-HSD1 by these compounds can be further investigated to delay or prevent UV-mediated skin damage and skin aging.

  11. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin

    Directory of Open Access Journals (Sweden)

    Zhi Li

    2018-02-01

    Full Text Available In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s, by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  12. Effect of BCNU on mouse skin and spinal cord in single drug and radiation exposures

    International Nuclear Information System (INIS)

    Lelieveld, P.; Brown, J.M.; Goffinet, D.R.; Schoeppel, S.L.; Scoles, M.

    1979-01-01

    We set out to determine whether any interaction occurs between BCNU and radiation for the mouse skin and spinal cord. Single doses of BCNU of 10, 20, or 30 mg/kg were injected intraperitoneally as a function of time before or after irradiation of the foot or spinal cord of anesthesized C3H mice. Enhancement of the radiation skin reaction (dose enhancement factor = 1.3) was seen when BCNU (30 mg/kg) was given 1 day, 6 hr, and 2 hr prior to irradiation of the foot with 2,500 rad, and a larger DEF of 1.6 was observed when BCNU was given immediately before the radiation dose. However, with a different mouse strain (BALB/c) not anesthetized at the time of irradiation, no significant enhancement following a dose of 20 mg/kg BCNU was observed. Experiments are in progress to determine the cause of these differences. BCNU (10 mg/kg) was given 24 hr or immediately prior to various single doses of radiation to a 12 mm segment of the mouse spinal cord (T/sub 11-12/ to L/sub 1-2/), and the subsequent myelitis was scored monthly. The addition of BCNU to irradiation did not accelerate the development of myelitis, not the ultimate proportion of animals developing hind limb paralysis: the 50% myelitis dose at 10 months (MD/sub 50/10/sub mo/) values for irradiation alone, BCNU at the time of irradiation and 24 hr before were 3,722, 3,795 and 3,853 rad, respectively

  13. Epithelial cell kinetics in mouse and rat skin irradiated with electrons

    International Nuclear Information System (INIS)

    McMaster-Schuyler, L.

    1984-02-01

    Experiments were performed to examine the kinetic responses of mouse and rat epidermal cells in vivo after single doses of ionizing radiation including responses of hair follicles at times after irradiation. The labeling indices in both species were reduced to 30 to 50% of control values immediately following irradiation at all the doses. In the rat, the labeling indices recovered and overshot control values within the first three days after 300 to 1200 rads. The mouse labeling indices continued to be suppressed for up to 10 days after 300 to 2400 rads. This indicated that rat G 1 phase epidermal cells recovered three times faster than those of the mouse with respect to the ability to maintain or increase control level cell proliferation after irradiation. After 1800 and 2400 rads, doses which produce skin ulceration, both species showed a reduction in their labeling indices for up to 7 days, indicating that a dose-dependent mechanism of recovery may be operable in the rat. 99 refs., 15 figs., 6 tabs

  14. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  15. The co-application effects of fullerene and ascorbic acid on UV-B irradiated mouse skin

    International Nuclear Information System (INIS)

    Ito, Shinobu; Itoga, Kazuyoshi; Yamato, Masayuki; Akamatsu, Hirohiko; Okano, Teruo

    2010-01-01

    The role of fullerene as a pro-oxidant or anti-oxidant in Ultraviolet B ray (UV-B)-induced disorders in mouse skin was investigated. Fullerene gave no photo-toxic effect to UV-B-irradiated mouse skin. Since erythema was concentrated at the pore circumference in a UV-B irradiation experiment in mouse skin, the sebaceous gland pairs was strongly implicated as a site for the generation of reactive oxygen species (ROS). In a histological evaluation of the skin stained with CH 3 MDFDA (ROS index) and YO-Pro-1 (apoptosis index), the fluorescence intensity of a sebaceous gland significantly increased with UV-B irradiation. With the application of fullerene to UV-irradiated mouse skin, no toxicity was recognized in comparison with the control, and erythema, the ROS index, and the apoptosis index decrease with the application of fullerene. Ascorbyl radical (AA·) increased with the application of ascorbate (AA) to UV-B-irradiated mouse skin, and AA· decreased with the application of fullerene. The co-application of AA and fullerene, which suppressed AA· in vitro, significantly suppressed erythema, and also suppressed both the ROS index and apoptosis index in mouse skin after UV-B irradiation. In both mouse skin at 48 h after UV-B irradiation and in an attempt to reproduce this phenomenon artificially in vitro, a similar high AA· peak (AA·/H· > 4) was observed in electron spin resonance (ESR) charts. The binding of fullerene with AA impairs the Fenton reaction between AA and Fe-protein based on the observation of ascorbate-specific UV absorption and a linear equation for the calibration curve. Therefore, fullerene may impair the intercalation of AA to a heme pocket by binding with AA. These results suggest that the co-application of AA and fullerene is effective against oxidative skin damage caused by UV-B irradiation, and the development of an AA· inhibitor such as fullerene should be useful for reducing organ damage associated with Fe-protein oxidation.

  16. Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.

    Science.gov (United States)

    Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A

    2009-08-01

    The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.

  17. Study of the mechanisms of flux enhancement through hairless mouse skin by pulsed DC iontophoresis

    International Nuclear Information System (INIS)

    Pikal, M.J.; Shah, S.

    1991-01-01

    Enhanced iontophoretic transport using pulsed DC is usually explained by citing the observed decrease in skin resistance caused by an increase in AC pulse frequency at very small currents. Alternately, it has been suggested that the on-to-off nature of pulsed DC imparts an impact energy to the fluid, thereby increasing transport. This report provides a test of these mechanisms for enhanced delivery via pulsed iontophoresis. The DC resistance of hairless mouse skin during continuous and pulsed DC iontophoresis is measured as a function of time for selected pulse frequencies and duty cycles using current densities ranging from 0.1 to 1.0 mA/cm2. As a test of the impact energy mechanism, the iontophoretic transport of 14C-glucose measured with pulsed DC is compared with similar data obtained previously using continuous DC. It is suggested that pulsed current can yield lower resistance and enhanced drug delivery provided that (a) the steady-state current during the on phase of the pulse is very small and (b) the frequency is low enough to allow depolarization of the skin during the off phase of the pulse. The glucose transport results suggest that the impact energy concept does not apply to iontophoresis

  18. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  19. UVA-induced mutational spectra in the laci gene from transgenic mouse skin

    International Nuclear Information System (INIS)

    Gorelick, N.J.; O'Kelly, J.A.; Biedermann, K.A.

    1995-01-01

    The UVB (295-320 nm) component of sunlight was once thought to be the sole cause of photoaging and skin cancer. However, there is now compelling evidence to suggest that chronic irradiation with UVA (320-400 nm) is a significant component of the etiologies of these diseases. To identify acute markers of UVA damage, we investigated UVA-induced mutagenesis in vivo by using a lacI transgenic mouse mutation assay. The backs of adult female C57BL/6 Big Blue reg-sign mice were shaved and exposed daily to a low or a high dose of UVA for 5 consecutive days. One group remained unexposed. The high dose of UVA significantly increased the mutant frequency in skin determined 12 days after the last exposure. Mutant frequencies were (Avg ± SEM, n=7-8/group): 6.1 ± 0.5 x 10 -5 (high dose). DNA sequence analysis of mutant lacI genes demonstrated that the high dose of UVA produced a different mutational spectrum compared to control. The mutational spectrum from the low dose mutants was not different from the control spectrum in skin generated previously; the predominant classes of recovered mutations were GC→At transitions at CpG sites (11/35) and GC →TA transversions (12/35). In contrast, in the high dose group, GC →AT transitions at non-CpG sites predominated (61/97 mutations); three tandem base substitutions (1 GG →AA; 2 CC→TT) were uniquely recovered; and an increased frequency of recovered GC→CG substitutions was observed (12/97 vs. none in controls). The recovered high dose spectrum is consistent with the types of DNA damage generated by UVA as well as by reactive oxygen species. These studies demonstrate that UVA is mutagenic in vivo and that this assay can be used to study early events in UVA-induced skin damage

  20. Photocarcinogenesis and persistent hyperplasia in UV-irradiated SENCAR mouse skin

    International Nuclear Information System (INIS)

    Strickland, P.T.

    1986-01-01

    Susceptibility to photocarcinogenesis has been examined in several mouse strains and stocks including SENCAR, CD-1, BALB/c, C3H, C57Bl, and NZB. SENCAR mice are hypersusceptible to tumorigenesis caused by single high dose exposures to ultraviolet (UV) radiation but not by chronic low-dose exposures. SENCAR mice also exhibit an exaggerated and persistent epidermal hyperplasia in response to UV-induced tissue damage. The persistent hyperplasia is apparently due to a sustained proliferation of the epithelial basal cells, rather than to delayed cell differentiation. SENCAR mice did not exhibit persistent hyperplasia following other forms of tissue damage (surgical or thermal). In related studies, the levels of thymine dimers induced in SENCAR epidermis by UV radiation were comparable to those observed in BALB/c epidermis. In addition, no differences were found in the tissue distribution or persistence of thymine dimers in SENCAR and BALB/c skin

  1. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  2. Keratinocyte-Derived Chemokines Orchestrate T-Cell Positioning in the Epidermis during Vitiligo and May Serve as Biomarkers of Disease.

    Science.gov (United States)

    Richmond, Jillian M; Bangari, Dinesh S; Essien, Kingsley I; Currimbhoy, Sharif D; Groom, Joanna R; Pandya, Amit G; Youd, Michele E; Luster, Andrew D; Harris, John E

    2017-02-01

    Vitiligo is an autoimmune disease of the skin that results in the destruction of melanocytes and the clinical appearance of white spots. Disease pathogenesis depends on IFN-γ and IFN-γ-induced chemokines to promote T-cell recruitment to the epidermis where melanocytes reside. The skin is a complex organ, with a variety of resident cell types. We sought to better define the microenvironment and distinct cellular contributions during autoimmunity in vitiligo, and we found that the epidermis is a chemokine-high niche in both a mouse model and human vitiligo. Analysis of chemokine expression in mouse skin showed that CXCL9 and CXCL10 expression strongly correlate with disease activity, whereas CXCL10 alone correlates with severity, supporting them as potential biomarkers for following disease progression. Further studies in both our mouse model and human patients showed that keratinocytes were the major chemokine producers throughout the course of disease, and functional studies using a conditional signal transducer and activator of transcription (STAT)-1 knockout mouse showed that IFN-γ signaling in keratinocytes was critical for disease progression and proper autoreactive T-cell homing to the epidermis. In contrast, epidermal immune cell populations including endogenous T cells, Langerhans cells, and γδ T cells were not required. These results have important clinical implications, because topical therapies that target IFN-γ signaling in keratinocytes could be safe and effective new treatments, and skin expression of these chemokines could be used to monitor disease activity and treatment responses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Sulforaphane induces phase II detoxication enzymes in mouse skin and prevents mutagenesis induced by a mustard gas analog

    Energy Technology Data Exchange (ETDEWEB)

    Abel, E.L. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States); Boulware, S. [Division of Pharmacy and Toxicology, College of Pharmacy, The University of Texas at Austin, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd., Austin, TX 78723 (United States); Fields, T.; McIvor, E.; Powell, K.L. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States); DiGiovanni, J.; Vasquez, K.M. [Division of Pharmacy and Toxicology, College of Pharmacy, The University of Texas at Austin, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd., Austin, TX 78723 (United States); MacLeod, M.C., E-mail: mcmacleod@mdanderson.org [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States)

    2013-02-01

    Mustard gas, used in chemical warfare since 1917, is a mutagenic and carcinogenic agent that produces severe dermal lesions for which there are no effective therapeutics; it is currently seen as a potential terrorist threat to civilian populations. Sulforaphane, found in cruciferous vegetables, is known to induce enzymes that detoxify compounds such as the sulfur mustards that react through electrophilic intermediates. Here, we observe that a single topical treatment with sulforaphane induces mouse epidermal levels of the regulatory subunit of glutamate-cysteine ligase, the rate-limiting enzyme in glutathione biosynthesis, and also increases epidermal levels of reduced glutathione. Furthermore, a glutathione S-transferase, GSTA4, is also induced in mouse skin by sulforaphane. In an in vivo model in which mice are given a single mutagenic application of the sulfur mustard analog 2-(chloroethyl) ethyl sulfide (CEES), we now show that therapeutic treatment with sulforaphane abolishes the CEES-induced increase in mutation frequency in the skin, measured four days after exposure. Sulforaphane, a natural product currently in clinical trials, shows promise as an effective therapeutic against mustard gas. -- Highlights: ► Sulforaphane induces increased levels of glutathione in mouse skin. ► Sulforaphane induces increased levels of GSTA4 in mouse skin. ► Sulforaphane, applied after CEES-treatment, completely abolishes CEES-mutagenesis. ► The therapeutic effect may suggest a long biological half-life for CEES in vivo.

  4. Reduction of radiation-induced early skin damage (mouse foot) by 0-(β-hydroxyaethyl)-rutoside

    International Nuclear Information System (INIS)

    Fritz-Niggli, H.; Froehlich, E.

    1980-01-01

    The effect of a bioflavonoid, 0-(β-hydroxyethyl)-rutoside (HR) on early radiation-induced skin damage was examined, using the mouse foot system; the response to radiation is not species specific and comparison with the clinical situation is therefore possible. The aim was to see whether HR, which is highly effective in protecting against late damage, is also able to reduce early effects. Early reactions were considered to be erythema, swelling and ulceration and occurring up to 30 days after irradiation. It was found that HR significantly reduces early damage, both after a single dose and after fractionated irradiation with low doses. A single pre-treatment dose of HR and pre-treatment together with 30 days post-treatment administration were both found to be effective. The protective effect became more marked with increasing radiation dose (single irradiation). Reduction of late effects is produced iptimally by an interval of 0.25 hours between application of HR and irradiation, and this is also true for early skin damage. The early effects are partly reversible, but there is possibly an interesting correlation between these and irreversible late effects (such as loss of toes); a similar mechanism, presumably affecting the vascular system, may therefore be postulated. The protective action of this well tolesated, highly effective substance, which apparently protects normal tissues from early and late injury, is discussed. (orig.) [de

  5. Validity of reciprocity rule on mouse skin thermal damage due to CO2 laser irradiation

    Science.gov (United States)

    Parvin, P.; Dehghanpour, H. R.; Moghadam, M. S.; Daneshafrooz, V.

    2013-07-01

    CO2 laser (10.6 μm) is a well-known infrared coherent light source as a tool in surgery. At this wavelength there is a high absorbance coefficient (860 cm-1), because of vibration mode resonance of H2O molecules. Therefore, the majority of the irradiation energy is absorbed in the tissue and the temperature of the tissue rises as a function of power density and laser exposure duration. In this work, the tissue damage caused by CO2 laser (1-10 W, ˜40-400 W cm-2, 0.1-6 s) was measured using 30 mouse skin samples. Skin damage assessment was based on measurements of the depth of cut, mean diameter of the crater and the carbonized layer. The results show that tissue damage as assessed above parameters increased with laser fluence and saturated at 1000 J cm-2. Moreover, the damage effect due to high power density at short duration was not equivalent to that with low power density at longer irradiation time even though the energy delivered was identical. These results indicate the lack of validity of reciprocity (Bunsen-Roscoe) rule for the thermal damage.

  6. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  7. Thymoquinone inhibits phorbol ester-induced activation of NF-κB and expression of COX-2, and induces expression of cytoprotective enzymes in mouse skin in vivo

    International Nuclear Information System (INIS)

    Kundu, Joydeb Kumar; Liu, Lijia; Shin, Jun-Wan; Surh, Young-Joon

    2013-01-01

    Highlights: •Thymoquinone inhibits phorbol ester-induced COX-2 expression in mouse skin. •Thymoquinone attenuates phosphorylation of IκBα and DNA binding of NF-κB in mouse skin. •Thymoquinone inhibits phosphorylation of p38 MAP kinase, JNK and Akt in mouse skin. •Thymoquinone induces the expression of cytoprotective proteins in mouse skin. -- Abstract: Thymoquinone (TQ), the active ingredient of Nigella sativa, has been reported to possess anti-inflammatory and chemopreventive properties. The present study was aimed at elucidating the molecular mechanisms of anti-inflammatory and antioxidative activities of thymoquinone in mouse skin. Pretreatment of female HR-1 hairless mouse skin with TQ attenuated 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced expression of cyclooxygenase-2 (COX-2). TQ diminished nuclear translocation and the DNA binding of nuclear factor-kappaB (NF-κB) via the blockade of phosphorylation and subsequent degradation of IκBα in TPA-treated mouse skin. Pretreatment with TQ attenuated the phosphorylation of Akt, c-Jun-N-terminal kinase and p38 mitogen-activated protein kinase, but not that of extracellular signal-regulated kinase-1/2. Moreover, topical application of TQ induced the expression of heme oxygenase-1, NAD(P)H-quinoneoxidoreductase-1, glutathione-S-transferase and glutamate cysteine ligase in mouse skin. Taken together, the inhibitory effects of TQ on TPA-induced COX-2 expression and NF-κB activation, and its ability to induce the expression of cytoprotective proteins provide a mechanistic basis of anti-inflammatory and antioxidative effects of TQ in hairless mouse skin

  8. Preclinical study of mouse pluripotent parthenogenetic embryonic stem cell derivatives for the construction of tissue-engineered skin equivalent.

    Science.gov (United States)

    Rao, Yang; Cui, Jihong; Yin, Lu; Liu, Wei; Liu, Wenguang; Sun, Mei; Yan, Xingrong; Wang, Ling; Chen, Fulin

    2016-10-22

    Embryonic stem cell (ESC) derivatives hold great promise for the construction of tissue-engineered skin equivalents (TESE). However, harvesting of ESCs destroys viable embryos and may lead to political and ethical concerns over their application. In the current study, we directed mouse parthenogenetic embryonic stem cells (pESCs) to differentiate into fibroblasts, constructed TESE, and evaluated its function in vivo. The stemness marker expression and the pluripotent differentiation ability of pESCs were tested. After embryoid body (EB) formation and adherence culture, mesenchymal stem cells (MSCs) were enriched and directed to differentiate into fibroblastic lineage. Characteristics of derived fibroblasts were assessed by quantitative real-time PCR and ELISA. Functional ability of the constructed TESE was tested by a mouse skin defects repair model. Mouse pESCs expressed stemness marker and could form teratoma containing three germ layers. MSCs could be enriched from outgrowths of EBs and directed to differentiate into fibroblastic lineage. These cells express a high level of growth factors including FGF, EGF, VEGF, TGF, PDGF, and IGF1, similar to those of ESC-derived fibroblasts and mouse fibroblasts. Seeded into collagen gels, the fibroblasts derived from pESCs could form TESE. Mouse skin defects could be successfully repaired 15 days after transplantation of TESE constructed by fibroblasts derived from pESCs. pESCs could be induced to differentiate into fibroblastic lineage, which could be applied to the construction of TESE and skin defect repair. Particularly, pESC derivatives avoid the limitations of political and ethical concerns, and provide a promising source for regenerative medicine.

  9. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  10. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Katherine J Zappia

    Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.

  11. Multimodality pH imaging in a mouse dorsal skin fold window chamber model

    Science.gov (United States)

    Leung, Hui Min; Schafer, Rachel; Pagel, Mark M.; Robey, Ian F.; Gmitro, Arthur F.

    2013-03-01

    Upregulate levels of expression and activity of membrane H+ ion pumps in cancer cells drives the extracellular pH (pHe,) to values lower than normal. Furthermore, disregulated pH is indicative of the changes in glycolytic metabolism in tumor cells and has been shown to facilitate extracellular tissue remodeling during metastasis Therefore, measurement of pHe could be a useful cancer biomarker for diagnostic and therapy monitoring evaluation. Multimodality in-vivo imaging of pHe in tumorous tissue in a mouse dorsal skin fold window chamber (DSFWC) model is described. A custom-made plastic window chamber structure was developed that is compatible with both imaging optical and MR imaging modalities and provides a model system for continuous study of the same tissue microenvironment on multiple imaging platforms over a 3-week period. For optical imaging of pHe, SNARF-1 carboxylic acid is injected intravenously into a SCID mouse with an implanted tumor. A ratiometric measurement of the fluorescence signal captured on a confocal microscope reveals the pHe of the tissue visible within the window chamber. This imaging method was used in a preliminary study to evaluate sodium bicarbonate as a potential drug treatment to reverse tissue acidosis. For MR imaging of pHe the chemical exchange saturation transfer (CEST) was used as an alternative way of measuring pHe in a DSFWC model. ULTRAVIST®, a FDA approved x-ray/CT contrast agent has been shown to have a CEST effect that is pH dependent. A ratiometric analysis of water saturation at 5.6 and 4.2 ppm chemical shift provides a means to estimate the local pHe.

  12. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA......-FABP as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... with epidermal growth factor (EGF), pituitary extract, and 10% fetal calf serum] revealed a strong up-regulation of PA-FABP, psoriasin, calgranulins A and B, and a few other proteins that are highly expressed in psoriatic skin. The levels of these proteins exceeded by far those observed in non-cultured normal...

  13. The response of mouse skin to multiple small doses of radiation

    International Nuclear Information System (INIS)

    Denekamp, J.; Harris, S.R.

    1975-01-01

    The response of mouse skin has been tested by irradiating the foot of albino mice and scoring erythema and desquamation during the following month. Multiple small doses of 150, 250 and 350 rad have been given 'daily', and the test dose necessary to achieve a given reaction has been determined one day after the last small fraction. This test dose has been compared with the single dose necessary to produce the same reaction level in previously untreated mice, in order to determine the ratio of the slopes of the dose-response curve at low and high doses: Slope ratio = (single dose - test dose)/total fractionated priming dose. In three separate experiments the slope ratio decreased as the dose per fraction was reduced from 350 to 150 rad. This conflicts with the data of Dutreix et al, who found a constant slope ratio over this dose range. The present data are compared with those obtained by Denekamp using 4, 9 and 14 fractions of 300 rad and by Douglas et al, using the same experimental technique, over the dose range 45 to 200 rad/fraction. In addition, the results from multifraction experiments in which equal dose increments were administered until the requisite skin reaction was achieved are also analysed in terms of their slope ratio (Fowler et al. Douglas et al). When all these results are plotted it is impossible to be sure whether the slope ratio is decreasing over the range 300 to 45 rad per fraction, although it seems likely. Most of the values at low doses lie in the range 0.15 to 0.25, indicating that at low doses the radiation is only 15 to 25% as effective per rad in causing cell death as at higher doses. (author)

  14. Effect of Thai banana (Musa AA group) in reducing accumulation of oxidation end products in UVB-irradiated mouse skin.

    Science.gov (United States)

    Leerach, Nontaphat; Yakaew, Swanya; Phimnuan, Preeyawass; Soimee, Wichuda; Nakyai, Wongnapa; Luangbudnark, Witoo; Viyoch, Jarupa

    2017-03-01

    Chronic UVB exposure causes skin disorders and cancer through DNA strand breaks and oxidation of numerous functional groups of proteins and lipids in the skin. In this study, we investigated the effects of Thai banana (Musa AA group, "Khai," and Musa ABB group, "Namwa") on the prevention of UVB-induced skin damage when fed to male ICR mice. Mice were orally fed banana (Khai or Namwa) fruit pulps at dose of 1mg/g body weight/day for 12weeks. The shaved backs of the mice were irradiated with UVB for 12weeks. The intensity dose of UVB-exposure was increased from 54mJ/cm 2 /exposure at week 1 to 126mJ/cm 2 /exposure at week 12. A significant increase in skin thickness, lipid peroxidation, protein oxidation end products, and expression of MMP-1 was observed in UVB-irradiated mouse skin. A reduction in the accumulation of oxidation end products was found in the skin of UVB-irradiated mice receiving Khai. This occurred in conjunction with a reduction in MMP-1 expression, inhibition of epidermal thickening, and induction of γ-GCS expression. The dietary intake of Khai prevented skin damage from chronic UVB exposure by increased γ-GCS expression and reduced oxidation end products included carbonyls, malondialdehyde and 4-hydroxynonenal. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Topical glycerol monooleate/propylene glycol formulations enhance 5-aminolevulinic acid in vitro skin delivery and in vivo protophorphyrin IX accumulation in hairless mouse skin.

    Science.gov (United States)

    Steluti, Regilene; De Rosa, Fernanda Scarmato; Collett, John; Tedesco, Antônio Cláudio; Bentley, Maria Vitória Lopes Badra

    2005-08-01

    Photodynamic therapy (PDT), a potential therapy for cancer treatment, utilizes exogenously applied or endogenously formed photosensitizers, further activated by light in an appropriate wavelength and dose to induce cell death through free radical formation. 5-Aminolevulinic acid (5-ALA) is a pro-drug which can be converted to the effective photosensitizer, protoporphyrin IX (PpIX). However, the use of 5-ALA in PDT is limited by the low penetration capacity of this highly hydrophilic molecule into appropriate skin layers. In the present study, we propose to increase 5-ALA penetration by using formulations containing glycerol monooleate (GMO), an interesting and useful component of pharmaceutical formulations. Propylene glycol solutions containing different concentrations of GMO significantly increased the in vitro skin permeation/retention of 5-ALA in comparison to control solutions. In vivo studies also showed increased PpIX accumulation in mouse hairless skin, after the use of topical 5-ALA formulations containing GMO in a concentration-dependent manner. The results show that skin 5-ALA penetration and PpIX accumulation, important factors for the success of topical 5-ALA-PDT in skin cancer, are optimized by GMO/propylene glycol formulations.

  16. The excimer lamp induces cutaneous nerve degeneration and reduces scratching in a dry-skin mouse model.

    Science.gov (United States)

    Kamo, Atsuko; Tominaga, Mitsutoshi; Kamata, Yayoi; Kaneda, Kazuyuki; Ko, Kyi C; Matsuda, Hironori; Kimura, Utako; Ogawa, Hideoki; Takamori, Kenji

    2014-12-01

    Epidermal hyperinnervation, which is thought to underlie intractable pruritus, has been observed in patients with atopic dermatitis (AD). The epidermal expression of axonal guidance molecules has been reported to regulate epidermal hyperinnervation. Previously, we showed that the excimer lamp has antihyperinnervative effects in nonpruritic dry-skin model mice, although epidermal expression of axonal guidance molecules was unchanged. Therefore, we investigated the antipruritic effects of excimer lamp irradiation and its mechanism of action. A single irradiation of AD model mice significantly inhibited itch-related behavior 1 day later, following improvement in the dermatitis score. In addition, irradiation of nerve fibers formed by cultured dorsal root ganglion neurons increased bleb formation and decreased nerve fiber expression of nicotinamide mononucleotide adenylyl transferase 2, suggesting degenerative changes in these fibers. We also analyzed whether attaching a cutoff excimer filter (COF) to the lamp, thus decreasing cytotoxic wavelengths, altered hyperinnervation and the production of cyclobutane pyrimidine dimer (CPD), a DNA damage marker, in dry-skin model mice. Irradiation with COF decreased CPD production in keratinocytes, as well as having an antihyperinnervative effect, indicating that the antipruritic effects of excimer lamp irradiation with COF are due to induction of epidermal nerve degeneration and reduced DNA damage.

  17. The plasma membrane-associated NADH oxidase (ECTO-NOX) of mouse skin responds to blue light

    Science.gov (United States)

    Morre, D. James; Morre, Dorothy M.

    2003-01-01

    NADH oxidases of the external plasma membrane surface (ECTO-NOX proteins) are characterized by oscillations in activity with a regular period length of 24 min. Explants of mouse skin exhibit the oscillatory activity as estimated from the decrease in A(340) suggesting that individual ECTO-NOX molecules must somehow be induced to function synchronously. Transfer of explants of mouse skin from darkness to blue light (495 nm, 2 min, 50 micromol m(-1) s(-1)) resulted in initiation of a new activity maximum (entrainment) with a midpoint 36 min after light exposure followed by maxima every 24 min thereafter. Addition of melatonin resulted in a new maximum 24 min after melatonin addition. The findings suggest that the ECTO-NOX proteins play a central role in the entrainment of the biological clock both by light and by melatonin.

  18. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....

  19. IL-22 is required for Th17 cell-mediated pathology in a mouse model of psoriasis-like skin inflammation.

    Science.gov (United States)

    Ma, Hak-Ling; Liang, Spencer; Li, Jing; Napierata, Lee; Brown, Tom; Benoit, Stephen; Senices, Mayra; Gill, Davinder; Dunussi-Joannopoulos, Kyriaki; Collins, Mary; Nickerson-Nutter, Cheryl; Fouser, Lynette A; Young, Deborah A

    2008-02-01

    Psoriasis is a chronic skin disease resulting from the dysregulated interplay between keratinocytes and infiltrating immune cells. We report on a psoriasis-like disease model, which is induced by the transfer of CD4(+)CD45RB(hi)CD25(-) cells to pathogen-free scid/scid mice. Psoriasis-like lesions had elevated levels of antimicrobial peptide and proinflammatory cytokine mRNA. Also, similar to psoriasis, disease progression in this model was dependent on the p40 common to IL-12 and IL-23. To investigate the role of IL-22, a Th17 cytokine, in disease progression, mice were treated with IL-22-neutralizing antibodies. Neutralization of IL-22 prevented the development of disease, reducing acanthosis (thickening of the skin), inflammatory infiltrates, and expression of Th17 cytokines. Direct administration of IL-22 into the skin of normal mice induced both antimicrobial peptide and proinflammatory cytokine gene expression. Our data suggest that IL-22, which acts on keratinocytes and other nonhematopoietic cells, is required for development of the autoreactive Th17 cell-dependent disease in this model of skin inflammation. We propose that IL-22 antagonism might be a promising therapy for the treatment of human psoriasis.

  20. IL-22 is required for Th17 cell–mediated pathology in a mouse model of psoriasis-like skin inflammation

    Science.gov (United States)

    Ma, Hak-Ling; Liang, Spencer; Li, Jing; Napierata, Lee; Brown, Tom; Benoit, Stephen; Senices, Mayra; Gill, Davinder; Dunussi-Joannopoulos, Kyriaki; Collins, Mary; Nickerson-Nutter, Cheryl; Fouser, Lynette A.; Young, Deborah A.

    2008-01-01

    Psoriasis is a chronic skin disease resulting from the dysregulated interplay between keratinocytes and infiltrating immune cells. We report on a psoriasis-like disease model, which is induced by the transfer of CD4+CD45RBhiCD25– cells to pathogen-free scid/scid mice. Psoriasis-like lesions had elevated levels of antimicrobial peptide and proinflammatory cytokine mRNA. Also, similar to psoriasis, disease progression in this model was dependent on the p40 common to IL-12 and IL-23. To investigate the role of IL-22, a Th17 cytokine, in disease progression, mice were treated with IL-22–neutralizing antibodies. Neutralization of IL-22 prevented the development of disease, reducing acanthosis (thickening of the skin), inflammatory infiltrates, and expression of Th17 cytokines. Direct administration of IL-22 into the skin of normal mice induced both antimicrobial peptide and proinflammatory cytokine gene expression. Our data suggest that IL-22, which acts on keratinocytes and other nonhematopoietic cells, is required for development of the autoreactive Th17 cell–dependent disease in this model of skin inflammation. We propose that IL-22 antagonism might be a promising therapy for the treatment of human psoriasis. PMID:18202747

  1. Blue light-induced oxidative stress in live skin.

    Science.gov (United States)

    Nakashima, Yuya; Ohta, Shigeo; Wolf, Alexander M

    2017-07-01

    Skin damage from exposure to sunlight induces aging-like changes in appearance and is attributed to the ultraviolet (UV) component of light. Photosensitized production of reactive oxygen species (ROS) by UVA light is widely accepted to contribute to skin damage and carcinogenesis, but visible light is thought not to do so. Using mice expressing redox-sensitive GFP to detect ROS, blue light could produce oxidative stress in live skin. Blue light induced oxidative stress preferentially in mitochondria, but green, red, far red or infrared light did not. Blue light-induced oxidative stress was also detected in cultured human keratinocytes, but the per photon efficacy was only 25% of UVA in human keratinocyte mitochondria, compared to 68% of UVA in mouse skin. Skin autofluorescence was reduced by blue light, suggesting flavins are the photosensitizer. Exposing human skin to the blue light contained in sunlight depressed flavin autofluorescence, demonstrating that the visible component of sunlight has a physiologically significant effect on human skin. The ROS produced by blue light is probably superoxide, but not singlet oxygen. These results suggest that blue light contributes to skin aging similar to UVA. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Integrin β4 Regulates Migratory Behavior of Keratinocytes by Determining Laminin-332 Organization*s

    Science.gov (United States)

    Sehgal, Bernd U.; DeBiase, Phillip J.; Matzno, Sumio; Chew, Teng-Leong; Claiborne, Jessica N.; Hopkinson, Susan B.; Russell, Alan; Marinkovich, M. Peter; Jones, Jonathan C. R.

