WorldWideScience

Sample records for mouse enabled homologue

  1. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  2. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  3. Mouse Homologue of the Schizophrenia Susceptibility Gene ZNF804A as a Target of Hoxc8

    Directory of Open Access Journals (Sweden)

    Hyun Joo Chung

    2010-01-01

    Full Text Available Using a ChIP-cloning technique, we identified a Zinc finger protein 804a (Zfp804a as one of the putative Hoxc8 downstream target genes. We confirmed binding of Hoxc8 to an intronic region of Zfp804a by ChIP-PCR in F9 cells as well as in mouse embryos. Hoxc8 upregulated Zfp804a mRNA levels and augmented minimal promoter activity in vitro. In E11.5 mouse embryos, Zfp804a and Hoxc8 were coexpressed. Recent genome-wide studies identified Zfp804a (or ZNF804A in humans as a plausible marker for schizophrenia, leading us to hypothesize that this embryogenic regulatory control might also exert influence in development of complex traits such as psychosis.

  4. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  5. Structural domains required for channel function of the mouse transient receptor potential protein homologue TRP1beta.

    Science.gov (United States)

    Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen

    2002-07-17

    Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.

  6. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  7. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole

    2003-01-01

    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  8. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  9. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  10. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  11. Chemical Cocktails Enable Hepatic Reprogramming of Mouse Fibroblasts with a Single Transcription Factor

    Directory of Open Access Journals (Sweden)

    Ren Guo

    2017-08-01

    Full Text Available Liver or hepatocytes transplantation is limited by the availability of donor organs. Functional hepatocytes independent of the donor sources may have wide applications in regenerative medicine and the drug industry. Recent studies have demonstrated that chemical cocktails may induce reprogramming of fibroblasts into a range of functional somatic cells. Here, we show that mouse fibroblasts can be transdifferentiated into the hepatocyte-like cells (iHeps using only one transcription factor (TF (Foxa1, Foxa2, or Foxa3 plus a chemical cocktail. These iHeps show typical epithelial morphology, express multiple hepatocyte-specific genes, and acquire hepatocyte functions. Genetic lineage tracing confirms the fibroblast origin of these iHeps. More interestingly, these iHeps are expandable in vitro and can reconstitute the damaged hepatic tissues of the fumarylacetoacetate hydrolase-deficient (Fah−/− mice. Our study provides a strategy to generate functional hepatocyte-like cells by using a single TF plus a chemical cocktail and is one step closer to generate the full-chemical iHeps.

  12. Usage of adenovirus expressing thymidine kinase mediated hepatocellular damage for enabling mouse liver repopulation with allogenic or xenogenic hepatocytes.

    Directory of Open Access Journals (Sweden)

    Daniel Moreno

    Full Text Available It has been shown that the liver of immunodeficient mice can be efficiently repopulated with human hepatocytes when subjected to chronic hepatocellular damage. Mice with such chimeric livers represent useful reagents for medical and clinical studies. However all previously reported models of humanized livers are difficult to implement as they involve cross-breeding of immunodeficient mice with mice exhibiting genetic alterations causing sustained hepatic injury. In this paper we attempted to create chimeric livers by inducing persistent hepatocellular damage in immunodeficient Rag2(-/- γc(-/- mice using an adenovirus encoding herpes virus thymidine kinase (AdTk and two consecutive doses of ganciclovir (GCV. We found that this treatment resulted in hepatocellular damage persisting for at least 10 weeks and enabled efficient engraftment and proliferation within the liver of either human or allogenic hepatocytes. Interestingly, while the nodules generated from the transplanted mouse hepatocytes were well vascularized, the human hepatocytes experienced progressive depolarization and exhibited reduced numbers of murine endothelial cells inside the nodules. In conclusion, AdTk/GCV-induced liver damage licenses the liver of immunodeficient mice for allogenic and xenogenic hepatocyte repopulation. This approach represents a simple alternative strategy for chimeric liver generation using immunodeficient mice without additional genetic manipulation of the germ line.

  13. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  14. μCT of ex-vivo stained mouse hearts and embryos enables a precise match between 3D virtual histology, classical histology and immunochemistry

    Science.gov (United States)

    Larsson, Emanuel; Martin, Sabine; Lazzarini, Marcio; Tromba, Giuliana; Missbach-Guentner, Jeannine; Pinkert-Leetsch, Diana; Katschinski, Dörthe M.; Alves, Frauke

    2017-01-01

    The small size of the adult and developing mouse heart poses a great challenge for imaging in preclinical research. The aim of the study was to establish a phosphotungstic acid (PTA) ex-vivo staining approach that efficiently enhances the x-ray attenuation of soft-tissue to allow high resolution 3D visualization of mouse hearts by synchrotron radiation based μCT (SRμCT) and classical μCT. We demonstrate that SRμCT of PTA stained mouse hearts ex-vivo allows imaging of the cardiac atrium, ventricles, myocardium especially its fibre structure and vessel walls in great detail and furthermore enables the depiction of growth and anatomical changes during distinct developmental stages of hearts in mouse embryos. Our x-ray based virtual histology approach is not limited to SRμCT as it does not require monochromatic and/or coherent x-ray sources and even more importantly can be combined with conventional histological procedures. Furthermore, it permits volumetric measurements as we show for the assessment of the plaque volumes in the aortic valve region of mice from an ApoE-/- mouse model. Subsequent, Masson-Goldner trichrome staining of paraffin sections of PTA stained samples revealed intact collagen and muscle fibres and positive staining of CD31 on endothelial cells by immunohistochemistry illustrates that our approach does not prevent immunochemistry analysis. The feasibility to scan hearts already embedded in paraffin ensured a 100% correlation between virtual cut sections of the CT data sets and histological heart sections of the same sample and may allow in future guiding the cutting process to specific regions of interest. In summary, since our CT based virtual histology approach is a powerful tool for the 3D depiction of morphological alterations in hearts and embryos in high resolution and can be combined with classical histological analysis it may be used in preclinical research to unravel structural alterations of various heart diseases. PMID:28178293

  15. Planar cell polarity enables posterior localization of nodal cilia and left-right axis determination during mouse and Xenopus embryogenesis.

    Directory of Open Access Journals (Sweden)

    Dragana Antic

    2010-02-01

    Full Text Available Left-right asymmetry in vertebrates is initiated in an early embryonic structure called the ventral node in human and mouse, and the gastrocoel roof plate (GRP in the frog. Within these structures, each epithelial cell bears a single motile cilium, and the concerted beating of these cilia produces a leftward fluid flow that is required to initiate left-right asymmetric gene expression. The leftward fluid flow is thought to result from the posterior tilt of the cilia, which protrude from near the posterior portion of each cell's apical surface. The cells, therefore, display a morphological planar polarization. Planar cell polarity (PCP is manifested as the coordinated, polarized orientation of cells within epithelial sheets, or as directional cell migration and intercalation during convergent extension. A set of evolutionarily conserved proteins regulates PCP. Here, we provide evidence that vertebrate PCP proteins regulate planar polarity in the mouse ventral node and in the Xenopus gastrocoel roof plate. Asymmetric anterior localization of VANGL1 and PRICKLE2 (PK2 in mouse ventral node cells indicates that these cells are planar polarized by a conserved molecular mechanism. A weakly penetrant Vangl1 mutant phenotype suggests that compromised Vangl1 function may be associated with left-right laterality defects. Stronger functional evidence comes from the Xenopus GRP, where we show that perturbation of VANGL2 protein function disrupts the posterior localization of motile cilia that is required for leftward fluid flow, and causes aberrant expression of the left side-specific gene Nodal. The observation of anterior-posterior PCP in the mouse and in Xenopus embryonic organizers reflects a strong evolutionary conservation of this mechanism that is important for body plan determination.

  16. AAV-PHP.B-Mediated Global-Scale Expression in the Mouse Nervous System Enables GBA1 Gene Therapy for Wide Protection from Synucleinopathy.

    Science.gov (United States)

    Morabito, Giuseppe; Giannelli, Serena G; Ordazzo, Gabriele; Bido, Simone; Castoldi, Valerio; Indrigo, Marzia; Cabassi, Tommaso; Cattaneo, Stefano; Luoni, Mirko; Cancellieri, Cinzia; Sessa, Alessandro; Bacigaluppi, Marco; Taverna, Stefano; Leocani, Letizia; Lanciego, José L; Broccoli, Vania

    2017-12-06

    The lack of technology for direct global-scale targeting of the adult mouse nervous system has hindered research on brain processing and dysfunctions. Currently, gene transfer is normally achieved by intraparenchymal viral injections, but these injections target a restricted brain area. Herein, we demonstrated that intravenous delivery of adeno-associated virus (AAV)-PHP.B viral particles permeated and diffused throughout the neural parenchyma, targeting both the central and the peripheral nervous system in a global pattern. We then established multiple procedures of viral transduction to control gene expression or inactivate gene function exclusively in the adult nervous system and assessed the underlying behavioral effects. Building on these results, we established an effective gene therapy strategy to counteract the widespread accumulation of α-synuclein deposits throughout the forebrain in a mouse model of synucleinopathy. Transduction of A53T-SCNA transgenic mice with AAV-PHP.B-GBA1 restored physiological levels of the enzyme, reduced α-synuclein pathology, and produced significant behavioral recovery. Finally, we provided evidence that AAV-PHP.B brain penetration does not lead to evident dysfunctions in blood-brain barrier integrity or permeability. Altogether, the AAV-PHP.B viral platform enables non-invasive, widespread, and long-lasting global neural expression of therapeutic genes, such as GBA1, providing an invaluable approach to treat neurodegenerative diseases with diffuse brain pathology such as synucleinopathies. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  17. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  18. Utrophin Compensates dystrophin Loss during Mouse Spermatogenesis

    OpenAIRE

    Chen, Hung-Chih; Chin, Yu-Feng; Lundy, David J.; Liang, Chung-Tiang; Chi, Ya-Hui; Kuo, Paolin; Hsieh, Patrick C. H.

    2017-01-01

    Duchenne muscular dystrophy (DMD) is an X-linked genetic disorder resulting from mutations in the dystrophin gene. The mdx/utrn ?/? mouse, lacking in both dystrophin and its autosomal homologue utrophin, is commonly used to model the clinical symptoms of DMD. Interestingly, these mice are infertile but the mechanisms underlying this phenomenon remain unclear. Using dystrophin deficient mdx mouse and utrophin haplodeficient mdx/utrn +/? mouse models, we demonstrate the contribution of Dp427 (f...

  19. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  20. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  1. Adaptive-optics SLO imaging combined with widefield OCT and SLO enables precise 3D localization of fluorescent cells in the mouse retina.

    Science.gov (United States)

    Zawadzki, Robert J; Zhang, Pengfei; Zam, Azhar; Miller, Eric B; Goswami, Mayank; Wang, Xinlei; Jonnal, Ravi S; Lee, Sang-Hyuck; Kim, Dae Yu; Flannery, John G; Werner, John S; Burns, Marie E; Pugh, Edward N

    2015-06-01

    Adaptive optics scanning laser ophthalmoscopy (AO-SLO) has recently been used to achieve exquisite subcellular resolution imaging of the mouse retina. Wavefront sensing-based AO typically restricts the field of view to a few degrees of visual angle. As a consequence the relationship between AO-SLO data and larger scale retinal structures and cellular patterns can be difficult to assess. The retinal vasculature affords a large-scale 3D map on which cells and structures can be located during in vivo imaging. Phase-variance OCT (pv-OCT) can efficiently image the vasculature with near-infrared light in a label-free manner, allowing 3D vascular reconstruction with high precision. We combined widefield pv-OCT and SLO imaging with AO-SLO reflection and fluorescence imaging to localize two types of fluorescent cells within the retinal layers: GFP-expressing microglia, the resident macrophages of the retina, and GFP-expressing cone photoreceptor cells. We describe in detail a reflective afocal AO-SLO retinal imaging system designed for high resolution retinal imaging in mice. The optical performance of this instrument is compared to other state-of-the-art AO-based mouse retinal imaging systems. The spatial and temporal resolution of the new AO instrumentation was characterized with angiography of retinal capillaries, including blood-flow velocity analysis. Depth-resolved AO-SLO fluorescent images of microglia and cone photoreceptors are visualized in parallel with 469 nm and 663 nm reflectance images of the microvasculature and other structures. Additional applications of the new instrumentation are discussed.

  2. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  3. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  4. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  5. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  6. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  7. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  8. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  9. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  10. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  11. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  12. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  13. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  14. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  15. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  16. Mouse adhalin

    DEFF Research Database (Denmark)

    Liu, L; Vachon, P H; Kuang, W

    1997-01-01

    . To analyze the biological roles of adhalin, we cloned the mouse adhalin cDNA, raised peptide-specific antibodies to its cytoplasmic domain, and examined its expression and localization in vivo and in vitro. The mouse adhalin sequence was 80% identical to that of human, rabbit, and hamster. Adhalin...... was specifically expressed in striated muscle cells and their immediate precursors, and absent in many other cell types. Adhalin expression in embryonic mouse muscle was coincident with primary myogenesis. Its expression was found to be up-regulated at mRNA and protein levels during myogenic differentiation...

  17. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  18. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  19. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  20. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  1. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  2. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  3. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  4. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  5. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  6. Optimization of the virtual mouse HeadMouse to foster its classroom use by children with physical disabilities

    Directory of Open Access Journals (Sweden)

    Merce TEIXIDO

    2014-03-01

    Full Text Available This paper presents the optimization of a virtual mouse called HeadMouse in order to foster its classroom use by children with physical disabilities. HeadMouse is an absolute virtual mouse that converts head movements in cursor displacement and facial gestures in click actions. The virtual mouse combines different image processing algorithms: face detection, pattern matching and optical flow in order to emulate the behaviour of a conventional computer mouse. The original implementation of HeadMouse requires large computational power and this paper proposes specific optimizations in order to enable its use by children with disabilities in standard low cost classroom computers.

  7. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  8. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  9. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  10. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  11. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  12. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  13. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  14. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  15. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  16. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  17. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  18. Organising to Enable Innovation

    DEFF Research Database (Denmark)

    Brink, Tove

    2016-01-01

    The purpose of this conceptual paper is to reveal how organising can enable innovation across organisational layers and organisational units. This approach calls for a cross-disciplinary literature review. The aim is to provide an integrated understanding of innovation in an organisational approach....... The findings reveal a continous organising process between individual/ team creativity and organisational structures/control to enable innovation at firm level. Organising provides a dynamic approach and contains the integrated reconstruction of creativity, structures and boundaries for enhanced balance...... of explorative and exploitative learning in uncertain environments. Shedding light on the cross-disciplinary theories to organise innovation provides a contribution at the firm level to enable innovation....

  19. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  20. Prox1 Inhibits Proliferation and Is Required for Differentiation of the Oligodendrocyte Cell Lineage in the Mouse.

    Directory of Open Access Journals (Sweden)

    Kentaro Kato

    Full Text Available Central nervous system injury induces a regenerative response in ensheathing glial cells comprising cell proliferation, spontaneous axonal remyelination, and limited functional recovery, but the molecular mechanisms are not fully understood. In Drosophila, this involves the genes prospero and Notch controlling the balance between glial proliferation and differentiation, and manipulating their levels in glia can switch the response to injury from prevention to promotion of repair. In the mouse, Notch1 maintains NG2 oligodendrocyte progenitor cells (OPCs in a progenitor state, but what factor may enable oligodendrocyte (OL differentiation and functional remyelination is not understood. Here, we asked whether the mammalian homologue of prospero, Prox1, is involved. Our data show that Prox1 is distributed in NG2+ OPCs and in OLs in primary cultured cells, and in the mouse spinal cord in vivo. siRNA prox1 knockdown in primary OPCs increased cell proliferation, increased NG2+ OPC cell number and decreased CC1+ OL number. Prox1 conditional knockout in the OL cell lineage in mice increased NG2+ OPC cell number, and decreased CC1+ OL number. Lysolecithin-induced demyelination injury caused a reduction in CC1+ OLs in homozygous Prox1-/- conditional knockout mice compared to controls. Remarkably, Prox1-/- conditional knockout mice had smaller lesions than controls. Altogether, these data show that Prox1 is required to inhibit OPC proliferation and for OL differentiation, and could be a relevant component of the regenerative glial response. Therapeutic uses of glia and stem cells to promote regeneration and repair after central nervous system injury would benefit from manipulating Prox1.