    2010-01-01

    Whether α6β4 integrin regulates migration remains controversial. β4 integrin-deficient (JEB) keratinocytes display aberrant migration in that they move in circles, a behavior that mirrors the circular arrays of laminin (LM)-332 in their matrix. In contrast, wild-type keratinocytes and JEB keratinocytes, induced to express β4 integrin, assemble laminin-332 in linear tracks over which they migrate. Moreover, laminin-332-dependent migration of JEB keratinocytes along linear tracks is restored when cells are plated on wild-type keratinocyte matrix, whereas wild-type keratinocytes show rotation over circular arrays of laminn-332 in JEB keratinocyte matrix. The activities of Rac1 and the actin cytoskeleton-severing protein cofilin are low in JEB keratinocytes compared with wild-type cells but are rescued following expression of wild-type β4 integrin in JEB cells. Additionally, in wild-type keratinocytes Rac1 is complexed with α6β4 integrin. Moreover, Rac1 or cofilin inactivation induces wild-type keratinocytes to move in circles over rings of laminin-332 in their matrix. Together these data indicate that laminin-332 matrix organization is determined by the α6β4 integrin/actin cytoskeleton via Rac1/cofilin signaling. Furthermore, our results imply that the organizational state of laminin-332 is a key determinant of the motility behavior of keratinocytes, an essential element of skin wound healing and the successful invasion of epidermal-derived tumor cells. PMID:16973601

  3. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    International Nuclear Information System (INIS)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-01-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  4. Expression analysis of the mouse S100A7/psoriasin gene in skin inflammation and mammary tumorigenesis

    International Nuclear Information System (INIS)

    Webb, Meghan; Myal, Yvonne; Shiu, Robert; Murphy, Leigh C; Watson, Peter H; Emberley, Ethan D; Lizardo, Michael; Alowami, Salem; Qing, Gefei; Alfia'ar, Abdullah; Snell-Curtis, Linda J; Niu, Yulian; Civetta, Alberto

    2005-01-01

    The human psoriasin (S100A7) gene has been implicated in inflammation and tumor progression. Implementation of a mouse model would facilitate further investigation of its function, however little is known of the murine psoriasin gene. In this study we have cloned the cDNA and characterized the expression of the potential murine ortholog of human S100A7/psoriasin in skin inflammation and mammary tumorigenesis. On the basis of chromosomal location, phylogenetic analysis, amino acid sequence similarity, conservation of a putative Jab1-binding motif, and similarities of the patterns of mouse S100A7/psoriasin gene expression (measured by RT-PCR and in-situ hybridization) with those of human S100A7/psoriasin, we propose that mouse S100A7/psoriasin is the murine ortholog of human psoriasin/S100A7. Although mouse S100A7/psoriasin is poorly conserved relative to other S100 family members, its pattern of expression parallels that of the human psoriasin gene. In murine skin S100A7/psoriasin was significantly upregulated in relation to inflammation. In murine mammary gland expression is also upregulated in mammary tumors, where it is localized to areas of squamous differentiation. This mirrors the context of expression in human tumor types where both squamous and glandular differentiation occur, including cervical and lung carcinomas. Additionally, mouse S100A7/psoriasin possesses a putative Jab1 binding motif that mediates many downstream functions of the human S100A7 gene. These observations and results support the hypothesis that the mouse S100A7 gene is structurally and functionally similar to human S100A7 and may offer a relevant model system for studying its normal biological function and putative role in tumor progression

  5. Cyr61/CCN1 induces CCL20 production by keratinocyte via activating p38 and JNK/AP-1 pathway in psoriasis.

    Science.gov (United States)

    Li, Huidan; Li, Haichuan; Huo, Rongfen; Wu, Pinru; Shen, Zhengyu; Xu, Hui; Shen, Baihua; Li, Ningli

    2017-10-01

    Psoriasis is a common chronic skin disease characterized by epidermal hyperplasia and inflammation. Cysteine-rich angiogenic inducer 61 (Cyr61/CCN1) has recently been implicated in psoriasis pathogenesis by promoting keratinocyte activation. However, the mechanisms by which CCN1 enhances cutaneous inflammation are not fully understood. In this study, we investigated the role of CCN1 on the expression of CCL20 in human keratinocyte. By double-label immunofluorescence staining, we first identified that the expression of CCN1 colocalized well with CCL20 production in the epidermis of psoriasis skin lesion. Furthermore, in vivo, blocking or knockdown CCN1 expression ameliorated skin inflammation and reduced the expression of CCL20 in both imiquimod and IL-23-induced psoriasis-like mouse models, which indicated that CCN1 might be involved in the regulation of CCL20 production in psoriasis. Next, in vitro, we stimulated primary normal human epidermal keratinocyte (NHEK) with exogenous protein CCN1 and found that CCN1 directly upregulated CCL20 production independent of TNF-α, IL-22 and IL-17 pathway. Lastly, the signaling pathway study showed that CCN1 enhanced the binding of AP-1 to the CCL20 promoter via crosstalk with p38 and JNK. Our study demonstrates that CCN1 stimulates CCL20 production in vitro and in vivo, and thus supports the notion that overexpressed CCN1 in hyperproliferating keratinocyte is functionally involved in the recruitment of inflammatory cells to skin lesions affected by psoriasis. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  6. Loss of Endogenous Interleukin-12 Activates Survival Signals in Ultraviolet-Exposed Mouse Skin and Skin Tumors

    Directory of Open Access Journals (Sweden)

    Syed M. Meeran

    2009-09-01

    Full Text Available Interleukin-12 (IL-12-deficiency promotes photocarcinogenesis in mice; however, the molecular mechanisms underlying this effect have not been fully elucidated. Here, we report that long-term exposure to ultraviolet (UV radiation resulted in enhancement of the levels of cell survival kinases, such as phosphatidylinositol 3-kinase (PI3K, Akt (Ser473, p-ERK1/2, and p-p38 in the skin of IL-12p40 knockout (IL-12 KO mice compared with the skin of wild-type mice. UV-induced activation of nuclear factor-κB (NF-κB/p65 in the skin of IL-12 KO mice was also more prominent. The levels of NF-κB-targeted proteins, such as proliferating cell nuclear antigen (PCNA, cyclooxygenase-2, cyclin D1, and inducible nitric oxide synthase, were higher in the UV-exposed skin of IL-12 KO mice than the UV-exposed skin of wild types. In short-term UV irradiation experiments, subcutaneous treatment of IL-12 KO mice with recombinant IL-12 (rIL-12 or topical treatment with oridonin, an inhibitor of NF-κB, resulted in the inhibition of UV-induced increases in the levels of PCNA, cyclin D1, and NF-κB compared with non-rIL-12- or non-oridonin-treated IL-12 KO mice. UV-induced skin tumors of IL-12 KO mice had higher levels of PI3K, p-Akt (Ser473, p-ERK1/2, p-p38, NF-κB, and PCNA and fewer apoptotic cells than skin tumors of wild types. Together, these data suggest that the loss of endogenous IL-12 activates survival signals in UV-exposed skin and that may lead to the enhanced photocarcinogenesis in mice.

  7. Cell death induced on cell cultures and nude mouse skin by non-thermal, nanosecond-pulsed generated plasma.

    Directory of Open Access Journals (Sweden)

    Arnaud Duval

    Full Text Available Non-thermal plasmas are gaseous mixtures of molecules, radicals, and excited species with a small proportion of ions and energetic electrons. Non-thermal plasmas can be generated with any high electro-magnetic field. We studied here the pathological effects, and in particular cell death, induced by nanosecond-pulsed high voltage generated plasmas homogeneously applied on cell cultures and nude mouse skin. In vitro, Jurkat cells and HMEC exhibited apoptosis and necrosis, in dose-dependent manner. In vivo, on nude mouse skin, cell death occurred for doses above 113 J/cm(2 for the epidermis, 281 J/cm(2 for the dermis, and 394 J/cm(2 for the hypodermis. Using electron microscopy, we characterized apoptosis for low doses and necrosis for high doses. We demonstrated that these effects were not related to thermal, photonic or pH variations, and were due to the production of free radicals. The ability of cold plasmas to generate apoptosis on cells in suspension and, without any sensitizer, on precise skin areas, opens new fields of application in dermatology for extracorporeal blood cell treatment and the eradication of superficial skin lesions.

  8. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    International Nuclear Information System (INIS)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The effect of previous x-irradiation on the response to hyperthermia (44 0 C), x-irradiation, and irradiation combined with hyperthermia (43 0 C or 44 0 C) was studied in mouse foot skin. Irradiation of mice feet 90 days before, with 20 Gy, increased the subsequent response to heat alone, or combined with irradiation, as well as to irradiation alone. It had little effect on the thermal enhancement ratios for both acute and late skin reactions. Memory of the previous irradiation treatment could be masked when the temperature of the subsequent heat treatment alone, or combined with irradiation, was 44 0 C. Priming heat treatment induced resistance to a subsequent heat treatment and to a subsequent combined irradiation-heat treatment in normal as well as previously irradiated skin. When late skin reaction was considered, a larger 'memory' of the previous irradiation treatment was always evident, compared to acute skin reaction: the 'remembered' dose in the late skin reaction was about twice the 'remembered' dose in the acute reaction. (U.K.)

  9. Photoprotective effects of two natural products on ultraviolet B-induced oxidative stress and apoptosis in SKH-1 mouse skin.

    Science.gov (United States)

    Filip, Adriana; Daicoviciu, Doina; Clichici, Simona; Mocan, Teodora; Muresan, Adriana; Postescu, Ion Dan

    2011-01-01

    Solar ultraviolet radiation (UV) is the major cause of nonmelanoma skin cancer in humans. Photochemoprevention with natural products represents a simple but very effective strategy for the management of cutaneous neoplasia. We studied the photoprotective activity of Calluna vulgaris and red grape seed (Vitis vinifera L, Burgund Mare variety [BM]) extracts in vivo in an SKH-1 hairless mice skin model. Fifty 8-week-old female SKH-1 hairless mice were randomly divided into 5 groups (n = 10 each): controls, UVB-irradiated, C. vulgaris plus UVB-irradiated, BM plus UVB-irradiated, and epigallocatechin gallate (EGCG) plus UVB-irradiated. A dose of 4 mg/mouse per cm² of skin area for both extracts was topically applied to the mice 30 minutes before a single-dose (240 mJ/cm²) UVB exposure. EGCG dissolved in phosphate-buffered saline (pH 6.6; 0.067 M) was administered at 2 mg/mouse per cm². Glutathione peroxidase and catalase activities, reduced glutathione (GSH), malondialdehyde, nitric oxide, and caspase 3 activity were determined in skin homogenates 24 hours after irradiation. A single dose of UVB increased GSH levels and glutathione peroxidase activity in the exposed skin. C. vulgaris and BM pretreatment significantly decreased GSH formation and glutathione peroxidase activity (P treatments with C. vulgaris and particularly BM extracts (P < .002) significantly reduced caspase 3 activity, indicating that the cells were protected against apoptosis. These results suggest that C. vulgaris and BM extracts might be chemopreventive candidates for reducing UV-induced risk for skin cancer.

  10. Photo-protective effect of calcipotriol upon skin photoreaction to UVA and UVB

    International Nuclear Information System (INIS)

    Youn, J.I.; Park, B.S.; Chung, J.H.; Lee, J.H.

    1997-01-01

    It has been shown that 1,25-dihydroxyvitamin D 3 has a photo-protective effect against UVB injury in mouse skin and cultured rat keratinocytes by induction of metallothionein (MT). Calcipotriol is a synthetic analogue of 1,25-dihydroxyvitamin D 3 with equi-potent cell regulating properties, but with a lower risk of calcium-related side effects. The aim of the present study was to see whether calcipotriol has a photo-protective property both in vitro and in vivo. We examined the effect of calcipotriol on UV-induced damage of cultured human keratinocytes through a cell viability assay, and measurement of DNA synthesis by cultured keratinocytes, on UV-induced damage of mouse skin and on minimal erythema dose (MED). We found that calcipotriol was protective against UVB-induced reduction in DNA synthetic activity of cultured keratinocytes in relatively low doses (20 and 40 mJ/cm 2 ) of UVB. With photo-testing following application of calcipotriol, five subjects among 10 healthy volunteers and three among six psoriasis patients showed an increase in MED compared with the vehicle-treated site. These findings imply that calcipotriol may be photo-protective and that more extensive studies with various doses of UV irradiation and modes of calcipotriol delivery are required. (au)

  11. Photo-protective effect of calcipotriol upon skin photoreaction to UVA and UVB

    Energy Technology Data Exchange (ETDEWEB)

    Youn, J.I.; Park, B.S.; Chung, J.H. [Seoul National Univ. College of Medicine, Dept. of Dermatology, Seoul (Korea, Republic of); Lee, J.H. [Inha Univ. College of Medicine, Incheon (Korea, Republic of)

    1997-03-01

    It has been shown that 1,25-dihydroxyvitamin D{sub 3} has a photo-protective effect against UVB injury in mouse skin and cultured rat keratinocytes by induction of metallothionein (MT). Calcipotriol is a synthetic analogue of 1,25-dihydroxyvitamin D{sub 3} with equi-potent cell regulating properties, but with a lower risk of calcium-related side effects. The aim of the present study was to see whether calcipotriol has a photo-protective property both in vitro and in vivo. We examined the effect of calcipotriol on UV-induced damage of cultured human keratinocytes through a cell viability assay, and measurement of DNA synthesis by cultured keratinocytes, on UV-induced damage of mouse skin and on minimal erythema dose (MED). We found that calcipotriol was protective against UVB-induced reduction in DNA synthetic activity of cultured keratinocytes in relatively low doses (20 and 40 mJ/cm{sup 2}) of UVB. With photo-testing following application of calcipotriol, five subjects among 10 healthy volunteers and three among six psoriasis patients showed an increase in MED compared with the vehicle-treated site. These findings imply that calcipotriol may be photo-protective and that more extensive studies with various doses of UV irradiation and modes of calcipotriol delivery are required. (au). 21 refs.

  12. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  13. Recovery of aging-related size increase of skin epithelial cells: in vivo mouse and in vitro human study.

    Directory of Open Access Journals (Sweden)

    Igor Sokolov

    Full Text Available The size increase of skin epithelial cells during aging is well-known. Here we demonstrate that treatment of aging cells with cytochalasin B substantially decreases cell size. This decrease was demonstrated on a mouse model and on human skin cells in vitro. Six nude mice were treated by topical application of cytochalasin B on skin of the dorsal left midsection for 140 days (the right side served as control for placebo treatment. An average decrease in cell size of 56±16% resulted. A reduction of cell size was also observed on primary human skin epithelial cells of different in vitro age (passages from 1 to 8. A cell strain obtained from a pool of 6 human subjects was treated with cytochalasin B in vitro for 12 hours. We observed a decrease in cell size that became statistically significant and reached 20-40% for cells of older passage (6-8 passages whereas no substantial change was observed for younger cells. These results may be important for understanding the aging processes, and for cosmetic treatment of aging skin.

  14. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy; Modelo de radionecrose cutanea induzida em camundongos Nude (Nu/Nu) para desenvolvimento de terapias regenerativas baseadas em substitutos dermo-epidermicos humanos

    Energy Technology Data Exchange (ETDEWEB)

    Mosca, Rodrigo Crespo

    2014-07-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  15. Prevention of burn wound conversion by allogeneic keratinocytes cultured on acellular xenodermis

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Eva; Brož, L.; Pokorná, Eva; Königová, R.

    2002-01-01

    Roč. 3, č. 1 (2002), s. 29-35 ISSN 1389-9333 Institutional research plan: CEZ:AV0Z5052915 Keywords : human keratinocytes * tissue engineered skin * dried porcine dermis Subject RIV: EB - Genetics ; Molecular Biology

  16. Staphylococcus aureus penetrate the interkeratinocyte spaces created by skin-infiltrating neutrophils in a mouse model of impetigo.

    Science.gov (United States)

    Imanishi, Ichiro; Hattori, Shinpei; Hisatsune, Junzo; Ide, Kaori; Sugai, Motoyuki; Nishifuji, Koji

    2017-02-01

    Impetigo is a bacterial skin disease characterized by intraepidermal neutrophilic pustules. Previous studies have demonstrated that exfoliative toxin producing staphylococci are isolated in the cutaneous lesions of human and canine impetigo. However, the mechanisms of intraepidermal splitting in impetigo remain poorly understood. To determine how staphylococci penetrate the living epidermis and create intraepidermal pustules in vivo using a mouse model of impetigo. Three Staphylococcus aureus strains harbouring the etb gene and three et gene negative strains were epicutaneously inoculated onto tape-stripped mouse skin. The skin samples were subjected to time course histopathological and immunofluorescence analyses to detect intraepidermal neutrophils and infiltrating staphylococci. To determine the role of neutrophils on intraepidermal bacterial invasion, cyclophosphamide (CPA) was injected intraperitoneally into the mice to cause leucopenia before the inoculation of etb gene positive strains. In mice inoculated with etb gene positive S. aureus, intraepidermal pustules resembling impetigo were detected as early as 4 h post-inoculation (hpi). Neutrophils in the epidermis were detected from 4 hpi, whereas intraepidermal staphylococci was detected from 6 hpi. The dimensions of the intraepidermal clefts created in mice inoculated with etb gene positive strains at 6 hpi were significantly larger than those in mice inoculated with et gene negative strains. In CPA treated mice, staphylococci or neutrophils were not detected in the deep epidermis until 6 hpi. Our findings indicate that intraepidermal neutrophils play an important role in S. aureus invasion into the living epidermis in a mouse model of impetigo. © 2016 ESVD and ACVD.

  17. Treatment of silymarin, a plant flavonoid, prevents ultraviolet light-induced immune suppression and oxidative stress in mouse skin.

    Science.gov (United States)

    Katiyar, Santosh K

    2002-12-01

    It is well documented that ultraviolet (UV) light-induced immune suppression and oxidative stress play an important role in the induction of skin cancers. Earlier, we have shown that topical treatment of silymarin, a plant flavonoid from milk thistle (Silybum marianum L. Gaertn.), to mouse skin prevents photocarcinogenesis, but the preventive mechanism of photocarcinogenesis in vivo animal system by silymarin is not well defined and understood. To define the mechanism of prevention, we employed immunostaining, analytical assays and ELISA which revealed that topical treatment of silymarin (1 mg/cm2 skin area) to C3H/HeN mice inhibits UVB (90 mJ/cm2)-induced suppression of contact hypersensitivity (CHS) response to contact sensitizer dinitrofluorobenzene. Prevention of UVB-induced suppression of CHS by silymarin was found to be associated with the inhibition of infiltrating leukocytes, particularly CD11b+ cell type, and myeloperoxidase activity (50-71%). Silymarin treatment also resulted in significant reduction of UVB-induced immunosuppressive cytokine interleukin-10 producing cells and its production (58-72%, pskin cancer risk human population and ii) development of sunscreen containing silymarin as an antioxidant (chemopreventive agent) or silymarin can be supplemented in skin care products.

  18. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  19. TIG3 - AN IMPORTANT REGULATOR OF KERATINOCYTE PROLIFERATION AND SURVIVAL

    OpenAIRE

    Scharadin, Tiffany M.; Eckert, Richard L.

    2014-01-01

    Tazarotene induced gene 3 (TIG3) is a tumor suppressor protein. In normal human epidermis, TIG3 is present in the differentiated, suprabasal layers and regulates terminal differentiation. TIG3 level is reduced in hyperproliferative diseases, including psoriasis and skin cancer, suggesting that loss of TIG3 is associated with enhanced cell proliferation. Moreover, transient expression of TIG3 leads to terminal differentiation in normal keratinocytes and apoptosis in skin cancer cells. In both ...

  20. Cellularized Bilayer Pullulan-Gelatin Hydrogel for Skin Regeneration.

    Science.gov (United States)

    Nicholas, Mathew N; Jeschke, Marc G; Amini-Nik, Saeid

    2016-05-01

    Skin substitutes significantly reduce the morbidity and mortality of patients with burn injuries and chronic wounds. However, current skin substitutes have disadvantages related to high costs and inadequate skin regeneration due to highly inflammatory wounds. Thus, new skin substitutes are needed. By combining two polymers, pullulan, an inexpensive polysaccharide with antioxidant properties, and gelatin, a derivative of collagen with high water absorbency, we created a novel inexpensive hydrogel-named PG-1 for "pullulan-gelatin first generation hydrogel"-suitable for skin substitutes. After incorporating human fibroblasts and keratinocytes onto PG-1 using centrifugation over 5 days, we created a cellularized bilayer skin substitute. Cellularized PG-1 was compared to acellular PG-1 and no hydrogel (control) in vivo in a mouse excisional skin biopsy model using newly developed dome inserts to house the skin substitutes and prevent mouse skin contraction during wound healing. PG-1 had an average pore size of 61.69 μm with an ideal elastic modulus, swelling behavior, and biodegradability for use as a hydrogel for skin substitutes. Excellent skin cell viability, proliferation, differentiation, and morphology were visualized through live/dead assays, 5-bromo-2'-deoxyuridine proliferation assays, and confocal microscopy. Trichrome and immunohistochemical staining of excisional wounds treated with the cellularized skin substitute revealed thicker newly formed skin with a higher proportion of actively proliferating cells and incorporation of human cells compared to acellular PG-1 or control. Excisional wounds treated with acellular or cellularized hydrogels showed significantly less macrophage infiltration and increased angiogenesis 14 days post skin biopsy compared to control. These results show that PG-1 has ideal mechanical characteristics and allows ideal cellular characteristics. In vivo evidence suggests that cellularized PG-1 promotes skin regeneration and may

  1. Rat embryonic fibroblasts improve reprogramming of human keratinocytes into induced pluripotent stem cells.

    Science.gov (United States)

    Linta, Leonhard; Stockmann, Marianne; Kleinhans, Karin N; Böckers, Anja; Storch, Alexander; Zaehres, Holm; Lin, Qiong; Barbi, Gotthold; Böckers, Tobias M; Kleger, Alexander; Liebau, Stefan

    2012-04-10

    Patient-specific human induced pluripotent stem (hiPS) cells not only provide a promising tool for cellular disease models in general, but also open up the opportunity to establish cell-type-specific systems for personalized medicine. One of the crucial prerequisites for these strategies, however, is a fast and efficient reprogramming strategy from easy accessible somatic cell populations. Keratinocytes from plucked human hair had been introduced as a superior cell source for reprogramming purposes compared with the widely used skin fibroblasts. The starting cell population is, however, limited and thereby further optimization in terms of time, efficiency, and quality is inevitable. Here we show that rat embryonic fibroblasts (REFs) should replace mouse embryonic fibroblasts as feeder cells in the reprogramming process. REFs enable a significantly more efficient reprogramming procedure as shown by colony number and total amount of SSEA4-positive cells. We successfully produced keratinocyte-derived hiPS (k-hiPS) cells from various donors. The arising k-hiPS cells display the hallmarks of pluripotency such as expression of stem cell markers and differentiation into all 3 germ layers. The increased reprogramming efficiency using REFs as a feeder layer occurred independent of the proliferation rate in the parental keratinocytes and acts, at least in part, in a non-cell autonomous way by secreting factors known to facilitate pluripotency such as Tgfb1, Inhba and Grem1. Hence, we provide an easy to use and highly efficient reprogramming system that could be very useful for a broad application to generate human iPS cells. © Mary Ann Liebert, Inc.

  2. In Vivo SILAC-Based Proteomics Reveals Phosphoproteome Changes during Mouse Skin Carcinogenesis

    NARCIS (Netherlands)

    Zanivan, S.; Meves, A.; Behrendt, K.; Schoof, E.M.; Neilson, L.J.; Cox, J.; Tang, H.R.; Kalna, G.; Ree, J.H. van; Deursen, J.M.A. van; Trempus, C.S.; Machesky, L.M.; Linding, R.; Wickstrom, S.A.; Fassler, R.; Mann, M.

    2013-01-01

    Cancer progresses through distinct stages, and mouse models recapitulating traits of this progression are frequently used to explore genetic, morphological, and pharmacological aspects of tumor development. To complement genomic investigations of this process, we here quantify phosphoproteomic

  3. Antibacterial Evaluation of Synthetic Thiazole Compounds In Vitro and In Vivo in a Methicillin-Resistant Staphylococcus aureus (MRSA) Skin Infection Mouse Model.

    Science.gov (United States)

    Mohammad, Haroon; Cushman, Mark; Seleem, Mohamed N

    2015-01-01

    The emergence of community-associated methicillin-resistant Staphylococcus aureus (MRSA), including strains resistant to current antibiotics, has contributed to an increase in the number of skin infections reported in humans in recent years. New therapeutic options are needed to counter this public health challenge. The aim of the present study was to examine the potential of thiazole compounds synthesized by our research group to be used topically to treat MRSA skin and wound infections. The broth microdilution method confirmed that the lead thiazole compound and four analogues are capable of inhibiting MRSA growth at concentrations as low as 1.3 μg/mL. Additionally, three compounds exhibited a synergistic relationship when combined with the topical antibiotic mupirocin against MRSA in vitro via the checkerboard assay. Thus the thiazole compounds have potential to be used alone or in combination with mupirocin against MRSA. When tested against human keratinocytes, four derivatives of the lead compound demonstrated an improved toxicity profile (were found to be non-toxic up to a concentration of 20 μg/mL). Utilizing a murine skin infection model, we confirmed that the lead compound and three analogues exhibited potent antimicrobial activity in vivo, with similar capability as the antibiotic mupirocin, as they reduced the burden of MRSA present in skin wounds by more than 90%. Taken altogether, the present study provides important evidence that these thiazole compounds warrant further investigation for development as novel topical antimicrobials to treat MRSA skin infections.

  4. Folate deficiency enhances arsenic effects on expression of genes involved in epidermal differentiation in transgenic K6/ODC mouse skin

    International Nuclear Information System (INIS)

    Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.

    2007-01-01

    Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis

  5. Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

    International Nuclear Information System (INIS)

    Han, S.R.

    1988-01-01

    The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

  6. Dose-modifying factors for skin ulceration in mouse legs exposed to gamma rays

    International Nuclear Information System (INIS)

    Masuda, Kouji; Miyoshi, Makoto; Uehara, Satoru; Omagari, Junichi; Withers, H.R.

    1996-01-01

    To assess the dose-modifying factors for skin ulceration, the hind legs of mice were irradiated using gamma-rays of various doses in single exposures. The skin ulceration began to occur 2 months after irradiation, after early skin reactions such as wet desquamation, had healed completely. No new skin ulceration was observed more than 8 months after irradiation even though the observations were continued until 12 months post-irradiation. The ulceration dose 50 (UD50), a dose required to produce skin ulceration in from 2 to 8 months in 50% of the tested animals, was calculated for each treatment schedule. The preliminary shaving procedure reduced the UD50 dose to 0.85 that of the untreated controls. The ventral aspect of the hind leg was more radioresistant to single-dose irradiation than was to the dorsal aspect. The UD50 for the ventral aspect was 1.29 times that for the dorsal aspect when the skin had been previously shaved, and 1.46 times that for the unshaved control legs. The UD50 was 7 and 14% larger when mice were kept in the dorsal rather than the abdominal position during irradiation, for the preliminarily shaved and unshaved skin, respectively. (author)

  7. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  8. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  9. The effect of bamboo (Phyllostachys nigra var. henenis Strapf) leaf extract on ultraviolet B-induced skin damages in mouse

    International Nuclear Information System (INIS)

    Chae, Se Lim; Lee, Hae June; Moon, Chang Jong; Kim, Jong Choon; Bae, Chun Sik; Kang, Seong Soo; Kim, Sung Ho; Jang, Jong Sik; Jo, Sung Kee

    2007-01-01

    The effects of bamboo (Phyllostachys nigra var. henenis Strapf) Leaf Extract (BLE) on the changes of UltraViolet (UV) light B radiation-induced apoptotic SunBurn Cell (SBC) and epidermal ATPase-positive Dendritic Cell (DC) in SKHI-hr or ICR mouse were investigated. The mice were treated with UVB (200 mJ/cm 2 ) and were sacrificed 24 hours later. BLE (50 mg/kg of body weight) or vehicle (saline) was given i.p. at 36 and 12 hours before irradiation, and 30 minutes after irradiation. BLE cream (0.2%) or cream base (vehicle) was also topically treated at 24 hours and 15 minutes before irradiation, and immediately after irradiation. The skin of SKH1-hr mouse prepared from the back of untreated mice exhibited about 0.3 SBC/cm length of epidermis, and 24 hours after UV irradiation, the applied areas show an increased number of SBCs. But the frequency of UVB-induced SBC formation was significantly reduced by intraperitoneal injection (59.0%) and topical application (31.8%) of BLE extract. The numbers of DC in normal ICR mouse were 628.00±51.56 or 663.20±62.58 per mm 2 of ear epidermis. By 1 day after UVB treatment, the number of ATPase-positive cells/mm 2 were decreased by 39.0% or 27.1% in i.p. or topical application group with vehicle. The frequency of UVB(200 mJ/cm 2 )-induced DC decrease was reduced by treatment of BLE as 25.7% in i.p. group and 3.2% in topical application group compared with the irradiation control group. The results presented herein that BLE administration could reduce the extent of skin damages produced by UVB

  10. The effect of bamboo (Phyllostachys nigra var. henenis Strapf) leaf extract on ultraviolet B-induced skin damages in mouse

    Energy Technology Data Exchange (ETDEWEB)

    Chae, Se Lim; Lee, Hae June; Moon, Chang Jong; Kim, Jong Choon; Bae, Chun Sik; Kang, Seong Soo; Kim, Sung Ho [Chonnam National Univ., Gwangju (Korea, Republic of); Jang, Jong Sik [Sangju National Univ., Sangju (Korea, Republic of); Jo, Sung Kee [KAERI, Daejeon (Korea, Republic of)

    2007-06-15

    The effects of bamboo (Phyllostachys nigra var. henenis Strapf) Leaf Extract (BLE) on the changes of UltraViolet (UV) light B radiation-induced apoptotic SunBurn Cell (SBC) and epidermal ATPase-positive Dendritic Cell (DC) in SKHI-hr or ICR mouse were investigated. The mice were treated with UVB (200 mJ/cm{sup 2}) and were sacrificed 24 hours later. BLE (50 mg/kg of body weight) or vehicle (saline) was given i.p. at 36 and 12 hours before irradiation, and 30 minutes after irradiation. BLE cream (0.2%) or cream base (vehicle) was also topically treated at 24 hours and 15 minutes before irradiation, and immediately after irradiation. The skin of SKH1-hr mouse prepared from the back of untreated mice exhibited about 0.3 SBC/cm length of epidermis, and 24 hours after UV irradiation, the applied areas show an increased number of SBCs. But the frequency of UVB-induced SBC formation was significantly reduced by intraperitoneal injection (59.0%) and topical application (31.8%) of BLE extract. The numbers of DC in normal ICR mouse were 628.00{+-}51.56 or 663.20{+-}62.58 per mm{sup 2} of ear epidermis. By 1 day after UVB treatment, the number of ATPase-positive cells/mm{sup 2} were decreased by 39.0% or 27.1% in i.p. or topical application group with vehicle. The frequency of UVB(200 mJ/cm{sup 2})-induced DC decrease was reduced by treatment of BLE as 25.7% in i.p. group and 3.2% in topical application group compared with the irradiation control group. The results presented herein that BLE administration could reduce the extent of skin damages produced by UVB.

  11. BP180 dysfunction triggers spontaneous skin inflammation in mice.

    Science.gov (United States)

    Zhang, Yang; Hwang, Bin-Jin; Liu, Zhen; Li, Ning; Lough, Kendall; Williams, Scott E; Chen, Jinbo; Burette, Susan W; Diaz, Luis A; Su, Maureen A; Xiao, Shengxiang; Liu, Zhi

    2018-06-04

    BP180, also known as collagen XVII, is a hemidesmosomal component and plays a key role in maintaining skin dermal/epidermal adhesion. Dysfunction of BP180, either through genetic mutations in junctional epidermolysis bullosa (JEB) or autoantibody insult in bullous pemphigoid (BP), leads to subepidermal blistering accompanied by skin inflammation. However, whether BP180 is involved in skin inflammation remains unknown. To address this question, we generated a BP180-dysfunctional mouse strain and found that mice lacking functional BP180 (termed Δ NC16A ) developed spontaneous skin inflammatory disease, characterized by severe itch, defective skin barrier, infiltrating immune cells, elevated serum IgE levels, and increased expression of thymic stromal lymphopoietin (TSLP). Severe itch is independent of adaptive immunity and histamine, but dependent on increased expression of TSLP by keratinocytes. In addition, a high TSLP expression is detected in BP patients. Our data provide direct evidence showing that BP180 regulates skin inflammation independently of adaptive immunity, and BP180 dysfunction leads to a TSLP-mediated itch. The newly developed mouse strain could be a model for elucidation of disease mechanisms and development of novel therapeutic strategies for skin inflammation and BP180-related skin conditions.

  12. [Effect of ionizing radiation and other factors on the thermal sensitivity of mouse skin].

    Science.gov (United States)

    Kurpeshev, O K; Konopliannikov, A G

    1987-03-01

    A study was made of the effect of various agents on skin injury by hyperthermia in experiments on noninbred albino mice. The effects of heating were assessed by the frequency of skin necrosis development. The results of the study showed that irradiation of the skin (30 Gy) before heating did not influence its thermosensitivity whereas heating 45-180 days after irradiation proved more effective. Ethanol, metronidazole, thyrocalcitonin and actinomycin D decreased skin thermosensitivity, and cyclohexamide, serotonin, hyperglycemia and applying a tourniquet increased it. The DMF value for actinomycin D depended on the temperature of heating. One should distinguish between true modification of tissue thermosensitivity (determined by cellular factors) and indirect modification (associated with change in volumetric circulation rate).

  13. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  14. Re-appraisal of keratinocytes' role in vitiligo pathogenesis

    Directory of Open Access Journals (Sweden)

    Ola Ahmed Bakry

    2018-01-01

    Full Text Available Background: Vitiligo is a common pigmentary disorder. Studies on its pathogenesis extensively investigated melanocytes' abnormalities and few studies searched for keratinocytes' role in disease development. Liver X receptor-α (LXR-α is a member of nuclear hormone receptors that acts as a transcription factor. Its target genes are the main regulators of melanocyte functions. Aim: The aim of this study is to investigate keratinocytes' role in vitiligo pathogenesis through immunohistochemical expression of LXR-α in lesional, perilesional, and distant nonlesional vitiligo skin. Materials and Methods: This case–control study was carried out on 44 participants. These included 24 patients with vitiligo and 20 age- and sex-matched normal individuals as a control group. Biopsies, from cases, were taken from lesional, perilesional, and distant nonlesional areas. Evaluation was done using immunohistochemical technique. Results: Keratinocyte LXR-α expression was upregulated in the lesional and perilesional skin (follicular and interfollicular epidermis compared with control skin (P<0.001 for all. There was significant association between higher histoscore (H-score in lesional epidermis (P<0.001 and in hair follicle (P=0.001 and the presence of angiogenesis. There was significant association between higher H-score in lesional epidermis and suprabasal vacuolization (P=0.02. No significant association was found between H-score or expression percentage and clinical data of selected cases. Conclusion: LXR-α upregulation is associated with keratinocyte damage in vitiligo lesional skin that leads to decreased keratinocyte-derived mediators and growth factors supporting the growth and/or melanization of surrounding melanocytes. Therefore, melanocyte function and survival are affected.

  15. Methotrexate treatment provokes apoptosis of proliferating keratinocyte in psoriasis patients.

    Science.gov (United States)

    Elango, Tamilselvi; Thirupathi, Anand; Subramanian, Swapna; Ethiraj, Purushoth; Dayalan, Haripriya; Gnanaraj, Pushpa

    2017-08-01

    Psoriasis is a chronic inflammatory skin disease characterized by hyper proliferation of keratinocytes. Recent data show that the epidermis thickening in psoriasis may be related to imbalance of homeostasis caused by abnormal apoptotic process. Maintenance of keratinocyte apoptotic process is very important in psoriasis. Methotrexate (MTX) has been used for many years to restore the normal skin in psoriasis condition. However, the exact mechanism of MTX in psoriasis condition is poorly understood. The aim of this study was to examine the role of MTX on keratinocyte apoptosis pathway in psoriasis patients. A total of 58 psoriasis vulgaris patients were recruited for this study. Nonlesional skin biopsies served as control. Skin biopsies of psoriatic patients were collected and analyzed for cytosolic, mitochondria and total cytochrome c by ELISA. Expression of caspase-9, NFκBp65, pAkt1 by western blot, real-time PCR and immunohistochemical analysis of c-FLIP protein was analyzed in nonlesional and lesional skin biopsies before (day 0) and after (at the end of 6 and 12 weeks) MTX treatment. After MTX treatment, a significant increase in cytochrome c was observed when compared with before MTX treatment in psoriasis patients (p psoriasis by controlling the acanthosis.

  16. Skin-derived mesenchymal stem cells help restore function to ovaries in a premature ovarian failure mouse model.

    Directory of Open Access Journals (Sweden)

    Dongmei Lai

    Full Text Available Skin-derived mesenchymal stem cells (SMSCs can differentiate into the three embryonic germ layers. For this reason, they are considered a powerful tool for therapeutic cloning and offer new possibilities for tissue therapy. Recent studies showed that skin-derived stem cells can differentiate into cells expressing germ-cell specific markers in vitro and form oocytes in vivo. The idea that SMSCs may be suitable for the treatment of intractable diseases or traumatic tissue damage has attracted attention. To determine the ability of SMSCs to reactivate injured ovaries, a mouse model with ovaries damaged by busulfan and cyclophosphamide was developed and is described here. Female skin-derived mesenchymal stem cells (F-SMSCs and male skin-derived mesenchymal stem cells (M-SMSCs from red fluorescence protein (RFP transgenic adult mice were used to investigate the restorative effects of SMSCs on ovarian function. Significant increases in total body weight and the weight of reproductive organs were observed in the treated animals. Both F-SMSCs and M-SMSCs were shown to be capable of partially restoring fertility in chemotherapy-treated females. Immunostaining with RFP and anti-Müllerian hormone (AMH antibodies demonstrated that the grafted SMSCs survived, migrated to the recipient ovaries. After SMSCs were administered to the treated mice, real-time PCR showed that the expression levels of pro-inflammatory cytokines TNF-α, TGF-β, IL-8, IL-6, IL-1β, and IFNγ were significantly lower in the ovaries than in the untreated controls. Consistent with this observation, expression of oogenesis marker genes Nobox, Nanos3, and Lhx8 increased in ovaries of SMSCs-treated mice. These findings suggest that SMSCs may play a role within the ovarian follicle microenvironment in restoring the function of damaged ovaries and could be useful in reproductive health.

  17. Early changes produced in mouse skin by the application of three middle distillates.

    Science.gov (United States)

    Grasso, P; Sharratt, M; Ingram, A J

    1988-01-01

    It has been reported by the American Petroleum Institute (API) that dermal applications of certain middle distillates of mineral oils can result in high incidences of skin tumours in mice. This was unexpected as the polycyclic aromatic hydrocarbon (PAH) levels in these were below detection limits. To examine the possible role of tissue injury in the induction of tumours, the skin reactions produced by thrice weekly applications of three middle distillates similar to those tested by the API were examined grossly and histopathologically at intervals up to 6 weeks. Various reference materials and oils were used as controls. Preliminary histological examination showed that severe skin damage was present from week 1 onwards in mice treated with the three middle distillates, two of them producing epidermal loss and ulceration. Marked epidermal hyperplasia was produced by all three middle distillates. These findings support the view that regenerative epidermal hyperplasia due to repeated severe skin damage may have exerted a powerful promotional effect in the production of the skin tumours by middle distillates in the API study.

  18. The incidence and multiplicity rates of keratinocyte cancers in Australia.

    Science.gov (United States)

    Pandeya, Nirmala; Olsen, Catherine M; Whiteman, David C

    2017-10-16

    To assess the incidence and multiplicity of keratinocyte cancers (basal cell carcinoma [BCC] and squamous cell carcinoma [SCC]) excised in Australia, and to examine variations by age, sex, state, and prior skin cancer history. Analysis of individual-level Medicare data for keratinocyte cancer treatments (identified by eight specific MBS item codes) during 2011-2014. Histological data from the QSkin prospective cohort study were analysed to estimate BCC and SCC incidence. A 10% systematic random sample of all people registered with Medicare during 1997-2014. People aged at least 20 years in 2011 who made at least one claim for any MBS medical service during 2011-2014 (1 704 193 individuals). Age-standardised incidence rates (ASRs) and standardised incidence ratios (SIRs). The person-based incidence of keratinocyte cancer excisions in Australia was 1531 per 100 000 person-years; incidence increased with age, and was higher for men than women (SIR, 1.43; 95% CI, 1.42-1.45). Lesion-based incidence was 3154 per 100 000 person-years. The estimated ASRs for BCC and SCC were 770 per 100 000 and 270 per 100 000 person-years respectively. During 2011-2014, 3.9% of Australians had one keratinocyte cancer excised, 2.7% had more than one excised; 74% of skin cancers were excised from patients who had two or more lesions removed. Multiplicity was strongly correlated with age; most male patients over 70 were treated for multiple lesions. Keratinocyte cancer incidence was eight times as high among people with a prior history of excisions as among those without. The incidence and multiplicity of keratinocyte cancer in Australia are very high, causing a large disease burden that has not previously been quantified.

  19. The role of alpha3beta1 integrin in determining the supramolecular organization of laminin-5 in the extracellular matrix of keratinocytes.

    Science.gov (United States)

    deHart, Gregory W; Healy, Kevin E; Jones, Jonathan C R

    2003-02-01

    Analyses of mice with targeted deletions in the genes for alpha3 and beta1 integrin suggest that the alpha3beta1 integrin heterodimer likely determines the organization of the extracellular matrix within the basement membrane of skin. Here we tested this hypothesis using keratinocytes derived from alpha3 integrin-null mice. We have compared the organizational state of laminin-5, a ligand of alpha3beta1 integrin, in the matrix of wild-type keratinocytes with that of laminin-5 in the matrix of alpha3 integrin-null cells. Laminin-5 distributes diffusely in arc structures in the matrix of wild-type mouse keratinocytes, whereas laminin-5 is organized into linear, spike-like arrays by the alpha3 integrin-null cells. The fact that alpha3 integrin-null cells are deficient in their ability to assemble a proper laminin-5 matrix is also shown by their failure to remodel laminin-5 when plated onto surfaces coated with purified laminin-5 protein. In sharp contrast, wild-type keratinocytes organize exogenously added laminin-5 into discrete ring-like organizations. These findings led us next to assess whether differences in laminin-5 organization in the matrix of the wild-type and alpha3 integrin-null cells impact cell behavior. Our results indicate that alpha3 integrin-null cells are more motile than their wild-type counterparts and leave extensive trails of laminin-5 over the surface on which they move. Moreover, HEK 293 cells migrate significantly more on the laminin-5-rich matrix derived from the alpha3 integrin-null cells than on the wild-type keratinocyte laminin-5 matrix. In addition, alpha3 integrin-null cells show low strength of adhesion to surfaces coated with purified laminin-5 compared to wild-type cells although both the wild type and the alpha3 integrin-null keratinocytes adhere equally strongly to laminin-5 that has been organized into arrays by other epithelial cells. These data suggest: (1) that alpha3beta1 integrin plays an important role in determining the

  20. The response of mouse skin and lung to fractionated x-rays

    International Nuclear Information System (INIS)

    Field, S.B.; Hornsey, S.

    1975-01-01

    The relationship between total dose and number of fractions has been investigated for damage to lung and skin in mice. Single doses and various numbers of fractions have been given and the results are analysed in two ways: (i) by comparing the fractionated treatment with a single dose. With this approach, and assuming that the observed damage to lung and skin is the result of cell killing, it is estimated that the ratio of initial to final slope of the cell survival curve is about 7:1; (ii) by measuring the additional dose required when the number of fractions is doubled. These results are roughly fitted by a single-hit times multitarget survival-curve model, with the ratio of slopes about 3:1. It is concluded from this discrepancy that the two-component model is an inadequate description of the survival curve for the cells of either skin or lung. (author)

  1. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Science.gov (United States)

    Tohidnezhad, Mersedeh; Lammel, Justus; Lippross, Sebastian; Behrendt, Peter; Klüter, Tim; Pufe, Thomas; Jahr, Holger; Cremer, Jochen; Rademacher, Franziska; Gläser, Regine; Harder, Jürgen

    2017-01-01

    Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs) or their clinically related formulations (e.g., Vivostat PRF®) came recently into the physicians' focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10) and late (transglutaminase-1 and involucrin) differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR-) dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo. PMID:28808357

  2. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Platelet-Released Growth Factors Induce Differentiation of Primary Keratinocytes

    Directory of Open Access Journals (Sweden)

    Andreas Bayer

    2017-01-01

    Full Text Available Autologous thrombocyte concentrate lysates, for example, platelet-released growth factors, (PRGFs or their clinically related formulations (e.g., Vivostat PRF® came recently into the physicians’ focus as they revealed promising effects in regenerative and reparative medicine such as the support of healing of chronic wounds. To elucidate the underlying mechanisms, we analyzed the influence of PRGF and Vivostat PRF on human keratinocyte differentiation in vitro and on epidermal differentiation status of skin wounds in vivo. Therefore, we investigated the expression of early (keratin 1 and keratin 10 and late (transglutaminase-1 and involucrin differentiation markers. PRGF treatment of primary human keratinocytes decreased keratin 1 and keratin 10 gene expression but induced involucrin and transglutaminase-1 gene expression in an epidermal growth factor receptor- (EGFR- dependent manner. In concordance with these results, microscopic analyses revealed that PRGF-treated human keratinocytes displayed morphological features typical of keratinocytes undergoing terminal differentiation. In vivo treatment of artificial human wounds with Vivostat PRF revealed a significant induction of involucrin and transglutaminase-1 gene expression. Together, our results indicate that PRGF and Vivostat PRF induce terminal differentiation of primary human keratinocytes. This potential mechanism may contribute to the observed beneficial effects in the treatment of hard-to-heal wounds with autologous thrombocyte concentrate lysates in vivo.

  4. Differential gene expression profiling of mouse skin after sulfur mustard exposure: Extended time response and inhibitor effect

    International Nuclear Information System (INIS)

    Gerecke, Donald R.; Chen Minjun; Isukapalli, Sastry S.; Gordon, Marion K.; Chang, Y.-C.; Tong Weida; Androulakis, Ioannis P.; Georgopoulos, Panos G.

    2009-01-01

    Sulfur mustard (HD, SM), is a chemical warfare agent that within hours causes extensive blistering at the dermal-epidermal junction of skin. To better understand the progression of SM-induced blistering, gene expression profiling for mouse skin was performed after a single high dose of SM exposure. Punch biopsies of mouse ears were collected at both early and late time periods following SM exposure (previous studies only considered early time periods). The biopsies were examined for pathological disturbances and the samples further assayed for gene expression profiling using the Affymetrix microarray analysis system. Principal component analysis and hierarchical cluster analysis of the differently expressed genes, performed with ArrayTrack showed clear separation of the various groups. Pathway analysis employing the KEGG library and Ingenuity Pathway Analysis (IPA) indicated that cytokine-cytokine receptor interaction, cell adhesion molecules (CAMs), and hematopoietic cell lineage are common pathways affected at different time points. Gene ontology analysis identified the most significantly altered biological processes as the immune response, inflammatory response, and chemotaxis; these findings are consistent with other reported results for shorter time periods. Selected genes were chosen for RT-PCR verification and showed correlations in the general trends for the microarrays. Interleukin 1 beta was checked for biological analysis to confirm the presence of protein correlated to the corresponding microarray data. The impact of a matrix metalloproteinase inhibitor, MMP-2/MMP-9 inhibitor I, against SM exposure was assessed. These results can help in understanding the molecular mechanism of SM-induced blistering, as well as to test the efficacy of different inhibitors

  5. Stabilization of influenza vaccine enhances protection by microneedle delivery in the mouse skin.

    Directory of Open Access Journals (Sweden)

    Fu-Shi Quan

    2009-09-01

    Full Text Available Simple and effective vaccine administration is particularly important for annually recommended influenza vaccination. We hypothesized that vaccine delivery to the skin using a patch containing vaccine-coated microneedles could be an attractive approach to improve influenza vaccination compliance and efficacy.Solid microneedle arrays coated with inactivated influenza vaccine were prepared for simple vaccine delivery to the skin. However, the stability of the influenza vaccine, as measured by hemagglutination activity, was found to be significantly damaged during microneedle coating. The addition of trehalose to the microneedle coating formulation retained hemagglutination activity, indicating stabilization of the coated influenza vaccine. For both intramuscular and microneedle skin immunization, delivery of un-stabilized vaccine yielded weaker protective immune responses including viral neutralizing antibodies, protective efficacies, and recall immune responses to influenza virus. Immunization using un-stabilized vaccine also shifted the pattern of antibody isotypes compared to the stabilized vaccine. Importantly, a single microneedle-based vaccination using stabilized influenza vaccine was found to be superior to intramuscular immunization in controlling virus replication as well as in inducing rapid recall immune responses post challenge.The functional integrity of hemagglutinin is associated with inducing improved protective immunity against influenza. Simple microneedle influenza vaccination in the skin produced superior protection compared to conventional intramuscular immunization. This approach is likely to be applicable to other vaccines too.

  6. Short-term biomarkers of tumor promotion in mouse skin treated with petroleum middle distillates.

    Science.gov (United States)

    Walborg, E F; DiGiovanni, J; Conti, C J; Slaga, T J; Freeman, J J; Steup, D R; Skisak, C M

    1998-10-01

    Topical application of certain petroleum middle distillates (PMD) to mice produces skin tumors after long latency, and initiation/promotion protocols indicate that this effect is associated with their tumor promoting activity. Since induction of sustained, potentiated epidermal hyperplasia is predictive of promoting activity, five compositionally distinct PMD [hydrodesulfurized kerosene (API 81-07); hydrodesulfurized PMD (API 81-10); odorless light petroleum hydrocarbons; severely hydrotreated light vacuum distillate (LVD); and lightly refined paraffinic oil (LRPO)] were assessed for their effects on epidermal hyperplasia. PMD were administered (2 x/week for 2 weeks) to skin of CD-1 mice. Four quantitative biomarkers of epidermal hyperplasia were evaluated: epidermal thickness, number of nucleated epidermal cells per unit length of basement membrane, labeling (BrdUrd) index of epidermal cells, and induction of epidermal ornithine decarboxylase (ODC) activity. As positive controls, 12-O-tetradecanoylphorbol-13-acetate (TPA) and n-dodecane were utilized. PMD-induced skin irritation was evaluated visually and/or histopathologically. All five PMD produced dose-dependent, skin irritation and epidermal hyperplasia. On a weight basis the magnitude of the maximal PMD-induced effects was similar to that produced by n-dodecane, but > 1000-fold less than that produced by TPA. Epidermal hyperplasia and subacute skin irritancy produced by the five PMD were similar. Of the four short-term markers of tumor promotion assessed, labeling index and epidermal ODC activity were predictive of the relative promoting activities of those PMD for which tumorigenicity bioassay data are available, i.e., API 81-07 > API 81-10 > LRPO. An apparent discrepancy to the predictability of epidermal ODC activity occurred with LRPO:toluene [1:1 (v/v)]. This mixture is nontumorigenic, yet significantly induced epidermal ODC activity. This mixture, however, produced severe epidermal toxicity that

  7. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  8. YAP regulates the expression of Hoxa1 and Hoxc13 in mouse and human oral and skin epithelial tissues.

    Science.gov (United States)

    Liu, Ming; Zhao, Shuangyun; Lin, Qingjie; Wang, Xiu-Ping

    2015-04-01

    Yes-associated protein (YAP) is a Hippo signaling transcriptional coactivator that plays pivotal roles in stem cell proliferation, organ size control, and tumor development. The downstream targets of YAP have been shown to be highly context dependent. In this study, we used the embryonic mouse tooth germ as a tool to search for the downstream targets of YAP in ectoderm-derived tissues. Yap deficiency in the dental epithelium resulted in a small tooth germ with reduced epithelial cell proliferation. We compared the gene expression profiles of embryonic day 14.5 (E14.5) Yap conditional knockout and YAP transgenic mouse tooth germs using transcriptome sequencing (RNA-Seq) and further confirmed the differentially expressed genes using real-time PCR and in situ hybridization. We found that YAP regulates the expression of Hoxa1 and Hoxc13 in oral and dental epithelial tissues as well as in the epidermis of skin during embryonic and adult stages. Sphere formation assay suggested that Hoxa1 and Hoxc13 are functionally involved in YAP-regulated epithelial progenitor cell proliferation, and chromatin immunoprecipitation (ChIP) assay implies that YAP may regulate Hoxa1 and Hoxc13 expression through TEAD transcription factors. These results provide mechanistic insights into abnormal YAP activities in mice and humans. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  10. Hemin inhibits cyclooxygenase-2 expression through nuclear factor-kappa B activation and ornithine decarboxylase expression in 12-O-tetradecanoylphorbol-13-acetate-treated mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jae Hee; Lee, Chang Ki [Department of Oral Biology, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of); Oral Cancer Research Institute, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of); Hwang, Young Sun [Department of Applied Life Science and Brain Korea 21 Project, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of); Park, Kwang-Kyun [Department of Oral Biology, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of); Department of Applied Life Science and Brain Korea 21 Project, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of); Chung, Won-Yoon [Department of Oral Biology, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of); Department of Applied Life Science and Brain Korea 21 Project, Yonsei University College of Dentistry, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul 120-752 (Korea, Republic of)], E-mail: wychung@yuhs.ac

    2008-07-03

    Inflammation induced by various stimuli has been found to be associated with increased risk for most types of human cancer. Inflammation facilitates the initiation of normal cells, as well as the growth of initiated cells and their progression to malignancy through production of proinflammatory cytokines and diverse reactive oxygen/nitrogen species. These also activate the signaling molecules that are involved in inflammation and carcinogenesis. Our previous studies have demonstrated that hemin inhibited 7,12-dimethylbenz[a]anthracene (DMBA)-induced bacterial mutagenesis and oxidative DNA damage, reduced the level of DNA-DMBA adduct and 12-O-tetradecanoylphorobl-13-acetate (TPA)-induced tumor formation in DMBA-initiated ICR mouse skin, and inhibited myeloperoxidase and ornithine decarboxylase (ODC) activity and H{sub 2}O{sub 2} formation in TPA-treated mouse skin. In the present study, to further elucidate the molecular mechanisms underlying the chemopreventive activity of hemin, its effect on the expression of ODC and cyclooxygenase (COX)-2, and the activation of nuclear factor-kappa B (NF-{kappa}B) and mitogen-activated protein kinases (MAPKs) regulating these proteins were explored in mouse skin with TPA-induced inflammation. Topically applied hemin inhibited ear edema and epidermal thickness in mice treated with TPA. Pretreatment with hemin reduced the expression of ODC and COX-2, and also reduced NF-{kappa}B activation in TPA-stimulated mouse skin. In addition, hemin suppressed the TPA-induced activation of extracellular signal-regulated protein kinase (ERK) and p38 MAPK in a dose-dependent manner. Taken together, hemin inhibited TPA-induced COX-2 expression by altering NF-{kappa}B signaling pathway via ERK and p38 MAPK, as well as TPA-induced ODC expression in mouse skin. Thereby, hemin may be an attractive candidate for a chemopreventive agent.

  11. Hemin inhibits cyclooxygenase-2 expression through nuclear factor-kappa B activation and ornithine decarboxylase expression in 12-O-tetradecanoylphorbol-13-acetate-treated mouse skin

    International Nuclear Information System (INIS)

    Park, Jae Hee; Lee, Chang Ki; Hwang, Young Sun; Park, Kwang-Kyun; Chung, Won-Yoon

    2008-01-01

    Inflammation induced by various stimuli has been found to be associated with increased risk for most types of human cancer. Inflammation facilitates the initiation of normal cells, as well as the growth of initiated cells and their progression to malignancy through production of proinflammatory cytokines and diverse reactive oxygen/nitrogen species. These also activate the signaling molecules that are involved in inflammation and carcinogenesis. Our previous studies have demonstrated that hemin inhibited 7,12-dimethylbenz[a]anthracene (DMBA)-induced bacterial mutagenesis and oxidative DNA damage, reduced the level of DNA-DMBA adduct and 12-O-tetradecanoylphorobl-13-acetate (TPA)-induced tumor formation in DMBA-initiated ICR mouse skin, and inhibited myeloperoxidase and ornithine decarboxylase (ODC) activity and H 2 O 2 formation in TPA-treated mouse skin. In the present study, to further elucidate the molecular mechanisms underlying the chemopreventive activity of hemin, its effect on the expression of ODC and cyclooxygenase (COX)-2, and the activation of nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinases (MAPKs) regulating these proteins were explored in mouse skin with TPA-induced inflammation. Topically applied hemin inhibited ear edema and epidermal thickness in mice treated with TPA. Pretreatment with hemin reduced the expression of ODC and COX-2, and also reduced NF-κB activation in TPA-stimulated mouse skin. In addition, hemin suppressed the TPA-induced activation of extracellular signal-regulated protein kinase (ERK) and p38 MAPK in a dose-dependent manner. Taken together, hemin inhibited TPA-induced COX-2 expression by altering NF-κB signaling pathway via ERK and p38 MAPK, as well as TPA-induced ODC expression in mouse skin. Thereby, hemin may be an attractive candidate for a chemopreventive agent

  12. Hair Follicle Morphogenesis in the Treatment of Mouse Full-Thickness Skin Defects Using Composite Human Acellular Amniotic Membrane and Adipose Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Wu Minjuan

    2016-01-01

    Full Text Available Early repair of skin injury and maximal restoration of the function and appearance have become important targets of clinical treatment. In the present study, we observed the healing process of skin defects in nude mice and structural characteristics of the new skin after transplantation of isolated and cultured adipose derived mesenchymal stem cells (ADMSCs onto the human acellular amniotic membrane (AAM. The result showed that ADMSCs were closely attached to the surface of AAM and grew well 24 h after seeding. Comparison of the wound healing rate at days 7, 14, and 28 after transplantation showed that ADMSCs seeded on AAM facilitated the healing of full-thickness skin wounds more effectively as compared with either hAM or AAM alone, indicating that ADMSCs participated in skin regeneration. More importantly, we noticed a phenomenon of hair follicle development during the process of skin repair. Composite ADMSCs and AAM not only promoted the healing of the mouse full-thickness defects but also facilitated generation of the appendages of the affected skin, thus promoting restoration of the skin function. Our results provide a new possible therapy idea for the treatment of skin wounds with respect to both anatomical regeneration and functional restoration.

  13. Coordination by Cdc42 of Actin, Contractility, and Adhesion for Melanoblast Movement in Mouse Skin

    DEFF Research Database (Denmark)

    Woodham, Emma F; Paul, Nikki R; Tyrrell, Benjamin

    2017-01-01

    traverse the dermis to reach the epidermis of the skin and hair follicles. We previously established that Rac1 signals via Scar/WAVE and Arp2/3 to effect pseudopod extension and migration of melanoblasts in skin. Here we show that RhoA is redundant in the melanocyte lineage but that Cdc42 coordinates...... multiple motility systems independent of Rac1. Similar to Rac1 knockouts, Cdc42 null mice displayed a severe loss of pigmentation, and melanoblasts showed cell-cycle progression, migration, and cytokinesis defects. However, unlike Rac1 knockouts, Cdc42 null melanoblasts were elongated and displayed large...... null cells lacked the ability to polarize their Golgi and coordinate motility systems for efficient movement. Loss of Cdc42 de-coupled three main systems: actin assembly via the formin FMNL2 and Arp2/3, active myosin-II localization, and integrin-based adhesion dynamics....

  14. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    International Nuclear Information System (INIS)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming

    2016-01-01

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  15. MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com

    2016-02-26

    MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.

  16. Ultrastructural demonstration of chemical modification of melanogenesis in hairless mouse skin

    International Nuclear Information System (INIS)

    Nishimura, M.; Gellin, G.A.; Hoshino, S.; Epstein, J.H.; Epstein, W.L.; Fukuyama, K.

    1982-01-01

    We investigated chemical and physical modifications of the genetically determined ultrastructure of melanosomes. The flank skin of hairless mice was treated with ultraviolet energy (UV) shorter than 320 nm or with a combination of a photosensitizer and UV (PUVA treatment). All melanosomes in the induced melanocytes and those in resident melanocytes in the ear skin showed eumelanogenesis, although the degree of melanin deposition differed considerably according to the induction process. Eumelanogenesis was most advanced in the resident melanocytes while PUVA-induced melanocytes showed more immature premelanosomes. We then topically applied 4-tertiary butyl catechol on the skin. The depigmenting agent caused an appearance of pheomelanosomes. The alteration in melanogenesis was seen most distinctly in premelanosomes of the PUVA-induced cells. Altered ultrastructure was also observed in matured melanosomes; this change was most apparent in the resident melanocytes. These findings indicate that cells with eumelanogenesis may undergo pheomelanogenesis. The present study demonstrated effects of chemicals on genetically determined function of melanocytes by quantitative analysis of melanosome ultrastructure

  17. Comparative studies of types 1 and 2 herpes simplex virus infection of cultured normal keratinocytes.

    OpenAIRE

    Su, S J; Wu, H H; Lin, Y H; Lin, H Y

    1995-01-01

    AIMS--To investigate the differences in biological properties, multiplication patterns, and cytopathic effects between type 1 and type 2 herpes simplex virus (HSV) through the replication of HSV in cultured normal human keratinocytes. METHODS--Keratinocytes were obtained from surgical specimens of normal gingiva, cervix, trunk skin, and newborn foreskin. They were cultured in serum free, chemically defined, culture medium and infected with a pool of HSV collected from clinical specimens. RESU...

  18. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    Science.gov (United States)

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  19. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  20. Ultraviolet carcinogenesis in the hairless mouse skin. Influence of the sunscreen 2-ethylhexyl-p-methoxycinnamate.

    Science.gov (United States)

    Gallagher, C H; Greenoak, G E; Reeve, V E; Canfield, P J; Baker, R S; Bonin, A M

    1984-10-01

    The mutagenicity of some samples of a commonly used sunscreen, 2-ethylhexyl-p-methoxycinnamate (2-EHMC), led to these studies of its potential carcinogenicity in the HRA/Skh hairless mouse. In a daily treatment regime, repeated for 9 weeks, groups of mice were painted on the dorsum with 2-EHMC, and were then exposed to low doses of one of two artificial ultraviolet (UV) light sources. Mice were also treated with UV alone and with 2-EHMC alone. The accumulated UV exposure alone produced tumours in 40-100% of mice. However, 2-EHMC-treated mice were protected. Subsequent treatment of the 2-EHMC-protected mice, and mice previously treated with 2-EHMC alone, with the tumour promoter, croton oil, produced tumours on a significant number of animals. We conclude that 2-EHMC protects from UV tumorigenesis in the absence of a tumour promoter. However, although tumours appeared on only 4 out of 160 2-EHMC-treated mice exposed to UV, the carcinogenic process had been initiated in others, as application of the tumour promoter, croton oil, produced tumours. Statistical analysis of the incidence of promoted tumours inferred that prior irradiation with UV may not have been implicated. Therefore, 2-EHMC itself may initiate tumours in this strain of hairless mouse.

  1. Studies on the tumor initiation/promotion potential of six middle distillates (MDs) in mouse skin.

    Science.gov (United States)

    Jungen, H; Mellert, W; Wenzel-Hartung, R

    1995-08-01

    Six middle distillates (MDs) were tested for tumor initiating/promoting activity after application to the skin of 30 male CD-1 (ICR) BR mice per group. As the control, 7,12-dimethylbenz[a]-anthracene (DMBA) was used for initiation followed by 12-O-tetradecanoylphorbol-13-acetate (TPA) for promotion. For assessing the tumor-initiating activity, 50 microliters of neat MDs was administered for 5 days with subsequent TPA promotion. In the promotion bioassay, after DMBA initiation 50 microliters of the neat MDs was administered twice weekly until Week 28. For the examination of complete carcinogenic activity, one MD was given without DMBA initiation. Hyperkeratosis, hyperplasia, and dermal inflammation, occurring during the initiation with the MDs, were completely reversible during the 2-week treatment-free period after initiation. Similar skin findings were observed during promotion with the MDs. Regarding the number of affected animals and the severity of the response, TPA was more irritating than the MDs. The initiation study revealed skin tumors for the DMBA/TPA control (30/30), MD 57,389 (14/30), MD 57,396 (5/30), MD 57,383 (4/30) and MD 57,324 (2/30). The promotion study revealed tumor induction by MDs 57,389 (9/30), 57,324 (1/30), 57,393 (1/30), and 57,396 (1/30). Two of 30 animals treated with MD 57,389 developed tumors without DMBA initiation thus indicating that it also is a complete carcinogen. MD 57,399 caused neither initiating nor promoting effects. The tumors observed were diagnosed histopathologically predominantly as squamous cell papillomas.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Inhibition of Akt enhances the chemopreventive effects of topical rapamycin in mouse skin

    Science.gov (United States)

    Dickinson, Sally E; Janda, Jaroslav; Criswell, Jane; Blohm-Mangone, Karen; Olson, Erik R.; Liu, Zhonglin; Barber, Christie; Rusche, Jadrian J.; Petricoin, Emmanuel; Calvert, Valerie; Einspahr, Janine G.; Dickinson, Jesse; Stratton, Steven P.; Curiel-Lewandrowski, Clara; Saboda, Kathylynn; Hu, Chengcheng; Bode, Ann M.; Dong, Zigang; Alberts, David S.; Bowden, G. Timothy

    2016-01-01

    The PI3Kinase/Akt/mTOR pathway has important roles in cancer development for multiple tumor types, including UV-induced non-melanoma skin cancer. Immunosuppressed populations are at increased risk of aggressive cutaneous squamous cell carcinoma (SCC). Individuals who are treated with rapamycin, (sirolimus, a classical mTOR inhibitor) have significantly decreased rates of developing new cutaneous SCCs compared to those that receive traditional immunosuppression. However, systemic rapamycin use can lead to significant adverse events. Here we explored the use of topical rapamycin as a chemopreventive agent in the context of solar simulated light (SSL)-induced skin carcinogenesis. In SKH-1 mice, topical rapamycin treatment decreased tumor yields when applied after completion of 15 weeks of SSL exposure compared to controls. However, applying rapamycin during SSL exposure for 15 weeks, and continuing for 10 weeks after UV treatment, increased tumor yields. We also examined whether a combinatorial approach might result in more significant tumor suppression by rapamycin. We validated that rapamycin causes increased Akt (S473) phosphorylation in the epidermis after SSL, and show for the first time that this dysregulation can be inhibited in vivo by a selective PDK1/Akt inhibitor, PHT-427. Combining rapamycin with PHT-427 on tumor prone skin additively caused a significant reduction of tumor multiplicity compared to vehicle controls. Our findings indicate that patients taking rapamycin should avoid sun exposure, and that combining topical mTOR inhibitors and Akt inhibitors may be a viable chemoprevention option for individuals at high risk for cutaneous SCC.

  3. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  4. Effect of Nanodiamond and Nanoplatinum Liquid, DPV576, on Human Primary Keratinocytes.

    Science.gov (United States)

    Ghoneum, Mamdooh H; Katano, Hideki; Agrawal, Sudhanshu; Ganguly, Sreerupa; Agrawal, Anshu

    2017-01-01

    Nanofabrics are now being used in a wide range of products that come into direct contact with skin, including carpet, clothing, and medical fabrics. In the current study, we examined the effect of a dispersed aqueous mixture of nanodiamond (ND) and nanoplatinum (NP) (DPV576) on human primary keratinocytes with respect to transient receptor potential vanilloid (TRPV) channel expression, secretion of cytokines and production of nerve growth factor (NGF). Keratinocytes were treated with DPV576 at concentrations of 1:10 and 1:100 dilutions for 24 hours in vitro, and their activation of was determined by production of cytokines TNF-α, IL-1β, and prostaglandin (PGE2), and by production of NGF. Inhibitor experiments were carried out by incubating keratinocytes with the TRPV4-selective antagonist HC-067047. TRPV receptor expression (TRPV1, TRPV3 and TRPV4) on keratinocytes as well as changes in Ca2+ potential were examined by flow cytometry. DPV576 treatment of keratinocytes resulted in the following effects: (1) stimulation of keratinocytes as indicated by the significant secretion of cytokines IL-1β, TNF-α, and PGE2, an effect noted only at higher concentration (1:10); (2) significant decrease in the expression of TRPV4 on keratinocytes with a spike in the calcium flux, but no change in the expression of TRPV1 and TRPV3; (3) induction of cytokine secretion independent of TRPV4, as the addition of TRPV4 inhibitor had no significant effect on the cytokine production from keratinocytes; (4) induction of NGF secretion by keratinocytes. These results demonstrate that DPV576 activates keratinocytes via multiple signaling pathways which may reduce stress associated with inflammation, pain, and circadian rhythms. ND/NP-coated fabrics that target the modulation of local inflammation, pain, and circadian rhythms could potentially be of benefit to humans.

  5. Assessment of reinforced poly(ethylene glycol) chitosan hydrogels as dressings in a mouse skin wound defect model

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Szu-Hsien [Institute of Polymer Science and Engineering, College of Engineering, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei City 10617, Taiwan (China); Tsao, Ching-Ting [Institute of Polymer Science and Engineering, College of Engineering, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei City 10617, Taiwan (China); Epithelial Biology Laboratory/Transgenic Mice Core-Laboratory, Department of Anatomy, Chang Gung University, Taoyuan 33302, Taiwan (China); Chang, Chih-Hao [Department of Orthopedics, National Taiwan University Hospital, Taiwan (China); National Taiwan University College of Medicine, No. 1, Jen-Ai Road, Taipei City 10018, Taiwan (China); Lai, Yi-Ting [Department of Chemical Engineering, College of Engineering, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei City 10617, Taiwan (China); Wu, Ming-Fung [Animal Medicine Center, College of Medicine, National Taiwan University, No. 1, Jen-Ai Road, Taipei City 10018, Taiwan (China); Chuang, Ching-Nan [Institute of Polymer Science and Engineering, College of Engineering, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei City 10617, Taiwan (China); Chou, Hung-Chia [Department of Chemical Engineering, College of Engineering, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei City 10617, Taiwan (China); Wang, Chih-Kuang, E-mail: ckwang@kmu.edu.tw [Department of Medicinal and Applied Chemistry, Kaohsiung Medical University, No. 100, Shih-Chuan 1st Road, Kaohsiung 80708, Taiwan (China); Hsieh, Kuo-Haung, E-mail: khhsieh@ntu.edu.tw [Institute of Polymer Science and Engineering, College of Engineering, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei City 10617, Taiwan (China)

    2013-07-01

    Wound dressings of chitosan are biocompatible, biodegradable, antibacterial and hemostatic biomaterials. However, applications for chitosan are limited due to its poor mechanical properties. Here, we conducted an in vivo mouse angiogenesis study on reinforced poly(ethylene glycol) (PEG)-chitosan (RPC) hydrogels. RPC hydrogels were formed by cross-linking chitosan with PEGs of different molecular weights at various PEG to chitosan ratios in our previous paper. These dressings can keep the wound moist, had good gas exchange capacity, and was capable of absorbing or removing the wound exudate. We examined the ability of these RPC hydrogels and neat chitosan to heal small cuts and full-thickness skin defects on the backs of male Balb/c mice. Histological examination revealed that chitosan suppressed the infiltration of inflammatory cells and accelerated fibroblast proliferation, while PEG enhanced epithelial migration. The RPC hydrogels promoted wound healing in the small cuts and full layer wounds. The optimal RPC hydrogel had a swelling ratio of 100% and a water vapor transmission rate (WVTR) of about 2000 g/m{sup 2}/day. In addition, they possess good mechanical property and appropriate degradation rates. Thus, the optimal RPC hydrogel formulation functioned effectively as a wound dressing and promoted wound healing. Highlights: ► Mouse angiogenesis study on reinforced poly(ethylene glycol)-chitosan (RPC) ► Water vapor transmission rate of about 2000 g/m{sup 2}/day is characteristic of RPC. ► RPC suppressed inflammatory cells and accelerated fibroblast proliferation. ► RPC composed of 1000-RP10C90 can be used as a biomaterial for wound dressing.