  1. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  2. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  3. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  4. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  5. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  6. The Mouse That Soared

    Science.gov (United States)

    2004-09-01

    diameter of about 12 miles. Their formation is associated with a Type II supernova, the collapse and subsequent explosion of a massive star. The origin of a pulsar's high velocity is not known, but many astrophysicists suspect that it is directly related to the explosive circumstances involved in the birth of the pulsar. The rapid rotation and strong magnetic field of a pulsar can generate a wind of high-energy matter and antimatter particles that rush out at near the speed of light. These pulsar winds create large, magnetized bubbles of high-energy particles called pulsar wind nebulae. The X-ray and radio data on the Mouse have enabled Gaensler and his colleagues to constrain the properties of the ambient gas, to estimate the velocity of the pulsar, and to analyze the structure of the various shock waves created by the pulsar, the flow of particles away from the pulsar, and the magnetic field in the nebula. Zoom into Chandra's Image of the Mouse Zoom into Chandra's Image of the Mouse Other members of the research team were Eric van der Swaluw (FOM Institute of Physics, The Netherlands), Fernando Camilo (Columbia Univ., New York), Vicky Kaspi (McGill Univ., Montreal), Frederick K. Baganoff (MIT, Cambridge, Mass.), Farhad Yusef-Zadeh (Northwestern), and Richard Manchester (Australia Telescope National Facility). The pulsar in the Mouse was originally detected by Camilo et al. in 2002 using Australia's Parkes radio telescope. Chandra observed the Mouse on October 23 and 24, 2002. NASA's Marshall Space Flight Center, Huntsville, Ala., manages the Chandra program for NASA's Office of Space Science, Washington. Northrop Grumman of Redondo Beach, Calif., formerly TRW, Inc., was the prime development contractor for the observatory. The Smithsonian Astrophysical Observatory controls science and flight operations from the Chandra X-ray Center in Cambridge, Mass. Additional information and images are available at: http://chandra.harvard.edu and http://chandra.nasa.gov

  7. The Nordic Housing Enabler

    DEFF Research Database (Denmark)

    Helle, Tina; Slaug, Bjørn; Brandt, Åse

    2010-01-01

    This study addresses development of a content valid cross-Nordic version of the Housing Enabler and investigation of its inter-rater reliability when used in occupational therapy rating situations, involving occupational therapists, clients and their home environments. The instrument was translated...... from the original Swedish version of the Housing Enabler, and adapted according to accessibility norms and guidelines for housing design in Sweden, Denmark, Finland and Iceland. This iterative process involved occupational therapists, architects, building engineers and professional translators......, resulting in the Nordic Housing Enabler. For reliability testing, the sampling strategy and data collection procedures used were the same in all countries. Twenty voluntary occupational therapists, pair-wise but independently from each other, collected data from 106 cases by means of the Nordic Housing...

  8. Pilot project as enabler?

    DEFF Research Database (Denmark)

    Neisig, Margit; Glimø, Helle; Holm, Catrine Granzow

    This article deals with a systemic perspective on transition. The field of study addressed is a pilot project as enabler of transition in a highly complex polycentric context. From a Luhmannian systemic approach, a framework is created to understand and address barriers of change occurred using...... pilot projects as enabler of transition. Aspects of how to create trust and deal with distrust during a transition are addressed. The transition in focus is the concept of New Public Management and how it is applied in the management of the Employment Service in Denmark. The transition regards...

  9. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  10. Enabling distributed collaborative science

    DEFF Research Database (Denmark)

    Hudson, T.; Sonnenwald, Diane H.; Maglaughlin, K.

    2000-01-01

    To enable collaboration over distance, a collaborative environment that uses a specialized scientific instrument called a nanoManipulator is evaluated. The nanoManipulator incorporates visualization and force feedback technology to allow scientists to see, feel, and modify biological samples bein...

  11. The Nordic Housing Enabler

    DEFF Research Database (Denmark)

    Helle, T.; Nygren, C.; Slaug, B.

    2014-01-01

    This study addresses development of a content-valid cross-Nordic version of the Housing Enabler and investigation of its inter-rater reliability when used in occupational therapy rating situations, involving occupational therapists, clients, and their home environments. The instrument was transla......This study addresses development of a content-valid cross-Nordic version of the Housing Enabler and investigation of its inter-rater reliability when used in occupational therapy rating situations, involving occupational therapists, clients, and their home environments. The instrument...... was translated from the original Swedish version of the Housing Enabler, and adapted according to accessibility norms and guidelines for housing design in Sweden, Denmark, Finland, and Iceland. This iterative process involved occupational therapists, architects, building engineers, and professional translators......, resulting in the Nordic Housing Enabler. For reliability testing, the sampling strategy and data collection procedures used were the same in all countries. Twenty voluntary occupational therapists, pair-wise but independently of each other, collected data from 106 cases by means of the Nordic Housing...

  12. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  13. Spatially enabled land administration

    DEFF Research Database (Denmark)

    Enemark, Stig

    2006-01-01

    enabling of land administration systems managing tenure, valuation, planning, and development will allow the information generated by these activities to be much more useful. Also, the services available to private and public sectors and to community organisations should commensurably improve. Knowledge....... In other words: Good governance and sustainable development is not attainable without sound land administration or - more broadly – sound land management. The paper presents a land management vision that incorporates the benefits of ICT enabled land administration functions. The idea is that spatial...... the communication between administrative systems and also establish more reliable data due to the use the original data instead of copies. In Denmark, such governmental guidelines for a service-oriented ITarchitecture in support of e-government are recently adopted. Finally, the paper presents the role of FIG...

  14. Nordic Housing Enabler

    DEFF Research Database (Denmark)

    Helle, Tina; Brandt, Åse

    Development and reliability testing of the Nordic Housing Enabler – an instrument for accessibility assessment of the physical housing. Tina Helle & Åse Brandt University of Lund, Health Sciences, Faculty of Medicine (SE) and University College Northern Jutland, Occupational Therapy department (DK......). Danish Centre for Assistive Technology. Abstract. For decades, accessibility to the physical housing environment for people with functional limitations has been of interest politically, professionally and for the users. Guidelines and norms on accessible housing design have gradually been developed......, however, the built environment shows serious deficits when it comes to accessibility. This study addresses development of a content valid cross-Nordic version of the Housing Enabler and investigation of inter-rater reliability, when used in occupational therapy practice. The instrument was translated from...

  15. Enabling Wind Power Nationwide

    Energy Technology Data Exchange (ETDEWEB)

    Jose Zayas, Michael Derby, Patrick Gilman and Shreyas Ananthan,

    2015-05-01

    Leveraging this experience, the U.S. Department of Energy’s (DOE’s) Wind and Water Power Technologies Office has evaluated the potential for wind power to generate electricity in all 50 states. This report analyzes and quantifies the geographic expansion that could be enabled by accessing higher above ground heights for wind turbines and considers the means by which this new potential could be responsibly developed.

  16. Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse

    Directory of Open Access Journals (Sweden)

    Green Carla B

    2001-05-01

    Full Text Available Abstract Background Nocturnin was originally identified by differential display as a circadian clock regulated gene with high expression at night in photoreceptors of the African clawed frog, Xenopus laevis. Although encoding a novel protein, the nocturnin cDNA had strong sequence similarity with a C-terminal domain of the yeast transcription factor CCR4, and with mouse and human ESTs. Since its original identification others have cloned mouse and human homologues of nocturnin/CCR4, and we have cloned a full-length cDNA from mouse retina, along with partial cDNAs from human, cow and chicken. The goal of this study was to determine the temporal pattern of nocturnin mRNA expression in multiple tissues of the mouse. Results cDNA sequence analysis revealed a high degree of conservation among vertebrate nocturnin/CCR4 homologues along with a possible homologue in Drosophila. Northern analysis of mRNA in C3H/He and C57/Bl6 mice revealed that the mNoc gene is expressed in a broad range of tissues, with greatest abundance in liver, kidney and testis. mNoc is also expressed in multiple brain regions including suprachiasmatic nucleus and pineal gland. Furthermore, mNoc exhibits circadian rhythmicity of mRNA abundance with peak levels at the time of light offset in the retina, spleen, heart, kidney and liver. Conclusion The widespread expression and rhythmicity of mNoc mRNA parallels the widespread expression of other circadian clock genes in mammalian tissues, and suggests that nocturnin plays an important role in clock function or as a circadian clock effector.

  17. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  18. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  19. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  20. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  1. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  2. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  3. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  4. EnableATIS strategy assessment.

    Science.gov (United States)

    2014-02-01

    Enabling Advanced Traveler Information Systems (EnableATIS) is the traveler information component of the Dynamic Mobility Application (DMA) program. The objective of : the EnableATIS effort is to foster transformative traveler information application...

  5. Enabling Digital Literacy

    DEFF Research Database (Denmark)

    Ryberg, Thomas; Georgsen, Marianne

    2010-01-01

    There are some tensions between high-level policy definitions of “digital literacy” and actual teaching practice. We need to find workable definitions of digital literacy; obtain a better understanding of what digital literacy might look like in practice; and identify pedagogical approaches, which...... support teachers in designing digital literacy learning. We suggest that frameworks such as Problem Based Learning (PBL) are approaches that enable digital literacy learning because they provide good settings for engaging with digital literacy. We illustrate this through analysis of a case. Furthermore......, these operate on a meso-level mediating between high-level concepts of digital literacy and classroom practice....

  6. CtOS Enabler

    OpenAIRE

    Crespo Cepeda, Rodrigo; El Yamri El Khatibi, Meriem; Carrera García, Juan Manuel

    2015-01-01

    Las Smart Cities son, indudablemente, el futuro próximo de la tecnología al que nos acercamos cada día, lo que se puede observar en la abundancia de dispositivos móviles entre la población, que informatizan la vida cotidiana mediante el uso de la geolocalización y la información. Pretendemos unir estos dos ámbitos con CtOS Enabler para crear un estándar de uso que englobe todos los sistemas de Smart Cities y facilite a los desarrolladores de dicho software la creación de nuevas herramientas. ...

  7. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  8. Smart Grid Enabled EVSE

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    2015-01-12

    The combined team of GE Global Research, Federal Express, National Renewable Energy Laboratory, and Consolidated Edison has successfully achieved the established goals contained within the Department of Energy’s Smart Grid Capable Electric Vehicle Supply Equipment funding opportunity. The final program product, shown charging two vehicles in Figure 1, reduces by nearly 50% the total installed system cost of the electric vehicle supply equipment (EVSE) as well as enabling a host of new Smart Grid enabled features. These include bi-directional communications, load control, utility message exchange and transaction management information. Using the new charging system, Utilities or energy service providers will now be able to monitor transportation related electrical loads on their distribution networks, send load control commands or preferences to individual systems, and then see measured responses. Installation owners will be able to authorize usage of the stations, monitor operations, and optimally control their electricity consumption. These features and cost reductions have been developed through a total system design solution.

  9. Centralized mouse repositories.

    Science.gov (United States)

    Donahue, Leah Rae; Hrabe de Angelis, Martin; Hagn, Michael; Franklin, Craig; Lloyd, K C Kent; Magnuson, Terry; McKerlie, Colin; Nakagata, Naomi; Obata, Yuichi; Read, Stuart; Wurst, Wolfgang; Hörlein, Andreas; Davisson, Muriel T

    2012-10-01

    Because the mouse is used so widely for biomedical research and the number of mouse models being generated is increasing rapidly, centralized repositories are essential if the valuable mouse strains and models that have been developed are to be securely preserved and fully exploited. Ensuring the ongoing availability of these mouse strains preserves the investment made in creating and characterizing them and creates a global resource of enormous value. The establishment of centralized mouse repositories around the world for distributing and archiving these resources has provided critical access to and preservation of these strains. This article describes the common and specialized activities provided by major mouse repositories around the world.

  10. Probiotic Lactobacillus rhamnosus GG prevents alveolar bone loss in a mouse model of experimental periodontitis.

    Science.gov (United States)

    Gatej, Simona M; Marino, Victor; Bright, Richard; Fitzsimmons, Tracy R; Gully, Neville; Zilm, Peter; Gibson, Rachel J; Edwards, Suzanne; Bartold, Peter M

    2018-02-01

    This study investigated the role of Lactobacillus rhamnosus GG (LGG) on bone loss and local and systemic inflammation in an in vivo mouse model of experimental periodontitis (PD). Experimental PD was induced in mice by oral inoculation with Porphyromonas gingivalis and Fusobacterium nucleatum over a period of 44 days. The probiotic LGG was administered via oral inoculation or oral gavage prior to, and during disease induction. The antimicrobial activity of LGG on the inoculum was also tested. Alveolar bone levels and gingival tissue changes were assessed using in vivo microcomputed tomography and histological analysis. Serum levels of mouse homologues for IL-8 were measured using multiplex assays. Pre-treatment with probiotics either via oral gavage or via oral inoculation significantly reduced bone loss (p loss in a mouse model of induced PD irrespective of the mode of administration. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Enabling graphene nanoelectronics.

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Wei; Ohta, Taisuke; Biedermann, Laura Butler; Gutierrez, Carlos; Nolen, C. M.; Howell, Stephen Wayne; Beechem Iii, Thomas Edwin; McCarty, Kevin F.; Ross, Anthony Joseph, III

    2011-09-01

    Recent work has shown that graphene, a 2D electronic material amenable to the planar semiconductor fabrication processing, possesses tunable electronic material properties potentially far superior to metals and other standard semiconductors. Despite its phenomenal electronic properties, focused research is still required to develop techniques for depositing and synthesizing graphene over large areas, thereby enabling the reproducible mass-fabrication of graphene-based devices. To address these issues, we combined an array of growth approaches and characterization resources to investigate several innovative and synergistic approaches for the synthesis of high quality graphene films on technologically relevant substrate (SiC and metals). Our work focused on developing the fundamental scientific understanding necessary to generate large-area graphene films that exhibit highly uniform electronic properties and record carrier mobility, as well as developing techniques to transfer graphene onto other substrates.

  12. Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F. (Harvard Medical School, Boston, MA (USA))

    1988-08-01

    Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

  13. Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

    International Nuclear Information System (INIS)

    Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F.

    1988-01-01

    Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid β precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS

  14. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  15. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  16. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    Energy Technology Data Exchange (ETDEWEB)

    Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  17. Grid-Enabled Measures

    Science.gov (United States)

    Moser, Richard P.; Hesse, Bradford W.; Shaikh, Abdul R.; Courtney, Paul; Morgan, Glen; Augustson, Erik; Kobrin, Sarah; Levin, Kerry; Helba, Cynthia; Garner, David; Dunn, Marsha; Coa, Kisha

    2011-01-01

    Scientists are taking advantage of the Internet and collaborative web technology to accelerate discovery in a massively connected, participative environment —a phenomenon referred to by some as Science 2.0. As a new way of doing science, this phenomenon has the potential to push science forward in a more efficient manner than was previously possible. The Grid-Enabled Measures (GEM) database has been conceptualized as an instantiation of Science 2.0 principles by the National Cancer Institute with two overarching goals: (1) Promote the use of standardized measures, which are tied to theoretically based constructs; and (2) Facilitate the ability to share harmonized data resulting from the use of standardized measures. This is done by creating an online venue connected to the Cancer Biomedical Informatics Grid (caBIG®) where a virtual community of researchers can collaborate together and come to consensus on measures by rating, commenting and viewing meta-data about the measures and associated constructs. This paper will describe the web 2.0 principles on which the GEM database is based, describe its functionality, and discuss some of the important issues involved with creating the GEM database, such as the role of mutually agreed-on ontologies (i.e., knowledge categories and the relationships among these categories— for data sharing). PMID:21521586

  18. Enabling distributed petascale science

    International Nuclear Information System (INIS)

    Baranovski, Andrew; Bharathi, Shishir; Bresnahan, John

    2007-01-01

    Petascale science is an end-to-end endeavour, involving not only the creation of massive datasets at supercomputers or experimental facilities, but the subsequent analysis of that data by a user community that may be distributed across many laboratories and universities. The new SciDAC Center for Enabling Distributed Petascale Science (CEDPS) is developing tools to support this end-to-end process. These tools include data placement services for the reliable, high-performance, secure, and policy-driven placement of data within a distributed science environment; tools and techniques for the construction, operation, and provisioning of scalable science services; and tools for the detection and diagnosis of failures in end-to-end data placement and distributed application hosting configurations. In each area, we build on a strong base of existing technology and have made useful progress in the first year of the project. For example, we have recently achieved order-of-magnitude improvements in transfer times (for lots of small files) and implemented asynchronous data staging capabilities; demonstrated dynamic deployment of complex application stacks for the STAR experiment; and designed and deployed end-to-end troubleshooting services. We look forward to working with SciDAC application and technology projects to realize the promise of petascale science

  19. Enabling immersive simulation.

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Josh (University of California Santa Cruz, Santa Cruz, CA); Mateas, Michael (University of California Santa Cruz, Santa Cruz, CA); Hart, Derek H.; Whetzel, Jonathan; Basilico, Justin Derrick; Glickman, Matthew R.; Abbott, Robert G.