  6. Assessment of reinforced poly(ethylene glycol) chitosan hydrogels as dressings in a mouse skin wound defect model

    International Nuclear Information System (INIS)

    Chen, Szu-Hsien; Tsao, Ching-Ting; Chang, Chih-Hao; Lai, Yi-Ting; Wu, Ming-Fung; Chuang, Ching-Nan; Chou, Hung-Chia; Wang, Chih-Kuang; Hsieh, Kuo-Haung

    2013-01-01

    Wound dressings of chitosan are biocompatible, biodegradable, antibacterial and hemostatic biomaterials. However, applications for chitosan are limited due to its poor mechanical properties. Here, we conducted an in vivo mouse angiogenesis study on reinforced poly(ethylene glycol) (PEG)-chitosan (RPC) hydrogels. RPC hydrogels were formed by cross-linking chitosan with PEGs of different molecular weights at various PEG to chitosan ratios in our previous paper. These dressings can keep the wound moist, had good gas exchange capacity, and was capable of absorbing or removing the wound exudate. We examined the ability of these RPC hydrogels and neat chitosan to heal small cuts and full-thickness skin defects on the backs of male Balb/c mice. Histological examination revealed that chitosan suppressed the infiltration of inflammatory cells and accelerated fibroblast proliferation, while PEG enhanced epithelial migration. The RPC hydrogels promoted wound healing in the small cuts and full layer wounds. The optimal RPC hydrogel had a swelling ratio of 100% and a water vapor transmission rate (WVTR) of about 2000 g/m 2 /day. In addition, they possess good mechanical property and appropriate degradation rates. Thus, the optimal RPC hydrogel formulation functioned effectively as a wound dressing and promoted wound healing. Highlights: ► Mouse angiogenesis study on reinforced poly(ethylene glycol)-chitosan (RPC) ► Water vapor transmission rate of about 2000 g/m 2 /day is characteristic of RPC. ► RPC suppressed inflammatory cells and accelerated fibroblast proliferation. ► RPC composed of 1000-RP10C90 can be used as a biomaterial for wound dressing

  7. PER, a Circadian Clock Component, Mediates the Suppression of MMP-1 Expression in HaCaT Keratinocytes by cAMP.

    Science.gov (United States)

    Yeom, Miji; Lee, HansongI; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun

    2018-03-23

    Skin circadian clock system responds to daily changes, thereby regulating skin functions. Exposure of the skin to UV irradiation induces the expression of matrix metalloproteinase-1 (MMP-1) and causes DNA damage. It has been reported both DNA repair and DNA replication are regulated by the circadian clock in mouse skin. However, the molecular link between circadian clock and MMP-1 has little been investigated. We found PERIOD protein, a morning clock component, represses the expression of MMP-1 in human keratinocytes by using a PER-knockdown strategy. Treatment with siPer3 alleviated the suppression of MMP-1 expression induced by forskolin. Results revealed PER3 suppresses the expression of MMP-1 via cAMP signaling pathway. Additionally, we screened for an activator of PER that could repress the expression of MMP-1 using HaCaT cell line containing PER promoter-luciferase reporter gene. Results showed Lespedeza capitate extract (LCE) increased PER promoter activity. LCE inhibited the expression of MMP-1 and its effect of LCE was abolished in knockdown of PER2 or PER3, demonstrating LCE can repress the expression of MMP-1 through PER. Since circadian clock component PER can regulate MMP-1 expression, it might be a new molecular mechanism to develop therapeutics to alleviate skin aging and skin cancer.

  8. PER, a Circadian Clock Component, Mediates the Suppression of MMP-1 Expression in HaCaT Keratinocytes by cAMP

    Directory of Open Access Journals (Sweden)

    Miji Yeom

    2018-03-01

    Full Text Available Skin circadian clock system responds to daily changes, thereby regulating skin functions. Exposure of the skin to UV irradiation induces the expression of matrix metalloproteinase-1 (MMP-1 and causes DNA damage. It has been reported both DNA repair and DNA replication are regulated by the circadian clock in mouse skin. However, the molecular link between circadian clock and MMP-1 has little been investigated. We found PERIOD protein, a morning clock component, represses the expression of MMP-1 in human keratinocytes by using a PER-knockdown strategy. Treatment with siPer3 alleviated the suppression of MMP-1 expression induced by forskolin. Results revealed PER3 suppresses the expression of MMP-1 via cAMP signaling pathway. Additionally, we screened for an activator of PER that could repress the expression of MMP-1 using HaCaT cell line containing PER promoter-luciferase reporter gene. Results showed Lespedeza capitate extract (LCE increased PER promoter activity. LCE inhibited the expression of MMP-1 and its effect of LCE was abolished in knockdown of PER2 or PER3, demonstrating LCE can repress the expression of MMP-1 through PER. Since circadian clock component PER can regulate MMP-1 expression, it might be a new molecular mechanism to develop therapeutics to alleviate skin aging and skin cancer.

  9. Skin vaccination against cervical cancer associated human papillomavirus with a novel micro-projection array in a mouse model.

    Directory of Open Access Journals (Sweden)

    Holly J Corbett

    Full Text Available BACKGROUND: Better delivery systems are needed for routinely used vaccines, to improve vaccine uptake. Many vaccines contain alum or alum based adjuvants. Here we investigate a novel dry-coated densely-packed micro-projection array skin patch (Nanopatch™ as an alternate delivery system to intramuscular injection for delivering an alum adjuvanted human papillomavirus (HPV vaccine (Gardasil® commonly used as a prophylactic vaccine against cervical cancer. METHODOLOGY/PRINCIPAL FINDINGS: Micro-projection arrays dry-coated with vaccine material (Gardasil® delivered to C57BL/6 mouse ear skin released vaccine within 5 minutes. To assess vaccine immunogenicity, doses of corresponding to HPV-16 component of the vaccine between 0.43 ± 0.084 ng and 300 ± 120 ng (mean ± SD were administered to mice at day 0 and day 14. A dose of 55 ± 6.0 ng delivered intracutaneously by micro-projection array was sufficient to produce a maximal virus neutralizing serum antibody response at day 28 post vaccination. Neutralizing antibody titres were sustained out to 16 weeks post vaccination, and, for comparable doses of vaccine, somewhat higher titres were observed with intracutaneous patch delivery than with intramuscular delivery with the needle and syringe at this time point. CONCLUSIONS/SIGNIFICANCE: Use of dry micro-projection arrays (Nanopatch™ has the potential to overcome the need for a vaccine cold chain for common vaccines currently delivered by needle and syringe, and to reduce risk of needle-stick injury and vaccine avoidance due to the fear of the needle especially among children.

  10. Comparison of the transcriptomes of mouse skin derived precursors (SKPs and SKP-derived fibroblasts (SFBs by RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Yujie Mao

    Full Text Available Skin-derived precursors (SKPs from dermis possess the capacities of self-renewal and multipotency. In vitro and in vivo studies demonstrated that they can differentiate into fibroblasts. However, little is known about the molecular mechanism of the differentiation of SKPs into fibroblasts. Here we compare the transcriptomes of mouse SKPs and SKP-derived fibroblasts (SFBs by RNA-Seq analysis, trying to find differences in gene expression between the two kinds of cells and then elucidate the candidate genes that may play important roles in the differentiation of SKPs into fibroblasts. A total of 1971 differentially expressed genes (DEGs were identified by RNA-Seq, which provided abundant data for further analysis. Gene Ontology enrichment analysis revealed that genes related to cell differentiation, cell proliferation, protein binding, transporter activity and membrane were significantly enriched. The most significantly up-regulated genes Wnt4, Wisp2 and Tsp-1 and down-regulated genes Slitrk1, Klk6, Agtr2, Ivl, Msx1, IL15, Atp6v0d2, Kcne1l and Thbs4 may play important roles in the differentiation of SKPs into fibroblasts. KEGG analysis showed that DEGs were significantly enriched in the TGF-β signaling pathway, Wnt signaling pathway and Notch signaling pathway, which have been previously proven to regulate the differentiation and self-renewal of various stem cells. These identified DEGs and pathways could facilitate further investigations of the detailed molecular mechanisms, making it possible to take advantage of the potential therapeutic applications of SKPs in skin regeneration in the future.

  11. Effects of whole-body and partial-body x irradiation upon epidermal mitotic activity during wound healing in mouse skin

    International Nuclear Information System (INIS)

    Kobayashi, K.

    1977-01-01

    Mitotic activity of normal (unwounded) and wounded skin was measured in the control (nonirradiated) and whole-body or partial-body x-irradiated mouse. Higher mitotic activity in the anterior than in the posterior region of the body was found in both the normal and the wounded skin of the control mouse. Whole-body irradiation (500 R) depressed completely the mitotic activity of normal skin 2 to 4 days after irradiation. In spite of this depression in mitotic activity, a surgical incision made 1 to 3 days after irradiation could induce a burst of proliferation after an inhibition of an initial mitosis increase. When the animals were partially irradiated with 500 R 3 days before wounding, it was shown that mitosis at 24 hr after wounding was inhibited markedly by the local effect of irradiation and that mitosis also could be inhibited diversely by the abscopal effect of irradiation. Because of a close similarity of sequential mitotic patterns between whole-body-irradiated and flapped-skin-only-irradiated groups (direct irradiation), the effect of irradiation upon mitosis was considered to be primarily local. Some discussions were made concerning the possible reasons which made a difference in mitotic patterns between the head-only-irradiated group, the irradiated group including the head and other parts of the body except for the skin flap

  12. Application of low level laser on skin cell lines

    CSIR Research Space (South Africa)

    Ndhundhuma, IM

    2010-01-01

    Full Text Available Lasers have emerged as powerful tools for tissue engineering. To examine cellular growth, and cell to cell interactions, in vitro skin models have been developed combining two major cell types of skin, keratinocytes and fibroblasts. The main...

  13. Leptin deficiency-induced obesity exacerbates ultraviolet B radiation-induced cyclooxygenase-2 expression and cell survival signals in ultraviolet B-irradiated mouse skin

    International Nuclear Information System (INIS)

    Sharma, Som D.; Katiyar, Santosh K.

    2010-01-01

    Obesity has been implicated in several inflammatory diseases and in different types of cancer. Chronic inflammation induced by exposure to ultraviolet (UV) radiation has been implicated in various skin diseases, including melanoma and nonmelanoma skin cancers. As the relationship between obesity and susceptibility to UV radiation-caused inflammation is not clearly understood, we assessed the role of obesity on UVB-induced inflammation, and mediators of this inflammatory response, using the genetically obese (leptin-deficient) mouse model. Leptin-deficient obese (ob/ob) mice and wild-type counterparts (C57/BL6 mice) were exposed to UVB radiation (120 mJ/cm 2 ) on alternate days for 1 month. The mice were then euthanized and skin samples collected for analysis of biomarkers of inflammatory responses using immunohistochemistry, western blotting, ELISA and real-time PCR. Here, we report that the levels of inflammatory responses were higher in the UVB-exposed skin of the ob/ob obese mice than those in the UVB-exposed skin of the wild-type non-obese mice. The levels of UVB-induced cyclooxygenase-2 expression, prostaglandin-E 2 production, proinflammatory cytokines (i.e., tumor necrosis factor-α, interleukin-1β, interleukin-6), and proliferating cell nuclear antigen and cell survival signals (phosphatidylinositol-3-kinase and p-Akt-Ser 473 ) were higher in the skin of the ob/ob obese mice than the those in skin of their wild-type non-obese counterparts. Compared with the wild-type non-obese mice, the leptin-deficient obese mice also exhibited greater activation of NF-κB/p65 and fewer apoptotic cells in the UVB-irradiated skin. Our study suggests for the first time that obesity in mice is associated with greater susceptibility to UVB-induced inflammatory responses and, therefore, obesity may increase susceptibility to UVB-induced inflammation-associated skin diseases, including the risk of skin cancer.

  14. Molecular cloning and expression of a novel keratinocyte protein (psoriasis-associated fatty acid-binding protein [PA-FABP]) that is highly up-regulated in psoriatic skin and that shares similarity to fatty acid-binding proteins

    DEFF Research Database (Denmark)

    Madsen, Peder; Rasmussen, H H; Leffers, H

    1992-01-01

    termed PA-FABP (psoriasis-associated fatty acid-binding protein). The deduced sequence predicted a protein with molecular weight of 15,164 daltons and a calculated pI of 6.96, values that are close to those recorded in the keratinocyte 2D gel protein database. The protein comigrated with PA-FABP...... as determined by 2D gel analysis of [35S]-methionine-labeled proteins expressed by transformed human amnion (AMA) cells transfected with clone 1592 using the vaccinia virus expression system and reacted with a rabbit polyclonal antibody raised against 2D gel purified PA-FABP. Structural analysis of the amino...... acid sequence revealed 48%, 52%, and 56% identity to known low-molecular-weight fatty acid-binding proteins belonging to the FABP family. Northern blot analysis showed that PA-FABP mRNA is indeed highly up-regulated in psoriatic keratinocytes. The transcript is present in human cell lines of epithelial...

  15. The time-course analysis of gene expression during wound healing in mouse skin.

    Science.gov (United States)

    Kagawa, Shinichiro; Matsuo, Aya; Yagi, Yoichi; Ikematsu, Kazuya; Tsuda, Ryouichi; Nakasono, Ichiro

    2009-03-01

    RNA analysis has been applied to forensic work to determine wound age. We investigated mRNA expression using quantitative RT-PCR of ten genes, including c-fos, fosB, mitogen-activated protein kinase phosphatase-1 (MKP-1), CD14, chemokine (C-C motif) ligand 9 (CCL9), placenta growth factor (PlGF), mast cell protease-5 (MCP-5), growth arrest specific 5 (Gas5), beta-2 microglobulin (B2M) and major urinary protein-1 (MUP-1), in terms of repair response in adult mice. The expression level of c-fos, fosB and MKP-1 transcripts increased drastically, peaked within 1h, and that of the CD14 and CCL9 transcripts peaked from 12 to 24h. An increase in PlGF and MCP-5 mRNA appeared on about day 5. Gas5, B2M and MUP-1 transcripts showed no significant change. Each gene had differentially expressional patterns with time-course. Our result implied that the observation of the 7 genes in wounded skin could serve to aid in the accurate diagnosis of wound age.

  16. [Cultivated keratinocytes on micro-carriers: in vitro studies of a new carrier system].

    Science.gov (United States)

    Hecht, J; Hoefter, E A; Hecht, J; Haraida, S; Nerlich, A; Hartinger, A; Mühlbauer, W; Dimoudis, N

    1997-03-01

    Epidermal grafts from confluently cultivated keratinocytes have been used since the early eighties for the treatment of severe burns, where the shortage of donor sites for split-thickness skin grafts did not allow for adequate wound coverage. The difficult handling of these grafts as well as the advanced differentiation of their epithelial cells into a multilayer sheet poses a problem for their clinical application. The aim of the study was to characterize cultivated keratinocytes, as well as to observe their migration and proliferation from the MC onto a surface. Keratinocytes were isolated from human foreskin and cultivated in serum-free and serum-containing medium according to a modified method by Rheinwald and Green. Collagen-coated Dextran beads were used as MC. The MC were colonized with keratinocytes using the Spinner culture technique. After seeding the colonized MC into culture flasks, their migration and proliferation was monitored regularly through immunohistochemical studies and measurement of the metabolic cell activity. Immunohistological staining proved that the cells isolated from human foreskin represent keratinocytes of the basal type. Keratinocytes, cultivated with serum-containing and serum free medium, both adhered to the surface of the MC, then migrated onto the surface of the flasks and proliferated to form a multilayer of epithelial cells. In the long-term, a flexible epithelial graft consisting of poorly differentiated keratinocytes should be available, which is simple to produce and easy to handle. This would be an alternative method for treating wounds, where the conventional multilayer epithelial graft (ET) is insufficient.

  17. 2,6-Dithiopurine, a nucleophilic scavenger, protects against mutagenesis in mouse skin treated in vivo with 2-(chloroethyl) ethyl sulfide, a mustard gas analog

    Energy Technology Data Exchange (ETDEWEB)

    Boulware, Stephen [Division of Pharmacy and Toxicology, College of Pharmacy, The University of Texas at Austin, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd., Austin, TX 78723 (United States); Fields, Tammy; McIvor, Elizabeth; Powell, K. Leslie; Abel, Erika L. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States); Vasquez, Karen M. [Division of Pharmacy and Toxicology, College of Pharmacy, The University of Texas at Austin, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd., Austin, TX 78723 (United States); MacLeod, Michael C., E-mail: mcmacleod@mdanderson.org [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Science Park, Smithville, TX 78957 (United States)

    2012-09-01

    Sulfur mustard [bis(2-chloroethyl)sulfide, SM] is a well-known DNA-damaging agent that has been used in chemical warfare since World War I, and is a weapon that could potentially be used in a terrorist attack on a civilian population. Dermal exposure to high concentrations of SM produces severe, long-lasting burns. Topical exposure to high concentrations of 2-(chloroethyl) ethyl sulfide (CEES), a monofunctional analog of SM, also produces severe skin lesions in mice. Utilizing a genetically engineered mouse strain, Big Blue, that allows measurement of mutation frequencies in mouse tissues, we now show that topical treatment with much lower concentrations of CEES induces significant dose- and time-dependent increases in mutation frequency in mouse skin; the mutagenic exposures produce minimal toxicity as determined by standard histopathology and immunohistochemical analysis for cytokeratin 6 and the DNA-damage induced phosphorylation of histone H2AX (γ-H2AX). We attempted to develop a therapeutic that would inhibit the CEES-induced increase in mutation frequency in the skin. We observe that multi-dose, topical treatment with 2,6-dithiopurine (DTP), a known chemical scavenger of CEES, beginning 1 h post-exposure to CEES, completely abolishes the CEES-induced increase in mutation frequency. These findings suggest the possibility that DTP, previously shown to be non-toxic in mice, may be useful as a therapeutic agent in accidental or malicious human exposures to SM. -- Highlights: ► 200 mM 2-(chloroethyl) ethyl sulfide (CEES) induces mutations in mouse skin. ► This dose of CEES is not overtly toxic, as assayed by histopathology. ► 2,6-Dithiopurine (DTP), applied after CEES-treatment, abolishes CEES-mutagenesis. ► This supports the idea that sulfur mustards exhibit long biological half-lives.

  18. 2,6-Dithiopurine, a nucleophilic scavenger, protects against mutagenesis in mouse skin treated in vivo with 2-(chloroethyl) ethyl sulfide, a mustard gas analog

    International Nuclear Information System (INIS)

    Boulware, Stephen; Fields, Tammy; McIvor, Elizabeth; Powell, K. Leslie; Abel, Erika L.; Vasquez, Karen M.; MacLeod, Michael C.

    2012-01-01

    Sulfur mustard [bis(2-chloroethyl)sulfide, SM] is a well-known DNA-damaging agent that has been used in chemical warfare since World War I, and is a weapon that could potentially be used in a terrorist attack on a civilian population. Dermal exposure to high concentrations of SM produces severe, long-lasting burns. Topical exposure to high concentrations of 2-(chloroethyl) ethyl sulfide (CEES), a monofunctional analog of SM, also produces severe skin lesions in mice. Utilizing a genetically engineered mouse strain, Big Blue, that allows measurement of mutation frequencies in mouse tissues, we now show that topical treatment with much lower concentrations of CEES induces significant dose- and time-dependent increases in mutation frequency in mouse skin; the mutagenic exposures produce minimal toxicity as determined by standard histopathology and immunohistochemical analysis for cytokeratin 6 and the DNA-damage induced phosphorylation of histone H2AX (γ-H2AX). We attempted to develop a therapeutic that would inhibit the CEES-induced increase in mutation frequency in the skin. We observe that multi-dose, topical treatment with 2,6-dithiopurine (DTP), a known chemical scavenger of CEES, beginning 1 h post-exposure to CEES, completely abolishes the CEES-induced increase in mutation frequency. These findings suggest the possibility that DTP, previously shown to be non-toxic in mice, may be useful as a therapeutic agent in accidental or malicious human exposures to SM. -- Highlights: ► 200 mM 2-(chloroethyl) ethyl sulfide (CEES) induces mutations in mouse skin. ► This dose of CEES is not overtly toxic, as assayed by histopathology. ► 2,6-Dithiopurine (DTP), applied after CEES-treatment, abolishes CEES-mutagenesis. ► This supports the idea that sulfur mustards exhibit long biological half-lives.

  19. Enhanced secretion of TIMP-1 by human hypertrophic scar keratinocytes could contribute to fibrosis.

    Science.gov (United States)

    Simon, Franck; Bergeron, Daniele; Larochelle, Sébastien; Lopez-Vallé, Carlos A; Genest, Hervé; Armour, Alexis; Moulin, Véronique J

    2012-05-01

    Hypertrophic scars are a pathological process characterized by an excessive deposition of extracellular matrix components. Using a tissue-engineered reconstructed human skin (RHS) method, we previously reported that pathological keratinocytes induce formation of a fibrotic dermal matrix. We further investigated keratinocyte action using conditioned media. Results showed that conditioned media induce a similar action on dermal thickness similar to when an epidermis is present. Using a two-dimensional electrophoresis technique, we then compared conditioned media from normal or hypertrophic scar keratinocytes and determined that TIMP-1 was increased in conditioned media from hypertrophic scar keratinocytes. This differential profile was confirmed using ELISA, assaying TIMP-1 presence on media from monolayer cultured keratinocytes and from RHS. The dermal matrix of these RHS was recreated using mesenchymal cells from three different origins (skin, wound and hypertrophic scar). The effect of increased TIMP-1 levels on dermal fibrosis was also validated independently from the mesenchymal cell origin. Immunodetection of TIMP-1 showed that this protein was increased in the epidermis of hypertrophic scar biopsies. The findings of this study represent an important advance in understanding the role of keratinocytes as a direct potent modulator for matrix degradation and scar tissue remodeling, possibly through inactivation of MMPs. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  20. Preconditioning With Low-Level Laser Irradiation Enhances the Therapeutic Potential of Human Adipose-derived Stem Cells in a Mouse Model of Photoaged Skin.

    Science.gov (United States)

    Liao, Xuan; Li, Sheng-Hong; Xie, Guang-Hui; Xie, Shan; Xiao, Li-Ling; Song, Jian-Xing; Liu, Hong-Wei

    2018-02-19

    This study was conducted to explore the therapeutic potential of human adipose-derived stem cells (ADSCs) irradiated with a low-level laser (LLL). Cultured ADSCs were treated with 650-nm GaAlAs laser irradiation at 2, 4 and 8 J cm -2 . Cell proliferation was quantified by MTT assays, cytokine secretion was determined by enzyme-linked immunosorbent assays, and adipogenic differentiation was examined by oil red O staining. Additionally, the expression profiles of putative ADSC surface markers were analyzed by quantitative real-time PCR. In addition, a mouse photoaged skin model was established by UVB irradiation. Effects of GaAlAs laser-treated ADSCs on the thicknesses of the epidermis and dermis were analyzed by hematoxylin and eosin staining. The results showed that GaAlAs laser treatment of cells at a radiant exposure of 4 J cm -2 enhanced ADSC proliferation and adipogenic differentiation and increased secretion of growth factors. Furthermore, GaAlAs laser irradiation upregulated the expression of putative ADSC surface markers. In the mouse model of photoaged skin, ADSCs treated with GaAlAs laser irradiation had markedly decreased the epidermal thickness and increased the dermal thickness of photoaged mouse skin. Our data indicate that LLL irradiation is an effective biostimulator of ADSCs and might enhance the therapeutic potential of ADSCs for clinical use. © 2018 The American Society of Photobiology.

  1. MicroRNA-17-92 cluster promotes the proliferation and the chemokine production of keratinocytes: implication for the pathogenesis of psoriasis.

    Science.gov (United States)

    Zhang, Weigang; Yi, Xiuli; An, Yawen; Guo, Sen; Li, Shuli; Song, Pu; Chang, Yuqian; Zhang, Shaolong; Gao, Tianwen; Wang, Gang; Li, Chunying

    2018-05-11

    Keratinocytes are the main epidermal cell type that constitutes the skin barrier against environmental damages, which emphasizes the balance between the growth and the death of keratinocytes in maintaining skin homeostasis. Aberrant proliferation of keratinocytes and the secretion of inflammatory factors from keratinocytes are related to the formation of chronic inflammatory skin diseases like psoriasis. MicroRNA-17-92 (miRNA-17-92 or miR-17-92) is a miRNA cluster that regulates cell growth and immunity, but the role of miR-17-92 cluster in keratinocytes and its relation to skin diseases have not been well investigated. In the present study, we initially found that miR-17-92 cluster promoted the proliferation and the cell-cycle progression of keratinocytes via suppressing cyclin-dependent kinase inhibitor 2B (CDKN2B). Furthermore, miR-17-92 cluster facilitated the secretion of C-X-C motif chemokine ligand 9 (CXCL9) and C-X-C motif chemokine ligand 10 (CXCL10) from keratinocytes by inhibiting suppressor of cytokine signaling 1 (SOCS1), which enhanced the chemotaxis for T lymphocytes formed by keratinocytes. In addition, we detected increased expression of miR-17-92 cluster in psoriatic lesions and the level of lesional miR-17-92 cluster was positively correlated with the disease severity in psoriasis patients. At last, miR-17-92 cluster was increased in keratinocytes by cytokines through the activation of signal transducers and activators of transcription 1 (STAT1) signaling pathway. Our findings demonstrate that cytokine-induced overexpression of miR-17-92 cluster can promote the proliferation and the immune function of keratinocytes, and thus may contribute to the development of inflammatory skin diseases like psoriasis, which implicates miR-17-92 cluster as a potential therapeutic target for psoriasis and other skin diseases with similar inflammatory pathogenesis.

  2. CD44 antibody stimulates adhesion of peripheral blood T cells to keratinocytes through the leukocyte function-associated antigen-1/intercellular adhesion molecule-1 pathway

    NARCIS (Netherlands)

    Bruynzeel, I.; Koopman, G.; van der Raaij, L. M.; Pals, S. T.; Willemze, R.

    1993-01-01

    Close contact between T lymphocytes and keratinocytes is an important feature of many inflammatory skin diseases. In vitro studies showed that stimulation of keratinocytes with interferon-gamma or tumor necrosis factor-alpha and of T cells with phorbol esters results in a leukocyte

  3. Temporal aspects of tumorigenic response to individual and mixed carcinogens. Comprehensive progress report, June 1, 1975--May 31, 1978. [Mouse skin, rats, hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Albert, R.E.; Burns, F.J.; Altshuler, B.

    1978-02-01

    The research proposed here is designed to obtain a better understanding of the temporal kinetics of tumor induction when one or more carcinogens are present simultaneously or sequentially for prolonged periods of time. Studies done to date under this contract have shown that carcinogenesis in mouse skin by polycyclic aromatic hydrocarbon carcinogens is consistent with the induction of dependent and autonomous cell transformations by the carcinogen followed by the conversion of autonomous tumor cells into malignancies at a rate which is determined by the level of carcinogen exposure. Dependent cell transformations remain latent in the skin unless expressed by a promoting agent. Dependent neoplasia appears to follow one-hit kinetics while malignancy is a multihit endpoint. Dose-related and time-related aspects of tumor induction are separable in the initiation-promotion system of mouse skin which along with rat skin and hamster lung is being used as a model for testing hypotheses. Results to date provide the basis for a new interpretation of the linear non-threshold extrapolation model. The broad aim of the study is to provide a basis or rationale for estimating risks associated with prolonged exposures to carcinogens found in the environment and to predict how different tissues and species respond to the same carcinogens.

  4. Cutaneous challenge with chemical warfare agents in the SKH-1 hairless mouse. (I) Development of a model for screening studies in skin decontamination and protection.

    Science.gov (United States)

    Dorandeu, F; Taysse, L; Boudry, I; Foquin, A; Hérodin, F; Mathieu, J; Daulon, S; Cruz, C; Lallement, G

    2011-06-01

    Exposure to lethal chemical warfare agents (CWAs) is no longer only a military issue due to the terrorist threat. Among the CWAs of concern are the organophosphorus nerve agent O-ethyl-S-(2[di-isopropylamino]ethyl)methyl-phosphonothioate (VX) and the vesicant sulfur mustard (SM). Although efficient means of decontamination are available, most of them lose their efficacy when decontamination is delayed after exposure of the bare skin. Alternatively, CWA skin penetration can be prevented by topical skin protectants. Active research in skin protection and decontamination is thus paramount. In vivo screening of decontaminants or skin protectants is usually time consuming and may be expensive depending on the animal species used. We were thus looking for a suitable, scientifically sound and cost-effective model, which is easy to handle. The euthymic hairless mouse Crl: SKH-1 (hr/hr) BR is widely used in some skin studies and has previously been described to be suitable for some experiments involving SM or SM analogs. To evaluate the response of this species, we studied the consequences of exposing male anaesthetized SKH-1 mice to either liquid VX or to SM, the latter being used in liquid form or as saturated vapours. Long-term effects of SM burn were also evaluated. The model was then used in the companion paper (Taysse et al.(1)).

  5. Nanodiamonds protect skin from ultraviolet B-induced damage in mice.

    Science.gov (United States)

    Wu, Meng-Si; Sun, Der-Shan; Lin, Yu-Chung; Cheng, Chia-Liang; Hung, Shih-Che; Chen, Po-Kong; Yang, Jen-Hung; Chang, Hsin-Hou

    2015-05-07

    Solar ultraviolet (UV) radiation causes various deleterious effects, and UV blockage is recommended for avoiding sunburn. Nanosized titanium dioxide and zinc oxide offer effective protection and enhance cosmetic appearance but entail health concerns regarding their photocatalytic activity, which generates reactive oxygen species. These concerns are absent in nanodiamonds (NDs). Among the UV wavelengths in sunlight, UVB irradiation primarily threatens human health. The efficacy and safety of NDs in UVB protection were evaluated using cell cultures and mouse models. We determined that 2 mg/cm(2) of NDs efficiently reduced over 95% of UVB radiation. Direct UVB exposure caused cell death of cultured keratinocyte, fibroblasts and skin damage in mice. By contrast, ND-shielding significantly protected the aforementioned pathogenic alterations in both cell cultures and mouse models. NDs are feasible and safe materials for preventing UVB-induced skin damage.

  6. Defects in Stratum Corneum Desquamation Are the Predominant Effect of Impaired ABCA12 Function in a Novel Mouse Model of Harlequin Ichthyosis.

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    Full Text Available Harlequin Ichthyosis is a severe skin disease caused by mutations in the human gene encoding ABCA12. Here, we characterize a novel mutation in intron 29 of the mouse Abca12 gene that leads to the loss of a 5' splice donor site and truncation of the Abca12 RNA transcript. Homozygous mutants of this smooth skin or smsk allele die perinatally with shiny translucent skin, typical of animal models of Harlequin Ichthyosis. Characterization of smsk mutant skin showed that the delivery of glucosylceramides and CORNEODESMOSIN was defective, while ultrastructural analysis revealed abnormal lamellar bodies and the absence of lipid lamellae in smsk epidermis. Unexpectedly, mutant stratum corneum remained intact when subjected to harsh chemical dissociation procedures. Moreover, both KALLIKREIN 5 and -7 were drastically decreased, with retention of desmoplakin in mutant SC. In cultured wild type keratinocytes, both KALLIKREIN 5 and -7 colocalized with ceramide metabolites following calcium-induced differentiation. Reducing the intracellular levels of glucosylceramide with a glucosylceramide synthase inhibitor resulted in decreased secretion of KALLIKREIN proteases by wild type keratinocytes, but not by smsk mutant keratinocytes. Together, these findings suggest an essential role for ABCA12 in transferring not only lipids, which are required for the formation of multilamellar structures in the stratum corneum, but also proteolytic enzymes that are required for normal desquamation. Smsk mutant mice recapitulate many of the pathological features of HI and can be used to explore novel topical therapies against a potentially lethal and debilitating neonatal disease.

  7. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  8. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Bernard, Eric; Hamel, Rodolphe; Neyret, Aymeric; Ekchariyawat, Peeraya; Molès, Jean-Pierre; Simmons, Graham; Chazal, Nathalie; Desprès, Philippe

    2015-01-01

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  9. A co-cultured skin model based on cell support membranes

    International Nuclear Information System (INIS)

    Dai, N.-T.; Yeh, M.-K.; Liu, Demeral David; Adams, E.F.; Chiang, C.-H.; Yen, C.-Y.; Shih, C.-M.; Sytwu, H.-K.; Chen, Tim-Mo; Wang, H.-J.; Williamson, M.R.; Coombes, A.G.A.

    2005-01-01

    Tissue engineering of skin based on collagen: PCL biocomposites using a designed co-culture system is reported. The collagen: PCL biocomposites having collagen: PCL (w/w) ratios of 1:4, 1:8, and 1:20 have been proven to be biocompatible materials to support both adult normal human epidermal Keratinocyte (NHEK) and mouse 3T3 fibroblast growth in cell culture, respectively, by Dai, Coombes, et al. in 2004. Films of collagen: PCL biocomposites were prepared using non-crosslinking method by impregnation of lyophilized collagen mats with PCL/dichloromethane solutions followed by solvent evaporation. To mimic the dermal/epidermal structure of skin, the 1:20 collagen: PCL biocomposites were selected for a feasibility study of a designed co-culture technique that would subsequently be used for preparing fibroblast/biocomposite/keratinocyte skin models. A 55.3% increase in cell number was measured in the designed co-culture system when fibroblasts were seeded on both sides of a biocomposite film compared with cell culture on one surface of the biocomposite in the feasibility study. The co-culture of human keratinocytes and 3T3 fibroblasts on each side of the membrane was therefore studied using the same co-culture system by growing keratinocytes on the top surface of membrane for 3 days and 3T3 fibroblasts underneath the membrane for 6 days. Scanning electron microscopy (SEM) and immunohistochemistry assay revealed good cell attachment and proliferation of both human keratinocytes and 3T3 fibroblasts with these two types of cells isolated well on each side of the membrane. Using a modified co-culture technique, a co-cultured skin model presenting a confluent epidermal sheet on one side of the biocomposite film and fibroblasts populated on the other side of the film was developed successfully in co-culture system for 28 days under investigations by SEM and immunohistochemistry assay. Thus, the design of a co-culture system based on 1:20 (w/w) collagen: PCL biocomposite

  10. Application of BALB/c mouse in the local lymph node assay:BrdU-ELISA for the prediction of the skin sensitizing potential of chemicals.

    Science.gov (United States)

    Hou, Fenxia; Xing, Caihong; Li, Bin; Cheng, Juan; Chen, Wei; Zhang, Man

    2015-01-01

    Allergic contact dermatitis (ACD) is a skin disease characterized by eczema and itching. A considerable proportion of chemicals induce ACD in humans. More than 10,000 substances should be tested for skin sensitization potential under the Registration, Evaluation, Authorization and Restriction of Chemical substances (REACH) regulation. The Local Lymph Node Assay (LLNA) has been designated as the first-choice in vivo assay for sensitization testing by REACH. The LLNA:BrdU-ELISA is a validated non-radioactive modification to the LLNA. For both the LLNA and the LLNA:BrdU-ELISA, CBA/JN mouse is the preferred mouse strain recommended in the regulatory guidelines. However, the availability of CBA/JN mouse in China is only limited to a few animal suppliers, which makes the mouse difficult to obtain. BALB/c mouse, which is widely commercially available, is considered for alternative use but it can only be used in the assay after it has been evaluated by formal validation study. Thus, a validation study was conducted in our laboratory to determine if BALB/c mouse could also be used in the LLNA:BrdU-ELISA. Forty-three test substances including 32 LLNA sensitizers and 11 LLNA non-sensitizers, their vehicles and each concentration used were the same as that used in the formal validation study for the LLNA:BrdU-ELISA using CBA/JN mouse. Female BALB/c mice of 8-10 weeks old were randomly allocated to groups (four mice per group). The test substance (25 μl) or the vehicle alone was applied to the dorsum of both ears daily for 3 consecutive days. A single intraperitoneal injection of 0.5 ml of BrdU (10mg/ml) solution was given on day 5. On day 6, a pair of auricular lymph nodes from each mouse was excised, weighed and stored at -20°C until BrdU-ELISA was conducted. This validation study for the LLNA:BrdU-ELISA using BALB/c mouse correctly identified 30 of 31 sensitizers and 8 of 11 non-sensitizers. The accuracy, sensitivity, specificity, false positive rate, false negative rate

  11. Regulation of p53, nuclear factor κB and cyclooxygenase-2 expression by bromelain through targeting mitogen-activated protein kinase pathway in mouse skin

    International Nuclear Information System (INIS)

    Kalra, Neetu; Bhui, Kulpreet; Roy, Preeti; Srivastava, Smita; George, Jasmine; Prasad, Sahdeo; Shukla, Yogeshwer

    2008-01-01

    Bromelain is a pharmacologically active compound, present in stems and immature fruits of pineapples (Ananas cosmosus), which has been shown to have anti-edematous, anti-inflammatory, anti-thrombotic and anti-metastatic properties. In the present study, antitumorigenic activity of bromelain was recorded in 7,12-dimethylbenz(a)anthracene (DMBA)-initiated and 12-O-tetradecanoylphorbol-13-acetate (TPA)-promoted 2-stage mouse skin model. Results showed that bromelain application delayed the onset of tumorigenesis and reduced the cumulative number of tumors, tumor volume and the average number of tumors/mouse. To establish a cause and effect relationship, we targeted the proteins involved in the cell death pathway. Bromelain treatment resulted in upregulation of p53 and Bax and subsequent activation of caspase 3 and caspase 9 with concomitant decrease in antiapoptotic protein Bcl-2 in mouse skin. Since persistent induction of cyclooxygenase-2 (Cox-2) is frequently implicated in tumorigenesis and is regulated by nuclear factor-kappa B (NF-κB), we also investigated the effect of bromelain on Cox-2 and NF-κB expression. Results showed that bromelain application significantly inhibited Cox-2 and inactivated NF-κB by blocking phosphorylation and subsequent degradation of IκBα. In addition, bromelain treatment attenuated DMBA-TPA-induced phosphorylation of extracellular signal-regulated protein kinase (ERK1/2), mitogen-activated protein kinase (MAPK) and Akt. Taken together, we conclude that bromelain induces apoptosis-related proteins along with inhibition of NF-κB-driven Cox-2 expression by blocking the MAPK and Akt/protein kinase B signaling in DMBA-TPA-induced mouse skin tumors, which may account for its anti-tumorigenic effects

  12. Pre-clinical efficacy assessment of Malva sylvestris on chronic skin inflammation.

    Science.gov (United States)

    Prudente, Arthur S; Sponchiado, Graziela; Mendes, Daniel A G B; Soley, Bruna S; Cabrini, Daniela A; Otuki, Michel F

    2017-09-01

    In the search for improved quality of life, the treatment of skin diseases like psoriasis (hyperproliferative disease) is valid, since it causes huge social discomfort to the patient. In this context, earlier studies showed that Malva sylvestris L. has anti-inflammatory activity demonstrated by acute animal models of skin inflammation, becoming a promising target for further studies. The present investigation aimed to verify the effect of hydroalcoholic extract of M. sylvestris (HEMS) on the chronic inflammatory and hyperproliferative response caused by multiple applications of 12-O-tetradecanoylphorbol-13-acetate (TPA) on mouse ears. Topical application of HEMS reduced oedema, leukocyte migration (mono- and polymorphonuclear cells) and keratinocyte hyperproliferation, confirmed by histology and proliferating cell nuclear antigen (PCNA) immunostaining. It was found that the anti-inflammatory effects of the extract did not involve the glucocorticoid system, and its incubation with HaCaT keratinocytes caused low toxicity and reduced cell proliferation by apoptosis. Thus, HEMS proved to be effective as an anti-psoriatic therapy, with the ability to prevent keratinocyte hyperproliferation and with low toxicity by topical application. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. Cutaneous penetration of soft nanoparticles via photodamaged skin: Lipid-based and polymer-based nanocarriers for drug delivery.

    Science.gov (United States)

    Hung, Chi-Feng; Chen, Wei-Yu; Hsu, Ching-Yun; Aljuffali, Ibrahim A; Shih, Hui-Chi; Fang, Jia-You

    2015-08-01

    Photoaging is recognized as the factor damaging skin-barrier function. The aim of this study was to examine the impact of ultraviolet (UV) irradiation on the cutaneous penetration of soft nanoparticles, including nanostructured lipid carriers (NLCs) and poly(lactic-co-glycolic acid) polymer nanoparticles (PNs). In vitro cutaneous permeation of retinoic acid (RA) carried by nanoparticles was evaluated. In vivo nude mouse skin distribution of topically applied nanoparticles was observed by fluorescence and confocal microscopies. The association of nanoparticles with cultured keratinocytes was measured by flow cytometry and fluorescence microscopy. The average diameter and surface charge were 236nm and -32mV for NLCs, and 207nm and -12mV for PNs. The ultrastructural images of skin demonstrated that the application of UV produced a loss of Odland bodies and desmosomes, the organelles regulating skin-barrier function. UVA exposure increased skin deposition of RA regardless of nanoparticle formulation. UVB did not alter RA deposition from nanoparticles as compared to the non-treated group. Exposure to UVA promoted RA delivery into hair follicles from NLCs and PNs by 4.2- and 4.9-fold, respectively. The in vivo skin distribution also showed a large accumulation of Nile red-loaded nanoparticles in follicles after UVA treatment. The soft nanoparticles were observed deep in the dermis. PNs with higher lipophilicity showed a greater association with keratinocytes compared to NLCs. The cell association of PNs was increased by UVA application, whereas the association between NLCs and keratinocytes was reduced two times by UVA. It was concluded that both follicles and intercellular spaces were the main pathways for nanoparticle diffusion into photodamaged skin. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Deletion of epidermal Rac1 inhibits HPV-8 induced skin papilloma formation and facilitates HPV-8- and UV-light induced skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Pfister, Herbert; Haase, Ingo

    2016-09-06

    Overexpression and increased activity of the small Rho GTPase Rac1 has been linked to squamous cell carcinoma of the epidermis and mucosa in humans. Targeted deletion of Rac1 or inhibition of Rac1 activity in epidermal keratinocytes reduced papilloma formation in a chemical skin carcinogenesis mouse model. However, a potential role of Rac1 in HPV- and UV-light induced skin carcinogenesis has not been investigated so far, solar UV radiation being an important carcinogen to the skin.To investigate this, we deleted Rac1 or modulated its activity in mice with transgenic expression of Human papilloma virus type-8 (HPV-8) in epidermal keratinocytes. Our data show that inhibition or deletion of Rac1 results in reduced papilloma formation upon UV-irradiation with a single dose, whereas constitutive activation of Rac1 strongly increases papilloma frequency in these mice. Surprisingly, we observed that, upon chronic UV-irradiation, the majority of mice with transgenic expression of HPV-8 and epidermis specific Rac1 deletion developed squamous cell carcinomas. Taken together, our data show that Rac1 exerts a dual role in skin carcinogenesis: its activation is, on one hand, required for HPV-8- and UV-light induced papilloma formation but, on the other, suppresses the development of squamous cell carcinomas.

  15. Changes in dermal matrix in the absence of Rac1 in keratinocytes

    DEFF Research Database (Denmark)

    Stanley, Alanna; Pedersen, Esben Ditlev Kølle; Brakebusch, Cord

    2016-01-01

    Keratinocytes, in response to irritants, secrete pro-inflammatory mediators which recruit and activate immune and mesenchymal cells, including fibroblasts, to repair the skin. Fibroblasts respond by synthesising collagen and promoting the crosslinking extracellular matrix (ECM). We recently showed....... As inflammation is intimately linked with fibrotic disease in the skin, this raised the question as to whether this deletion may also affect the deposition and arrangement of the dermal ECM. This study assessed the effects of Rac1 deletion in keratinocytes and of the heightened inflammatory status by induction...... that this increase in the diameter of collagen fibrils due to inflammation may serve as pre-fibrotic marker enabling earlier determination of fibrosis and earlier treatment. This study has revealed previously unknown effects on the ECM due to the deletion of Rac1 in keratinocytes....

  16. Ca2+-dependent localization of integrin-linked kinase to cell junctions in differentiating keratinocytes.

    Science.gov (United States)

    Vespa, Alisa; Darmon, Alison J; Turner, Christopher E; D'Souza, Sudhir J A; Dagnino, Lina

    2003-03-28

    Integrin complexes are necessary for proper proliferation and differentiation of epidermal keratinocytes. Differentiation of these cells is accompanied by down-regulation of integrins and focal adhesions as well as formation of intercellular adherens junctions through E-cadherin homodimerization. A central component of integrin adhesion complexes is integrin-linked kinase (ILK), which can induce loss of E-cadherin expression and epithelial-mesenchymal transformation when ectopically expressed in intestinal and mammary epithelia. In cultured primary mouse keratinocytes, we find that ILK protein levels are independent of integrin expression and signaling, since they remain constant during Ca(2+)-induced differentiation. In contrast, keratinocyte differentiation is accompanied by marked reduction in kinase activity in ILK immunoprecipitates and altered ILK subcellular distribution. Specifically, ILK distributes in close apposition to actin fibers along intercellular junctions in differentiated but not in undifferentiated keratinocytes. ILK localization to cell-cell borders occurs independently of integrin signaling and requires Ca(2+) as well as an intact actin cytoskeleton. Further, and in contrast to what is observed in other epithelial cells, ILK overexpression in differentiated keratinocytes does not promote E-cadherin down-regulation and epithelial-mesenchymal transition. Thus, novel tissue-specific mechanisms control the formation of ILK complexes associated with cell-cell junctions in differentiating murine epidermal keratinocytes.

  17. T-plastin expression downstream to the calcineurin/NFAT pathway is involved in keratinocyte migration.

    Directory of Open Access Journals (Sweden)

    Cécilia Brun

    Full Text Available Cutaneous wound healing requires keratinocyte proliferation, migration and differentiation to restore the barrier function of the skin. The calcineurin/nuclear factor of activated-T-cell (NFAT signaling pathway has been recently shown to be involved in keratinocyte growth, differentiation and migration. It is induced by an increased intracellular calcium rate and its inhibition results in decreased capacities of keratinocytes to migrate. Nevertheless, the link between calcineurin activation and keratinocyte migration remains unknown. Recently, Orai1, a pore subunit of a store-operated calcium channel that favors calcium influx, was shown to play a critical role to control proliferation and migration of basal keratinocytes. Of interest, the actin-bundling T-plastin is crucial in cell motility through cross-linking to actin filament and its synthesis was shown to be induced by calcium influx and regulated by the calcineurin/NFAT pathway in tumor Sezary cells. We investigated herein the role of the calcineurin/NFAT pathway-dependent T-plastin in keratinocyte migration, by quantifying T-plastin expression in keratinocytes and by analyzing their migration under calcineurin inhibition or knockdown of NFAT2 or T-plastin. We did confirm the role of the calcineurin/NFAT pathway in keratinocyte migration as shown by their decreased capacities to migrate after FK506 treatment or siNFAT2 transfection in both scratching and Boyden assays. The expression of NFAT2 and T-plastin in keratinocytes was decreased under FK506 treatment, suggesting that T-plastin plays a role in keratinocyte migration downstream to the calcineurin/NFAT pathway. Accordingly, siRNA knockdown of T-plastin expression also decreased their migration capacities. Actin lamellipodia formation as well as FAK and β6-integrin expression were also significantly decreased after treatment with FK506 or siRNA, reinforcing that NFAT2-dependent T-plastin expression plays a role in keratinocyte

  18. Effect of topical application of antioxidants and free radical scavengers on protection of hairless mouse skin exposed to chronic doses of ultraviolet B

    Energy Technology Data Exchange (ETDEWEB)

    Muizzuddin, N.; Shakoori, A.R. [Univ. of the Punjab, Dept. of Zoology, Cell and Molecular Biology Lab., Lahore (Pakistan); Marenus, K.D. [SUNY at Stonybrook, Stonybrook, NY (United States)

    1998-11-01

    treatment, respectively. Conclusion: Data from these studies suggest that low level chronic exposures to UV can lead to alteration of the skin, like epidermal thickening and appearance of sunburn cells. The data also indicates that a mix of common antioxidants and free radical scavengers are photoprotective against chronic skin damage in the hairless mouse skin model. (au)

  19. Effect of topical application of antioxidants and free radical scavengers on protection of hairless mouse skin exposed to chronic doses of ultraviolet B

    International Nuclear Information System (INIS)

    Muizzuddin, N.; Shakoori, A.R.; Marenus, K.D.

    1998-01-01

    treatment, respectively. Conclusion: Data from these studies suggest that low level chronic exposures to UV can lead to alteration of the skin, like epidermal thickening and appearance of sunburn cells. The data also indicates that a mix of common antioxidants and free radical scavengers are photoprotective against chronic skin damage in the hairless mouse skin model. (au)

  20. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  1. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  2. Smad4 disruption accelerates keratinocyte reepithelialization in murine cutaneous wound repair.

    Science.gov (United States)

    Yang, Leilei; Li, Wenlong; Wang, Shaoxia; Wang, Lijuan; Li, Yang; Yang, Xiao; Peng, Ruiyun

    2012-10-01

    Keratinocyte reepithelialization is a rate-limiting event in cutaneous wound repair, which involves the migration and proliferation of keratinocytes to cover the denuded dermal surface. Transforming growth factor-β1 (TGF-β1) has the ability to induce epithelial cell migration while inhibiting proliferation, and controversial results have been generated regarding the effect of TGF-β signaling on reepithelialization. In this study, full-thickness skin wounds were made in keratinocyte-specific Smad4 knockout and the control mice. The wound closure, reepithelialization, keratinocyte proliferation, myofibroblast numbers and collagen deposition of were assessed. The results showed that the proliferation of keratinocytes increased, which accelerated the reepithelialization, and led to faster wound repair in the epidermis of Smad4 mutant mice. Upregulation of keratin 17, 14-3-3 sigma and phosphorylated AKT in the hyperproliferative epidermis may be correlated with the accelerated reepithelialization. We conclude that Smad4 plays an inhibitory role in the keratinocyte-mediated reepithelialization of wound healing.

  3. Crucial role of vinexin for keratinocyte migration in vitro and epidermal wound healing in vivo

    International Nuclear Information System (INIS)

    Kioka, Noriyuki; Ito, Takuya; Yamashita, Hiroshi; Uekawa, Natsuko; Umemoto, Tsutomu; Motoyoshi, Soh; Imai, Hiroshi; Takahashi, Kenzo; Watanabe, Hideto; Yamada, Masayasu; Ueda, Kazumitsu

    2010-01-01

    In the process of tissue injury and repair, epithelial cells rapidly migrate and form epithelial sheets. Vinexin is a cytoplasmic molecule of the integrin-containing cell adhesion complex localized at focal contacts in vitro. Here, we investigated the roles of vinexin in keratinocyte migration in vitro and wound healing in vivo. Vinexin knockdown using siRNA delayed migration of both HaCaT human keratinocytes and A431 epidermoid carcinoma cells in scratch assay but did not affect cell proliferation. Induction of cell migration by scratching the confluent monolayer culture of these cells activated both EGFR and ERK, and their inhibitors AG1478 and U0126 substantially suppressed scratch-induced keratinocyte migration. Vinexin knockdown in these cells inhibited the scratch-induced activation of EGFR, but not that of ERK, suggesting that vinexin promotes cell migration via activation of EGFR. We further generated vinexin (-/-) mice and isolated their keratinocytes. They similarly showed slow migration in scratch assay. Furthermore, vinexin (-/-) mice exhibited a delay in cutaneous wound healing in both the back skin and tail without affecting the proliferation of keratinocytes. Together, these results strongly suggest a crucial role of vinexin in keratinocyte migration in vitro and cutaneous wound healing in vivo.

  4. Promotion of hair follicle development and trichogenesis by Wnt-10b in cultured embryonic skin and in reconstituted skin

    International Nuclear Information System (INIS)

    Ouji, Yukiteru; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki

    2006-01-01

    We previously showed that Wnt-10b promoted the differentiation of primary skin epithelial cells (MPSEC) toward hair shaft and inner root sheath of the hair follicle (IRS) cells in vitro. In the present study, we found that Wnt-10b promotes the development of hair follicles using a culture of mouse embryonic skin tissue and trichogenesis using a reconstitution experiment with nude mice. Hair follicle development was observed in skin taken from mouse embryos on embryonic day 10.5 following a 2-day culture with recombinant Wnt-10b (rWnt-10b), however, not without rWnt-10b. Brown hair growth was observed at the site of reconstituted skin in Balb/c nude mice where dermal fibroblasts and keratinocytes, derived from C3H/HeN new born mice, were transplanted with Wnt-10b-producing COS cells (Wnt-COS). Without the co-transplantation of Wnt-COS, no hair growth was observed. Our results suggest an important role of Wnt-10b in the initiation of hair follicle development and following trichogenesis

  5. The Herbal Bitter Drug Gentiana lutea Modulates Lipid Synthesis in Human Keratinocytes In Vitro and In Vivo.

    Science.gov (United States)

    Wölfle, Ute; Haarhaus, Birgit; Seiwerth, Jasmin; Cawelius, Anja; Schwabe, Kay; Quirin, Karl-Werner; Schempp, Christoph M

    2017-08-22

    Gentiana lutea is a herbal bitter drug that is used to enhance gastrointestinal motility and secretion. Recently we have shown that amarogentin, a characteristic bitter compound of Gentiana lutea extract (GE), binds to the bitter taste receptors TAS2R1 and TAS2R38 in human keratinocytes, and stimulates the synthesis of epidermal barrier proteins. Here, we wondered if GE also modulates lipid synthesis in human keratinocytes. To address this issue, human primary keratinocytes were incubated for 6 days with GE. Nile Red labeling revealed that GE significantly increased lipid synthesis in keratinocytes. Similarly, gas chromatography with flame ionization detector indicated that GE increases the amount of triglycerides in keratinocytes. GE induced the expression of epidermal ceramide synthase 3, but not sphingomyelinase. Lipid synthesis, as well as ceramide synthase 3 expression, could be specifically blocked by inhibitors of the p38 MAPK and PPARγ signaling pathway. To assess if GE also modulates lipid synthesis in vivo, we performed a proof of concept half side comparison on the volar forearms of 33 volunteers. In comparison to placebo, GE significantly increased the lipid content of the treated skin areas, as measured with a sebumeter. Thus, GE enhances lipid synthesis in human keratinocytes that is essential for building an intact epidermal barrier. Therefore, GE might be used to improve skin disorders with an impaired epidermal barrier, e.g., very dry skin and atopic eczema.

  6. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Elmets, Craig A. [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294-0019 (United States); Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2014-08-29

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34{sup +}/K15{sup +}/p63{sup +} keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in

  7. Keratin-6 driven ODC expression to hair follicle keratinocytes enhances stemness and tumorigenesis by negatively regulating Notch

    International Nuclear Information System (INIS)

    Arumugam, Aadithya; Weng, Zhiping; Chaudhary, Sandeep C.; Afaq, Farrukh; Elmets, Craig A.; Athar, Mohammad

    2014-01-01

    Highlights: • Targeting ODC to hair follicle augments skin carcinogenesis and invasive SCCs. • Hair follicle ODC expands stem cell compartment carrying CD34 + /K15 + /p63 + keratinocytes. • Negatively regulated Notch1 is associated with expansion of stem cell compartment. - Abstract: Over-expression of ornithine decarboxylase (ODC) is known to be involved in the epidermal carcinogenesis. However, the mechanism by which it enhances skin carcinogenesis remains undefined. Recently, role of stem cells localized in various epidermal compartments has been shown in the pathogenesis of skin cancer. To direct ODC expression in distinct epidermal compartments, we have developed keratin 6 (K6)-ODC/SKH-1 and keratin 14 (K14)-ODC/SKH-1 mice and employed them to investigate the role of ODC directed to these epidermal compartments on UVB-induced carcinogenesis. K6-driven ODC over-expression directed to outer root sheath (ORS) of hair follicle was more effective in augmenting tumorigenesis as compared to mice where K14-driven ODC expression was directed to inter-follicular epidermal keratinocytes. Chronically UVB-irradiated K6-ODC/SKH-1 developed 15 ± 2.5 tumors/mouse whereas K14-ODC/SKH-1 developed only 6.8 ± 1.5 tumors/mouse. K6-ODC/SKH-1 showed augmented UVB-induced proliferation and much higher pro-inflammatory responses than K14-ODC/SKH-1 mice. Tumors induced in K6-ODC/SKH-1 were rapidly growing, invasive and ulcerative squamous cell carcinoma (SCC) showing decreased expression of epidermal polarity marker E-cadherin and enhanced mesenchymal marker, fibronectin. Interestingly, the number of CD34/CK15/p63 positive stem-like cells was significantly higher in chronically UVB-irradiated K6-ODC/SKH-1 as compared to K14-ODC/SKH-1 mice. Reduced Notch1 expression was correlated with the expansion of stem cell compartment in these animals. However, other signaling pathways such as DNA damage response or mTOR signaling pathways were not significantly different in tumors induced

  8. Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes

    Science.gov (United States)

    Bernerd, Francoise; Sarasin, Alain; Magnaldo, Thierry

    1999-01-01

    Galectin-7 is a β-galactoside binding protein specifically expressed in stratified epithelia and notably in epidermis, but barely detectable in epidermal tumors and absent from squamous carcinoma cell lines. Galectin-7 gene is an early transcriptional target of the tumor suppressor protein P53 [Polyak, K., Xia, Y., Zweier, J., Kinzler, K. & Vogelstein, B. (1997) Nature (London) 389, 300–305]. Because p53 transcriptional activity is increased by genotoxic stresses we have examined the possible effects of ultraviolet radiations (UVB) on galectin-7 expression in epidermal keratinocytes. The amounts of galectin-7 mRNA and protein are increased rapidly after UVB irradiation of epidermal keratinocytes. The increase of galectin-7 is parallel to P53 stabilization. UVB irradiation of skin reconstructed in vitro and of human skin ex vivo demonstrates that galectin-7 overexpression is associated with sunburn/apoptotic keratinocytes. Transfection of a galectin-7 expression vector results in a significant increase in terminal deoxynucleotidyltransferase-mediated UTP end labeling-positive keratinocytes. The present findings demonstrate a keratinocyte-specific protein involved in the UV-induced apoptosis, an essential process in the maintenance of epidermal homeostasis. PMID:10500176

  9. Ecklonia cava Extract and Dieckol Attenuate Cellular Lipid Peroxidation in Keratinocytes Exposed to PM10.

    Science.gov (United States)

    Lee, Jeong-Won; Seok, Jin Kyung; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter can cause oxidative stress, inflammation, and premature skin aging. Marine plants such as Ecklonia cava Kjellman contain high amounts of polyphenolic antioxidants. The purpose of this study was to examine the antioxidative effects of E. cava extract in cultured keratinocytes exposed to airborne particulate matter with a diameter of <10  μ m (PM10). After the exposure of cultured HaCaT keratinocytes to PM10 in the absence and presence of E. cava extract and its constituents, cell viability and cellular lipid peroxidation were assessed. The effects of eckol and dieckol on cellular lipid peroxidation and cytokine expression were examined in human epidermal keratinocytes exposed to PM10. The total phenolic content of E. cava extract was the highest among the 50 marine plant extracts examined. The exposure of HaCaT cells to PM10 decreased cell viability and increased lipid peroxidation. The PM10-induced cellular lipid peroxidation was attenuated by E. cava extract and its ethyl acetate fraction. Dieckol more effectively attenuated cellular lipid peroxidation than eckol in both HaCaT cells and human epidermal keratinocytes. Dieckol and eckol attenuated the expression of inflammatory cytokines such as tumor necrosis factor- (TNF-) α , interleukin- (IL-) 1 β , IL-6, and IL-8 in human epidermal keratinocytes stimulated with PM10. This study suggested that the polyphenolic constituents of E. cava , such as dieckol, attenuated the oxidative and inflammatory reactions in skin cells exposed to airborne particulate matter.

  10. Comparison of the carcinogenic effectiveness in mouse skin of methyl- and ethylnitrosourea, nitrosourethane and nitrosonitro-guanidine and the effect of deuterium labeling

    International Nuclear Information System (INIS)

    Lijinsky, W.

    1982-01-01

    The carcinogenic activities of a number of directly acting methylating and ethylating agents have been compared by mouse skin painting in acetone solution. Nitrosomethylurethane and nitrosoethylurethane failed to induce tumors after greater than 60 weeks treatment. Nitrosomethylurea was somewhat more effective than nitrosoethylurea, as measured by the longer latent period than nitrosoethylurea, as measured Nitrosomethylnitroguanidine, by the same measure, was a weaker carcinogen than nitrosoethylnitroguanidine at both dose levels used (0.02 M and 0.008 M); the latter compound was the most potent skin carcinogen of those examined. There was no significant difference in carcinogenic effectiveness when the alkyl group of the nitrosoureas or the nitronitrosoguanidines contained deuterium instead of hydrogen, which supports the concept that alkylation of cellular macromolecules by the intact alkyl group is responsible for carcinogenesis by these compounds

  11. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  12. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  13. Neurohumoral mechanisms of keratinocytes regulation in diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Ekaterina Viktorovna Artemova

    2016-12-01

    Full Text Available The extent of damage to the nervous, vascular and microcirculatory systems in diabetic patients determine the regulation of physiological events that lead to the formation of chronic wounds, reduction of patient quality of life and increase of the financial value of medical care. Successful physiological repair is impossible without the successive phases of inflammation, proliferation and wound healing. Keratinocytes are the major cellular barrier components of the epidermis. These cells play an important role in physiological repair, as suggested by recent research, with many cells able to secrete steroid hormones de novo. Damage to the integrity of the skin leads to keratinocyte activation, triggering a cascade of reactions that contribute to changes in epidermal cell phenotype and lead to their proliferation and migration, analogous to changes in cellular adhesion and configuration of the cytoskeleton. An open question remains as to how the keratinocyte cell cycle, which is altered under conditions of hyperglycemia, and neurotransmitter metabolism during different stages of physiological repair are regulated. Understanding these processes will provide a scientific basis for the development of new targets for pharmacotherapies.

  14. Matriptase and prostasin are expressed in human skin in an inverse trend over the course of differentiation and are targeted to different regions of the plasma membrane

    Directory of Open Access Journals (Sweden)

    Chih-Hsin Lai

    2016-10-01

    Full Text Available Matriptase and prostasin, acting as a tightly coupled proteolytic cascade, were reported to be required for epidermal barrier formation in mouse skin. Here we show that, in human skin, matriptase and prostasin are expressed with an inverse pattern over the course of differentiation. Matriptase was detected primarily in epidermal basal keratinocytes and the basaloid cells in the outer root sheath of hair follicles and the sebaceous gland, where prostasin was not detected. In contrast, prostasin was detected primarily in differentiated cells in the epidermal granular layer, the inner root sheath of hair follicles, and the sebaceous gland, where matriptase expression is negligible. While co-expressed in the middle stage of differentiation, prostasin was detected as polarized patches, and matriptase at intercellular junctions. Targeting to different subcellular localizations is also observed in HaCaT human keratinocytes, in which matriptase was detected primarily at intercellular junctions, and prostasin primarily on membrane protrusion. Furthermore, upon induction of zymogen activation, free active prostasin remains cell-associated and free active matriptase is rapidly shed into the extracellular milieu. Our data suggest that matriptase and prostasin likely function as independent entities in human skin rather than as a tightly coupled proteolytic cascade as observed in mouse skin.

  15. Macrophage migration inhibitory factor triggers chemotaxis of CD74+CXCR2+ NKT cells in chemically induced IFN-γ-mediated skin inflammation.

    Science.gov (United States)

    Hsieh, Chia-Yuan; Chen, Chia-Ling; Lin, Yee-Shin; Yeh, Trai-Ming; Tsai, Tsung-Ting; Hong, Ming-Yuan; Lin, Chiou-Feng

    2014-10-01

    IFN-γ mediates chemically induced skin inflammation; however, the mechanism by which IFN-γ-producing cells are recruited to the sites of inflammation remains undefined. Secretion of macrophage migration inhibitory factor (MIF), a proinflammatory cytokine, from damaged cells may promote immune cell recruitment. We hypothesized that MIF triggers an initial step in the chemotaxis of IFN-γ-producing cells in chemically induced skin inflammation. Using acute and chronic models of 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced skin inflammation in mouse ears, MIF expression was examined, and its role in this process was investigated pharmacologically. The cell populations targeted by MIF, their receptor expression patterns, and the effects of MIF on cell migration were examined. TPA directly caused cytotoxicity accompanied by MIF release in mouse ear epidermal keratinocytes, as well as in human keratinocytic HaCaT cells. Treatment with the MIF antagonist (S,R)-3-(4-hydroxyphenyl)-4,5-dihydro-5-isoxazole acetic acid methyl ester considerably attenuated TPA-induced ear swelling, leukocyte infiltration, epidermal cell proliferation, and dermal angiogenesis. Inhibition of MIF greatly diminished the dermal infiltration of IFN-γ(+) NKT cells, whereas the addition of exogenous TPA and MIF to NKT cells promoted their IFN-γ production and migration, respectively. MIF specifically triggered the chemotaxis of NKT cells via CD74 and CXCR2, and the resulting depletion of NKT cells abolished TPA-induced skin inflammation. In TPA-induced skin inflammation, MIF is released from damaged keratinocytes and then triggers the chemotaxis of CD74(+)CXCR2(+) NKT cells for IFN-γ production. Copyright © 2014 by The American Association of Immunologists, Inc.

  16. Plumbagin Suppresses α-MSH-Induced Melanogenesis in B16F10 Mouse Melanoma Cells by Inhibiting Tyrosinase Activity

    Directory of Open Access Journals (Sweden)

    Taek-In Oh

    2017-02-01

    Full Text Available Recent studies have shown that plumbagin has anti-inflammatory, anti-allergic, antibacterial, and anti-cancer activities; however, it has not yet been shown whether plumbagin suppresses alpha-melanocyte stimulating hormone (α-MSH-induced melanin synthesis to prevent hyperpigmentation. In this study, we demonstrated that plumbagin significantly suppresses α-MSH-stimulated melanin synthesis in B16F10 mouse melanoma cells. To understand the inhibitory mechanism of plumbagin on melanin synthesis, we performed cellular or cell-free tyrosinase activity assays and analyzed melanogenesis-related gene expression. We demonstrated that plumbagin directly suppresses tyrosinase activity independent of the transcriptional machinery associated with melanogenesis, which includes micropthalmia-associated transcription factor (MITF, tyrosinase (TYR, and tyrosinase-related protein 1 (TYRP1. We also investigated whether plumbagin was toxic to normal human keratinocytes (HaCaT and lens epithelial cells (B3 that may be injured by using skin-care cosmetics. Surprisingly, lower plumbagin concentrations (0.5–1 μM effectively inhibited melanin synthesis and tyrosinase activity but do not cause toxicity in keratinocytes, lens epithelial cells, and B16F10 mouse melanoma cells, suggesting that plumbagin is safe for dermal application. Taken together, these results suggest that the inhibitory effect of plumbagin to pigmentation may make it an acceptable and safe component for use in skin-care cosmetic formulations used for skin whitening.

  17. Cryopreservation of dermal fibroblasts and keratinocytes in hydroxyethyl starch-based cryoprotectants.

    Science.gov (United States)

    Naaldijk, Yahaira; Johnson, Adiv A; Friedrich-Stöckigt, Annett; Stolzing, Alexandra

    2016-12-01

    Preservation of human skin fibroblasts and keratinocytes is essential for the creation of skin tissue banks. For successful cryopreservation of cells, selection of an appropriate cryoprotectant agent (CPA) is imperative. The aim of this study was to identify CPAs that minimize toxic effects and allow for the preservation of human fibroblasts and keratinocytes in suspension and in monolayers. We cryopreserved human fibroblasts and keratinocytes with different CPAs and compared them to fresh, unfrozen cells. Cells were frozen in the presence and absence of hydroxyethyl starch (HES) or dimethyl sulfoxide (DMSO), the latter of which is a commonly used CPA known to exert toxic effects on cells. Cell numbers were counted immediately post-thaw as well as three days after thawing. Cellular structures were analyzed and counted by labeling nuclei, mitochondria, and actin filaments. We found that successful cryopreservation of suspended or adherent keratinocytes can be accomplished with a 10% HES or a 5% HES, 5% DMSO solution. Cell viability of fibroblasts cryopreserved in suspension was maintained with 10% HES or 5% HES, 5% DMSO solutions. Adherent, cryopreserved fibroblasts were successfully maintained with a 5% HES, 5% DMSO solution. We conclude that skin tissue cells can be effectively cryopreserved by substituting all or a portion of DMSO with HES. Given that DMSO is the most commonly used CPA and is believed to be more toxic than HES, these findings are of clinical significance for tissue-based replacement therapies. Therapies that require the use of keratinocyte and fibroblast cells, such as those aimed at treating skin wounds or skin burns, may be optimized by substituting a portion or all of DMSO with HES during cryopreservation protocols.