    2009-02-01

    The object of the 'Enabling Immersive Simulation for Complex Systems Analysis and Training' LDRD has been to research, design, and engineer a capability to develop simulations which (1) provide a rich, immersive interface for participation by real humans (exploiting existing high-performance game-engine technology wherever possible), and (2) can leverage Sandia's substantial investment in high-fidelity physical and cognitive models implemented in the Umbra simulation framework. We report here on these efforts. First, we describe the integration of Sandia's Umbra modular simulation framework with the open-source Delta3D game engine. Next, we report on Umbra's integration with Sandia's Cognitive Foundry, specifically to provide for learning behaviors for 'virtual teammates' directly from observed human behavior. Finally, we describe the integration of Delta3D with the ABL behavior engine, and report on research into establishing the theoretical framework that will be required to make use of tools like ABL to scale up to increasingly rich and realistic virtual characters.

  20. Displays enabling mobile multimedia

    Science.gov (United States)

    Kimmel, Jyrki

    2007-02-01

    With the rapid advances in telecommunications networks, mobile multimedia delivery to handsets is now a reality. While a truly immersive multimedia experience is still far ahead in the mobile world, significant advances have been made in the constituent audio-visual technologies to make this become possible. One of the critical components in multimedia delivery is the mobile handset display. While such alternatives as headset-style near-to-eye displays, autostereoscopic displays, mini-projectors, and roll-out flexible displays can deliver either a larger virtual screen size than the pocketable dimensions of the mobile device can offer, or an added degree of immersion by adding the illusion of the third dimension in the viewing experience, there are still challenges in the full deployment of such displays in real-life mobile communication terminals. Meanwhile, direct-view display technologies have developed steadily, and can provide a development platform for an even better viewing experience for multimedia in the near future. The paper presents an overview of the mobile display technology space with an emphasis on the advances and potential in developing direct-view displays further to meet the goal of enabling multimedia in the mobile domain.

  1. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  2. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu

    2010-11-01

    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  3. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Science.gov (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2010-11-01

    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  4. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  5. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  6. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  7. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  8. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  9. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  10. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  11. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  12. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  13. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  16. Enabling cleanup technology transfer

    International Nuclear Information System (INIS)

    Ditmars, J. D.

    2002-01-01

    Technology transfer in the environmental restoration, or cleanup, area has been challenging. While there is little doubt that innovative technologies are needed to reduce the times, risks, and costs associated with the cleanup of federal sites, particularly those of the Departments of Energy (DOE) and Defense, the use of such technologies in actual cleanups has been relatively limited. There are, of course, many reasons why technologies do not reach the implementation phase or do not get transferred from developing entities to the user community. For example, many past cleanup contracts provided few incentives for performance that would compel a contractor to seek improvement via technology applications. While performance-based contracts are becoming more common, they alone will not drive increased technology applications. This paper focuses on some applications of cleanup methodologies and technologies that have been successful and are illustrative of a more general principle. The principle is at once obvious and not widely practiced. It is that, with few exceptions, innovative cleanup technologies are rarely implemented successfully alone but rather are implemented in the context of enabling processes and methodologies. And, since cleanup is conducted in a regulatory environment, the stage is better set for technology transfer when the context includes substantive interactions with the relevant stakeholders. Examples of this principle are drawn from Argonne National Laboratory's experiences in Adaptive Sampling and Analysis Programs (ASAPs), Precise Excavation, and the DOE Technology Connection (TechCon) Program. The lessons learned may be applicable to the continuing challenges posed by the cleanup and long-term stewardship of radioactive contaminants and unexploded ordnance (UXO) at federal sites

  17. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  18. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  19. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  20. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  2. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  4. FOILFEST :community enabled security.

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Judy Hennessey; Johnson, Curtis Martin; Whitley, John B.; Drayer, Darryl Donald; Cummings, John C., Jr. (.,; .)

    2005-09-01

    The Advanced Concepts Group of Sandia National Laboratories hosted a workshop, ''FOILFest: Community Enabled Security'', on July 18-21, 2005, in Albuquerque, NM. This was a far-reaching look into the future of physical protection consisting of a series of structured brainstorming sessions focused on preventing and foiling attacks on public places and soft targets such as airports, shopping malls, hotels, and public events. These facilities are difficult to protect using traditional security devices since they could easily be pushed out of business through the addition of arduous and expensive security measures. The idea behind this Fest was to explore how the public, which is vital to the function of these institutions, can be leveraged as part of a physical protection system. The workshop considered procedures, space design, and approaches for building community through technology. The workshop explored ways to make the ''good guys'' in public places feel safe and be vigilant while making potential perpetrators of harm feel exposed and convinced that they will not succeed. Participants in the Fest included operators of public places, social scientists, technology experts, representatives of government agencies including DHS and the intelligence community, writers and media experts. Many innovative ideas were explored during the fest with most of the time spent on airports, including consideration of the local airport, the Albuquerque Sunport. Some provocative ideas included: (1) sniffers installed in passage areas like revolving door, escalators, (2) a ''jumbotron'' showing current camera shots in the public space, (3) transparent portal screeners allowing viewing of the screening, (4) a layered open/funnel/open/funnel design where open spaces are used to encourage a sense of ''communitas'' and take advantage of citizen ''sensing'' and funnels are technological

  5. The Virtual Mouse Brain: A Computational Neuroinformatics Platform to Study Whole Mouse Brain Dynamics.

    Science.gov (United States)

    Melozzi, Francesca; Woodman, Marmaduke M; Jirsa, Viktor K; Bernard, Christophe

    2017-01-01

    Connectome-based modeling of large-scale brain network dynamics enables causal in silico interrogation of the brain's structure-function relationship, necessitating the close integration of diverse neuroinformatics fields. Here we extend the open-source simulation software The Virtual Brain (TVB) to whole mouse brain network modeling based on individual diffusion magnetic resonance imaging (dMRI)-based or tracer-based detailed mouse connectomes. We provide practical examples on how to use The Virtual Mouse Brain (TVMB) to simulate brain activity, such as seizure propagation and the switching behavior of the resting state dynamics in health and disease. TVMB enables theoretically driven experimental planning and ways to test predictions in the numerous strains of mice available to study brain function in normal and pathological conditions.

  6. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  7. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  8. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  9. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  10. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  11. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  12. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  13. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  14. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  15. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  16. Restoring efficiency of hemopoietic cell transplantation in a mouse lethally irradiated by a total exposure to X rays

    International Nuclear Information System (INIS)

    Doria, Gino

    1959-10-01

    This research thesis reports the study of possibility of treatments (or restoration) of a mouse which has been submitted to a lethal dose of X rays. More particularly, the author compared the restoring efficiency of bone marrow and fetal liver injected in a mouse which had been lethally irradiated by a total exposure to X rays. He also studied the functional status of the hemopoietic graft, and the emergence of the secondary disease in mice which had been as well lethally irradiated and then restored by injection of bone marrow and fetal liver. The author then addressed the influence of the induction of immune tolerance of the host with respect to the donor on the survival of a mouse lethally irradiated and restored by homologue bone marrow [fr

  17. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  18. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  19. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  20. X-irradiation improves mdx mouse muscle as a model of myofiber loss in DMD

    International Nuclear Information System (INIS)

    Wakeford, S.; Watt, D.J.; Partridge, T.A.

    1991-01-01

    The mdx mouse, although a genetic and biochemical homologue of human Duchenne muscular dystrophy (DMD), presents a comparatively mild histopathological and clinical phenotype. These differences are partially attributable to the greater efficacy of regeneration in the mdx mouse than in DMD muscle. To lessen this disparity, we have used a single dose of X-irradiation (16 Gy) to inhibit regeneration in one leg of mdx mice. The result is an almost complete block of muscle fiber regeneration leading to progressive loss of muscle fibers and their replacement by loose connective tissue. Surviving fibers are mainly peripherally nucleated and, surprisingly, of large diameter. Thus, X-irradiation converts mdx muscle to a model system in which the degenerative process can be studied in isolation from the complicating effect of myofiber regeneration. This system should be of use for testing methods of alleviating the myofiber degeneration which is common to mdx and DMD

  1. X-irradiation improves mdx mouse muscle as a model of myofiber loss in DMD

    Energy Technology Data Exchange (ETDEWEB)

    Wakeford, S.; Watt, D.J.; Partridge, T.A. (Charing Cross and Westminster Medical School, London (England))

    1991-01-01

    The mdx mouse, although a genetic and biochemical homologue of human Duchenne muscular dystrophy (DMD), presents a comparatively mild histopathological and clinical phenotype. These differences are partially attributable to the greater efficacy of regeneration in the mdx mouse than in DMD muscle. To lessen this disparity, we have used a single dose of X-irradiation (16 Gy) to inhibit regeneration in one leg of mdx mice. The result is an almost complete block of muscle fiber regeneration leading to progressive loss of muscle fibers and their replacement by loose connective tissue. Surviving fibers are mainly peripherally nucleated and, surprisingly, of large diameter. Thus, X-irradiation converts mdx muscle to a model system in which the degenerative process can be studied in isolation from the complicating effect of myofiber regeneration. This system should be of use for testing methods of alleviating the myofiber degeneration which is common to mdx and DMD.

  2. Geo-Enabled, Mobile Services

    DEFF Research Database (Denmark)

    Jensen, Christian Søndergaard

    2006-01-01

    We are witnessing the emergence of a global infrastructure that enables the widespread deployment of geo-enabled, mobile services in practice. At the same time, the research community has also paid increasing attention to data management aspects of mobile services. This paper offers me...

  3. Gaze beats mouse

    DEFF Research Database (Denmark)

    Mateo, Julio C.; San Agustin, Javier; Hansen, John Paulin

    2008-01-01

    Facial EMG for selection is fast, easy and, combined with gaze pointing, it can provide completely hands-free interaction. In this pilot study, 5 participants performed a simple point-and-select task using mouse or gaze for pointing and a mouse button or a facial-EMG switch for selection. Gaze...

  4. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  5. Toward genome-enabled mycology.

    Science.gov (United States)

    Hibbett, David S; Stajich, Jason E; Spatafora, Joseph W

    2013-01-01

    Genome-enabled mycology is a rapidly expanding field that is characterized by the pervasive use of genome-scale data and associated computational tools in all aspects of fungal biology. Genome-enabled mycology is integrative and often requires teams of researchers with diverse skills in organismal mycology, bioinformatics and molecular biology. This issue of Mycologia presents the first complete fungal genomes in the history of the journal, reflecting the ongoing transformation of mycology into a genome-enabled science. Here, we consider the prospects for genome-enabled mycology and the technical and social challenges that will need to be overcome to grow the database of complete fungal genomes and enable all fungal biologists to make use of the new data.

  6. Decerebrate mouse model for studies of the spinal cord circuits

    DEFF Research Database (Denmark)

    Meehan, Claire Francesca; Mayr, Kyle A; Manuel, Marin

    2017-01-01

    The adult decerebrate mouse model (a mouse with the cerebrum removed) enables the study of sensory-motor integration and motor output from the spinal cord for several hours without compromising these functions with anesthesia. For example, the decerebrate mouse is ideal for examining locomotor be......, which is ample time to perform most short-term procedures. These protocols can be modified for those interested in cardiovascular or respiratory function in addition to motor function and can be performed by trainees with some previous experience in animal surgery....

  7. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  8. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  9. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  10. Computer Security Systems Enable Access.

    Science.gov (United States)

    Riggen, Gary

    1989-01-01

    A good security system enables access and protects information from damage or tampering, but the most important aspects of a security system aren't technical. A security procedures manual addresses the human element of computer security. (MLW)

  11. How GNSS Enables Precision Farming

    Science.gov (United States)

    2014-12-01

    Precision farming: Feeding a Growing Population Enables Those Who Feed the World. Immediate and Ongoing Needs - population growth (more to feed) - urbanization (decrease in arable land) Double food production by 2050 to meet world demand. To meet thi...

  12. Mouse Genome Informatics (MGI)

    Data.gov (United States)

    U.S. Department of Health & Human Services — MGI is the international database resource for the laboratory mouse, providing integrated genetic, genomic, and biological data to facilitate the study of human...

  13. Mouse Phenome Database (MPD)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Mouse Phenome Database (MPD) has characterizations of hundreds of strains of laboratory mice to facilitate translational discoveries and to assist in selection...

  14. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  15. An X-linked homologue of the autosomal inprinted gene ZNF127 escapes X inactivation

    Energy Technology Data Exchange (ETDEWEB)

    Longstreet, M.; Nicholls, R.D.; Willard, H.F. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others

    1994-09-01

    The ZNF127 gene has been shown to be subject to parental imprinting in both humans and the mouse and maps to within the Prader-Willi/Angelman Syndrome critical region on chromosome 15. We have cloned two X-linked related loci, one of which, ZNFXp is a transcribed gene while the other, ZNFXq, is an untranscribed pseudogene. ZNFXp is 83.6% identical to ZNFXq and 65.4% identical to ZNF127 over 1.4 kb of open reading frame they share in common, Like ZNF127, the predicted protein sequence of ZNFXp contains a C{sub 3}HC{sub 4} zinc finger domain and C{sub 3}H zinc finger-like motifs. Whereas ZNF127 has three C{sub 3}H motifs, ZNFXp has four. A strong CpG island is located within 1 kb 5{prime} of the predicted amino terminus of ZNFXp. Expression of ZNFXp has been detected from mouse/human somatic cell hybrids containing either an active (n=2) or an inactive (n=4) chromosome, and thus escapes X inactivation. Probes made from the 3{prime} UTR of ZNFXp detect a number of related loci in both human and murine DNA, none of which is the ZNF127 locus on chromosome 15. None of the detectable murine bands shows dosage differences between males and females as would be expected for X-linked loci. This raises the possibility that ZNFXp inserted into the human X chromosome after its divergence from a common ancestor with the murine X. We have mapped ZNFXp to Xp11.4 by Southern blotting and PCR of hybrid DNAs and by fluorescence in situ hybridization (FISH). ZNFXq maps within the X Inactivation Center (XIC) region on Xq13.2, approximately 300 kb distal to the XIST gene. We find it intriguing, and perhaps significant, that two members of this gene family are subject to epigenetic regulation -- one autosomal imprinting, and the other escape from X inactivation. These results could imply an evolutionary and mechanistic relationship between these two processes.

  16. OGC® Sensor Web Enablement Standards

    Directory of Open Access Journals (Sweden)

    George Percivall

    2006-09-01

    Full Text Available This article provides a high-level overview of and architecture for the Open Geospatial Consortium (OGC standards activities that focus on sensors, sensor networks, and a concept called the “Sensor Web”. This OGC work area is known as Sensor Web Enablement (SWE. This article has been condensed from "OGC® Sensor Web Enablement: Overview And High Level Architecture," an OGC White Paper by Mike Botts, PhD, George Percivall, Carl Reed, PhD, and John Davidson which can be downloaded from http://www.opengeospatial.org/pt/15540. Readers interested in greater technical and architecture detail can download and read the OGC SWE Architecture Discussion Paper titled “The OGC Sensor Web Enablement Architecture” (OGC document 06-021r1, http://www.opengeospatial.org/pt/14140.

  17. Characterization of mouse neuro-urological dynamics in a novel decerebrate arterially perfused mouse (DAPM) preparation

    OpenAIRE

    Ito, Hiroki; Drake, Marcus J.; Fry, Christopher H.; Kanai, Anthony J.; Pickering, Anthony E.

    2018-01-01

    Aim To develop the decerebrate arterially perfused mouse (DAPM) preparation, a novel voiding model of the lower urinary tract (LUT) that enables in vitro-like access with in vivo-like neural connectivity. Methods Adult male mice were decerebrated and arterially perfused with a carbogenated, Ringer's solution to establish the DAPM. To allow distinction between central and peripheral actions of interventions, experiments were conducted in both the DAPM and in a “pithed” DAPM which has no brains...

  18. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  19. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  20. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  1. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  2. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  3. Understanding sex determination in the mouse: genetics ...

    Indian Academy of Sciences (India)

    challenge now is to understand how controlled epigenomic changes effect the now familiar sexually dimorphic transcriptomic profiles of the ... Cattanach, personal communication, April 2015. .... The human homologue, DMRT1, is found on.

  4. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  5. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  6. Immunostimulatory mouse granuloma protein.

    Science.gov (United States)

    Fontan, E; Fauve, R M; Hevin, B; Jusforgues, H

    1983-10-01

    Earlier studies have shown that from subcutaneous talc-induced granuloma in mice, a fraction could be extracted that fully protected mice against Listeria monocytogenes. Using standard biochemical procedures--i.e., ammonium sulfate fractionation, preparative electrophoresis, gel filtration chromatography, isoelectric focusing, and preparative polyacrylamide gel electrophoresis--we have now purified an active factor to homogeneity. A single band was obtained in NaDodSO4/polyacrylamide gel with an apparent Mr of 55,000. It migrated with alpha 1-globulins and the isoelectric point was 5 +/- 0.1. The biological activity was destroyed with Pronase but not with trypsin and a monospecific polyclonal rabbit antiserum was obtained. The intravenous injection of 5 micrograms of this "mouse granuloma protein" fully protects mice against a lethal inoculum of L. monocytogenes. Moreover, after their incubation with 10 nM mouse granuloma protein, mouse peritoneal cells became cytostatic against Lewis carcinoma cells.

  7. Burn mouse models

    DEFF Research Database (Denmark)

    Calum, Henrik; Høiby, Niels; Moser, Claus

    2014-01-01

    Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6 % third-degree b......Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6 % third...... with infected burn wound compared with the burn wound only group. The burn mouse model resembles the clinical situation and provides an opportunity to examine or develop new strategies like new antibiotics and immune therapy, in handling burn wound victims much....

  8. Organizational Enablers for Project Governance

    DEFF Research Database (Denmark)

    Müller, Ralf; Shao, Jingting; Pemsel, Sofia

    and their relationships to organizational success. Based on these results, the authors discovered that organizational enablers (including key factors such as leadership, governance, and influence of project managers) have a critical impact on how organizations operate, adapt to market fluctuations and forces, and make......While corporate culture plays a significant role in the success of any corporation, governance and “governmentality” not only determine how business should be conducted, but also define the policies and procedures organizations follow to achieve business functions and goals. In their book......, Organizational Enablers for Project Governance, Ralf Müller, Jingting Shao, and Sofia Pemsel examine the interaction of governance and governmentality in various types of companies and demonstrate how these factors drive business success and influence project work, efficiency, and profitability. The data...

  9. 'Ethos' Enabling Organisational Knowledge Creation

    Science.gov (United States)

    Matsudaira, Yoshito

    This paper examines knowledge creation in relation to improvements on the production line in the manufacturing department of Nissan Motor Company and aims to clarify embodied knowledge observed in the actions of organisational members who enable knowledge creation will be clarified. For that purpose, this study adopts an approach that adds a first, second, and third-person's viewpoint to the theory of knowledge creation. Embodied knowledge, observed in the actions of organisational members who enable knowledge creation, is the continued practice of 'ethos' (in Greek) founded in Nissan Production Way as an ethical basis. Ethos is knowledge (intangible) assets for knowledge creating companies. Substantiated analysis classifies ethos into three categories: the individual, team and organisation. This indicates the precise actions of the organisational members in each category during the knowledge creation process. This research will be successful in its role of showing the indispensability of ethos - the new concept of knowledge assets, which enables knowledge creation -for future knowledge-based management in the knowledge society.

  10. The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

    Science.gov (United States)

    Nadeau, J H; Phillips, S J

    1987-11-01

    Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

  11. Colonization, mouse-style

    Directory of Open Access Journals (Sweden)

    Searle Jeremy B

    2010-10-01

    Full Text Available Abstract Several recent papers, including one in BMC Evolutionary Biology, examine the colonization history of house mice. As well as background for the analysis of mouse adaptation, such studies offer a perspective on the history of movements of the humans that accidentally transported the mice. See research article: http://www.biomedcentral.com/1471-2148/10/325

  12. Smart Grid enabled heat pumps

    DEFF Research Database (Denmark)

    Carmo, Carolina; Detlefsen, Nina; Nielsen, Mads Pagh

    2014-01-01

    The transition towards a 100 % fossil-free energy system, while achieving extreme penetration levels of intermittent wind and solar power in electricity generation, requires demand-side technologies that are smart (intermittency-friendly) and efficient. The integration of Smart Grid enabling...... with an empirical study in order to achieve a number of recommendations with respect to technology concepts and control strategies that would allow residential vapor-compression heat pumps to support large-scale integration of intermittent renewables. The analysis is based on data gathered over a period of up to 3...

  13. EuroPhenome and EMPReSS: online mouse phenotyping resource.

    Science.gov (United States)

    Mallon, Ann-Marie; Blake, Andrew; Hancock, John M

    2008-01-01

    EuroPhenome (http://www.europhenome.org) and EMPReSS (http://empress.har.mrc.ac.uk/) form an integrated resource to provide access to data and procedures for mouse phenotyping. EMPReSS describes 96 Standard Operating Procedures for mouse phenotyping. EuroPhenome contains data resulting from carrying out EMPReSS protocols on four inbred laboratory mouse strains. As well as web interfaces, both resources support web services to enable integration with other mouse phenotyping and functional genetics resources, and are committed to initiatives to improve integration of mouse phenotype databases. EuroPhenome will be the repository for a recently initiated effort to carry out large-scale phenotyping on a large number of knockout mouse lines (EUMODIC).

  14. mouseTube – a database to collaboratively unravel mouse ultrasonic communication [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Nicolas Torquet

    2016-09-01

    Full Text Available Ultrasonic vocalisation is a broadly used proxy to evaluate social communication in mouse models of neuropsychiatric disorders. The efficacy and robustness of testing these models suffer from limited knowledge of the structure and functions of these vocalisations as well as of the way to analyse the data. We created mouseTube, an open database with a web interface, to facilitate sharing and comparison of ultrasonic vocalisations data and metadata attached to a recording file. Metadata describe 1 the acquisition procedure, e.g., hardware, software, sampling frequency, bit depth; 2 the biological protocol used to elicit ultrasonic vocalisations; 3 the characteristics of the individual emitting ultrasonic vocalisations (e.g., strain, sex, age. To promote open science and enable reproducibility, data are made freely available. The website provides searching functions to facilitate the retrieval of recording files of interest. It is designed to enable comparisons of ultrasonic vocalisation emission between strains, protocols or laboratories, as well as to test different analysis algorithms and to search for protocols established to elicit mouse ultrasonic vocalisations. Over the long term, users will be able to download and compare different analysis results for each data file. Such application will boost the knowledge on mouse ultrasonic communication and stimulate sharing and comparison of automatic analysis methods to refine phenotyping techniques in mouse models of neuropsychiatric disorders.

  15. A Humanized Mouse Model Generated Using Surplus Neonatal Tissue

    Directory of Open Access Journals (Sweden)

    Matthew E. Brown

    2018-04-01

    Full Text Available Summary: Here, we describe the NeoThy humanized mouse model created using non-fetal human tissue sources, cryopreserved neonatal thymus and umbilical cord blood hematopoietic stem cells (HSCs. Conventional humanized mouse models are made by engrafting human fetal thymus and HSCs into immunocompromised mice. These mice harbor functional human T cells that have matured in the presence of human self-peptides and human leukocyte antigen molecules. Neonatal thymus tissue is more abundant and developmentally mature and allows for creation of up to ∼50-fold more mice per donor compared with fetal tissue models. The NeoThy has equivalent frequencies of engrafted human immune cells compared with fetal tissue humanized mice and exhibits T cell function in assays of ex vivo cell proliferation, interferon γ secretion, and in vivo graft infiltration. The NeoThy model may provide significant advantages for induced pluripotent stem cell immunogenicity studies, while bypassing the requirement for fetal tissue. : Corresponding author William Burlingham and colleagues created a humanized mouse model called the NeoThy. The NeoThy uses human neonatal, rather than fetal, tissue sources for generating a human immune system within immunocompromised mouse hosts. NeoThy mice are an attractive alternative to conventional humanized mouse models, as they enable robust and reproducible iPSC immunogenicity experiments in vivo. Keywords: NeoThy, humanized mouse, iPSC, PSC, immunogenicity, transplantation, immunology, hematopoietic stem cells, induced pluripotent stem cells, thymus

  16. Astonishing advances in mouse genetic tools for biomedical research.

    Science.gov (United States)

    Kaczmarczyk, Lech; Jackson, Walker S

    2015-01-01

    The humble house mouse has long been a workhorse model system in biomedical research. The technology for introducing site-specific genome modifications led to Nobel Prizes for its pioneers and opened a new era of mouse genetics. However, this technology was very time-consuming and technically demanding. As a result, many investigators continued to employ easier genome manipulation methods, though resulting models can suffer from overlooked or underestimated consequences. Another breakthrough, invaluable for the molecular dissection of disease mechanisms, was the invention of high-throughput methods to measure the expression of a plethora of genes in parallel. However, the use of samples containing material from multiple cell types could obfuscate data, and thus interpretations. In this review we highlight some important issues in experimental approaches using mouse models for biomedical research. We then discuss recent technological advances in mouse genetics that are revolutionising human disease research. Mouse genomes are now easily manipulated at precise locations thanks to guided endonucleases, such as transcription activator-like effector nucleases (TALENs) or the CRISPR/Cas9 system, both also having the potential to turn the dream of human gene therapy into reality. Newly developed methods of cell type-specific isolation of transcriptomes from crude tissue homogenates, followed by detection with next generation sequencing (NGS), are vastly improving gene regulation studies. Taken together, these amazing tools simplify the creation of much more accurate mouse models of human disease, and enable the extraction of hitherto unobtainable data.

  17. The mouse-human anatomy ontology mapping project.

    Science.gov (United States)

    Hayamizu, Terry F; de Coronado, Sherri; Fragoso, Gilberto; Sioutos, Nicholas; Kadin, James A; Ringwald, Martin

    2012-01-01

    The overall objective of the Mouse-Human Anatomy Project (MHAP) was to facilitate the mapping and harmonization of anatomical terms used for mouse and human models by Mouse Genome Informatics (MGI) and the National Cancer Institute (NCI). The anatomy resources designated for this study were the Adult Mouse Anatomy (MA) ontology and the set of anatomy concepts contained in the NCI Thesaurus (NCIt). Several methods and software tools were identified and evaluated, then used to conduct an in-depth comparative analysis of the anatomy ontologies. Matches between mouse and human anatomy terms were determined and validated, resulting in a highly curated set of mappings between the two ontologies that has been used by other resources. These mappings will enable linking of data from mouse and human. As the anatomy ontologies have been expanded and refined, the mappings have been updated accordingly. Insights are presented into the overall process of comparing and mapping between ontologies, which may prove useful for further comparative analyses and ontology mapping efforts, especially those involving anatomy ontologies. Finally, issues concerning further development of the ontologies, updates to the mapping files, and possible additional applications and significance were considered. DATABASE URL: http://obofoundry.org/cgi-bin/detail.cgi?id=ma2ncit.

  18. Cyber-Enabled Scientific Discovery

    International Nuclear Information System (INIS)

    Chan, Tony; Jameson, Leland

    2007-01-01

    It is often said that numerical simulation is third in the group of three ways to explore modern science: theory, experiment and simulation. Carefully executed modern numerical simulations can, however, be considered at least as relevant as experiment and theory. In comparison to physical experimentation, with numerical simulation one has the numerically simulated values of every field variable at every grid point in space and time. In comparison to theory, with numerical simulation one can explore sets of very complex non-linear equations such as the Einstein equations that are very difficult to investigate theoretically. Cyber-enabled scientific discovery is not just about numerical simulation but about every possible issue related to scientific discovery by utilizing cyberinfrastructure such as the analysis and storage of large data sets, the creation of tools that can be used by broad classes of researchers and, above all, the education and training of a cyber-literate workforce

  19. Simulation enabled safeguards assessment methodology

    International Nuclear Information System (INIS)

    Bean, Robert; Bjornard, Trond; Larson, Tom

    2007-01-01

    It is expected that nuclear energy will be a significant component of future supplies. New facilities, operating under a strengthened international nonproliferation regime will be needed. There is good reason to believe virtual engineering applied to the facility design, as well as to the safeguards system design will reduce total project cost and improve efficiency in the design cycle. Simulation Enabled Safeguards Assessment MEthodology has been developed as a software package to provide this capability for nuclear reprocessing facilities. The software architecture is specifically designed for distributed computing, collaborative design efforts, and modular construction to allow step improvements in functionality. Drag and drop wire-frame construction allows the user to select the desired components from a component warehouse, render the system for 3D visualization, and, linked to a set of physics libraries and/or computational codes, conduct process evaluations of the system they have designed. (authors)

  20. Simulation Enabled Safeguards Assessment Methodology

    International Nuclear Information System (INIS)

    Robert Bean; Trond Bjornard; Thomas Larson

    2007-01-01

    It is expected that nuclear energy will be a significant component of future supplies. New facilities, operating under a strengthened international nonproliferation regime will be needed. There is good reason to believe virtual engineering applied to the facility design, as well as to the safeguards system design will reduce total project cost and improve efficiency in the design cycle. Simulation Enabled Safeguards Assessment Methodology (SESAME) has been developed as a software package to provide this capability for nuclear reprocessing facilities. The software architecture is specifically designed for distributed computing, collaborative design efforts, and modular construction to allow step improvements in functionality. Drag and drop wireframe construction allows the user to select the desired components from a component warehouse, render the system for 3D visualization, and, linked to a set of physics libraries and/or computational codes, conduct process evaluations of the system they have designed

  1. Context-Enabled Business Intelligence

    Energy Technology Data Exchange (ETDEWEB)

    Troy Hiltbrand

    2012-04-01

    To truly understand context and apply it in business intelligence, it is vital to understand what context is and how it can be applied in addressing organizational needs. Context describes the facets of the environment that impact the way that end users interact with the system. Context includes aspects of location, chronology, access method, demographics, social influence/ relationships, end-user attitude/ emotional state, behavior/ past behavior, and presence. To be successful in making Business Intelligence content enabled, it is important to be able to capture the context of use user. With advances in technology, there are a number of ways in which this user based information can be gathered and exposed to enhance the overall end user experience.

  2. Informatics enables public health surveillance

    Directory of Open Access Journals (Sweden)

    Scott J. N McNabb

    2017-01-01

    Full Text Available Over the past decade, the world has radically changed. New advances in information and communication technologies (ICT connect the world in ways never imagined. Public health informatics (PHI leveraged for public health surveillance (PHS, can enable, enhance, and empower essential PHS functions (i.e., detection, reporting, confirmation, analyses, feedback, response. However, the tail doesn't wag the dog; as such, ICT cannot (should not drive public health surveillance strengthening. Rather, ICT can serve PHS to more effectively empower core functions. In this review, we explore promising ICT trends for prevention, detection, and response, laboratory reporting, push notification, analytics, predictive surveillance, and using new data sources, while recognizing that it is the people, politics, and policies that most challenge progress for implementation of solutions.