  18. A New Pharmacological Agent (AKB-4924) Stabilizes Hypoxia Inducible Factor (HIF) and Increases Skin Innate Defenses Against Bacterial Infection

    Science.gov (United States)

    Okumura, Cheryl Y.M.; Hollands, Andrew; Tran, Dan N.; Olson, Joshua; Dahesh, Samira; von Köckritz-Blickwede, Maren; Thienphrapa, Wdee; Corle, Courtney; Jeung, Seung Nam; Kotsakis, Anna; Shalwitz, Robert A.; Johnson, Randall S.; Nizet, Victor

    2013-01-01

    Hypoxia inducible factor-1 (HIF-1) is a transcription factor that is a major regulator of energy homeostasis and cellular adaptation to low oxygen stress. HIF-1 is also activated in response to bacterial pathogens and supports the innate immune response of both phagocytes and keratinocytes. In this work, we show that a new pharmacological compound AKB-4924 (Akebia Therapeutics) increases HIF-1α levels and enhances the antibacterial activity of phagocytes and keratinocytes against both methicillin-sensitive and -resistant strains of Staphylococcus aureus in vitro. AKB-4924 is also effective in stimulating the killing capacity of keratinocytes against the important opportunistic skin pathogens Pseudomonas aeruginosa and Acinitobacter baumanii. The effect of AKB-4924 is mediated through the activity of host cells, as the compound exerts no direct antimicrobial activity. Administered locally as a single agent, AKB-4924 limits S. aureus proliferation and lesion formation in a mouse skin abscess model. This approach to pharmacologically boost the innate immune response via HIF-1 stabilization may serve as a useful adjunctive treatment for antibiotic-resistant bacterial infections. PMID:22371073

  19. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

  20. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  1. Protoporphyrin IX fluorescence kinetics and localization after topical application of ALA pentyl ester and ALA on hairless mouse skin with UVB-induced early skin cancer

    NARCIS (Netherlands)

    van den Akker, J. T.; de Bruijn, H. S.; Beijersbergen van Henegouwen, G. M.; Star, W. M.; Sterenborg, H. J.

    2000-01-01

    In order to improve the efficacy of 5-aminolevulinic acid-based (ALA) photodynamic therapy (PDT), different ALA derivatives are presently being investigated. ALA esters are more lipophilic and therefore may have better skin penetration properties than ALA, possibly resulting in enhanced

  2. Evaluation of the contribution of chronic skin irritation and selected compositional parameters to the tumorigenicity of petroleum middle distillates in mouse skin.

    Science.gov (United States)

    Freeman, J J; Federici, T M; McKee, R H

    1993-07-28

    Two-year skin carcinogenicity studies were conducted in C3H mice to assess the effects of irritation and selected compositional parameters on the carcinogenic potential of four petroleum liquids. Three samples (lightly refined paraffinic oil, LRPO; lightly hydrodesulfurized specialty oil, LHSO; jet fuel, JF) can be generically classified as middle distillates, i.e. distillation occurs between 350 and 700 degrees F (175-370 degrees C). The fourth sample was a Steam Cracked Gas Oil (SCGO) that distilled within the same range. In studies that assess the effects of irritation on tumorigenicity, LRPO was tested undiluted or was diluted to 50% and 25% in either mineral oil (which eliminated irritation of the skin) or toluene (which did not). Undiluted LRPO elicited tumors in 8% of the mice. Both dilution procedures eliminated tumorigenic potential. Thus, it was possible to maintain a visible level of skin irritation equivalent to that elicited by undiluted LRPO without inducing tumors. SCGO elicited a chronic irritant state grossly equivalent to LRPO but was not tumorigenic. Jet Fuel A (JF) was tested undiluted using both a standard skin painting protocol and an intermittent dosing schedule in which treatment was suspended periodically to allow skin irritation to resolve. The standard treatment protocol of JF resulted in both marked skin irritation and tumors in 44% of the mice. However, using the intermittent schedule, the tumor yield was reduced to 2%. Collectively these data demonstrate that tumor formation is not a necessary sequelae to chronic skin irritation. Conversely, prevention of a marked chronic irritant state was accompanied by decreased tumor yield. These data suggest that the chronic irritant state may be a necessary but not sufficient condition for tumor formation. In studies to assess the effects of compositional parameters, a lightly hydrodesulfurized specialty oil (LHSO) similar to LRPO but refined to have negligible levels of sulfur compounds (3 ppm

  3. A mouse model of harlequin ichthyosis delineates a key role for Abca12 in lipid homeostasis.

    Directory of Open Access Journals (Sweden)

    Ian Smyth

    2008-09-01

    Full Text Available Harlequin Ichthyosis (HI is a severe and often lethal hyperkeratotic skin disease caused by mutations in the ABCA12 transport protein. In keratinocytes, ABCA12 is thought to regulate the transfer of lipids into small intracellular trafficking vesicles known as lamellar bodies. However, the nature and scope of this regulation remains unclear. As part of an original recessive mouse ENU mutagenesis screen, we have identified and characterised an animal model of HI and showed that it displays many of the hallmarks of the disease including hyperkeratosis, loss of barrier function, and defects in lipid homeostasis. We have used this model to follow disease progression in utero and present evidence that loss of Abca12 function leads to premature differentiation of basal keratinocytes. A comprehensive analysis of lipid levels in mutant epidermis demonstrated profound defects in lipid homeostasis, illustrating for the first time the extent to which Abca12 plays a pivotal role in maintaining lipid balance in the skin. To further investigate the scope of Abca12's activity, we have utilised cells from the mutant mouse to ascribe direct transport functions to the protein and, in doing so, we demonstrate activities independent of its role in lamellar body function. These cells have severely impaired lipid efflux leading to intracellular accumulation of neutral lipids. Furthermore, we identify Abca12 as a mediator of Abca1-regulated cellular cholesterol efflux, a finding that may have significant implications for other diseases of lipid metabolism and homeostasis, including atherosclerosis.

  4. A role for NF-κB activity in skin hyperplasia and the development of keratoacanthomata in mice.

    Directory of Open Access Journals (Sweden)

    Brian Poligone

    Full Text Available BACKGROUND: Previous studies have implicated NF-κB signaling in both cutaneous development and oncogenesis. However, these studies have been limited in part by the lethality that results from extreme over- or under-expression of NF-κB in available mouse models. Even cre-driven tissue specific expression of transgenes, or targeted deletion of NF-κB can cause cell death. Therefore, the present study was undertaken to evaluate a novel mouse model of enhanced NF-κB activity in the skin. METHODS: A knock-in homologous recombination technique was utilized to develop a mouse model (referred to as PD mice with increased NF-κB activity. RESULTS: The data show that increased NF-κB activity leads to hyperproliferation and dysplasia of the mouse epidermis. Chemical carcinogenesis in the context of enhanced NF-κB activity promotes the development of keratoacanthomata. CONCLUSION: Our findings support an important role for NF-κB in keratinocyte dysplasia. We have found that enhanced NF-κB activity renders keratinocytes susceptible to hyperproliferation and keratoacanthoma (KA development but is not sufficient for transformation and SCC development. We therefore propose that NF-κB activation in the absence of additional oncogenic events can promote TNF-dependent, actinic keratosis-like dysplasia and TNF-independent, KAs upon chemical carcinogensis. These studies suggest that resolution of KA cannot occur when NF-κB activation is constitutively enforced.

  5. Daily intake of Jeju groundwater improves the skin condition of the model mouse for human atopic dermatitis.

    Science.gov (United States)

    Tanaka, Akane; Jung, Kyungsook; Matsuda, Akira; Jang, Hyosun; Kajiwara, Naoki; Amagai, Yosuke; Oida, Kumiko; Ahn, Ginnae; Ohmori, Keitaro; Kang, Kyung-goo; Matsuda, Hiroshi

    2013-03-01

    Drinking water is an important nutrient for human health. The mineral ingredients included in drinking water may affect the physical condition of people. Various kinds of natural water are in circulation as bottled water in developed countries; however, its influence on clinical conditions of patients with certain diseases has not been fully evaluated. In this study, effects of the natural groundwater from Jeju Island on clinical symptoms and skin barrier function in atopic dermatitis (AD) were evaluated. NC/Tnd mice, a model for human AD, with moderate to severe dermatitis were used. Mice were given different natural groundwater or tap water for 8 weeks from 4 weeks of age. Clinical skin severity scores were recorded every week. Scratching analysis and measurement of transepidermal water loss were performed every other week. The pathological condition of the dorsal skin was evaluated histologically. Real-time polymerase chain reaction analysis was performed for cytokine expression in the affected skin. The epidermal hyperplasia and allergic inflammation were reduced in atopic mice supplied with Jeju groundwater when compared to those supplied with tap water or other kinds of natural groundwater. The increase in scratching behavior with the aggravation of clinical severity of dermatitis was favorably controlled. Moreover, transepidermal water loss that reflects skin barrier function was recovered. The early inflammation and hypersensitivity in the atopic skin was alleviated in mice supplied with Jeju groundwater, suggesting its profitable potential on the daily care of patients with skin troubles including AD. © 2013 Japanese Dermatological Association.

  6. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W. [Kaohsiung Medical College (Taiwan). Dept. of Dermatology; Chiang, L.-C. [Kaohsiung Medical College (Taiwan). Dept. of Microbiology and Immunology; Yu, C.-L. [National Yang-Ming University School of Medicine (Taiwan). Veterans General Hospital-Taipei

    1996-08-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm{sup 2} UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author).

  7. The cytotoxic effect of neonatal lupus erythematosus and maternal sera on keratinocyte cultures is complement-dependent and can be augmented by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Yu, H.-S.; Chang, C.-H.; Kang, J.-W.; Chiang, L.-C.; Yu, C.-L.

    1996-01-01

    To elucidate the role of autoantibodies and ultraviolet (UV) exposure in the pathogenesis of the skin lesions in neonatal lupus erythematosus (NLE), keratinocytes were cultured, as the target cells, from a patient with NLE and from a normal neonate. We demonstrated that the expression of nuclear/cytoplasma Ro/SSA and La/SSB molecules on to the surface of NLE keratinocytes occurred to a much greater extent than that on normal keratinocytes. A dose of 200 mJ/cm 2 UVB irradiation on NLE keratinocytes induced a 2.5-3-fold increase in Ro/SSA and La/SSB expression compared to non-irradiated cells. Sera derived from both the NLE patient and from his mother exhibited a cytotoxic effect on NLE keratinocytes, but not on control cells, in the presence of complement. Furthermore, the cytotoxicity of the sera was enhanced in UVB-irradiated NLE keratinocytes, whereas it had no cytotoxic effects on UVB-irradiated control cells. This suggests that the abnormal expression of both Ro/SSA and La/SSB on the surface membrane of NLE keratinocytes induces the autoantibodies and complements to injure the cells. This complement-mediated cytotoxic effect can be augmented by UV irradiation, a concept not incompatible with the exacerbation of the skin eruption in sun-exposed skin sites. (author)

  8. Effect of a 91 day long stay in weightlessness on the International Space Station on mouse skin physiology

    Data.gov (United States)

    National Aeronautics and Space Administration — Comparitive gene expression in skin between mice maintained in microgravity (0g) and normogravity (1g) environment. Six male C57Bl/J10 mice were housed for 91 days...

  9. Influence of misonidazole, anaesthesia, clamping of the leg and stress of the animal during treatment on the radiation-induced skin reaction of mouse feet

    International Nuclear Information System (INIS)

    Wondergem, J.; Haveman, J.; Schueren, E. van der

    1982-01-01

    The influence of anaesthesia and misonidazole on the 'acute' (average of the scores between day 10 and 30) and 'late' (average of the scores between day 100 and 120) skin reaction of the feet of mice was investigated under two different conditions. Firstly, the legs were kept untaped in the radiation field; secondly, the legs were fixed with surgical tape on the backscatter block. Irradiation was carried out by X-radiation at a dose of 35 Gy. Results showed that stress in unanaesthetized animals has a large influence on the radiation response of mouse skin. Adequate treatment conditions, tranquillizers or anaesthesia can compensate for this factor. Taping of the animals' legs, resulting in clamping, interferes with the assessment of these modalities. No influence of misonidazole on the skin reaction could be demonstrated in conditions where no artificial hypoxia was induced. The importance of taking experimental conditions into account is pointed out for the correct assessment of the effect of radiosensitizers and possibly other anticancer drugs. (U.K.)

  10. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  11. A Patient with Multiple Keratinocytic Cancers (MKC: Uncommon Presentation in a Bulgarian Patient

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2018-01-01

    Full Text Available Keratinocyte skin cancers, including basal cell carcinoma (BCC and squamous cell carcinoma (SCC, are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not.  Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  12. A Patient with Multiple Keratinocytic Cancers (MKC): Uncommon Presentation in a Bulgarian Patient.

    Science.gov (United States)

    Tchernev, Georgi; Philipov, Stanislav; Chokoeva, Anastasiya Atanasova; Wollina, Uwe; Lotti, Torello; Lozev, Ilia; Yungareva, Irina; Maximov, Georgi Konstantinov

    2018-01-25

    Keratinocyte skin cancers, including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC), are the most common cancer occurring in people with fair skin, worldwide. Despite all known triggers, several suggested contributors are still investigated. We will focus our attention on the personal history of previous cancers and radiation exposure as occupational risk factors, as in the presented case. We report a patient, with multiple BCCs, and subsequent occurrence of a SCC on photo-exposed area of the face, as we want to emphasize the importance of strict following up of these patients, regarding the risk for developing new tumors in short periods of time, no matter if the triggering exposure factor is known from the history, or not. Although keratinocytes tumours are associated with the low mortality rate, we focus the attention on the fact, that the history of non-melanoma skin cancer is associated with increased mortality.

  13. Podoplanin expression in peritumoral keratinocytes predicts aggressive behavior in extramammary Paget's disease.

    Science.gov (United States)

    Cho, Zaigen; Konishi, Eiichi; Kanemaru, Mai; Isohisa, Taro; Arita, Takahiro; Kawai, Minako; Tsutsumi, Miho; Mizutani, Hiromi; Takenaka, Hideya; Ozawa, Toshiyuki; Tsuruta, Daisuke; Katoh, Norito; Asai, Jun

    2017-07-01

    Recent studies have demonstrated podoplanin expression in several tumors, which has been associated with lymph node metastasis and poor prognosis. Podoplanin expression in peritumoral cells such as cancer-associated fibroblasts also correlates with tumor progression in several cancers. However, podoplanin expression and its association with extramammary Paget's disease (EMPD) remain unclear. In this study, we examined whether the presence of podoplanin expression in tumor cells or peritumoral basal keratinocytes correlated with aggressive behavior in patients with EMPD and investigated the mechanisms of podoplanin-mediated tumor invasion in this disorder. Skin samples of 37 patients with EMPD were investigated by immunohistochemical analysis. The functions of podoplanin in keratinocytes were examined in vitro by RT-PCR and with invadopodia gelatin-degradation assays using HaCaT cells. Podoplanin was not identified in tumor cells in all cases. Podoplanin expression in peritumoral basal keratinocytes was observed in 25 patients (67.6%). In in situ EMPD, 50% of cases (9 in 18) exhibited podoplanin-positive keratinocytes, whereas 84.2% (16 in 19) demonstrated positive staining in invasive EMPD (P<0.05). Podoplanin expression in peritumoral keratinocytes was also associated with tumor thickness (P<0.005). By immunohistochemical analysis, podoplanin-positive peritumoral keratinocytes were found to be negative for E-cadherin, one of the major adhesion molecules of keratinocytes, which might contribute to tumor invasion into the dermis through a crack in the basal cell layer induced by down-regulation of cell adhesion therein. We further found that podoplanin-positive keratinocytes exhibited invadopodia, which are thought to function in the migration of cancer cells through tissue barriers, indicating that podoplanin-positive peritumoral basal keratinocytes might assist tumor invasion by degrading the extracellular matrix. The presence of podoplanin expression in

  14. Concentration-dependent effect of platelet-rich plasma on keratinocyte and fibroblast wound healing.

    Science.gov (United States)

    Xian, Law Jia; Chowdhury, Shiplu Roy; Bin Saim, Aminuddin; Idrus, Ruszymah Bt Hj

    2015-03-01

    Platelet-rich plasma (PRP) has been found to contain a high concentration of growth factors that are present during the process of healing. Studies conducted found that application of PRP accelerates wound healing. In this study, we characterized the skin cell suspension harvested using the co-isolation technique and evaluated the effects of PRP (10% and 20%, v/v) on co-cultured keratinocytes and fibroblasts in terms of wound healing. Human keratinocytes and fibroblasts were harvested via co-isolation technique and separated via differential trypsinization. These cells were then indirectly co-cultured in medium supplemented with 10% or 20% PRP for 3 days without medium change for analysis of wound-healing potential. The wound-healing potential of keratinocytes and fibroblasts was evaluated in terms of growth property, migratory property, extracellular matrix gene expression and soluble factor secretion. The co-isolation technique yielded a skin cell population dominated by fibroblasts and keratinocytes, with a small amount of melanocytes. Comparison between the 10% and 20% PRP cultures showed that the 10% PRP culture exhibited higher keratinocyte apparent specific growth rate, and secretion of hepatocyte growth factor, monocyte chemoattractant protein-1, epithelial-derived neutrophil-activating protein 78 and vascular endothelial growth factor A, whereas the 20% PRP culture has significantly higher collagen type 1 and collagen type 3 expressions and produced more granulocyte-macrophage colony-stimulating factor. PRP concentration modulates keratinocyte and fibroblast wound healing potential, whereby the 10% PRP promotes wound remodeling, whereas the 20% PRP enhances inflammation and collagen deposition. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  15. GRHL3 binding and enhancers rearrange as epidermal keratinocytes transition between functional states.

    Directory of Open Access Journals (Sweden)

    Rachel Herndon Klein

    2017-04-01

    Full Text Available Transcription factor binding, chromatin modifications and large scale chromatin re-organization underlie progressive, irreversible cell lineage commitments and differentiation. We know little, however, about chromatin changes as cells enter transient, reversible states such as migration. Here we demonstrate that when human progenitor keratinocytes either differentiate or migrate they form complements of typical enhancers and super-enhancers that are unique for each state. Unique super-enhancers for each cellular state link to gene expression that confers functions associated with the respective cell state. These super-enhancers are also enriched for skin disease sequence variants. GRHL3, a transcription factor that promotes both differentiation and migration, binds preferentially to super-enhancers in differentiating keratinocytes, while during migration, it binds preferentially to promoters along with REST, repressing the expression of migration inhibitors. Key epidermal differentiation transcription factor genes, including GRHL3, are located within super-enhancers, and many of these transcription factors in turn bind to and regulate super-enhancers. Furthermore, GRHL3 represses the formation of a number of progenitor and non-keratinocyte super-enhancers in differentiating keratinocytes. Hence, chromatin relocates GRHL3 binding and enhancers to regulate both the irreversible commitment of progenitor keratinocytes to differentiation and their reversible transition to migration.

  16. Rapid adhesion and proliferation of keratinocytes on the gold colloid/chitosan film scaffold

    International Nuclear Information System (INIS)

    Zhang Yi; He Hong; Gao Wenjuan; Lu Shuangyun; Liu Yang; Gu Haiying

    2009-01-01

    The gold colloid/chitosan film scaffold, which could enhance the attached ratio and accelerate proliferation of newborn mice keratinocytes, was fabricated by nanotechnology and self-assembly technology. This nanometer scaffold was characterized by atomic force microscopy (AFM) and scanning electron microscopy (SEM). The keratinocytes were cultured and observed on three different extracellular matrices (ECM): gold colloid/chitosan film scaffold, chitosan film and cell culture plastic (control groups). 6 h, 12 h, 24 h after inoculation, the cell attached ratios were calculated respectively. In comparison to control groups, this scaffold could significantly (P < 0.01) increase the attached ratio of keratinocytes and promote their growth. Meanwhile, there were not any fusiform fibroblasts growing on this scaffold. The rapidly proliferating keratinocytes were indentified and characterized by immunohistochemistry and transmissive electron microscope (TEM), which showed the cells maintain their biological activity well. The results indicated that gold colloid/chitosan film scaffold was nontoxic to keratinocytes, and was a good candidate for wound dressing in skin tissue engineering.

  17. Anti-aging effect of adipose-derived stem cells in a mouse model of skin aging induced by D-galactose.

    Directory of Open Access Journals (Sweden)

    Shengchang Zhang

    Full Text Available INTRODUCTION: Glycation products accumulate during aging of slowly renewing tissue, including skin, and are suggested as an important mechanism underlying the skin aging process. Adipose-derived cells are widely used in the clinic to treat ischemic diseases and enhance wound healing. Interestingly, adipose-derived stem cells (ASCs are also effective in anti-aging therapy, although the mechanism underlying their effects remains unknown. The purpose of the present study was to examine the anti-aging effect of ASCs in a D-galactose-induced aging animal model and to clarify the underlying mechanism. MATERIALS AND METHODS: Six-week-old nude mice were subcutaneously injected with D-gal daily for 8 weeks. Two weeks after completion of treatment, mice were randomized to receive subcutaneous injections of 106 green fluorescent protein (GFP-expressing ASCs, aminoguanidine (AG or phosphate-buffered saline (PBS. Control mice received no treatment. We examined tissue histology and determined the activity of senescence-associated molecular markers such as superoxide dismutase (SOD and malondialdehyde (MDA. RESULTS: Transplanted ASCs were detectable for 14 days and their GFP signal disappeared at day 28 after injection. ASCs inhibited advanced glycation end product (AGE levels in our animal model as well as increased the SOD level and decreased the MDA level, all of which act to reverse the aging phenotype in a similar way to AG, an inhibitor of AGE formation. Furthermore, ASCs released angiogenic factors in vivo such as vascular endothelial growth factor, suggesting a skin trophic effect. CONCLUSIONS: These results demonstrate that ASCs may contribute to the regeneration of skin during aging. In addition, the data shows that ASCs provide a functional benefit by glycation suppression, antioxidation, and trophic effects in a mouse model of aging.

  18. Indian Hedgehog Controls Proliferation and Differentiation in Skin Tumorigenesis and Protects against Malignant Progression

    Directory of Open Access Journals (Sweden)

    Parisa Kakanj

    2013-07-01

    Full Text Available Mutations in the hedgehog pathway drive the formation of tumors in many different organs, including the development of basal cell carcinoma in the skin. However, little is known about the role of epidermal Indian hedgehog (Ihh in skin physiology. Using mouse genetics, we identified overlapping and distinct functions of Ihh in different models of epidermal tumorigenesis. Epidermal deletion of Ihh resulted in increased formation of benign squamous papilloma. Strikingly, Ihh-deficient mice showed an increase in malignant squamous cell carcinoma and developed lung and lymph node metastases. In a sebaceous gland tumor model, Ihh deficiency inhibited tumor cell differentiation. More mechanistically, IHH stimulated cell proliferation by activating the transcription factor GLI2 in human keratinocytes and human tumors. Thus, our results uncover important functions for Ihh signaling in controlling proliferation, differentiation, malignant progression, and metastasis of epithelial cancer, establishing Ihh as a gatekeeper for controlling the grade of tumor malignancy.

  19. Diminution of acute radiation reaction of mouse skin with low-intensity infrared laser/red diodes-emitted light

    International Nuclear Information System (INIS)

    Meshcherikova, V.V.; Klimakov, B.D.; Goldobenko, G.V.; Vajnson, A.A.

    2000-01-01

    Efficiency of the application of different regimes of laser treatment of radiation-induced skin reactions in mice feet is compared. Posterior limb feet of mice were exposed to acute X radiation at 30-36 Gy dose or fractionated radiation at 45 Gy dose. In the day of primary irradiation or different time later the feet were treated using magnetic infrared laser therapeutic MILTA-01 apparatus. Magnetic and light components of the MILTA-01 apparatus reduce the effect of radiation on mice skin corresponding two time decrease in X-radiation dose [ru

  20. A new pharmacological agent (AKB-4924) stabilizes hypoxia inducible factor-1 (HIF-1) and increases skin innate defenses against bacterial infection.

    Science.gov (United States)

    Okumura, Cheryl Y M; Hollands, Andrew; Tran, Dan N; Olson, Joshua; Dahesh, Samira; von Köckritz-Blickwede, Maren; Thienphrapa, Wdee; Corle, Courtney; Jeung, Seung Nam; Kotsakis, Anna; Shalwitz, Robert A; Johnson, Randall S; Nizet, Victor

    2012-09-01

    Hypoxia inducible factor-1 (HIF-1) is a transcription factor that is a major regulator of energy homeostasis and cellular adaptation to low oxygen stress. HIF-1 is also activated in response to bacterial pathogens and supports the innate immune response of both phagocytes and keratinocytes. In this work, we show that a new pharmacological compound AKB-4924 increases HIF-1 levels and enhances the antibacterial activity of phagocytes and keratinocytes against both methicillin-sensitive and methicillin-resistant strains of Staphylococcus aureus in vitro. AKB-4924 is also effective in stimulating the killing capacity of keratinocytes against the important opportunistic skin pathogens Pseudomonas aeruginosa and Acinetobacter baumanii. The effect of AKB-4924 is mediated through the activity of host cells, as the compound exerts no direct antimicrobial activity. Administered locally as a single agent, AKB-4924 limits S. aureus proliferation and lesion formation in a mouse skin abscess model. This approach to pharmacologically boost the innate immune response via HIF-1 stabilization may serve as a useful adjunctive treatment for antibiotic-resistant bacterial infections.

  1. Leishmania infantum proteophosphoglycans regurgitated by the bite of its natural sand fly vector, Lutzomyia longipalpis, promote parasite establishment in mouse skin and skin-distant tissues.

    Science.gov (United States)

    Rogers, Matthew Edward; Corware, Karina; Müller, Ingrid; Bates, Paul Andrew

    2010-10-01

    We demonstrate that a proteophosphoglycan-rich gel secreted by Leishmania infantum inside the midgut of Lutzomyia longipalpis sand flies (promastigote secretory gel) is regurgitated along with an average dose of 500 L. infantum metacyclic promastigotes per infected bite. Using both low (10³) and high (10⁵) doses of parasites in the ears of BALB/c mice we show that the infections benefit from the presence of vector saliva and parasite gel in the skin. However, chronic infection of the spleen was only enhanced in high dose co-infections with gel. These results provide the framework for a more natural experimental model of visceral leishmaniasis. Copyright © 2010. Published by Elsevier SAS.

  2. Chemical Characterization and Toxicologic Evaluation of Airborne Mixtures. Tumorigenicity Studies of Diesel Fuel-2, Red Smoke Dye and Violet Smoke Dyes in the SENCAR Mouse Skin Tumorigenesis Bioassay System

    Science.gov (United States)

    1985-09-01

    methyl nitrosourea on mouse skin in the drop test. Acta Biol. Med. Ger. 16: KI-K3. Hennings, H., and R. K. Boutwel’.. 1969. Inhibition of DNA synthesis ...J., G. T. Bowden, B. G. Shapas, and R. K. Boutwell. 1973. "Macromolecular synthesis following a single application of alkylating agents used as

  3. A novel DLX3-PKC integrated signaling network drives keratinocyte differentiation.

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-Wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-04-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  4. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  5. Melanosomes are transferred from melanocytes to keratinocytes through the processes of packaging, release, uptake, and dispersion.

    Science.gov (United States)

    Ando, Hideya; Niki, Yoko; Ito, Masaaki; Akiyama, Kaoru; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

    2012-04-01

    Recent studies have described the role of shedding vesicles as physiological conveyers of intracellular components between neighboring cells. Here we report that melanosomes are one example of shedding vesicle cargo, but are processed by a previously unreported mechanism. Pigment globules were observed to be connected to the filopodia of melanocyte dendrites, which have previously been shown to be conduits for melanosomes. Pigment globules containing multiple melanosomes were released from various areas of the dendrites of normal human melanocytes derived from darkly pigmented skin. The globules were then captured by the microvilli of normal human keratinocytes, also derived from darkly pigmented skin, which incorporated them in a protease-activated receptor-2 (PAR-2)-dependent manner. After the pigment globules were ingested by the keratinocytes, the membrane that surrounded each melanosome cluster was gradually degraded, and the individual melanosomes then spread into the cytosol and were distributed primarily in the perinuclear area of each keratinocyte. These results suggest a melanosome transfer pathway wherein melanosomes are transferred from melanocytes to keratinocytes via the shedding vesicle system. This packaging system generates pigment globules containing multiple melanosomes in a unique manner.

  6. Early changes in blood flow of the mouse skin after irradiation as measured by the 133Xe clearance method

    International Nuclear Information System (INIS)

    Tsujii, Hirohiko; Irie, Goro

    1983-01-01

    The early effects of radiation on the local blood flow in the skin of mice were evaluated by measuring the local clearance rate of 133 Xe after its subcutaneous injection; this was done at four to five weeks after irradiation during the animals' normal resting conditions. The fractionation schedules employed were single fractions, two fractions in 15 days and four fractions in 15 days. The dose effect curves with these schedules showed a two-component pattern. There was a uniform reduction in flood flow after 10 to 30 Gy, and a steady increase in flood flow after doses more than 40 Gy. The blood flow after higher-fractionated doses was always lower than less-fractionated doses. It was considered that radiation doses causing higher severity of acute skin reactions might have predominated a degree of acute vasodilatation over fibrotic changes, thus resulting in increased blood flow. A steady increase in early blood flow was observed with increasing severity of acute skin reactions, but the early blood flow was not a good indicator for predicting late skin reactions, except for a severe leg deformity which was accompanied with a significant increase in early blood flow. (author)

  7. Differential gene expression between skin and cervix induced by the E7 oncoprotein in a transgenic mouse model

    Science.gov (United States)

    Ibarra Sierra, E; Díaz Chávez, J; Cortés-Malagón, EM; Uribe-Figueroa, L; Hidalgo-Miranda, A; Lambert, PF; Gariglio, P

    2013-01-01

    HPV16 E7 oncoprotein expression in K14E7 transgenic mice induces cervical cancer after 6 months of treatment with the co-carcinogen 17β-estradiol. In untreated mice, E7 also induces skin tumors late in life albeit at low penetrance. These findings indicate that E7 alters cellular functions in cervix and skin so as to predispose these organs to tumorigenesis. Using microarrays, we determined the global genes expression profile in cervical and skin tissue of young adult K14E7 transgenic mice without estrogen treatment. In these tissues, the E7 oncoprotein altered the transcriptional pattern of genes involved in several biological processes including signal transduction, transport, metabolic process, cell adhesion, apoptosis, cell differentiation, immune response and inflammatory response. Among the E7-dysregulated genes were ones not previously known to be involved in cervical neoplasia including DMBT1, GLI1 and 17βHSD2 in cervix, as well as MMP2, 12, 14, 19 and 27 in skin. PMID:22980503

  8. Ultrasonic Stimulation of Mouse Skin Reverses the Healing Delays in Diabetes and Aging by Activation of Rac1.

    Science.gov (United States)

    Roper, James A; Williamson, Rosalind C; Bally, Blandine; Cowell, Christopher A M; Brooks, Rebecca; Stephens, Phil; Harrison, Andrew J; Bass, Mark D

    2015-11-01

    Chronic skin-healing defects are one of the leading challenges to lifelong well-being, affecting 2-5% of populations. Chronic wound formation is linked to age and diabetes and frequently leads to major limb amputation. Here we identify a strategy to reverse fibroblast senescence and improve healing rates. In healthy skin, fibronectin activates Rac1 in fibroblasts, causing migration into the wound bed, and driving wound contraction. We discover that mechanical stimulation of the skin with ultrasound can overturn healing defects by activating a calcium/CamKinaseII/Tiam1/Rac1 pathway that substitutes for fibronectin-dependent signaling and promotes fibroblast migration. Treatment of diabetic and aged mice recruits fibroblasts to the wound bed and reduces healing times by 30%, restoring healing rates to those observed in young, healthy animals. Ultrasound treatment is equally effective in rescuing the healing defects of animals lacking fibronectin receptors, and can be blocked by pharmacological inhibition of the CamKinaseII pathway. Finally, we discover that the migration defects of fibroblasts from human venous leg ulcer patients can be reversed by ultrasound, demonstrating that the approach is applicable to human chronic samples. By demonstrating that this alternative Rac1 pathway can substitute for that normally operating in the skin, we identify future opportunities for management of chronic wounds.

  9. Inhibition of DNA and protein synthesis in UV-irradiated mouse skin by 2-difluoromethylornithine, methylglyoxal bis(guanylhydrazone), and their combination

    Energy Technology Data Exchange (ETDEWEB)

    Kaepyaho, K.; Lauharanta, J.; Jaenne, J.

    1983-08-01

    Exposure of mouse skin to UVB irradiation greatly enhanced the biosynthesis and accumulation of putrescine and spermidine before or concomitantly with stimulation of epidermal macromolecular (DNA and protein) synthesis. Topical treatment of UV-exposed skin with 2 inhibitors of polyamine biosynthesis, 2-difluoromethylornithine (DFMO) and methylglyoxal bis(guanylhydrazone) (MGBG) prevented the enhanced epidermal accumulation of polyamines, especially spermidine, and also inhibited the incorporation of radioactive precursors into DNA and protein. When applied in combination, these 2 antimetabolites of polyamines produced an inhibition of macromolecular synthesis that was at least additive: (/sup 3/H)thymidine incorporation decreased by 80% and (/sup 14/C)leucine incorporation by 44% as compared with the UVB-irradiated control mice. A slight decrease in the ratio of (/sup 3/H)histidine/(/sup 14/C)leucine incorporation indicated that protein synthesis of the differentiating cell layers was also affected by the inhibitors. The effects of the combined DFMO and MGBG treatment were partially reversed by concomitant topical application of spermidine.

  10. Inhibition of DNA and protein synthesis in UV-irradiated mouse skin by 2-difluoromethylornithine, methylglyoxal bis(guanylhydrazone), and their combination

    International Nuclear Information System (INIS)

    Kaepyaho, K.; Lauharanta, J.; Jaenne, J.

    1983-01-01

    Exposure of mouse skin to UVB irradiation greatly enhanced the biosynthesis and accumulation of putrescine and spermidine before or concomitantly with stimulation of epidermal macromolecular (DNA and protein) synthesis. Topical treatment of UV-exposed skin with 2 inhibitors of polyamine biosynthesis, 2-difluoromethylornithine (DFMO) and methylglyoxal bis(guanylhydrazone) (MGBG) prevented the enhanced epidermal accumulation of polyamines, especially spermidine, and also inhibited the incorporation of radioactive precursors into DNA and protein. When applied in combination, these 2 antimetabolites of polyamines produced an inhibition of macromolecular synthesis that was at least additive: [ 3 H]thymidine incorporation decreased by 80% and [ 14 C]leucine incorporation by 44% as compared with the UVB-irradiated control mice. A slight decrease in the ratio of [ 3 H]histidine/[ 14 C]leucine incorporation indicated that protein synthesis of the differentiating cell layers was also affected by the inhibitors. The effects of the combined DFMO and MGBG treatment were partially reversed by concomitant topical application of spermidine

  11. Mathematical modeling of calcium waves induced by mechanical stimulation in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuaki Kobayashi

    Full Text Available Recent studies have shown that the behavior of calcium in the epidermis is closely related to the conditions of the skin, especially the differentiation of the epidermal keratinocytes and the permeability barrier function, and therefore a correct understanding of the calcium dynamics is important in explaining epidermal homeostasis. Here we report on experimental observations of in vitro calcium waves in keratinocytes induced by mechanical stimulation, and present a mathematical model that can describe the experimentally observed wave behavior that includes finite-range wave propagation and a ring-shaped pattern. A mechanism of the ring formation hypothesized by our model may be related to similar calcium propagation patterns observed during the wound healing process in the epidermis. We discuss a possible extension of our model that may serve as a tool for investigating the mechanisms of various skin diseases.