  3. Uncertainty enabled Sensor Observation Services

    Science.gov (United States)

    Cornford, Dan; Williams, Matthew; Bastin, Lucy

    2010-05-01

    Almost all observations of reality are contaminated with errors, which introduce uncertainties into the actual observation result. Such uncertainty is often held to be a data quality issue, and quantification of this uncertainty is essential for the principled exploitation of the observations. Many existing systems treat data quality in a relatively ad-hoc manner, however if the observation uncertainty is a reliable estimate of the error on the observation with respect to reality then knowledge of this uncertainty enables optimal exploitation of the observations in further processes, or decision making. We would argue that the most natural formalism for expressing uncertainty is Bayesian probability theory. In this work we show how the Open Geospatial Consortium Sensor Observation Service can be implemented to enable the support of explicit uncertainty about observations. We show how the UncertML candidate standard is used to provide a rich and flexible representation of uncertainty in this context. We illustrate this on a data set of user contributed weather data where the INTAMAP interpolation Web Processing Service is used to help estimate the uncertainty on the observations of unknown quality, using observations with known uncertainty properties. We then go on to discuss the implications of uncertainty for a range of existing Open Geospatial Consortium standards including SWE common and Observations and Measurements. We discuss the difficult decisions in the design of the UncertML schema and its relation and usage within existing standards and show various options. We conclude with some indications of the likely future directions for UncertML in the context of Open Geospatial Consortium services.

  4. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  5. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  6. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  7. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  8. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  9. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  11. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  12. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  13. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  14. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  15. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  16. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  17. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  18. Imaging of Chromosome Dynamics in Mouse Testis Tissue by Immuno-FISH.

    Science.gov (United States)

    Scherthan, Harry

    2017-01-01

    The mouse (Mus musculus) represents the central mammalian genetic model system for biomedical and developmental research. Mutant mouse models have provided important insights into chromosome dynamics during the complex meiotic differentiation program that compensates for the genome doubling at fertilization. Homologous chromosomes (homologues) undergo dynamic pairing and recombine during first meiotic prophase before they become partitioned into four haploid sets by two consecutive meiotic divisions that lack an intervening S-phase. Fluorescence in situ hybridization (FISH) has been instrumental in the visualization and imaging of the dynamic reshaping of chromosome territories and mobility during prophase I, in which meiotic telomeres were found to act as pacemakers for the chromosome pairing dance. FISH combined with immunofluorescence (IF) co-staining of nuclear proteins has been instrumental for the visualization and imaging of mammalian meiotic chromosome behavior. This chapter describes FISH and IF methods for the analysis of chromosome dynamics in nuclei of paraffin-embedded mouse testes. The techniques have proven useful for fresh and archived paraffin testis material of several mammalian species.

  19. Mouse fetal antigen 1 (mFA1), the circulating gene product of mdlk, pref-1 and SCP-1: isolation, characterization and biology

    DEFF Research Database (Denmark)

    Bachmann, E; Krogh, T N; Højrup, P

    1996-01-01

    The mouse homologue to human fetal antigen 1 (hFA1) was purified from mouse amniotic fluid by cation exchange chromatography and immunospecific affinity chromatography. Mouse FA1 (mFA1) is a single chain glycoprotein with an M(r) of 42-50 kDa (SDS-PAGE). The N-terminal amino acid sequence (39...... residues) revealed 74% identity to hFA1 and 100% identity to the translated cDNAs referred to as mouse dlk, pref-1 and SCP-1. mFA1 is the secreted processed molecule encoded by the mRNA defined by these identical mouse cDNAs. Monospecific rabbit anti-mFA1 antibodies, purified by ammonium sulfate...... precipitation and immunospecific affinity chromatography, were used for immunohistochemical and quantitative ELISA techniques. The indirect immunoperoxidase technique demonstrated mFA1 within the endocrine structures of adult mouse pancreas, whereas the exocrine tissue remained unstained. FA1-positive staining...

  20. Integrating 2D Mouse Emulation with 3D Manipulation for Visualizations on a Multi-Touch Table

    NARCIS (Netherlands)

    Vlaming, Luc; Collins, Christopher; Hancock, Mark; Nacenta, Miguel; Isenberg, Tobias; Carpendale, Sheelagh

    2010-01-01

    We present the Rizzo, a multi-touch virtual mouse that has been designed to provide the fine grained interaction for information visualization on a multi-touch table. Our solution enables touch interaction for existing mouse-based visualizations. Previously, this transition to a multi-touch

  1. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  2. Enabling individualized therapy through nanotechnology.

    Science.gov (United States)

    Sakamoto, Jason H; van de Ven, Anne L; Godin, Biana; Blanco, Elvin; Serda, Rita E; Grattoni, Alessandro; Ziemys, Arturas; Bouamrani, Ali; Hu, Tony; Ranganathan, Shivakumar I; De Rosa, Enrica; Martinez, Jonathan O; Smid, Christine A; Buchanan, Rachel M; Lee, Sei-Young; Srinivasan, Srimeenakshi; Landry, Matthew; Meyn, Anne; Tasciotti, Ennio; Liu, Xuewu; Decuzzi, Paolo; Ferrari, Mauro

    2010-08-01

    Individualized medicine is the healthcare strategy that rebukes the idiomatic dogma of 'losing sight of the forest for the trees'. We are entering a new era of healthcare where it is no longer acceptable to develop and market a drug that is effective for only 80% of the patient population. The emergence of "-omic" technologies (e.g. genomics, transcriptomics, proteomics, metabolomics) and advances in systems biology are magnifying the deficiencies of standardized therapy, which often provide little treatment latitude for accommodating patient physiologic idiosyncrasies. A personalized approach to medicine is not a novel concept. Ever since the scientific community began unraveling the mysteries of the genome, the promise of discarding generic treatment regimens in favor of patient-specific therapies became more feasible and realistic. One of the major scientific impediments of this movement towards personalized medicine has been the need for technological enablement. Nanotechnology is projected to play a critical role in patient-specific therapy; however, this transition will depend heavily upon the evolutionary development of a systems biology approach to clinical medicine based upon "-omic" technology analysis and integration. This manuscript provides a forward looking assessment of the promise of nanomedicine as it pertains to individualized medicine and establishes a technology "snapshot" of the current state of nano-based products over a vast array of clinical indications and range of patient specificity. Other issues such as market driven hurdles and regulatory compliance reform are anticipated to "self-correct" in accordance to scientific advancement and healthcare demand. These peripheral, non-scientific concerns are not addressed at length in this manuscript; however they do exist, and their impact to the paradigm shifting healthcare transformation towards individualized medicine will be critical for its success. Copyright 2010 Elsevier Ltd. All rights

  3. Enabling individualized therapy through nanotechnology

    Science.gov (United States)

    Sakamoto, Jason H.; van de Ven, Anne L.; Godin, Biana; Blanco, Elvin; Serda, Rita E.; Grattoni, Alessandro; Ziemys, Arturas; Bouamrani, Ali; Hu, Tony; Ranganathan, Shivakumar I.; De Rosa, Enrica; Martinez, Jonathan O.; Smid, Christine A.; Buchanan, Rachel M.; Lee, Sei-Young; Srinivasan, Srimeenakshi; Landry, Matthew; Meyn, Anne; Tasciotti, Ennio; Liu, Xuewu; Decuzzi, Paolo; Ferrari, Mauro

    2010-01-01

    Individualized medicine is the healthcare strategy that rebukes the idiomatic dogma of ‘losing sight of the forest for the trees’. We are entering a new era of healthcare where it is no longer acceptable to develop and market a drug that is effective for only 80% of the patient population. The emergence of “-omic” technologies (e.g. genomics, transcriptomics, proteomics, metabolomics) and advances in systems biology are magnifying the deficiencies of standardized therapy, which often provide little treatment latitude for accommodating patient physiologic idiosyncrasies. A personalized approach to medicine is not a novel concept. Ever since the scientific community began unraveling the mysteries of the genome, the promise of discarding generic treatment regimens in favor of patient-specific therapies became more feasible and realistic. One of the major scientific impediments of this movement towards personalized medicine has been the need for technological enablement. Nanotechnology is projected to play a critical role in patient-specific therapy; however, this transition will depend heavily upon the evolutionary development of a systems biology approach to clinical medicine based upon “-omic” technology analysis and integration. This manuscript provides a forward looking assessment of the promise of nanomedicine as it pertains to individualized medicine and establishes a technology “snapshot” of the current state of nano-based products over a vast array of clinical indications and range of patient specificity. Other issues such as market driven hurdles and regulatory compliance reform are anticipated to “self-correct” in accordance to scientific advancement and healthcare demand. These peripheral, non-scientific concerns are not addressed at length in this manuscript; however they do exist, and their impact to the paradigm shifting healthcare transformation towards individualized medicine will be critical for its success. PMID:20045055

  4. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  5. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  6. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  7. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  8. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  10. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  11. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  12. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  13. Genetic characterization and improved genotyping of the dysferlin-deficient mouse strain Dysf (tm1Kcam).

    Science.gov (United States)

    Wiktorowicz, Tatiana; Kinter, Jochen; Kobuke, Kazuhiro; Campbell, Kevin P; Sinnreich, Michael

    2015-01-01

    Mouse models of dysferlinopathies are valuable tools with which to investigate the pathomechanisms underlying these diseases and to test novel therapeutic strategies. One such mouse model is the Dysf (tm1Kcam) strain, which was generated using a targeting vector to replace a 12-kb region of the dysferlin gene and which features a progressive muscular dystrophy. A prerequisite for successful animal studies using genetic mouse models is an accurate genotyping protocol. Unfortunately, the lack of robustness of currently available genotyping protocols for the Dysf (tm1Kcam) mouse has prevented efficient colony management. Initial attempts to improve the genotyping protocol based on the published genomic structure failed. These difficulties led us to analyze the targeted locus of the dysferlin gene of the Dysf (tm1Kcam) mouse in greater detail. In this study we resequenced and analyzed the targeted locus of the Dysf (tm1Kcam) mouse and developed a novel PCR protocol for genotyping. We found that instead of a deletion, the dysferlin locus in the Dysf (tm1Kcam) mouse carries a targeted insertion. This genetic characterization enabled us to establish a reliable method for genotyping of the Dysf (tm1Kcam) mouse, and thus has made efficient colony management possible. Our work will make the Dysf (tm1Kcam) mouse model more attractive for animal studies of dysferlinopathies.

  14. In vivo cellular imaging with microscopes enabled by MEMS scanners

    Science.gov (United States)

    Ra, Hyejun

    High-resolution optical imaging plays an important role in medical diagnosis and biomedical research. Confocal microscopy is a widely used imaging method for obtaining cellular and sub-cellular images of biological tissue in reflectance and fluorescence modes. Its characteristic optical sectioning capability also enables three-dimensional (3-D) image reconstruction. However, its use has mostly been limited to excised tissues due to the requirement of high numerical aperture (NA) lenses for cellular resolution. Microscope miniaturization can enable in vivo imaging to make possible early cancer diagnosis and biological studies in the innate environment. In this dissertation, microscope miniaturization for in vivo cellular imaging is presented. The dual-axes confocal (DAC) architecture overcomes limitations of the conventional single-axis confocal (SAC) architecture to allow for miniaturization with high resolution. A microelectromechanical systems (MEMS) scanner is the central imaging component that is key in miniaturization of the DAC architecture. The design, fabrication, and characterization of the two-dimensional (2-D) MEMS scanner are presented. The gimbaled MEMS scanner is fabricated on a double silicon-on-insulator (SOI) wafer and is actuated by self-aligned vertical electrostatic combdrives. The imaging performance of the MEMS scanner in a DAC configuration is shown in a breadboard microscope setup, where reflectance and fluorescence imaging is demonstrated. Then, the MEMS scanner is integrated into a miniature DAC microscope. The whole imaging system is integrated into a portable unit for research in small animal models of human biology and disease. In vivo 3-D imaging is demonstrated on mouse skin models showing gene transfer and siRNA silencing. The siRNA silencing process is sequentially imaged in one mouse over time.

  15. Deep proteomics of mouse skeletal muscle enables quantitation of protein isoforms, metabolic pathways, and transcription factors.

    Science.gov (United States)

    Deshmukh, Atul S; Murgia, Marta; Nagaraj, Nagarjuna; Treebak, Jonas T; Cox, Jürgen; Mann, Matthias

    2015-04-01

    Skeletal muscle constitutes 40% of individual body mass and plays vital roles in locomotion and whole-body metabolism. Proteomics of skeletal muscle is challenging because of highly abundant contractile proteins that interfere with detection of regulatory proteins. Using a state-of-the art MS workflow and a strategy to map identifications from the C2C12 cell line model to tissues, we identified a total of 10,218 proteins, including skeletal muscle specific transcription factors like myod1 and myogenin and circadian clock proteins. We obtain absolute abundances for proteins expressed in a muscle cell line and skeletal muscle, which should serve as a valuable resource. Quantitation of protein isoforms of glucose uptake signaling pathways and in glucose and lipid metabolic pathways provides a detailed metabolic map of the cell line compared with tissue. This revealed unexpectedly complex regulation of AMP-activated protein kinase and insulin signaling in muscle tissue at the level of enzyme isoforms. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Deep Proteomics of Mouse Skeletal Muscle Enables Quantitation of Protein Isoforms, Metabolic Pathways, and Transcription Factors*

    Science.gov (United States)

    Deshmukh, Atul S.; Murgia, Marta; Nagaraj, Nagarjuna; Treebak, Jonas T.; Cox, Jürgen; Mann, Matthias

    2015-01-01

    Skeletal muscle constitutes 40% of individual body mass and plays vital roles in locomotion and whole-body metabolism. Proteomics of skeletal muscle is challenging because of highly abundant contractile proteins that interfere with detection of regulatory proteins. Using a state-of-the art MS workflow and a strategy to map identifications from the C2C12 cell line model to tissues, we identified a total of 10,218 proteins, including skeletal muscle specific transcription factors like myod1 and myogenin and circadian clock proteins. We obtain absolute abundances for proteins expressed in a muscle cell line and skeletal muscle, which should serve as a valuable resource. Quantitation of protein isoforms of glucose uptake signaling pathways and in glucose and lipid metabolic pathways provides a detailed metabolic map of the cell line compared with tissue. This revealed unexpectedly complex regulation of AMP-activated protein kinase and insulin signaling in muscle tissue at the level of enzyme isoforms. PMID:25616865

  17. Deep proteomics of mouse skeletal muscle enables quantitation of protein isoforms, metabolic pathways and transcription factors

    DEFF Research Database (Denmark)

    Deshmukh, Atul S; Murgia, Marta; Nagaraja, Nagarjuna

    2015-01-01

    Skeletal muscle constitutes 40% of individual body mass and plays vital roles in locomotion and whole-body metabolism. Proteomics of skeletal muscle is challenging due to highly abundant contractile proteins that interfere with detection of regulatory proteins. Using a state-of-the art mass...

  18. A Comprehensive Atlas of the Adult Mouse Penis

    Science.gov (United States)

    Phillips, Tiffany R.; Wright, David K.; Gradie, Paul E.; Johnston, Leigh A.; Pask, Andrew J.

    2016-01-01

    Mice are routinely used to study the development of the external genitalia and, in particular, the process of male urethral closure. This is because misplacement of the male penile urethra, or hypospadias, is amongst the most common birth defects reported in humans. While mice present a tractable model to study penile development, several structures differ between mice and humans, and there is a lack of consensus in the literature on their annotation and developmental origins. Defining the ontology of the mouse prepuce is especially important for the relevance and interpretation of mouse models of hypospadias to human conditions. We have developed a detailed annotation of the adult mouse penis that addresses these differences and enables an accurate comparison of murine and human hypospadias phenotypes. Through MRI data, gross morphology and section histology, we define the origin of the mouse external and internal prepuces, their relationship to the single human foreskin as well as provide a comprehensive view of the various structures of the mouse penis and their associated muscle attachments within the body. These data are combined to annotate structures in a novel 3D adult penis atlas that can be downloaded, viewed at any angle, and manipulated to examine the relationship of various structures. PMID:26112156

  19. Inverted light-sheet microscope for imaging mouse pre-implantation development.

    Science.gov (United States)

    Strnad, Petr; Gunther, Stefan; Reichmann, Judith; Krzic, Uros; Balazs, Balint; de Medeiros, Gustavo; Norlin, Nils; Hiiragi, Takashi; Hufnagel, Lars; Ellenberg, Jan

    2016-02-01

    Despite its importance for understanding human infertility and congenital diseases, early mammalian development has remained inaccessible to in toto imaging. We developed an inverted light-sheet microscope that enabled us to image mouse embryos from zygote to blastocyst, computationally track all cells and reconstruct a complete lineage tree of mouse pre-implantation development. We used this unique data set to show that the first cell fate specification occurs at the 16-cell stage.

  20. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Tanaka, K.; Satokata, I.; Ogita, Z.; Uchida, T.; Okada, Y.

    1989-01-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene

  1. 3D confocal imaging in CUBIC-cleared mouse heart

    Energy Technology Data Exchange (ETDEWEB)

    Nehrhoff, I.; Bocancea, D.; Vaquero, J.; Vaquero, J.J.; Lorrio, M.T.; Ripoll, J.; Desco, M.; Gomez-Gaviro, M.V.

    2016-07-01

    Acquiring high resolution 3D images of the heart enables the ability to study heart diseases more in detail. Here, the CUBIC (clear, unobstructed brain imaging cocktails and computational analysis) clearing protocol was adapted for thick mouse heart sections to increase the penetration depth of the confocal microscope lasers into the tissue. The adapted CUBIC clearing of the heart lets the antibody penetrate deeper into the tissue by a factor of five. The here shown protocol enables deep 3D highresolution image acquisition in the heart. This allows a much more accurate assessment of the cellular and structural changes that underlie heart diseases. (Author)

  2. 3D confocal imaging in CUBIC-cleared mouse heart

    International Nuclear Information System (INIS)

    Nehrhoff, I.; Bocancea, D.; Vaquero, J.; Vaquero, J.J.; Lorrio, M.T.; Ripoll, J.; Desco, M.; Gomez-Gaviro, M.V.

    2016-01-01

    Acquiring high resolution 3D images of the heart enables the ability to study heart diseases more in detail. Here, the CUBIC (clear, unobstructed brain imaging cocktails and computational analysis) clearing protocol was adapted for thick mouse heart sections to increase the penetration depth of the confocal microscope lasers into the tissue. The adapted CUBIC clearing of the heart lets the antibody penetrate deeper into the tissue by a factor of five. The here shown protocol enables deep 3D highresolution image acquisition in the heart. This allows a much more accurate assessment of the cellular and structural changes that underlie heart diseases. (Author)

  3. Digital three-dimensional reconstruction and ultrastructure of the mouse proximal tubule

    DEFF Research Database (Denmark)

    Zhai, X.Y.; Birn, H.; Jensen, K.B.

    2003-01-01

    . In the medullary rays, these are arranged in layers outside the clusters of more superficial tubules. In contrast to rat and human kidney, no major segmental variation in the ultrastructure of the proximal tubule was identified, and no parameters enabled definition of distinct segments in this strain of mice......, detailed analyses of normal mouse kidney structure and organization are lacking. This study describes the 3D organization and ultrastructural, segmental variation of the mouse kidney proximal tubule. A total of 160 proximal tubules in three C57/BL/6J mouse kidneys were analyzed on 800 serial sections from...

  4. Preparation and Observation of Fresh-frozen Sections of the Green Fluorescent Protein Transgenic Mouse Head

    International Nuclear Information System (INIS)

    Tada, Masahito; Shinohara, Yoshinori; Kato, Ichiro; Hiraga, Koichi; Aizawa, Tomoyasu; Demura, Makoto; Mori, Yoshihiro; Shinoda, Hiroyuki; Mizuguchi, Mineyuki; Kawano, Keiichi

    2006-01-01

    Hard tissue decalcification can cause variation in the constituent protein characteristics. This paper describes a method of preparating of frozen mouse head sections so as to clearly observe the nature of the constituent proteins. Frozen sections of various green fluorescent protein (GFP) transgenic mouse heads were prepared using the film method developed by Kawamoto and Shimizu. This method made specimen dissection without decalcification possible, wherein GFP was clearly observed in an undamaged state. Conversely, using the same method with decalcification made GFP observation in the transgenic mouse head difficult. This new method is suitable for observing GFP marked cells, enabling us to follow the transplanted GFP marked cells within frozen head sections

  5. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  6. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  7. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  8. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  9. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  10. An Internet enabled impact limiter material database

    Energy Technology Data Exchange (ETDEWEB)

    Wix, S.; Kanipe, F.; McMurtry, W.

    1998-09-01

    This paper presents a detailed explanation of the construction of an interest enabled database, also known as a database driven web site. The data contained in the internet enabled database are impact limiter material and seal properties. The technique used in constructing the internet enabled database presented in this paper are applicable when information that is changing in content needs to be disseminated to a wide audience.

  11. An internet enabled impact limiter material database

    Energy Technology Data Exchange (ETDEWEB)

    Wix, S.; Kanipe, F.; McMurtry, W. [Sandia National Labs., Albuquerque, NM (United States)

    1998-07-01

    This paper presents a detailed explanation of the construction of an internet enabled database, also known as a database driven web site. The data contained in the internet enabled database are impact limiter material and seal properties. The techniques used in constructing the internet enabled database presented in this paper are applicable when information that is changing in content needs to be disseminated to a wide audience. (authors)

  12. An internet enabled impact limiter material database

    International Nuclear Information System (INIS)

    Wix, S.; Kanipe, F.; McMurtry, W.

    1998-01-01

    This paper presents a detailed explanation of the construction of an internet enabled database, also known as a database driven web site. The data contained in the internet enabled database are impact limiter material and seal properties. The techniques used in constructing the internet enabled database presented in this paper are applicable when information that is changing in content needs to be disseminated to a wide audience. (authors)

  13. An Internet enabled impact limiter material database

    International Nuclear Information System (INIS)

    Wix, S.; Kanipe, F.; McMurtry, W.

    1998-01-01

    This paper presents a detailed explanation of the construction of an interest enabled database, also known as a database driven web site. The data contained in the internet enabled database are impact limiter material and seal properties. The technique used in constructing the internet enabled database presented in this paper are applicable when information that is changing in content needs to be disseminated to a wide audience

  14. Cloning and characterization of the mouse Mcoln1 gene reveals an alternatively spliced transcript not seen in humans

    Directory of Open Access Journals (Sweden)

    Stahl Stefanie

    2002-02-01

    Full Text Available Abstract Background Mucolipidosis type IV (MLIV is an autosomal recessive lysosomal storage disorder characterized by severe neurologic and ophthalmologic abnormalities. Recently the MLIV gene, MCOLN1, has been identified as a new member of the transient receptor potential (TRP cation channel superfamily. Here we report the cloning and characterization of the mouse homologue, Mcoln1, and report a novel splice variant that is not seen in humans. Results The human and mouse genes display a high degree of synteny. Mcoln1 shows 91% amino acid and 86% nucleotide identity to MCOLN1. Also, Mcoln1 maps to chromosome 8 and contains an open reading frame of 580 amino acids, with a transcript length of approximately 2 kb encoded by 14 exons, similar to its human counterpart. The transcript that results from murine specific alternative splicing encodes a 611 amino acid protein that differs at the c-terminus. Conclusions Mcoln1 is highly similar to MCOLN1, especially in the transmembrane domains and ion pore region. Also, the late endosomal/lysosomal targeting signal is conserved, supporting the hypothesis that the protein is localized to these vesicle membranes. To date, there are very few reports describing species-specific splice variants. While identification of Mcoln1 is crucial to the development of mouse models for MLIV, the fact that there are two transcripts in mice suggests an additional or alternate function of the gene that may complicate phenotypic assessment.

  15. Mouse and human genetic analyses associate kalirin with ventral striatal activation during impulsivity and with alcohol misuse

    Directory of Open Access Journals (Sweden)

    Yolanda ePeña-Oliver

    2016-04-01

    Full Text Available Impulsivity is associated with a spectrum of psychiatric disorders including drug addiction. To investigate genetic associations with impulsivity and initiation of drug taking, we took a two-step approach. First, we identified genes whose expression level in prefrontal cortex, striatum and accumbens were associated with impulsive behaviour in the 5-choice serial reaction time task across 10 BXD recombinant inbred (BXD RI mouse strains and their progenitor C57BL/6J and DBA2/J strains. Behavioural data were correlated with regional gene expression using GeneNetwork (www.genenetwork.org, to identify 44 genes whose probability of association with impulsivity exceeded a false discovery rate of <0.05. We then interrogated the IMAGEN database of 1423 adolescents for potential associations of SNPs in human homologues of those genes identified in the mouse study, with brain activation during impulsive performance in the Monetary Incentive Delay task, and with novelty seeking scores from the Temperament and Character Inventory, as well as alcohol-experience. There was a significant overall association between the human homologues of impulsivity-related genes and percentage of premature responses in the MID task and with fMRI BOLD-response in ventral striatum (VS during reward anticipation. In contrast, no significant association was found between the polygenic scores and anterior cingulate cortex activation. Univariate association analyses revealed that the G allele (major of the intronic SNP rs6438839 in the KALRN gene was significantly associated with increased VS activation. Additionally, the A-allele (minor of KALRN intronic SNP rs4634050, belonging to the same haplotype block, was associated with increased frequency of binge drinking.

  16. The enabling approach for housing supply

    Directory of Open Access Journals (Sweden)

    Ghada Farouk Hassan

    2011-12-01

    The paper attempts to highlight prerequisites needed to improve the success of the enabling approach in achieving adequate housing provision. Then the paper revisits the Egyptian experiences in the application of the enabling approach from 2005 till 2010. Finally, the paper highlights the main drops and lessons must be considered as promising approach after the revolution.

  17. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  18. New Insights on the Morphology of Adult Mouse Penis1

    Science.gov (United States)

    Rodriguez, Esequiel; Weiss, Dana A.; Yang, Jennifer H.; Menshenina, Julia; Ferretti, Max; Cunha, Tristan J.; Barcellos, Dale; Chan, Lok Yun; Risbridger, Gail; Cunha, Gerald R.; Baskin, Laurence S.

    2011-01-01

    ABSTRACT The adult mouse penis represents the end point of masculine sex differentiation of the embryonic genital tubercle and contains bone, cartilage, the urethra, erectile bodies, several types of epithelium, and many individual cell types arrayed into specific anatomical structures. Using contemporary high-resolution imaging techniques, we sought to provide new insights to the current description of adult mouse penile morphology to enable understanding of penile abnormalities, including hypospadias. Examination of serial transverse and longitudinal sections, scanning electron microscopy, and three-dimensional (3D) reconstruction provided a new appreciation of the individual structures in the adult mouse penis and their 3D interrelationships. In so doing, we discovered novel paired erectile bodies, the male urogenital mating protuberance (MUMP), and more accurately described the urethral meatus. These morphological observations were quantified by morphometric analysis and now provide accurate morphological end points of sex differentiation of mouse penis that will be the foundation of future studies to identify normal and abnormal penile development. PMID:21918128

  19. Cardiac disease and arrhythmogenesis: Mechanistic insights from mouse models

    Directory of Open Access Journals (Sweden)

    Lois Choy

    2016-09-01

    Full Text Available The mouse is the second mammalian species, after the human, in which substantial amount of the genomic information has been analyzed. With advances in transgenic technology, mutagenesis is now much easier to carry out in mice. Consequently, an increasing number of transgenic mouse systems have been generated for the study of cardiac arrhythmias in ion channelopathies and cardiomyopathies. Mouse hearts are also amenable to physical manipulation such as coronary artery ligation and transverse aortic constriction to induce heart failure, radiofrequency ablation of the AV node to model complete AV block and even implantation of a miniature pacemaker to induce cardiac dyssynchrony. Last but not least, pharmacological models, despite being simplistic, have enabled us to understand the physiological mechanisms of arrhythmias and evaluate the anti-arrhythmic properties of experimental agents, such as gap junction modulators, that may be exert therapeutic effects in other cardiac diseases. In this article, we examine these in turn, demonstrating that primary inherited arrhythmic syndromes are now recognized to be more complex than abnormality in a particular ion channel, involving alterations in gene expression and structural remodelling. Conversely, in cardiomyopathies and heart failure, mutations in ion channels and proteins have been identified as underlying causes, and electrophysiological remodelling are recognized pathological features. Transgenic techniques causing mutagenesis in mice are extremely powerful in dissecting the relative contributions of different genes play in producing disease phenotypes. Mouse models can serve as useful systems in which to explore how protein defects contribute to arrhythmias and direct future therapy.

  20. Neuroscience imaging enabled by new highly tunable and high peak power femtosecond lasers

    Science.gov (United States)

    Hakulinen, T.; Klein, J.

    2017-02-01

    Neuroscience applications benefit from recent developments in industrial femtosecond laser technology. New laser sources provide several megawatts of peak power at wavelength of 1040 nm, which enables simultaneous optogenetics photoactivation of tens or even hundreds of neurons using red shifted opsins. Another recent imaging trend is to move towards longer wavelengths, which would enable access to deeper layers of tissue due to lower scattering and lower absorption in the tissue. Femtosecond lasers pumping a non-collinear optical parametric amplifier (NOPA) enable the access to longer wavelengths with high peak powers. High peak powers of >10 MW at 1300 nm and 1700 nm allow effective 3-photon excitation of green and red shifted calcium indicators respectively and access to deeper, sub-cortex layers of the brain. Early results include in vivo detection of spontaneous activity in hippocampus within an intact mouse brain, where neurons express GCaMP6 activated in a 3-photon process at 1320 nm.

  1. Musculoskeletal Geometry, Muscle Architecture and Functional Specialisations of the Mouse Hindlimb.

    Directory of Open Access Journals (Sweden)

    James P Charles

    Full Text Available Mice are one of the most commonly used laboratory animals, with an extensive array of disease models in existence, including for many neuromuscular diseases. The hindlimb is of particular interest due to several close muscle analogues/homologues to humans and other species. A detailed anatomical study describing the adult morphology is lacking, however. This study describes in detail the musculoskeletal geometry and skeletal muscle architecture of the mouse hindlimb and pelvis, determining the extent to which the muscles are adapted for their function, as inferred from their architecture. Using I2KI enhanced microCT scanning and digital segmentation, it was possible to identify 39 distinct muscles of the hindlimb and pelvis belonging to nine functional groups. The architecture of each of these muscles was determined through microdissections, revealing strong architectural specialisations between the functional groups. The hip extensors and hip adductors showed significantly stronger adaptations towards high contraction velocities and joint control relative to the distal functional groups, which exhibited larger physiological cross sectional areas and longer tendons, adaptations for high force output and elastic energy savings. These results suggest that a proximo-distal gradient in muscle architecture exists in the mouse hindlimb. Such a gradient has been purported to function in aiding locomotor stability and efficiency. The data presented here will be especially valuable to any research with a focus on the architecture or gross anatomy of the mouse hindlimb and pelvis musculature, but also of use to anyone interested in the functional significance of muscle design in relation to quadrupedal locomotion.

  2. Optical Coherent Receiver Enables THz Wireless Bridge

    DEFF Research Database (Denmark)

    Yu, Xianbin; Liu, Kexin; Zhang, Hangkai

    2016-01-01

    We experimentally demonstrated a 45 Gbit/s 400 GHz photonic wireless communication system enabled by an optical coherent receiver, which has a high potential in fast recovery of high data rate connections, for example, in disaster....

  3. Web Enabled DROLS Verity TopicSets

    National Research Council Canada - National Science Library

    Tong, Richard

    1999-01-01

    The focus of this effort has been the design and development of automatically generated TopicSets and HTML pages that provide the basis of the required search and browsing capability for DTIC's Web Enabled DROLS System...

  4. Creating an Economically Enabling and Competitive Business ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Creating an Economically Enabling and Competitive Business Environment in the ... the scope of operations of private sector enterprises in the West Bank and Gaza. ... IWRA/IDRC webinar on climate change and adaptive water management.

  5. Utility Energy Services Contracts: Enabling Documents

    Energy Technology Data Exchange (ETDEWEB)

    None

    2009-05-01

    Utility Energy Services Contracts: Enabling Documents provides materials that clarify the authority for Federal agencies to enter into utility energy services contracts (UESCs), as well as sample documents and resources to ease utility partnership contracting.