  12. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  13. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  14. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Tu, Min; Huang, Yi; Li, Hai-Ling; Gao, Zhong-Hong

    2012-01-01

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO 2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  15. Abnormalities in the basement membrane structure promote basal keratinocytes in the epidermis of hypertrophic scars to adopt a proliferative phenotype.

    Science.gov (United States)

    Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing

    2016-05-01

    The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.

  16. Image enhancement of optical images for binary system of melanocytes and keratinocytes

    Science.gov (United States)

    Takanezawa, S.; Baba, A.; Sako, Y.; Ozaki, Y.; Date, A.; Toyama, K.; Morita, S.

    2013-05-01

    Automatic determination of the cell shapes of large numbers of melanocytes based on optical images of human skin models have been largely unsuccessful (the complexities introduced by dendrites and the melanin pigmentation over the keratinocytes to give unclear outlines). Here, we present an image enhancement procedure for enhancing the contrast of images with removing the non-uniformity of background. The brightness is normalized also for the non-uniform population density of melanocytes.

  17. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. CDH1 regulates E2F1 degradation in response to differentiation signals in keratinocytes.

    Science.gov (United States)

    Singh, Randeep K; Dagnino, Lina

    2017-01-17

    The E2F1 transcription factor plays key roles in skin homeostasis. In the epidermis, E2F1 expression is essential for normal proliferation of undifferentiated keratinocytes, regeneration after injury and DNA repair following UV radiation-induced photodamage. Abnormal E2F1 expression promotes nonmelanoma skin carcinoma. In addition, E2F1 must be downregulated for proper keratinocyte differentiation, but the relevant mechanisms involved remain poorly understood. We show that differentiation signals induce a series of post-translational modifications in E2F1 that are jointly required for its downregulation. Analysis of the structural determinants that govern these processes revealed a central role for S403 and T433. In particular, substitution of these two amino acid residues with non-phosphorylatable alanine (E2F1 ST/A) interferes with E2F1 nuclear export, K11- and K48-linked polyubiquitylation and degradation in differentiated keratinocytes. In contrast, replacement of S403 and T433 with phosphomimetic aspartic acid to generate a pseudophosphorylated E2F1 mutant protein (E2F1 ST/D) generates a protein that is regulated in a manner indistinguishable from that of wild type E2F1. Cdh1 is an activating cofactor that interacts with the anaphase-promoting complex/cyclosome (APC/C) ubiquitin E3 ligase, promoting proteasomal degradation of various substrates. We found that Cdh1 associates with E2F1 in keratinocytes. Inhibition or RNAi-mediated silencing of Cdh1 prevents E2F1 degradation in response to differentiation signals. Our results reveal novel regulatory mechanisms that jointly modulate post-translational modifications and downregulation of E2F1, which are necessary for proper epidermal keratinocyte differentiation.

  19. Activation of P2X7-mediated apoptosis Inhibits DMBA/TPA-induced formation of skin papillomas and cancer in mice

    International Nuclear Information System (INIS)

    Fu, Wen; Gorodeski, George I; McCormick, Tom; Qi, Xiaoping; Luo, Liping; Zhou, Lingyin; Li, Xin; Wang, Bing-Cheng; Gibbons, Heidi E; Abdul-Karim, Fadi W

    2009-01-01

    The study tested the hypothesis that apoptosis can prevent and control growth of neoplastic cells. Previous studies in-vitro have shown that the pro-apoptotic P2X 7 receptor regulates growth of epithelial cells. The specific objective of the present study was to understand to what degree the P2X 7 system controls development and growth of skin cancer in vivo, and what cellular and molecular mechanisms are involved in the P2X 7 action. Skin neoplasias in mice (papillomas, followed by squamous spindle-cell carcinomas) were induced by local application of DMBA/TPA. Experiments in-vitro utilized cultured epidermal keratinocytes generated from wild-type or from P2X 7 -null mice. Assays involved protein immunostaining and Western blots; mRNA real-time qPCR; and apoptosis (evaluated in situ by TUNEL and quantified in cultured keratinocytes as solubilized DNA or by ELISA). Changes in cytosolic calcium or in ethidium bromide influx (P2X 7 pore formation) were determined by confocal laser microscopy. (a) Co-application on the skin of the P2X 7 specific agonist BzATP inhibited formation of DMBA/TPA-induced skin papillomas and carcinomas. At the completion of study (week 28) the proportion of living animals with cancers in the DMBA/TPA group was 100% compared to 43% in the DMBA/TPA+BzATP group. (b) In the normal skin BzATP affected mainly P2X 7 -receptor – expressing proliferating keratinocytes, where it augmented apoptosis without evoking inflammatory changes. (c) In BzATP-treated mice the degree of apoptosis was lesser in cancer than in normal or papilloma keratinocytes. (d) Levels of P2X 7 receptor, protein and mRNA were 4–5 fold lower in cancer tissues than in normal mouse tissues. (e) In cultured mouse keratinocytes BzATP induced apoptosis, formation of pores in the plasma membrane, and facilitated prolonged calcium influx. (f) The BzATP-induced apoptosis, pore-formation and augmented calcium influx had similar dose-dependence for BzATP. (g) Pore formation and the

  20. Activation of P2X7-mediated apoptosis Inhibits DMBA/TPA-induced formation of skin papillomas and cancer in mice

    Directory of Open Access Journals (Sweden)

    Fu Wen

    2009-04-01

    Full Text Available Abstract Background The study tested the hypothesis that apoptosis can prevent and control growth of neoplastic cells. Previous studies in-vitro have shown that the pro-apoptotic P2X7 receptor regulates growth of epithelial cells. The specific objective of the present study was to understand to what degree the P2X7 system controls development and growth of skin cancer in vivo, and what cellular and molecular mechanisms are involved in the P2X7 action. Methods Skin neoplasias in mice (papillomas, followed by squamous spindle-cell carcinomas were induced by local application of DMBA/TPA. Experiments in-vitro utilized cultured epidermal keratinocytes generated from wild-type or from P2X7-null mice. Assays involved protein immunostaining and Western blots; mRNA real-time qPCR; and apoptosis (evaluated in situ by TUNEL and quantified in cultured keratinocytes as solubilized DNA or by ELISA. Changes in cytosolic calcium or in ethidium bromide influx (P2X7 pore formation were determined by confocal laser microscopy. Results (a Co-application on the skin of the P2X7 specific agonist BzATP inhibited formation of DMBA/TPA-induced skin papillomas and carcinomas. At the completion of study (week 28 the proportion of living animals with cancers in the DMBA/TPA group was 100% compared to 43% in the DMBA/TPA+BzATP group. (b In the normal skin BzATP affected mainly P2X7-receptor – expressing proliferating keratinocytes, where it augmented apoptosis without evoking inflammatory changes. (c In BzATP-treated mice the degree of apoptosis was lesser in cancer than in normal or papilloma keratinocytes. (d Levels of P2X7 receptor, protein and mRNA were 4–5 fold lower in cancer tissues than in normal mouse tissues. (e In cultured mouse keratinocytes BzATP induced apoptosis, formation of pores in the plasma membrane, and facilitated prolonged calcium influx. (f The BzATP-induced apoptosis, pore-formation and augmented calcium influx had similar dose-dependence for

  1. The acute effects of alpha and beta irradiation of mouse skin and the factors affecting the response

    International Nuclear Information System (INIS)

    Needham, S.G.; Coggle, J.E.

    1991-01-01

    Several problems regarding acute effects of alpha and beta irradiation were investigated in order to clarify protection problems of localised doses to the skin. A study into the acute biological effects of different energy beta emitters and the effects of energy and area on the response showed direct relationships between these criteria for a range of different acute responses with different time courses. Three different types of acute response were found and these are described as 'moist desquamation', 'acute ulceration' and 'acute epidermal necrosis'. An unexpected finding was that the lower energy beta emitter 170 Tm was as efficient at inducing scab formation as the higher energy 90 Sr sources for the same area of exposure. Experiments using 2x4 cm 2 exposures to 224 Cm alpha particles showed that the response to this poorly penetrating radiation was minimal after doses as high as 180 Gy measured at 10 μm into the skin. In comparison, large area exposure to 170 Tm produced areas of prolonged scabbing after doses up to 100 Gy. However, the intensity of the reaction varied between strains. (author)

  2. Hydrogen-enriched water restoration of impaired calcium propagation by arsenic in primary keratinocytes

    Science.gov (United States)

    Yu, Wei-Tai; Chiu, Yi-Ching; Lee, Chih-Hung; Yoshioka, Tohru; Yu, Hsin-Su

    2013-11-01

    Endemic contamination of artesian water for drinking by arsenic is known to cause several human cancers, including cancers of the skin, bladder, and lungs. In skin, multiple arsenic-induced Bowen's disease (As-BD) can develop into invasive cancers after decades of arsenic exposure. The characteristic histological features of As-BD include full-layer epidermal dysplasia, apoptosis, and abnormal proliferation. Calcium propagation is an essential cellular event contributing to keratinocyte differentiation, proliferation, and apoptosis, all of which occur in As-BD. This study investigated how arsenic interferes calcium propagation of skin keratinocytes through ROS production and whether hydrogen-enriched water would restore arsenic-impaired calcium propagation. Arsenic was found to induce oxidative stress and inhibit ATP- and thapsigaragin-induced calcium propagation. Pretreatment of arsenic-treated keratinocytes by hydrogen-enriched water or beta-mercaptoethanol with potent anti-oxidative effects partially restored the propagation of calcium by ATP and by thapsigaragin. It was concluded that arsenic may impair calcium propagation, likely through oxidative stress and interactions with thiol groups in membrane proteins.

  3. Experimental model of cultured keratinocytes Modelo experimental de cultura de queratinócitos

    Directory of Open Access Journals (Sweden)

    Alfredo Gragnani

    2003-01-01

    Full Text Available The bioengineering research is essential in the development of ideal combination of biomaterials and cultured cells to produce the permanent wound coverage. The experimental model of cultured keratinocytes presents all steps of the culture, since the isolation of the keratinocytes, preparation of the human acellular dermis, preparation of the composite skin graft and their elevation to the air-liquid interface. The research in cultured keratinocytes model advances in two main ways: 1. optimization of the methods in vitro to the skin cells culture and proliferation and 2. developing biomaterials that present similar skin properties.A pesquisa em bioengenharia é primordial no desenvolvimento da combinação ideal de biomateriais e células cultivadas para produzir a cobertura definitiva das lesões. O modelo experimental da cultura de queratinócitos apresenta toda as etapas do cultivo, desde o isolamento dos queratinócitos, preparação da derme acelular humana, do enxerto composto e da sua elevação à interface ar-líquido. A pesquisa em modelo de cultura de queratinócitos desenvolve-se em duas vias principais: 1. otimização dos métodos in vitro para cultivo e proliferação de células da pele e 2. desenvolvimento de biomateriais que mimetizem as propriedades da pele.

  4. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  5. Assessment of edema volume in skin upon injury in a mouse ear model with optical coherence tomography

    Science.gov (United States)

    Qin, Wan

    2017-01-01

    Accurate measurement of edema volume is essential for the investigation of tissue response and recovery following a traumatic injury. The measurements must be noninvasive and repetitive over time so as to monitor tissue response throughout the healing process. Such techniques are particularly necessary for the evaluation of therapeutics that are currently in development to suppress or prevent edema formation. In this study, we propose to use optical coherence tomography (OCT) technique to image and quantify edema in a mouse ear model where the injury is induced by a superficial-thickness burn. Extraction of edema volume is achieved by an attenuation compensation algorithm performed on the three-dimensional OCT images, followed by two segmentation procedures. In addition to edema volume, the segmentation method also enables accurate thickness mapping of edematous tissue, which is an important characteristic of the external symptoms of edema. To the best of our knowledge, this is the first method for noninvasively measuring absolute edema volume. PMID:27282161

  6. Potent immunity to low doses of influenza vaccine by probabilistic guided micro-targeted skin delivery in a mouse model.

    Directory of Open Access Journals (Sweden)

    Germain J P Fernando

    Full Text Available BACKGROUND: Over 14 million people die each year from infectious diseases despite extensive vaccine use [1]. The needle and syringe--first invented in 1853--is still the primary delivery device, injecting liquid vaccine into muscle. Vaccines could be far more effective if they were precisely delivered into the narrow layer just beneath the skin surface that contains a much higher density of potent antigen-presenting cells (APCs essential to generate a protective immune response. We hypothesized that successful vaccination could be achieved this way with far lower antigen doses than required by the needle and syringe. METHODOLOGY/PRINCIPAL FINDINGS: To meet this objective, using a probability-based theoretical analysis for targeting skin APCs, we designed the Nanopatch, which contains an array of densely packed projections (21025/cm(2 invisible to the human eye (110 microm in length, tapering to tips with a sharpness of <1000 nm, that are dry-coated with vaccine and applied to the skin for two minutes. Here we show that the Nanopatches deliver a seasonal influenza vaccine (Fluvax 2008 to directly contact thousands of APCs, in excellent agreement with theoretical prediction. By physically targeting vaccine directly to these cells we induced protective levels of functional antibody responses in mice and also protection against an influenza virus challenge that are comparable to the vaccine delivered intramuscularly with the needle and syringe--but with less than 1/100(th of the delivered antigen. CONCLUSIONS/SIGNIFICANCE: Our results represent a marked improvement--an order of magnitude greater than reported by others--for injected doses administered by other delivery methods, without reliance on an added adjuvant, and with only a single vaccination. This study provides a proven mathematical/engineering delivery device template for extension into human studies--and we speculate that successful translation of these findings into humans could

  7. Response of mouse skin to tattooing: use of SKH-1 mice as a surrogate model for human tattooing

    International Nuclear Information System (INIS)

    Gopee, Neera V.; Cui, Yanyan; Olson, Greg; Warbritton, Alan R.; Miller, Barbara J.; Couch, Letha H.; Wamer, Wayne G.; Howard, Paul C.

    2005-01-01

    Tattooing is a popular cosmetic practice involving more than 45 million US citizens. Since the toxicology of tattoo inks and pigments used to formulate tattoo inks has not been reported, we studied the immunological impact of tattooing and determined recovery time from this trauma. SKH-1 hairless mice were tattooed using commercial tattoo inks or suspensions of titanium dioxide, cadmium sulfide, or iron oxide, and sacrificed at 0.5, 1, 3, 4, 7, or 14 days post-tattooing. Histological evaluation revealed dermal hemorrhage at 0.5 and 1 day. Acute inflammation and epidermal necrosis were initiated at 0.5 day decreasing in incidence by day 14. Dermal necrosis and epidermal hyperplasia were prominent by day 3, reducing in severity by day 14. Chronic active inflammation persisted in all tattooed mice from day 3 to 14 post-tattooing. Inguinal and axillary lymph nodes were pigmented, the inguinal being most reactive as evidenced by lymphoid hyperplasia and polymorphonuclear infiltration. Cutaneous nuclear protein concentrations of nuclear factor-kappa B were elevated between 0.5 and 4 days. Inflammatory and proliferative biomarkers, cyclooxygenase-1, cyclooxygenase-2, and ornithine decarboxylase protein levels were elevated between 0.5 and 4 days in the skin and decreased to control levels by day 14. Interleukin-1 beta and interleukin-10 were elevated in the lymph nodes but suppressed in the tattooed skin, with maximal suppression occurring between days 0.5 and 4. These data demonstrate that mice substantially recover from the tattooing insult by 14 days, leaving behind pigment in the dermis and the regional lymph nodes. The response seen in mice is similar to acute injury seen in humans, suggesting that the murine model might be a suitable surrogate for investigating the toxicological and phototoxicological properties of ingredients used in tattooing

  8. Vitamin D for combination photodynamic therapy of skin cancer in individuals with vitamin D deficiency: Insights from a preclinical study in a mouse model of squamous cell carcinoma

    Science.gov (United States)

    Anand, Sanjay; Thomas, Erik; Hasan, Tayyaba; Maytin, Edward V.

    2016-03-01

    Combination photodynamic therapy (cPDT) in which vitamin D (VD) is given prior to aminolevulinate, a precursor (pro-drug) for protoporphyrin IX (PpIX), is an approach developed in our laboratory. We previously showed that 1α,25- dihydroxyvitamin D3 (calcitriol), given prior to PDT, enhances accumulation of PpIX and improves cell death post-PDT in a mouse skin cancer model. However, since calcitriol poses a risk for hypercalcemia, we replaced systemic calcitriol with oral cholecalciferol (D3), administered as a high (tenfold, "10K") diet over a ten-day period. Here, we ask whether VD deficiency might alter the response to cPDT. Nude mice were fed a VD-deficient diet for at least 4 weeks ("deficient"); controls were fed a normal 1,000 IU/kg diet ("1K"). Human A431 cells were implanted subcutaneously and mice were switched to the 10K diet or continued on their baseline diets (controls). In other experiments, mice received a human equivalent dose of 50,000 IU D3 by oral gavage, to simulate administration of a single, high-dose VD pill. At various times, tumors were harvested and serum was collected to measure levels of VD metabolic intermediates. A significant increase in PpIX levels and in the expression of differentiation and proliferation markers in tumor tissue was observed after VD supplementation of both the deficient and 1K mice. Further results describing mechanistic details of PpIX enhancement through alteration of heme- and VD-metabolic enzyme levels will be presented. Based on these results, a clinical study using oral vitamin D prior to PDT for human skin cancer should be performed.

  9. Antimicrobial blue light therapy for multidrug-resistant Acinetobacter baumannii infection in a mouse burn model: implications for prophylaxis and treatment of combat-related wound infections.

    Science.gov (United States)

    Zhang, Yunsong; Zhu, Yingbo; Gupta, Asheesh; Huang, Yingying; Murray, Clinton K; Vrahas, Mark S; Sherwood, Margaret E; Baer, David G; Hamblin, Michael R; Dai, Tianhong

    2014-06-15

    In this study, we investigated the utility of antimicrobial blue light therapy for multidrug-resistant Acinetobacter baumannii infection in a mouse burn model. A bioluminescent clinical isolate of multidrug-resistant A. baumannii was obtained. The susceptibility of A. baumannii to blue light (415 nm)-inactivation was compared in vitro to that of human keratinocytes. Repeated cycles of sublethal inactivation of bacterial by blue light were performed to investigate the potential resistance development of A. baumannii to blue light. A mouse model of third degree burn infected with A. baumannii was developed. A single exposure of blue light was initiated 30 minutes after bacterial inoculation to inactivate A. baumannii in mouse burns. It was found that the multidrug-resistant A. baumannii strain was significantly more susceptible than keratinocytes to blue light inactivation. Transmission electron microscopy revealed blue light-induced ultrastructural damage in A. baumannii cells. Fluorescence spectroscopy suggested that endogenous porphyrins exist in A. baumannii cells. Blue light at an exposure of 55.8 J/cm(2) significantly reduced the bacterial burden in mouse burns. No resistance development to blue light inactivation was observed in A. baumannii after 10 cycles of sublethal inactivation of bacteria. No significant DNA damage was detected in mouse skin by means of a skin TUNEL assay after a blue light exposure of 195 J/cm(2). © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes.

    Science.gov (United States)

    Büchau, Amanda S; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Gallo, Richard L

    2008-11-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrolimus enhances distinct expression of cathelicidin, CD14, and human beta-defensin-2 and beta-defensin-3 in response to TLR2/6 ligands. Some of these responses were further enhanced by 1,25 vitamin D3. Pimecrolimus also increased the functional capacity of keratinocytes to inhibit growth of Staphylococcus aureus and decreased TLR2/6-induced expression of IL-10 and IL-1beta. Furthermore, pimecrolimus inhibited nuclear translocation of NFAT and NF-kappaB in keratinocytes. These observations uncover a previously unreported function for pimecrolimus in cutaneous innate host defense.

  11. Keratinocytes express fibrillin and assemble microfibrils: implications for dermal matrix organization.

    Science.gov (United States)

    Haynes, S L; Shuttleworth, C A; Kielty, C M

    1997-07-01

    Fibrillin-containing microfibrils are key architectural structures of the upper dermis and integral components of the dermal elastic fibre network. Microfibril bundles intercalate into the dermal-epithelial junction and provide an elastic connection between the dermal elastic fibre network and the epidermis. Immunohistochemical studies have suggested that they are laid down both at the dermal-epithelial junction and in the deep dermis. While dermal fibroblasts are responsible for deposition of the elastin and microfibrillar components that comprise the elastic fibres of the deep dermis, the cellular origin of the microfibril bundles that extrude from the dermal-epithelial junction is not well defined. We have used fresh tissues, freshly isolated epidermis and primary human and porcine keratinocyte cultures to investigate the possibility that keratinocytes are responsible for deposition of these microfibrils. We have shown that keratinocytes in vivo and in vitro synthesize both fibrillin-1 and fibrillin-2, and assemble beaded microfibrils concurrently with expression of basement membrane collagen. These observations suggest that keratinocytes co-ordinate the secretion, deposition and assembly of these distinct structural elements of the dermal matrix, and have important implications for skin remodelling.

  12. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  13. Role of the Slug Transcription Factor in Chemically-Induced Skin Cancer

    Directory of Open Access Journals (Sweden)

    Kristine von Maltzan

    2016-02-01

    Full Text Available The Slug transcription factor plays an important role in ultraviolet radiation (UVR-induced skin carcinogenesis, particularly in the epithelial-mesenchymal transition (EMT occurring during tumor progression. In the present studies, we investigated the role of Slug in two-stage chemical skin carcinogenesis. Slug and the related transcription factor Snail were expressed at high levels in skin tumors induced by 7,12-dimethylbenz[α]anthracene application followed by 12-O-tetradecanoylphorbol-13-acetate (TPA treatment. TPA-induced transient elevation of Slug and Snail proteins in normal mouse epidermis and studies in Slug transgenic mice indicated that Slug modulates TPA-induced epidermal hyperplasia and cutaneous inflammation. Although Snail family factors have been linked to inflammation via interactions with the cyclooxygenase-2 (COX-2 pathway, a pathway that also plays an important role in skin carcinogenesis, transient TPA induction of Slug and Snail appeared unrelated to COX-2 expression. In cultured human keratinocytes, TPA induced Snail mRNA expression while suppressing Slug expression, and this differential regulation was due specifically to activation of the TPA receptor. These studies show that Slug and Snail exhibit similar patterns of expression during both UVR and chemical skin carcinogenesis, that Slug and Snail can be differentially regulated under some conditions and that in vitro findings may not recapitulate in vivo results.

  14. Relation between speckle decorrelation and optical phase conjugation (OPC)-based turbidity suppression through dynamic scattering media: a study on in vivo mouse skin

    Science.gov (United States)

    Jang, Mooseok; Ruan, Haowen; Vellekoop, Ivo M.; Judkewitz, Benjamin; Chung, Euiheon; Yang, Changhuei

    2014-01-01

    Light scattering in biological tissue significantly limits the accessible depth for localized optical interrogation and deep-tissue optical imaging. This challenge can be overcome by exploiting the time-reversal property of optical phase conjugation (OPC) to reverse multiple scattering events or suppress turbidity. However, in living tissue, scatterers are highly movable and the movement can disrupt time-reversal symmetry when there is a latency in the OPC playback. In this paper, we show that the motion-induced degradation of the OPC turbidity-suppression effect through a dynamic scattering medium shares the same decorrelation time constant as that determined from speckle intensity autocorrelation – a popular conventional measure of scatterer movement. We investigated this decorrelation characteristic time through a 1.5-mm-thick dorsal skin flap of a living mouse and found that it ranges from 50 ms to 2.5 s depending on the level of immobilization. This study provides information on relevant time scales for applying OPC to living tissues. PMID:25657876

  15. Curcumin Protects against UVB-Induced Skin Cancers in SKH-1 Hairless Mouse: Analysis of Early Molecular Markers in Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Kuen-Daw Tsai

    2012-01-01

    Full Text Available Curcumin (CUR has been shown to possess a preventive effect against various cancers and interfere with multiple-cell signaling pathways. We evaluated the protective effects of CUR in regression of UVB-induced skin tumor formation in SKH-1 hairless mice and its underlying early molecular biomarkers associated with carcinogenesis. Mice irradiated with UVB at 180 mJ/cm2 twice per week elicited 100% tumor incidence at 20 weeks. Topical application of CUR prior to UVB irradiation caused delay in tumor appearance, multiplicity, and size. Topical application of CUR prior to and immediately after a single UVB irradiation (180 mJ/cm2 resulted in a significant decrease in UVB-induced thymine dimer-positive cells, expression of proliferative cell nuclear antigen (PCNA, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling, and apoptotic sunburn cells together with an increase in p53 and p21/Cip1-positive cell population in epidermis. Simultaneously, CUR also significantly inhibited NF-κB, cyclooxygenase-2 (COX-2, prostaglandin E2 (PGE2, and nitric oxide (NO levels. The results suggest that the protective effect of CUR against photocarcinogenesis is accompanied by downregulation of cell proliferative controls, involving thymine dimer, PCNA, apoptosis, transcription factors NF-κB, and of inflammatory responses involving COX-2, PGE2, and NO, while upregulation of p53 and p21/Cip1 to prevent DNA damage and facilitate DNA repair.

  16. on skin keratinocytes by nuclear factor-kappa B

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-21

    Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...

  17. Skin immune sentinels in health and disease.

    Science.gov (United States)

    Nestle, Frank O; Di Meglio, Paola; Qin, Jian-Zhong; Nickoloff, Brian J

    2009-10-01

    Human skin and its immune cells provide essential protection of the human body from injury and infection. Recent studies reinforce the importance of keratinocytes as sensors of danger through alert systems such as the inflammasome. In addition, newly identified CD103(+) dendritic cells are strategically positioned for cross-presentation of skin-tropic pathogens and accumulating data highlight a key role of tissue-resident rather than circulating T cells in skin homeostasis and pathology. This Review focuses on recent progress in dissecting the functional role of skin immune cells in skin disease.

  18. Modified methods for growing 3-D skin equivalents: an update.

    Science.gov (United States)

    Lamb, Rebecca; Ambler, Carrie A

    2014-01-01

    Artificial epidermis can be reconstituted in vitro by seeding primary epidermal cells (keratinocytes) onto a supportive substrate and then growing the developing skin equivalent at the air-liquid interface. In vitro skin models are widely used to study skin biology and for industrial drug and cosmetic testing. Here, we describe updated methods for growing 3-dimensional skin equivalents using de-vitalized, de-epidermalized dermis (DED) substrates including methods for DED substrate preparation, cell seeding, growth conditions, and fixation procedures.

  19. Skin Photoaging and the Role of Antioxidants in Its Prevention

    OpenAIRE

    Pandel, Ruža; Poljšak, Borut; Godic, Aleksandar; Dahmane, Raja

    2013-01-01

    Photoaging of the skin depends primarily on the degree of ultraviolet radiation (UVR) and on an amount of melanin in the skin (skin phototype). In addition to direct or indirect DNA damage, UVR activates cell surface receptors of keratinocytes and fibroblasts in the skin, which leads to a breakdown of collagen in the extracellular matrix and a shutdown of new collagen synthesis. It is hypothesized that dermal collagen breakdown is followed by imperfect repair that yields a deficit in the stru...

  20. Astragaloside IV Downregulates β-Catenin in Rat Keratinocytes to Counter LiCl-Induced Inhibition of Proliferation and Migration

    Directory of Open Access Journals (Sweden)

    Fu-Lun Li

    2012-01-01

    Full Text Available Re-epithelialization is a crucial step towards wound healing. The traditional Chinese medicine, Astragalus membranaceus (Fisch Bge, has been used for hundreds of years for many kinds of ulcerated wounds. Recent research has identified the active compound in this drug as astragaloside IV (AS-IV, but the underlying molecular mechanisms of its therapeutic action on keratinocytes remain poorly understood. In this study, we used an in vitro model of ulcer-like wound processes, lithium chloride (LiCl-induced cultured mouse keratinocytes, to investigate the effects of AS-IV treatment. The effects on cell proliferation were evaluated by the MTS/PMS colorimetric assay, effects on cell migration were determined by a wound-healing scratch experiment, effects on the cell cycle were analyzed by flow cytometry, and effects on protein expression were analyzed by immunoblotting and immunofluorescence. LiCl strongly inhibited cell proliferation and migration, up-regulated β-catenin expression, and down-regulated proliferating cell nuclear antigen (PCNA expression. AS-IV treatment attenuat the inhibition of proliferation and migration, significantly reducing the enhanced β-catenin expression, and recovering PCNA and β-tubulin expression. Thus, AS-IV mediates mouse keratinocyte proliferation and migration via regulation of the Wnt signaling pathway. Down-regulating β-catenin to increase keratinocyte migration and proliferation is one mechanism by which AS-IV can promote ulcerated wound healing.

  1. Carcinogenicity of the environmental pollutants cyclopenteno-(cd)pyrene and cyclopentano(cd)pyrene in mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Cavalieri, E.; Rogan, E.; Toth, B.; Munhall, A.

    1981-01-01

    Cyclopenteno(cd)pyrene (CPEP) is a widespread environmental pollutant. This hydrocarbon and its 3,4-dihydro derivative, cyclopentano(cd)pyrene (CPAP), were tested on skin in a two-stage initiation-promotion experiment in CD-1 mice and by repeated application in Swiss mice. The biological effect of CPEP and CPAP was compared to that of benzo(a)-pyrene (BP). Nine-week-old female CD-1 mice in groups of 30 were treated every other day over a 20-day period at mini-dose levels of 0.18, 0.06 and 0.02 mumol of CPEP or CPAP in acetone. One group was treated with BP at the low mini-dose level. Initiation was followed by twice weekly application of tetradecanoyl phorbol acetate for 40 weeks. In the second experiments, nine-week-old female Swiss mice in groups of 30 were treated at dose levels of 1.8, 0.6 and 0.2 mumol CPEP or CPAP in acetone twice weekly for 30 weeks. One group was treated with BP at the low dose. CPAP was virtually inactive in both studies. In the initiation-promotion experiment CPEP was inactive at the low dose level, whereas BP exhibited significant tumorigenicity. At the medium and high doses CPEP showed weak, but statistically insignificant, tumorigenic activity. Repeated application of CPEP at the high, medium and low doses resulted in tumor incidences of 23, 37 and 57%, respectively. This reverse dose-response may be due to the relatively high cytotoxicity of CPEP, BP, which was compared to CPEP at the low dose, elicited tumors in 100% of the mice. Most of the CPEP-induced neoplasms were malignant and some metastasized to lungs and lymph nodes. The inactivity of CPAP suggests the carcinogenicity of CPEP is probably due to formation of the ultimate metabolite CPEP 3,4-oxide. In view of the abundance of CPEP in environmental and occupational pollutants, its moderately potent carcinogenicity may represent a potential health hazard.

  2. In vivo relative quantitative proteomics reveals HMGB1 as a downstream mediator of oestrogen-stimulated keratinocyte migration.

    Science.gov (United States)

    Shin, Jung U; Noh, Ji Yeon; Lee, Ju Hee; Lee, Won Jai; Yoo, Jong Shin; Kim, Jin Young; Kim, Hyeran; Jung, Inhee; Jin, Shan; Lee, Kwang Hoon

    2015-06-01

    It is known that oestrogen influences skin wound healing by modulating the inflammatory response, cytokine expression and extracellular matrix deposition; accelerating re-epithelialization; and stimulating angiogenesis. To identify novel proteins associated with effects of oestrogen on keratinocyte, stable isotope labelling by amino acids in cell culture (SILAC)-based mass spectrometry was performed. Using SILAC, quantification of 1085 proteins was achieved. Among these proteins, 60 proteins were upregulated and 32 proteins were downregulated. Among significantly upregulated proteins, high-mobility group protein B1 (HMGB1) has been further evaluated for its role in the effect of oestrogen on keratinocytes. HMGB1 expression was strongly induced in oestrogen-treated keratinocytes in dose- and time-dependent manner. Further, HMGB1 was able to significantly accelerate the rate of HaCaT cell migration. To determine whether HMGB1 is involved in E2-induced HaCaT cell migration, cells were transfected with HMGB1 siRNA. Knockdown of HMGB1 blocked oestrogen-induced keratinocyte migration. Collectively, these experiments demonstrate that HMGB1 is a novel downstream mediator of oestrogen-stimulated keratinocyte migration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Photodynamic therapy using a novel irradiation source, LED lamp, is similarly effective to photodynamic therapy using diode laser or metal-halide lamp on DMBA- and TPA-induced mouse skin papillomas.

    Science.gov (United States)

    Takahashi, Hidetoshi; Nakajima, Susumu; Ogasawara, Koji; Asano, Ryuji; Nakae, Yoshinori; Sakata, Isao; Iizuka, Hajime

    2014-08-01

    Photodynamic therapy (PDT) is useful for superficial skin tumors such as actinic keratosis and Bowen disease. Although PDT is non-surgical and easily-performed treatment modality, irradiation apparatus is large and expensive. Using 7, 12-dimethylbenz[a]anthracene (DMBA) and 12-ο-tetradecanoylphorbol-13-acetate (TPA)-induced mouse skin papilloma model, we compared the efficacy of TONS501- and ALA-PDT with a LED lamp, a diode laser lamp or a metal-halide lamp on the skin tumor regression. TONS501-PDT using 660 nm LED lamp showed anti-tumor effect at 1 day following the irradiation and the maximal anti-tumor effect was observed at 3 days following the irradiation. There was no significant difference in the anti-tumor effects among TONS501-PDT using LED, TONS501-PDT using diode laser, and 5-aminolevulinic acid hydrochloride (ALA)-PDT using metal-halide lamp. Potent anti-tumor effect on DMBA- and TPA-induced mouse skin papilloma was observed by TONS501-PDT using 660 nm LED, which might be more useful for clinical applications. © 2014 Japanese Dermatological Association.