  6. Utility Energy Services Contracts: Enabling Documents

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Karen; Vasquez, Deb

    2017-01-01

    The Federal Energy Management Program's 'Utility Energy Service Contracts: Enabling Documents' provide legislative information and materials that clarify the authority for federal agencies to enter into utility energy service contracts, or UESCs.

  7. Development and function of human innate immune cells in a humanized mouse model.

    Science.gov (United States)

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

    2014-04-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

  8. 5G-Enabled Tactile Internet

    OpenAIRE

    Simsek, Meryem; Aijaz, Adnan; Dohler, Mischa; Sachs, Joachim; Fettweis, Gerhard

    2016-01-01

    The long-term ambition of the Tactile Internet is to enable a democratization of skill, and how it is being delivered globally. An integral part of this is to be able to transmit touch in perceived real-time, which is enabled by suitable robotics and haptics equipment at the edges, along with an unprecedented communications network. The fifth generation (5G) mobile communications systems will underpin this emerging Internet at the wireless edge. This paper presents the most important technolo...

  9. Integrated Photonics Enabled by Slow Light

    DEFF Research Database (Denmark)

    Mørk, Jesper; Chen, Yuntian; Ek, Sara

    2012-01-01

    In this talk we will discuss the physics of slow light in semiconductor materials and in particular the possibilities offered for integrated photonics. This includes ultra-compact slow light enabled optical amplifiers, lasers and pulse sources.......In this talk we will discuss the physics of slow light in semiconductor materials and in particular the possibilities offered for integrated photonics. This includes ultra-compact slow light enabled optical amplifiers, lasers and pulse sources....

  10. Bio-Inspired PVDF-Based, Mouse Whisker Mimicking, Tactile Sensor

    Directory of Open Access Journals (Sweden)

    Mohsin Islam Tiwana

    2016-10-01

    Full Text Available The design and fabrication of a Polyvinylidene fluoride (PVDF based, mouse (or rodent whisker mimicking, tactile sensor is presented. Unlike previous designs reported in the literature, this sensor mimics the mouse whisker not only mechanically, but it also makes macro movements just like a real mouse whisker in a natural environment. We have developed a mathematical model and performed finite element analysis using COMSOL, in order to optimise the whisker to have the same natural frequency as that of a biological whisker. Similarly, we have developed a control system that enables the whisker mimicking sensor to vibrate at variable frequencies and conducted practical experiments to validate the response of the sensor. The natural frequency of the whisker can be designed anywhere between 35 and 110 Hz, the same as a biological whisker, by choosing different materials and physical dimensions. The control system of this sensor enables the whisker to vibrate between 5 and 236 Hz.

  11. A surgical approach appropriate for targeted cochlear gene therapy in the mouse.

    Science.gov (United States)

    Jero, J; Tseng, C J; Mhatre, A N; Lalwani, A K

    2001-01-01

    Therapeutic manipulations of the mammalian cochlea, including cochlear gene transfer, have been predominantly studied using the guinea pig as the experimental model. With the significant developments in mouse genomics and the availability of mutant strains of mice with well-characterized hearing loss, the mouse justifiably will be the preferred animal model for therapeutic manipulations. However, the potential advantages of the mouse model have not been fully realized due to the surgical difficulty of accessing its small cochlea. This study describes a ventral approach, instead of the routinely used postauricular approach in other rodents, for accessing the mouse middle and inner ear, and its application in cochlear gene transfer. This ventral approach enabled rapid and direct delivery of liposome-transgene complex to the mouse inner ear while avoiding blood loss, facial nerve morbidity, and mortality. Transgene expression at 3 days was detected in Reissner's membrane, spiral limbus, spiral ligament, and spiral ganglion cells, in a pattern similar to that previously described in the guinea pig. The successful access and delivery of material to the mouse cochlea and the replication of gene expression seen in the guinea pig demonstrated in this study should promote the use of the mouse in future studies investigating targeted cochlear therapy.

  12. TL transgenic mouse strains

    International Nuclear Information System (INIS)

    Obata, Y.; Matsudaira, Y.; Hasegawa, H.; Tamaki, H.; Takahashi, T.; Morita, A.; Kasai, K.

    1993-01-01

    As a result of abnormal development of the thymus of these mice, TCR αβ lineage of the T cell differentiation is disturbed and cells belonging to the TCR γδ CD4 - CD8 - double negative (DN) lineage become preponderant. The γδ DN cells migrate into peripheral lymphoid organs and constitute nearly 50% of peripheral T cells. Immune function of the transgenic mice is severely impaired, indicating that the γδ cells are incapable of participating in these reactions. Molecular and serological analyses of T-cell lymphomas reveal that they belong to the γδ lineage. Tg.Tla a -3-1 mice should be useful in defining the role of TL in normal and abnormal T cell differentiation as well as in the development of T-cell lymphomas, and further they should facilitate studies on the differentiation and function of γδ T cells. We isolated T3 b -TL gene from B6 mice and constructed a chimeric gene in which T3 b -TL is driven by the promoter of H-2K b . With the chimeric gene, two transgenic mouse strains, Tg. Con.3-1 and -2 have been derived in C3H background. Both strains express TL antigen in various tissues including skin. The skin graft of transgenic mice on C3H and (B6 X C3H)F 1 mice were rejected. In the mice which rejected the grafts, CD8 + TCRαβ cytotoxic T cells (CTL) against TL antigens were recognized. The recognition of TL by CTL did not require the antigen presentation by H-2 molecules. The results indicated that TL antigen in the skin becomes a transplantation antigen and behaves like a typical allogeneic MHC class I antigen. The facts that (B6 X C3H)F 1 mice rejected the skin expressing T3 b -TL antigen and induced CTL that killed TL + lymphomas of B6 origin revealed that TL antigen encoded by T3 b -TL is recognized as non-self in B6 mice. Experiments are now extended to analyze immune responses to TL antigen expressed on autochthonous T cell lymphomas. (J.P.N.)

  13. 10. international mouse genome conference

    Energy Technology Data Exchange (ETDEWEB)

    Meisler, M.H.

    1996-12-31

    Ten years after hosting the First International Mammalian Genome Conference in Paris in 1986, Dr. Jean-Louis Guenet presided over the Tenth Conference at the Pasteur Institute, October 7--10, 1996. The 1986 conference was a satellite to the Human Gene Mapping Workshop and had approximately 50 attendees. The 1996 meeting was attended by 300 scientists from around the world. In the interim, the number of mapped loci in the mouse increased from 1,000 to over 20,000. This report contains a listing of the program and its participants, and two articles that review the meeting and the role of the laboratory mouse in the Human Genome project. More than 200 papers were presented at the conference covering the following topics: International mouse chromosome committee meetings; Mutant generation and identification; Physical and genetic maps; New technology and resources; Chromatin structure and gene regulation; Rate and hamster genetic maps; Informatics and databases; and Quantitative trait analysis.

  14. Teratology studies in the mouse.

    Science.gov (United States)

    Marsden, Edward; Leroy, Mariline

    2013-01-01

    The rat is the routine species of choice as the rodent model for regulatory safety testing of xenobiotics such as medicinal products, food additives, and other chemicals. However, the rat is not always suitable for pharmacological, toxicological, immunogenic, pharmacokinetic, or even practical reasons. Under such circumstances, the mouse offers an alternative for finding a suitable rodent model acceptable to the regulatory authorities. Since all essential routes of administration are possible, the short reproductive cycle and large litter size of the mouse make it a species well adapted for use in teratology studies. Given that good quality animals, including virgin mated females, can be acquired relatively easily and inexpensively, the mouse has been used in reproductive toxicity studies for decades and study protocols are well established.

  15. Mouse models of Fanconi anemia

    International Nuclear Information System (INIS)

    Parmar, Kalindi; D'Andrea, Alan; Niedernhofer, Laura J.

    2009-01-01

    Fanconi anemia is a rare inherited disease characterized by congenital anomalies, growth retardation, aplastic anemia and an increased risk of acute myeloid leukemia and squamous cell carcinomas. The disease is caused by mutation in genes encoding proteins required for the Fanconi anemia pathway, a response mechanism to replicative stress, including that caused by genotoxins that cause DNA interstrand crosslinks. Defects in the Fanconi anemia pathway lead to genomic instability and apoptosis of proliferating cells. To date, 13 complementation groups of Fanconi anemia were identified. Five of these genes have been deleted or mutated in the mouse, as well as a sixth key regulatory gene, to create mouse models of Fanconi anemia. This review summarizes the phenotype of each of the Fanconi anemia mouse models and highlights how genetic and interventional studies using the strains have yielded novel insight into therapeutic strategies for Fanconi anemia and into how the Fanconi anemia pathway protects against genomic instability.

  16. Mouse models of Fanconi anemia

    Energy Technology Data Exchange (ETDEWEB)

    Parmar, Kalindi; D' Andrea, Alan [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, MA 02115 (United States); Niedernhofer, Laura J., E-mail: niedernhoferl@upmc.edu [Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine and Cancer Institute, 5117 Centre Avenue, Hillman Cancer Center, Research Pavilion 2.6, Pittsburgh, PA 15213-1863 (United States)

    2009-07-31

    Fanconi anemia is a rare inherited disease characterized by congenital anomalies, growth retardation, aplastic anemia and an increased risk of acute myeloid leukemia and squamous cell carcinomas. The disease is caused by mutation in genes encoding proteins required for the Fanconi anemia pathway, a response mechanism to replicative stress, including that caused by genotoxins that cause DNA interstrand crosslinks. Defects in the Fanconi anemia pathway lead to genomic instability and apoptosis of proliferating cells. To date, 13 complementation groups of Fanconi anemia were identified. Five of these genes have been deleted or mutated in the mouse, as well as a sixth key regulatory gene, to create mouse models of Fanconi anemia. This review summarizes the phenotype of each of the Fanconi anemia mouse models and highlights how genetic and interventional studies using the strains have yielded novel insight into therapeutic strategies for Fanconi anemia and into how the Fanconi anemia pathway protects against genomic instability.

  17. Mouse Genome Informatics (MGI) Resource: Genetic, Genomic, and Biological Knowledgebase for the Laboratory Mouse.

    Science.gov (United States)

    Eppig, Janan T

    2017-07-01

    The Mouse Genome Informatics (MGI) Resource supports basic, translational, and computational research by providing high-quality, integrated data on the genetics, genomics, and biology of the laboratory mouse. MGI serves a strategic role for the scientific community in facilitating biomedical, experimental, and computational studies investigating the genetics and processes of diseases and enabling the development and testing of new disease models and therapeutic interventions. This review describes the nexus of the body of growing genetic and biological data and the advances in computer technology in the late 1980s, including the World Wide Web, that together launched the beginnings of MGI. MGI develops and maintains a gold-standard resource that reflects the current state of knowledge, provides semantic and contextual data integration that fosters hypothesis testing, continually develops new and improved tools for searching and analysis, and partners with the scientific community to assure research data needs are met. Here we describe one slice of MGI relating to the development of community-wide large-scale mutagenesis and phenotyping projects and introduce ways to access and use these MGI data. References and links to additional MGI aspects are provided. © The Author 2017. Published by Oxford University Press.

  18. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  19. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  20. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  1. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  2. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  3. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  4. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  5. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  6. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  7. Mouse Resource Browser-a database of mouse databases

    NARCIS (Netherlands)

    Zouberakis, Michael; Chandras, Christina; Swertz, Morris; Smedley, Damian; Gruenberger, Michael; Bard, Jonathan; Schughart, Klaus; Rosenthal, Nadia; Hancock, John M.; Schofield, Paul N.; Kollias, George; Aidinis, Vassilis

    2010-01-01

    The laboratory mouse has become the organism of choice for discovering gene function and unravelling pathogenetic mechanisms of human diseases through the application of various functional genomic approaches. The resulting deluge of data has led to the deployment of numerous online resources and the

  8. Enabling Open Innovation: Lessons from Haier

    Institute of Scientific and Technical Information of China (English)

    Arie Y.Lewin; Liisa V(a)likangas; Jin Chen

    2017-01-01

    Open innovation has become a dominant innovation paradigm.However,the actual adoption of open innovation organizational designs and practices remains elusive,and ongoing examples of large companies practicing open innovation in mature industries or beyond R&D activities are rare.Despite the continuing interest in open innovation and the surging research on the topic,not much is documented about how,in particular,large companies interpret and implement open innovation or develop and sustain an innovation-enabling culture.This paper reports on a study of Haier's adoption of six radical innovations as it implements an open innovation organization over a period of seven years.The study is unique in that the cases reveal how open innovation is enabled by the socially enabling mechanisms developed under Chairman Ruimin Zhang's leadership.These varied enabling mechanisms open the organization to serendipity at every level,from the bottom up to suppliers.Most importantly,the mechanisms imprint and sustain an open innovation culture recognized as important-yet often left unarticulated in terms of how it is practiced-in the prior literature.The paper contributes to and highlights the centrality of socially enabling mechanisms underlying an organization's innovation absorptive capacity.

  9. Mouse Embryo Compaction.

    Science.gov (United States)

    White, M D; Bissiere, S; Alvarez, Y D; Plachta, N

    2016-01-01

    Compaction is a critical first morphological event in the preimplantation development of the mammalian embryo. Characterized by the transformation of the embryo from a loose cluster of spherical cells into a tightly packed mass, compaction is a key step in the establishment of the first tissue-like structures of the embryo. Although early investigation of the mechanisms driving compaction implicated changes in cell-cell adhesion, recent work has identified essential roles for cortical tension and a compaction-specific class of filopodia. During the transition from 8 to 16 cells, as the embryo is compacting, it must also make fundamental decisions regarding cell position, polarity, and fate. Understanding how these and other processes are integrated with compaction requires further investigation. Emerging imaging-based techniques that enable quantitative analysis from the level of cell-cell interactions down to the level of individual regulatory molecules will provide a greater understanding of how compaction shapes the early mammalian embryo. © 2016 Elsevier Inc. All rights reserved.

  10. Nanomaterial-Enabled Wearable Sensors for Healthcare.

    Science.gov (United States)

    Yao, Shanshan; Swetha, Puchakayala; Zhu, Yong

    2018-01-01

    Highly sensitive wearable sensors that can be conformably attached to human skin or integrated with textiles to monitor the physiological parameters of human body or the surrounding environment have garnered tremendous interest. Owing to the large surface area and outstanding material properties, nanomaterials are promising building blocks for wearable sensors. Recent advances in the nanomaterial-enabled wearable sensors including temperature, electrophysiological, strain, tactile, electrochemical, and environmental sensors are presented in this review. Integration of multiple sensors for multimodal sensing and integration with other components into wearable systems are summarized. Representative applications of nanomaterial-enabled wearable sensors for healthcare, including continuous health monitoring, daily and sports activity tracking, and multifunctional electronic skin are highlighted. Finally, challenges, opportunities, and future perspectives in the field of nanomaterial-enabled wearable sensors are discussed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. The ENABLER - Based on proven NERVA technology

    International Nuclear Information System (INIS)

    Livingston, J.M.; Pierce, B.L.

    1991-01-01

    The ENABLER reactor for use in a nuclear thermal propulsion engine uses the technology developed in the NERVA/Rover program, updated to incorporate advances in the technology. Using composite fuel, higher power densities per fuel element, improved radiation resistant control components and the advancements in use of carbon-carbon materials; the ENABLER can provide a specific impulse of 925 seconds, an engine thrust to weight (excluding reactor shield) approaching five, an improved initial mass in low Earth orbit and a consequent reduction in launch costs and logistics problems. This paper describes the 75,000 lbs thrust ENABLER design which is a low cost, low risk approach to meeting tommorrow's space propulsion needs

  12. The ENABLER - Based on proven NERVA technology

    Science.gov (United States)

    Livingston, Julie M.; Pierce, Bill L.

    The ENABLER reactor for use in a nuclear thermal propulsion engine uses the technology developed in the NERVA/Rover program, updated to incorporate advances in the technology. Using composite fuel, higher power densities per fuel element, improved radiation resistant control components and the advancements in use of carbon-carbon materials; the ENABLER can provide a specific impulse of 925 seconds, an engine thrust to weight (excluding reactor shield) approaching five, an improved initial mass in low Earth orbit and a consequent reduction in launch costs and logistics problems. This paper describes the 75,000 lbs thrust ENABLER design which is a low cost, low risk approach to meeting tommorrow's space propulsion needs.