  4. A synthetic peptide blocking TRPV1 activation inhibits UV-induced skin responses.

    Science.gov (United States)

    Kang, So Min; Han, Sangbum; Oh, Jang-Hee; Lee, Young Mee; Park, Chi-Hyun; Shin, Chang-Yup; Lee, Dong Hun; Chung, Jin Ho

    2017-10-01

    Transient receptor potential type 1 (TRPV1) can be activated by ultraviolet (UV) irradiation, and mediates UV-induced matrix metalloproteinase (MMP)-1 and proinflammatory cytokines in keratinocytes. Various chemicals and compounds targeting TRPV1 activation have been developed, but are not in clinical use mostly due to their safety issues. We aimed to develop a novel TRPV1-targeting peptide to inhibit UV-induced responses in human skin. We designed and generated a novel TRPV1 inhibitory peptide (TIP) which mimics the specific site in TRPV1 (aa 701-709: Gln-Arg-Ala-Ile-Thr-Ile-Leu-Asp-Thr, QRAITILDT), Thr 705 , and tested its efficacy of blocking UV-induced responses in HaCaT, mouse, and human skin. TIP effectively inhibited capsaicin-induced calcium influx and TRPV1 activation. Treatment of HaCaT with TIP prevented UV-induced increases of MMP-1 and pro-inflammatory cytokines such as interleukin (IL)-6 and tumor necrosis factor-α. In mouse skin in vivo, TIP inhibited UV-induced skin thickening and prevented UV-induced expression of MMP-13 and MMP-9. Moreover, TIP attenuated UV-induced erythema and the expression of MMP-1, MMP-2, IL-6, and IL-8 in human skin in vivo. The novel synthetic peptide targeting TRPV1 can ameliorate UV-induced skin responses in vitro and in vivo, providing a promising therapeutic approach against UV-induced inflammation and photoaging. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  5. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    Yoshito, Daniele; Almeida, Tiago L.; Santin, Stefany Plumeri; Somessari, Elizabeth S.R.; Silveira, Carlos G. da; Mathor, Monica B.; Altran, Silvana C.; Isaac, Cesar

    2009-01-01

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh -1 ; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  6. In Vivo Assessment of Printed Microvasculature in a Bilayer Skin Graft to Treat Full-Thickness Wounds

    Science.gov (United States)

    Yanez, Maria; Rincon, Julio; Dones, Aracely; De Maria, Carmelo; Gonzales, Raoul

    2015-01-01

    Chronic wounds such as diabetic foot ulcers and venous leg ulcers are common problems in people suffering from type 2 diabetes. These can cause pain, and nerve damage, eventually leading to foot or leg amputation. These types of wounds are very difficult to treat and sometimes take months or even years to heal because of many possible complications during the process. Allogeneic skin grafting has been used to improve wound healing, but the majority of grafts do not survive several days after being implanted. We have been studying the behavior of fibroblasts and keratinocytes in engineered capillary-like endothelial networks. A dermo-epidermal graft has been implanted in an athymic nude mouse model to assess the integration with the host tissue as well as the wound healing process. To build these networks into a skin graft, a modified inkjet printer was used, which allowed the deposit of human microvascular endothelial cells. Neonatal human dermal fibroblast cells and neonatal human epidermal keratinocytes were manually mixed in the collagen matrix while endothelial cells printed. A full-thickness wound was created at the top of the back of athymic nude mice and the area was covered by the bilayered graft. Mice of the different groups were followed until completion of the specified experimental time line, at which time the animals were humanely euthanized and tissue samples were collected. Wound contraction improved by up to 10% when compared with the control groups. Histological analysis showed the neoskin having similar appearance to the normal skin. Both layers, dermis and epidermis, were present with thicknesses resembling normal skin. Immunohistochemistry analysis showed favorable results proving survival of the implanted cells, and confocal images showed the human cells' location in the samples that were collocated with the bilayer printed skin graft. PMID:25051339

  7. Resveratrol prevents oxidative stress-induced senescence and proliferative dysfunction by activating the AMPK-FOXO3 cascade in cultured primary human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yasuo Ido

    Full Text Available The aging process is perceived as resulting from a combination of intrinsic factors such as changes in intracellular signaling and extrinsic factors, most notably environmental stressors. In skin, the relationship between intrinsic changes and keratinocyte function is not clearly understood. Previously, we found that increasing the activity of AMP-activated protein kinase (AMPK suppressed senescence in hydrogen peroxide (H2O2-treated human primary keratinocytes, a model of oxidative stress-induced cellular aging. Using this model in the present study, we observed that resveratrol, an agent that increases the activities of both AMPK and sirtuins, ameliorated two age-associated phenotypes: cellular senescence and proliferative dysfunction. In addition, we found that treatment of keratinocytes with Ex527, a specific inhibitor of sirtuin 1 (SIRT1, attenuated the ability of resveratrol to suppress senescence. In keeping with the latter observation, we noted that compared to non-senescent keratinocytes, senescent cells lacked SIRT1. In addition to these effects on H2O2-induced senescence, resveratrol also prevented the H2O2-induced decrease in proliferation (as indicated by 3H-thymidine incorporation in the presence of insulin. This effect was abrogated by inhibition of AMPK but not SIRT1. Compared to endothelium, we found that human keratinocytes expressed relatively high levels of Forkhead box O3 (FOXO3, a downstream target of both AMPK and SIRT1. Treatment of keratinocytes with resveratrol transactivated FOXO3 and increased the expression of its target genes including catalase. Resveratrol's effects on both senescence and proliferation disappeared when FOXO3 was knocked down. Finally, we performed an exploratory study which showed that skin from humans over 50 years old had lower AMPK activity than skin from individuals under age 20. Collectively, these findings suggest that the effects of resveratrol on keratinocyte senescence and proliferation

  8. Aqueous extract from Vitis vinifera tendrils is able to enrich keratinocyte antioxidant defences.

    Science.gov (United States)

    Fraternale, Daniele; De Bellis, Roberta; Calcabrini, Cinzia; Potenza, Lucia; Cucchiarini, Luigi; Mancini, Umberto; Dachà, Marina; Ricci, Donata

    2011-09-01

    An aqueous extract of V. vinifera L. tendrils was evaluated for its ability to enrich the antioxidant capacity of cultured cells. The long-time antioxidant capability of the extract was measured by in vitro chemical methods, and its influence on reduced glutathione levels and plasma membrane oxido reductase activity was determined in cultured human keratinocytes (NCTC 2544). Keratinocytes are cells normally exposed to oxidative stress, and for this reason adequately equipped with antioxidant defences. However, it has long been suggested that exogenous antioxidants may play an important role in minimizing the adverse effects of oxidative stress on skin.We demonstrated that V. vinifera tendril aqueous extract was able to increase, in a time- and dose-dependent manner, the reduced glutathione concentration and activity of trans plasma membrane oxido reductase as an indirect evaluation of the intracellular redox status of the cells demonstrating a relevant antioxidant activity of this phytocomplex.

  9. Markedly diminished epidermal keratinocyte expression of intercellular adhesion molecule-1 (ICAM-1) in Sezary syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))

    1989-04-21

    In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.

  10. Keratinocyte growth factor mRNA expression in periodontal ligament fibroblasts

    DEFF Research Database (Denmark)

    Dabelsteen, S; Wandall, H H; Grøn, B

    1997-01-01

    Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF mRNA is expres......Keratinocyte growth factor (KGF) is a fibroblast growth factor which mediates epithelial growth and differentiation. KGF is expressed in subepithelial fibroblasts, but generally not in fibroblasts of deep connective tissue, such as fascia and ligaments. Here we demonstrate that KGF m......RNA is expressed in periodontal ligament fibroblasts, and that the expression is increased upon serum stimulation. Fibroblasts from human periodontal ligament, from buccal mucosa, from gingiva, and from skin were established from explants. Alkaline phosphatase activity was used as an indicator of the periodontal...

  11. The porcine skin associated T-cell homing chemokine CCL27: molecular cloning and mRNA expression in piglets infected experimentally with Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Johnsen, C. K.; Jensen, Annette Nygaard; Ahrens, P.

    2003-01-01

    CCL27 (also named CTACK, ALP, ILC and ESkine) is a CC chemokine primarily expressed by keratinocytes of the skin. The cognate receptor of CCL27 named CCR10 (GPR-2), is also expressed in skin-derived cells, and in addition by a subset of peripheral blood T-cells and in a variety of other tissues....... In this paper, we report the cloning of porcine CCL27 cDNA and investigation of CCL27 mRNA expression in Staphylococcus hyicus infected piglets. At the protein level, 77 and 74% homology was found to human and mouse CCL27 sequences, respectively. The results of the expression analyses show that CCL27 m...

  12. Polycyclic aromatic hydrocarbons as skin carcinogens: Comparison of benzo[a]pyrene, dibenzo[def,p]chrysene and three environmental mixtures in the FVB/N mouse

    International Nuclear Information System (INIS)

    Siddens, Lisbeth K.; Larkin, Andrew; Krueger, Sharon K.; Bradfield, Christopher A.; Waters, Katrina M.; Tilton, Susan C.; Pereira, Cliff B.; Löhr, Christiane V.; Arlt, Volker M.; Phillips, David H.; Williams, David E.

    2012-01-01

    The polycyclic aromatic hydrocarbon (PAH), benzo[a]pyrene (BaP), was compared to dibenzo[def,p]chrysene (DBC) and combinations of three environmental PAH mixtures (coal tar, diesel particulate and cigarette smoke condensate) using a two stage, FVB/N mouse skin tumor model. DBC (4 nmol) was most potent, reaching 100% tumor incidence with a shorter latency to tumor formation, less than 20 weeks of 12-O-tetradecanoylphorbol-13-acetate (TPA) promotion compared to all other treatments. Multiplicity was 4 times greater than BaP (400 nmol). Both PAHs produced primarily papillomas followed by squamous cell carcinoma and carcinoma in situ. Diesel particulate extract (1 mg SRM 1650b; mix 1) did not differ from toluene controls and failed to elicit a carcinogenic response. Addition of coal tar extract (1 mg SRM 1597a; mix 2) produced a response similar to BaP. Further addition of 2 mg of cigarette smoke condensate (mix 3) did not alter the response with mix 2. PAH-DNA adducts measured in epidermis 12 h post initiation and analyzed by 32 P post‐labeling, did not correlate with tumor incidence. PAH‐dependent alteration in transcriptome of skin 12 h post initiation was assessed by microarray. Principal component analysis (sum of all treatments) of the 922 significantly altered genes (p < 0.05), showed DBC and BaP to cluster distinct from PAH mixtures and each other. BaP and mixtures up-regulated phase 1 and phase 2 metabolizing enzymes while DBC did not. The carcinogenicity with DBC and two of the mixtures was much greater than would be predicted based on published Relative Potency Factors (RPFs). -- Highlights: ► Dibenzo[def,p]chrysene (DBC), 3 PAH mixtures, benzo[a]pyrene (BaP) were compared. ► DBC and 2 PAH mixtures were more potent than Relative Potency Factor estimates. ► Transcriptome profiles 12 hours post initiation were analyzed by microarray. ► Principle components analysis of alterations revealed treatment-based clustering. ► DBC gave a unique pattern of

  13. Polycyclic aromatic hydrocarbons as skin carcinogens: Comparison of benzo[a]pyrene, dibenzo[def,p]chrysene and three environmental mixtures in the FVB/N mouse

    Energy Technology Data Exchange (ETDEWEB)

    Siddens, Lisbeth K.; Larkin, Andrew [Department of Environmental and Molecular Toxicology, Oregon State University (United States); Superfund Research Center, Oregon State University (United States); Krueger, Sharon K. [Superfund Research Center, Oregon State University (United States); The Linus Pauling Institute, Oregon State University (United States); Bradfield, Christopher A. [McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706 (United States); Waters, Katrina M.; Tilton, Susan C. [Superfund Research Center, Oregon State University (United States); Computational Biology and Bioinformatics Group, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Pereira, Cliff B. [Superfund Research Center, Oregon State University (United States); Deptartment of Statistics, Oregon State University, Corvallis, OR 97331 (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); Löhr, Christiane V. [Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Arlt, Volker M.; Phillips, David H. [Analytical and Environmental Sciences Division, MRC-HPA Centre for Environment and Health, King' s College London, London SE1 9NH (United Kingdom); Williams, David E., E-mail: david.williams@oregonstate.edu [Department of Environmental and Molecular Toxicology, Oregon State University (United States); Superfund Research Center, Oregon State University (United States); The Linus Pauling Institute, Oregon State University (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); and others

    2012-11-01

    The polycyclic aromatic hydrocarbon (PAH), benzo[a]pyrene (BaP), was compared to dibenzo[def,p]chrysene (DBC) and combinations of three environmental PAH mixtures (coal tar, diesel particulate and cigarette smoke condensate) using a two stage, FVB/N mouse skin tumor model. DBC (4 nmol) was most potent, reaching 100% tumor incidence with a shorter latency to tumor formation, less than 20 weeks of 12-O-tetradecanoylphorbol-13-acetate (TPA) promotion compared to all other treatments. Multiplicity was 4 times greater than BaP (400 nmol). Both PAHs produced primarily papillomas followed by squamous cell carcinoma and carcinoma in situ. Diesel particulate extract (1 mg SRM 1650b; mix 1) did not differ from toluene controls and failed to elicit a carcinogenic response. Addition of coal tar extract (1 mg SRM 1597a; mix 2) produced a response similar to BaP. Further addition of 2 mg of cigarette smoke condensate (mix 3) did not alter the response with mix 2. PAH-DNA adducts measured in epidermis 12 h post initiation and analyzed by {sup 32}P post‐labeling, did not correlate with tumor incidence. PAH‐dependent alteration in transcriptome of skin 12 h post initiation was assessed by microarray. Principal component analysis (sum of all treatments) of the 922 significantly altered genes (p < 0.05), showed DBC and BaP to cluster distinct from PAH mixtures and each other. BaP and mixtures up-regulated phase 1 and phase 2 metabolizing enzymes while DBC did not. The carcinogenicity with DBC and two of the mixtures was much greater than would be predicted based on published Relative Potency Factors (RPFs). -- Highlights: ► Dibenzo[def,p]chrysene (DBC), 3 PAH mixtures, benzo[a]pyrene (BaP) were compared. ► DBC and 2 PAH mixtures were more potent than Relative Potency Factor estimates. ► Transcriptome profiles 12 hours post initiation were analyzed by microarray. ► Principle components analysis of alterations revealed treatment-based clustering. ► DBC gave a unique

  14. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  15. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  16. Tissue-engineered skin preserving the potential of epithelial cells to differentiate into hair after grafting.

    Science.gov (United States)

    Larouche, Danielle; Cuffley, Kristine; Paquet, Claudie; Germain, Lucie

    2011-03-01

    The aim of this study was to evaluate whether tissue-engineered skin produced in vitro was able to sustain growth of hair follicles in vitro and after grafting. Different tissues were designed. Dissociated newborn mouse keratinocytes or newborn mouse hair buds (HBs) were added onto dermal constructs consisting of a tissue-engineered cell-derived matrix elaborated from either newborn mouse or adult human fibroblasts cultured with ascorbic acid. After 7-21 days of maturation at the air-liquid interface, no hair was noticed in vitro. Epidermal differentiation was observed in all tissue-engineered skin. However, human fibroblast-derived tissue-engineered dermis (hD) promoted a thicker epidermis than mouse fibroblast-derived tissue-engineered dermis (mD). In association with mD, HBs developed epithelial cyst-like inclusions presenting outer root sheath-like attributes. In contrast, epidermoid cyst-like inclusions lined by a stratified squamous epithelium were present in tissues composed of HBs and hD. After grafting, pilo-sebaceous units formed and hair grew in skin elaborated from HBs cultured 10-26 days submerged in culture medium in association with mD. However, the number of normal hair follicles decreased with longer culture time. This hair-forming capacity after grafting was not observed in tissues composed of hD overlaid with HBs. These results demonstrate that epithelial stem cells can be kept in vitro in a permissive tissue-engineered dermal environment without losing their potential to induce hair growth after grafting.

  17. Continuous manganese delivery via osmotic pumps for manganese-enhanced mouse MRI does not impair spatial learning but leads to skin ulceration.

    Science.gov (United States)

    Vousden, Dulcie A; Cox, Elizabeth; Allemang-Grand, Rylan; Laliberté, Christine; Qiu, Lily R; Lindenmaier, Zsuzsa; Nieman, Brian J; Lerch, Jason P

    2018-06-01

    Manganese-enhanced magnetic resonance imaging (MEMRI) is a widely used technique in rodent neuroimaging studies. Traditionally, Mn 2+ is delivered to animals via a systemic injection; however, this can lead to toxic effects at high doses. Recent studies have shown that subcutaneously implanted mini-osmotic pumps can be used to continuously deliver manganese chloride (MnCl 2 ), and that they produce satisfactory contrast while circumventing many of the toxic side effects. However, neither the time-course of signal enhancement nor the effect of continuous Mn 2+ delivery on behaviour, particularly learning and memory, have been well-characterized. Here, we investigated the effect of MnCl 2 dose and route of administration on a) spatial learning in the Morris Water Maze and b) tissue signal enhancement in the mouse brain. Even as early as 3 days after pump implantation, infusion of 25-50 mg/kg/day MnCl 2 via osmotic pump produced signal enhancement as good as or better than that achieved 24 h after a single 50 mg/kg intraperitoneal injection. Neither route of delivery nor MnCl 2 dose adversely affected spatial learning and memory on the water maze. However, especially at higher doses, mice receiving MnCl 2 via osmotic pumps developed skin ulceration which limited the imaging window. With these findings, we provide recommendations for route and dose of MnCl 2 to use for different study designs. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Sustained phenotypic reversion of junctional epidermolysis bullosa dog keratinocytes: Establishment of an immunocompetent animal model for cutaneous gene therapy

    International Nuclear Information System (INIS)

    Spirito, Flavia; Capt, Annabelle; Rio, Marcela Del; Larcher, Fernando; Guaguere, Eric; Danos, Olivier; Meneguzzi, Guerrino

    2006-01-01

    Gene transfer represents the unique therapeutic issue for a number of inherited skin disorders including junctional epidermolysis bullosa (JEB), an untreatable genodermatose caused by mutations in the adhesion ligand laminin 5 (α3β3γ2) that is secreted in the extracellular matrix by the epidermal basal keratinocytes. Because gene therapy protocols require validation in animal models, we have phenotypically reverted by oncoretroviral transfer of the curative gene the keratinocytes isolated from dogs with a spontaneous form of JEB associated with a genetic mutation in the α3 chain of laminin 5. We show that the transduced dog JEB keratinocytes: (1) display a sustained secretion of laminin 5 in the extracellular matrix; (2) recover the adhesion, proliferation, and clonogenic capacity of wild-type keratinocytes; (3) generate fully differentiated stratified epithelia that after grafting on immunocompromised mice produce phenotypically normal skin and sustain permanent expression of the transgene. We validate an animal model that appears particularly suitable to demonstrate feasibility, efficacy, and safety of genetic therapeutic strategies for cutaneous disorders before undertaking human clinical trials

  19. Redistribution of melanosomal complexes within keratinocytes following UV-A irradiation

    International Nuclear Information System (INIS)

    Lavker, R.M.; Kaidbey, K.H.

    1982-01-01

    In contrast to other ultraviolet (UV) wavelengths, UV-A can induce long-term or 'true' pigmentation rapidly with little or no latency. The response cannot be clearly separated from immediate pigment darkening and is too rapid in onset to be explained by neomelanogenesis. In order to investigate possible mechanisms for this phenomenon, UV-irradiated skin was examined microscopically and ultrastructurally 18 h postirradiation. Specimens from skin sites tanned by exposure to melanogenic doses of UV-A showed a paradoxical reduction in the degree of basal melanization by light microscopy compared to unirradiated skin. Ultrastructurally, there was migration and dispersion of packaged melanosomes within keratinocytes from their normal, aggregated location around the nucleus towards the periphery of the cell. These changes were not observed in specimens exposed to melanogenic doses of UV-B. We propose that UV-A wavelengths can selectively cause redistribution of melanin-laden organelles within human keratinocytes in vivo and that this phenomenon accounts for the visually observed hyperpigmentation that develops soon after single exposures to these wavelengths. Dispersion of melanosomal complexes may be another mechanism by which UV-radiation (UVR) can induce tanning in human skin. (orig.)

  20. Redistribution of melanosomal complexes within keratinocytes following UV-A irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Lavker, R.M.; Kaidbey, K.H.

    1982-03-01

    In contrast to other ultraviolet (UV) wavelengths, UV-A can induce long-term or 'true' pigmentation rapidly with little or no latency. The response cannot be clearly separated from immediate pigment darkening and is too rapid in onset to be explained by neomelanogenesis. In order to investigate possible mechanisms for this phenomenon, UV-irradiated skin was examined microscopically and ultrastructurally 18 h postirradiation. Specimens from skin sites tanned by exposure to melanogenic doses of UV-A showed a paradoxical reduction in the degree of basal melanization by light microscopy compared to unirradiated skin. Ultrastructurally, there was migration and dispersion of packaged melanosomes within keratinocytes from their normal, aggregated location around the nucleus towards the periphery of the cell. These changes were not observed in specimens exposed to melanogenic doses of UV-B. We propose that UV-A wavelengths can selectively cause redistribution of melanin-laden organelles within human keratinocytes in vivo and that this phenomenon accounts for the visually observed hyperpigmentation that develops soon after single exposures to these wavelengths. Dispersion of melanosomal complexes may be another mechanism by which UV-radiation (UVR) can induce tanning in human skin.

  1. Ultraviolet Radiation Increases the Toxicity of Pyrene, 1-Aminopyrene and 1-Hydroxypyrene to Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Huey-Min Hwang

    2005-04-01

    Full Text Available Over the past several years, a great deal of interest has been focused on the harmful effects of ultraviolet (UV radiation to human skin. UV light has been implicated in aging, sunburn and skin cancer. Few studies, however, have been done to determine the effects that UV light, in conjunction with other environmental contaminants, may have on human skin. Polycyclic Aromatic Hydrocarbons (PAHs are a class of compounds that have been reported to be toxic, mutagenic and carcinogenic to many eukaryotic organisms. UV light is also known to increase the toxicity of PAHs through photo-activation and photo-modification. The purpose of this study was to assess the effects of UV-A irradiated pyrene (Pyr, 1-aminopyrene (1-AP and 1-hydroxypyrene (1-HP on human keratinocytes, the skin primary site of UV irradiated PAH exposure. Our findings indicate that simultaneous treatment of human keratinocyte cell line, HaCaT, with 1.0μg/ml pyrene, 1-AP or 1-HP and 3.9 J/cm2/min UV-A light resulted in significant inhibition of cell proliferation. Approximately 100% of the cells died in the case of UV-A irradiated 1-AP and 1-HP. In the case of UV-A irradiated pyrene, more than 70% of the cells died, indicating that UV-A is able to transform these PAHs into more harmful intermediates.

  2. Cytochrome P450 1b1 in polycyclic aromatic hydrocarbon (PAH)-induced skin carcinogenesis: Tumorigenicity of individual PAHs and coal-tar extract, DNA adduction and expression of select genes in the Cyp1b1 knockout mouse

    Energy Technology Data Exchange (ETDEWEB)

    Siddens, Lisbeth K. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Bunde, Kristi L. [College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Harper, Tod A. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); McQuistan, Tammie J. [Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); Löhr, Christiane V. [Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Bramer, Lisa M. [Applied Statistics and Computational Modeling, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Waters, Katrina M. [Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Biological Sciences Division, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Tilton, Susan C. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Krueger, Sharon K. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); and others

    2015-09-01

    FVB/N mice wild-type, heterozygous or null for Cyp 1b1 were used in a two-stage skin tumor study comparing PAH, benzo[a]pyrene (BaP), dibenzo[def,p]chrysene (DBC), and coal tar extract (CTE, SRM 1597a). Following 20 weeks of promotion with TPA the Cyp 1b1 null mice, initiated with DBC, exhibited reductions in incidence, multiplicity, and progression. None of these effects were observed with BaP or CTE. The mechanism of Cyp 1b1-dependent alteration of DBC skin carcinogenesis was further investigated by determining expression of select genes in skin from DBC-treated mice 2, 4 and 8 h post-initiation. A significant reduction in levels of Cyp 1a1, Nqo1 at 8 h and Akr 1c14 mRNA was observed in Cyp 1b1 null (but not wt or het) mice, whereas no impact was observed in Gst a1, Nqo 1 at 2 and 4 h or Akr 1c19 at any time point. Cyp 1b1 mRNA was not elevated by DBC. The major covalent DNA adducts, dibenzo[def,p]chrysene-(±)-11,12-dihydrodiol-cis and trans-13,14-epoxide-deoxyadenosine (DBCDE-dA) were quantified by UHPLC-MS/MS 8 h post-initiation. Loss of Cyp1 b1 expression reduced DBCDE-dA adducts in the skin but not to a statistically significant degree. The ratio of cis- to trans-DBCDE-dA adducts was higher in the skin than other target tissues such as the spleen, lung and liver (oral dosing). These results document that Cyp 1b1 plays a significant role in bioactivation and carcinogenesis of DBC in a two-stage mouse skin tumor model and that loss of Cyp 1b1 has little impact on tumor response with BaP or CTE as initiators. - Highlights: • Cyp1b1 null mice exhibit lower skin cancer sensitivity to DBC but not BaP or CTE. • Cyp1b1 expression impacts expression of other PAH metabolizing enzymes. • cis/trans-DBCDE-dA ratio significantly higher in the skin than the spleen, lung or liver • Potency of DBC and CTE in mouse skin is higher than predicted by RPFs.

  3. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  4. UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

    Science.gov (United States)

    Kraemer, Anne; Chen, I-Peng; Henning, Stefan; Faust, Alexandra; Volkmer, Beate; Atkinson, Michael J.; Moertl, Simone; Greinert, Ruediger

    2013-01-01

    MicroRNA (miRNA)-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2), which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis. PMID:24391759

  5. Sulfur mustard induces an endoplasmic reticulum stress response in the mouse ear vesicant model

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Yoke-Chen; Wang, James D. [Rutgers University, Pharmacology and Toxicology, 170 Frelinghuysen Rd, Piscataway, NJ 08854 (United States); Svoboda, Kathy K. [Texas A and M University, Baylor College of Dentistry, Center for Craniofacial Research 3302 Gaston Ave, Dallas, Texas 75246 (United States); Casillas, Robert P. [MRIGlobal, 425 Volker Boulevard, Kansas City, MO 64110 (United States); Laskin, Jeffrey D. [UMDNJ-Robert Wood Johnson Medical School, Environmental and Occupational Medicine, 170 Frelinghuysen Rd, Piscataway, NJ 08854 (United States); Gordon, Marion K. [Rutgers University, Pharmacology and Toxicology, 170 Frelinghuysen Rd, Piscataway, NJ 08854 (United States); Gerecke, Donald R., E-mail: gerecke@eohsi.rutgers.edu [Rutgers University, Pharmacology and Toxicology, 170 Frelinghuysen Rd, Piscataway, NJ 08854 (United States)

    2013-04-15

    The endoplasmic reticulum (ER) stress response is a cell survival pathway upregulated when cells are under severe stress. Severely damaged mouse ear skin exposed to the vesicant, sulfur mustard (bis-2-chloroethyl sulfide, SM), resulted in increased expression of ER chaperone proteins that accompany misfolded and incorrectly made proteins targeted for degradation. Time course studies with SM using the mouse ear vesicant model (MEVM) showed progressive histopathologic changes including edema, separation of the epidermis from the dermis, persistent inflammation, upregulation of laminin γ2 (one of the chains of laminin-332, a heterotrimeric skin glycoprotein required for wound repair), and delayed wound healing from 24 h to 168 h post exposure. This was associated with time related increased expression of the cell survival ER stress marker, GRP78/BiP, and the ER stress apoptosis marker, GADD153/CHOP, suggesting simultaneous activation of both cell survival and non-mitochondrial apoptosis pathways. Dual immunofluorescence labeling of a keratinocyte migration promoting protein, laminin γ2 and GRP78/BIP, showed colocalization of the two molecules 72 h post exposure indicating that the laminin γ2 was misfolded after SM exposure and trapped within the ER. Taken together, these data show that ER stress is induced in mouse skin within 24 h of vesicant exposure in a defensive response to promote cell survival; however, it appears that this response is rapidly overwhelmed by the apoptotic pathway as a consequence of severe SM-induced injury. - Highlights: ► We demonstrated ER stress response in the mouse ear vesicant model. ► We described the asymmetrical nature of wound repair in the MEVM. ► We identified the distribution of various ER stress markers in the MEVM.

  6. Aplicação de substituto de pele em oncologia cutânea: estudo experimental com derme acelular e ceratinócitos cultivados Application of skin substitutes in skin oncology: experimental study using acellular dermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    José Anselmo Lofêgo Filho

    2008-02-01

    Full Text Available FUNDAMENTOS: As neoplasias malignas da pele de grandes dimensões apresentam dificuldades de reconstrução após a excisão. OBJETIVO: O objetivo deste estudo foi avaliar a exeqüibilidade de uma nova proposta de cobertura para feridas cirúrgicas criadas após a ressecção de grandes tumores cutâneos, a combinação da derme acelular humana com epitélio autólogo cultivado. MÉTODOS: A aplicação dos substitutos de pele foi feita em quatro pacientes com área de implante variando de 33 a 120 cm2. Além da observação dos resultados clínicos, realizou-se estudo morfológico para avaliação da integração dos implantes. RESULTADOS: Ceratinócitos autólogos cultivados foram enxertados em dois pacientes e não demonstraram integração. A derme acelular foi aplicada em quatro pacientes, sendo que em um deles foram feitas duas aplicações. Dos cinco implantes de derme acelular realizados, dois não apresentaram integração, em dois a integração foi de 70%, e de 50% no último. CONCLUSÃO: A cobertura imediata e definitiva de defeitos cirúrgicos através da aplicação de derme acelular humana combinada com epitélio autólogo cultivado é exeqüível. Em oncologia cutânea apenas em situações especiais o uso de substitutos de pele pode ser conveniente no sentido de evitar reconstruções mais complexas.BACKGROUND: Reconstruction difficulties may arise after excision of large malignant skin neoplasms.a OBJECTIVE: The objective of this study was to assess the feasibility of a new coverage for surgical wounds following resection of large skin tumors: a combination of human acellular dermis with cultured autologous epithelium. METHODS: The skin substitute was implanted in four patients, one of them received two implants and the area ranged from 33 to 120 cm2. Clinical results and morphologic studies were assessed as to implant integration. RESULTS: Cultured autologous epithelium was grafted in two patients and no integration was

  7. Stress-induced NQO1 controls stability of C/EBPα against 20S proteasomal degradation to regulate p63 expression with implications in protection against chemical-induced skin cancer.

    Science.gov (United States)

    Patrick, B A; Jaiswal, A K

    2012-10-04

    Previously, we have shown a role of cytosolic NAD(P)H:quinone oxidoreductase 1 (NQO1) in the stabilization of p63 against 20S proteasomal degradation resulting in thinning of the epithelium and chemical-induced skin cancer (Oncogene (2011) 30, 1098-1107). Current studies have demonstrated that NQO1 control of CCAAT-enhancer binding protein (C/EBPα) against 20S proteasomal degradation also contributes to the upregulation of p63 expression and protection. Western and immunohistochemistry analysis revealed that disruption of the NQO1 gene in mice and mouse keratinocytes led to degradation of C/EBPα and loss of p63 gene expression. p63 promoter mutagenesis, transfection and chromatin immunoprecipitation assays identified a C/EBPα-binding site between nucleotide position -185 and -174 that bound to C/EBPα and upregulated p63 gene expression. Co-immunoprecipitation and immunoblot analysis demonstrated that 20S proteasomes directly interacted and degraded C/EBPα. NQO1 direct interaction with C/EBPα led to stabilization of C/EBPα against 20S proteasomal degradation. NQO1 protection of C/EBPα required binding of NADH with NQO1. Exposure of skin and keratinocytes to the chemical stress agent benzo(a)pyrene led to induction of NQO1 and stabilization of C/EBPα protein, resulting in an increase in p63 RNA and protein in wild-type but not in NQO1-/- mice. Collectively, the current data combined with previous data suggest that stress induction of NQO1 through both stabilization of C/EBPα and increase in p63 and direct stabilization of p63 controls keratinocyte differentiation, leading to protection against chemical-induced skin carcinogenesis. The studies are significant as 2-4% human individuals are homozygous and 23% are heterozygous for the NQO1P187S mutation and might be susceptible to stress-induced skin diseases.

  8. Virulence Inhibitors from Brazilian Peppertree Block Quorum Sensing and Abate Dermonecrosis in Skin Infection Models

    Science.gov (United States)

    Muhs, Amelia; Lyles, James T.; Parlet, Corey P.; Nelson, Kate; Kavanaugh, Jeffery S.; Horswill, Alexander R.; Quave, Cassandra L.

    2017-01-01

    Widespread antibiotic resistance is on the rise and current therapies are becoming increasingly limited in both scope and efficacy. Methicillin-resistant Staphylococcus aureus (MRSA) represents a major contributor to this trend. Quorum sensing controlled virulence factors include secreted toxins responsible for extensive damage to host tissues and evasion of the immune system response; they are major contributors to morbidity and mortality. Investigation of botanical folk medicines for wounds and infections led us to study Schinus terebinthifolia (Brazilian Peppertree) as a potential source of virulence inhibitors. Here, we report the inhibitory activity of a flavone rich extract “430D-F5” against all S. aureus accessory gene regulator (agr) alleles in the absence of growth inhibition. Evidence for this activity is supported by its agr-quenching activity (IC50 2–32 μg mL−1) in transcriptional reporters, direct protein outputs (α-hemolysin and δ-toxin), and an in vivo skin challenge model. Importantly, 430D-F5 was well tolerated by human keratinocytes in cell culture and mouse skin in vivo; it also demonstrated significant reduction in dermonecrosis following skin challenge with a virulent strain of MRSA. This study provides an explanation for the anti-infective activity of peppertree remedies and yields insight into the potential utility of non-biocide virulence inhibitors in treating skin infections. PMID:28186134

  9. A novel DLX3–PKC integrated signaling network drives keratinocyte differentiation

    Science.gov (United States)

    Palazzo, Elisabetta; Kellett, Meghan D; Cataisson, Christophe; Bible, Paul W; Bhattacharya, Shreya; Sun, Hong-wei; Gormley, Anna C; Yuspa, Stuart H; Morasso, Maria I

    2017-01-01

    Epidermal homeostasis relies on a well-defined transcriptional control of keratinocyte proliferation and differentiation, which is critical to prevent skin diseases such as atopic dermatitis, psoriasis or cancer. We have recently shown that the homeobox transcription factor DLX3 and the tumor suppressor p53 co-regulate cell cycle-related signaling and that this mechanism is functionally involved in cutaneous squamous cell carcinoma development. Here we show that DLX3 expression and its downstream signaling depend on protein kinase C α (PKCα) activity in skin. We found that following 12-O-tetradecanoyl-phorbol-13-acetate (TPA) topical treatment, DLX3 expression is significantly upregulated in the epidermis and keratinocytes from mice overexpressing PKCα by transgenic targeting (K5-PKCα), resulting in cell cycle block and terminal differentiation. Epidermis lacking DLX3 (DLX3cKO), which is linked to the development of a DLX3-dependent epidermal hyperplasia with hyperkeratosis and dermal leukocyte recruitment, displays enhanced PKCα activation, suggesting a feedback regulation of DLX3 and PKCα. Of particular significance, transcriptional activation of epidermal barrier, antimicrobial peptide and cytokine genes is significantly increased in DLX3cKO skin and further increased by TPA-dependent PKC activation. Furthermore, when inhibiting PKC activity, we show that epidermal thickness, keratinocyte proliferation and inflammatory cell infiltration are reduced and the PKC-DLX3-dependent gene expression signature is normalized. Independently of PKC, DLX3 expression specifically modulates regulatory networks such as Wnt signaling, phosphatase activity and cell adhesion. Chromatin immunoprecipitation sequencing analysis of primary suprabasal keratinocytes showed binding of DLX3 to the proximal promoter regions of genes associated with cell cycle regulation, and of structural proteins and transcription factors involved in epidermal differentiation. These results indicate

  10. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    International Nuclear Information System (INIS)

    Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo

    2014-01-01

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive fe