  13. A Transgenic Tri-Modality Reporter Mouse

    OpenAIRE

    Yan, Xinrui; Ray, Pritha; Paulmurugan, Ramasamy; Tong, Ricky; Gong, Yongquan; Sathirachinda, Ataya; Wu, Joseph C.; Gambhir, Sanjiv S.

    2013-01-01

    Transgenic mouse with a stably integrated reporter gene(s) can be a valuable resource for obtaining uniformly labeled stem cells, tissues, and organs for various applications. We have generated a transgenic mouse model that ubiquitously expresses a tri-fusion reporter gene (fluc2-tdTomato-ttk) driven by a constitutive chicken β-actin promoter. This "Tri-Modality Reporter Mouse" system allows one to isolate most cells from this donor mouse and image them for bioluminescent (fluc2), fluorescent...

  14. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  15. Origami-enabled deformable silicon solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Rui; Huang, Hai; Liang, Hanshuang; Liang, Mengbing [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, Arizona 85287 (United States); Tu, Hongen; Xu, Yong [Electrical and Computer Engineering, Wayne State University, 5050 Anthony Wayne Dr., Detroit, Michigan 48202 (United States); Song, Zeming; Jiang, Hanqing, E-mail: hanqing.jiang@asu.edu [School for Engineering of Matter, Transport and Energy, Arizona State University, Tempe, Arizona 85287 (United States); Yu, Hongyu, E-mail: hongyu.yu@asu.edu [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, Arizona 85287 (United States); School of Earth and Space Exploration, Arizona State University, Tempe, Arizona 85287 (United States)

    2014-02-24

    Deformable electronics have found various applications and elastomeric materials have been widely used to reach flexibility and stretchability. In this Letter, we report an alternative approach to enable deformability through origami. In this approach, the deformability is achieved through folding and unfolding at the creases while the functional devices do not experience strain. We have demonstrated an example of origami-enabled silicon solar cells and showed that this solar cell can reach up to 644% areal compactness while maintaining reasonable good performance upon cyclic folding/unfolding. This approach opens an alternative direction of producing flexible, stretchable, and deformable electronics.

  16. Origami-enabled deformable silicon solar cells

    International Nuclear Information System (INIS)

    Tang, Rui; Huang, Hai; Liang, Hanshuang; Liang, Mengbing; Tu, Hongen; Xu, Yong; Song, Zeming; Jiang, Hanqing; Yu, Hongyu

    2014-01-01

    Deformable electronics have found various applications and elastomeric materials have been widely used to reach flexibility and stretchability. In this Letter, we report an alternative approach to enable deformability through origami. In this approach, the deformability is achieved through folding and unfolding at the creases while the functional devices do not experience strain. We have demonstrated an example of origami-enabled silicon solar cells and showed that this solar cell can reach up to 644% areal compactness while maintaining reasonable good performance upon cyclic folding/unfolding. This approach opens an alternative direction of producing flexible, stretchable, and deformable electronics

  17. Enabling Routes as Context in Mobile Services

    DEFF Research Database (Denmark)

    Brilingaite, Agne; Jensen, Christian Søndergaard; Zokaite, Nora

    2004-01-01

    With the continuing advances in wireless communications, geo-positioning, and portable electronics, an infrastructure is emerging that enables the delivery of on-line, location-enabled services to very large numbers of mobile users. A typical usage situation for mobile services is one characterized...... by a small screen and no keyboard, and by the service being only a secondary focus of the user. It is therefore particularly important to deliver the "right" information and service at the right time, with as little user interaction as possible. This may be achieved by making services context aware.Mobile...

  18. Nanotechnologv Enabled Biological and Chemical Sensors

    Science.gov (United States)

    Koehne, Jessica; Meyyappan, M.

    2011-01-01

    Nanotechnology is an enabling technology that will impact almost all economic sectors: one of the most important and with great potential is the health/medical sector. - Nanomaterials for drug delivery - Early warning sensors - Implantable devices - Artificial parts with improved characteristics Carbon nanotubes and nanofibers show promise for use in sensor development, electrodes and other biomedical applications.

  19. Action Learning: Avoiding Conflict or Enabling Action

    Science.gov (United States)

    Corley, Aileen; Thorne, Ann

    2006-01-01

    Action learning is based on the premise that action and learning are inextricably entwined and it is this potential, to enable action, which has contributed to the growth of action learning within education and management development programmes. However has this growth in action learning lead to an evolution or a dilution of Revan's classical…

  20. Creating an Economically Enabling and Competitive Business ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Creating an Economically Enabling and Competitive Business Environment in the West Bank and Gaza Strip. The prospect of indefinite Israeli occupation of the Palestinian territories, and their extreme dependence on foreign assistance and Israeli-controlled customs revenues, had led to the conclusion that the Palestinian ...

  1. Creating an Economically Enabling and Competitive Business ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Creating an Economically Enabling and Competitive Business Environment in the West Bank and Gaza Strip. The prospect of indefinite Israeli occupation of the ... Impact of implementing the Palestinian banking law on the performance of the private sector [Arabic language]. Documents. Impact of the commercial agents law ...

  2. Enabling DRM-preserving Digital content Redistribution

    NARCIS (Netherlands)

    Krishnan Nair, S.; Popescu, B.C.; Gamage, C.D.; Crispo, B.; Tanenbaum, A.S.

    2005-01-01

    Traditionally, the process of online digital content distribution has involved a limited number of centralised distributors selling protected contents and licenses authorising the use of the se contents, to consumers. In this paper, we extend this model by introducing a security scheme that enables

  3. Enablements and constraints to school leadership practice

    African Journals Online (AJOL)

    There are many schools in developing countries which, despite the challenges they face, defy the odds and continue to perform at exceptionally high levels. We cast our gaze on one of these resilient schools in South Africa, and sought to learn about the leadership practices prevalent in this school and the enablements and ...

  4. Sustainable Venture Capital Investments: An Enabler Investigation

    Directory of Open Access Journals (Sweden)

    Elena Antarciuc

    2018-04-01

    Full Text Available Investing in sustainable projects can help tackle the current sustainability challenges. Venture capital investments can contribute significantly to the growth of sustainable start-ups. Sustainable venture capital (SVC research is just emerging. This paper identifies enablers for sustainable venture capital investments in Saudi Arabia taking into account different stakeholders and firm’s tangible and intangible resources. Using perspectives from venture capital experts in Saudi Arabia and the grey-based Decision-Making Trial and Evaluation Laboratory (DEMATEL method, this study pinpoints the most critical enablers and investigates their causal and effect interconnections. The methodological process consists of reviewing the SVC literature and consulting the experts to identify the SVC enablers, creating a questionnaire, acquiring the answers from four experts, analyzing the data with grey-based DEMATEL and performing a sensitivity analysis. The government use of international standards, policies and regulations for sustainable investments, the commitment of the venture capitalists to sustainability and their deep understanding of sustainable business models are the most influential enablers. The paper concludes with implications for different actors, limitations and prospective directions for the sustainable venture capital research.

  5. 75 FR 13235 - IP-Enabled Services

    Science.gov (United States)

    2010-03-19

    ... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 63 [WC Docket No. 04-36; FCC 09-40] IP-Enabled Services AGENCY: Federal Communications Commission ACTION: Final rule; announcement of effective date... Internet Protocol (VoIP) service the discontinuance obligations that apply to domestic non-dominant...

  6. Extreme Networks' 10-Gigabit Ethernet enables

    CERN Multimedia

    2002-01-01

    " Extreme Networks, Inc.'s 10-Gigabit switching platform enabled researchers to transfer one Terabyte of information from Vancouver to Geneva across a single network hop, the world's first large-scale, end-to-end transfer of its kind" (1/2 page).

  7. Abnormal GABAA-mediated metabolic response in the MDX mouse - an explanation for the mental deficit in Duchenne muscular dystrophy?

    International Nuclear Information System (INIS)

    Rae, C.; Bubb, W.A.; Maitland, A.; Head, S.I.

    2001-01-01

    Full text: Duchenne muscular dystrophy is an X-linked disorder associated with lack of the 728 kDa protein dystrophin. In addition to the well-known muscle wasting, sufferers also experience a 15 point downshift in IQ. Recently reduced clustering of GABA A receptors in cerebellar Purkinje and hippocampal CA1 neurons has been shown in the murine homologue of DMD, the mdx mouse. In this work, the functional efficacy of GABA A receptors in mdx mice (C57B1/10Sc-Sn-mdx) and control was tested by examining the metabolism of [1- 13 C]D-glucose under both normoxic and hypoxic conditions and also by examining the metabolic response to the GABA A agonist muscimol (5-aminomethyl-3-hydroxyisoxazole). Although total measured [ 13 C] was identical in mdx cf. control mice, the fractional enrichment of all metabolites was increased in mdx mice, suggesting decreased inhibitory input in these animals. Further, although flux into metabolites from [1- 13 C]D-glucose decreased as expected in control mice in the presence of muscimol, the GABA a agonist had weaker effect in mdx mice, consistent with weaker GABA A activation. Finally, the response of mdx mouse brain tissue slices to mild hypoxia (partially mediated by GABA A ) was altered cf. control mice, with increased production of lactate and decreased flux into Krebs cycle intermediates. These data are consistent with a functional lesion of a subset of GABA A receptors in DMD

  8. The Mouse SAGE Site: database of public mouse SAGE libraries

    Czech Academy of Sciences Publication Activity Database

    Divina, Petr; Forejt, Jiří

    2004-01-01

    Roč. 32, - (2004), s. D482-D483 ISSN 0305-1048 R&D Projects: GA MŠk LN00A079; GA ČR GV204/98/K015 Grant - others:HHMI(US) 555000306 Institutional research plan: CEZ:AV0Z5052915 Keywords : mouse SAGE libraries * web -based database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.260, year: 2004

  9. Influence of age, irradiation and humanization on NSG mouse phenotypes

    Directory of Open Access Journals (Sweden)

    Jaclyn S. Knibbe-Hollinger

    2015-10-01

    Full Text Available Humanized mice are frequently utilized in bench to bedside therapeutic tests to combat human infectious, cancerous and degenerative diseases. For the fields of hematology-oncology, regenerative medicine, and infectious diseases, the immune deficient mice have been used commonly in basic research efforts. Obstacles in true translational efforts abound, as the relationship between mouse and human cells in disease pathogenesis and therapeutic studies requires lengthy investigations. The interplay between human immunity and mouse biology proves ever more complicated when aging, irradiation, and human immune reconstitution are considered. All can affect a range of biochemical and behavioral functions. To such ends, we show age- and irradiation-dependent influences for the development of macrocytic hyper chromic anemia, myelodysplasia, blood protein reductions and body composition changes. Humanization contributes to hematologic abnormalities. Home cage behavior revealed day and dark cycle locomotion also influenced by human cell reconstitutions. Significant age-related day-to-day variability in movement, feeding and drinking behaviors were observed. We posit that this data serves to enable researchers to better design translational studies in this rapidly emerging field of mouse humanization.

  10. Enabling ICU patients to die at home.

    Science.gov (United States)

    Battle, Emma; Bates, Lucy; Liderth, Emma; Jones, Samantha; Sheen, Sheryl; Ginty, Andrew; Northmore, Melanie

    2014-10-07

    There is often an overlap between intensive care medicine and palliative medicine. When all curative treatment options have been explored, keeping the patient comfortable and free from pain is the main concern for healthcare practitioners. Patient autonomy in end of life decisions has not been encouraged in the intensive care unit (ICU), until now, because of its specialised and technical nature. Staff at the Royal Bolton Hospital have broken down the barriers to enabling ICU patients to die in their own homes, and have developed a system of collaborative working that can help to fulfil a patient's final wish to go home. This article describes how ICU staff developed a process that enabled two ventilated patients to be transferred home for end of life care.

  11. Femtosecond laser enabled keratoplasty for advanced keratoconus

    Directory of Open Access Journals (Sweden)

    Yathish Shivanna

    2013-01-01

    Full Text Available Purpose : To assess the efficacy and advantages of femtosecond laser enabled keratoplasty (FLEK over conventional penetrating keratoplasty (PKP in advanced keratoconus. Materials and Methods: Detailed review of literature of published randomized controlled trials of operative techniques in PKP and FLEK. Results: Fifteen studies were identified, analyzed, and compared with our outcome. FLEK was found to have better outcome in view of better and earlier stabilization uncorrected visual acuity (UCVA, best corrected visual acuity (BCVA, and better refractive outcomes with low astigmatism as compared with conventional PKP. Wound healing also was noticed to be earlier, enabling early suture removal in FLEK. Conclusions: Studies relating to FLEK have shown better results than conventional PKP, however further studies are needed to assess the safety and intraoperative complications of the procedure.

  12. Enablers & Barriers for Realizing Modularity Benefits

    DEFF Research Database (Denmark)

    Storbjerg, Simon Haahr; Brunø, Thomas Ditlev; Thyssen, Jesper

    2012-01-01

    far less attention compared to the theories and methods concerning modularization of technical systems. Harvesting the full potential of modularization, particularly in relation to product development agility, depends on more than an optimal architecture. Key enablers in this context......Although modularization is becoming both a well-described domain in academia and a broadly applied concept in business, many of today’s firm still struggle to realize the promised benefits of this approach. Managing modularization is a complex matter, and in spite of this, a topic that has received...... are the organizational and systems related aspects. Recognizing the need for guidance to realize the benefits of modularity, the purpose of this study is through a literature study and a case study to improve the insight into the organizational and systems related enablers and barriers with regard to obtaining the full...

  13. NASP - Enabling new space launch options

    Science.gov (United States)

    Froning, David; Gaubatz, William; Mathews, George

    1990-10-01

    Successful NASP developments in the United States are bringing about the possibility of effective, fully reusable vehicles for transport of people and cargo between earth and space. These developments include: extension of airbreathing propulsion to a much higher speed; densification of propellants for greater energy per unit volume of mass; structures with much greater strength-to-weight at high temperatures; computational advancements that enable more optimal design and integration of airframes, engines and controls; and advances in avionics, robotics, artificial intelligence and automation that enable accomplishment of earth-to-orbit (ETO) operations with much less manpower support and cost. This paper describes the relative magnitude of improvement that these developments may provide.

  14. Enabling Sustainable Improvement in IT Entrepreneurship

    Directory of Open Access Journals (Sweden)

    Paul E. Renaud

    2013-06-01

    Full Text Available Firms must embrace processes that enable the information technology (IT function to become a strategic partner to the business functions it serves. Process ambidexterity is a way for processes to be augmented to improve alignment and adaptability to new markets and technologies. By applying the principles of process ambidexterity, the key elements required for sustainable change within the capabilities that comprise the IT function of the firm are identified. Furthermore, the scope and depth of the dysfunction that is widespread across large firms that depend upon IT are outlined to provide a contextual basis for presenting a solution framework to address sustainable change. This framework for sustainable change is of primary benefit to IT executives seeking to systematically transform the IT function and enable IT entrepreneurship.

  15. Enabling Routes as Context in Mobile Services

    DEFF Research Database (Denmark)

    Brilingaite, Agne; Jensen, Christian Søndergaard; Zokaite, Nora

    With the continuing advances in wireless communications, geo-positioning, and portable electronics, an infrastructure is emerging that enables the delivery of on-line, location-enabled services to very large numbers of mobile users. A typical usage situation for mobile services is one characteriz...... and accumulates the routes of a user along with their usage patterns and that makes the routes available to services. Experiences from using the component on logs of GPS positions acquired from vehicles traveling within a real road network are reported....... by a small screen and no keyboard, and by the service being only a secondary focus of the user. Under such circumstances, it is particularly important to deliver the "right" information and service at the right time, with as little user interaction as possible. This may be achieved by making services context...

  16. Ethics case reflection sessions: Enablers and barriers.

    Science.gov (United States)

    Bartholdson, Cecilia; Molewijk, Bert; Lützén, Kim; Blomgren, Klas; Pergert, Pernilla

    2018-03-01

    In previous research on ethics case reflection (ECR) sessions about specific cases, healthcare professionals in childhood cancer care were clarifying their perspectives on the ethical issue to resolve their main concern of consolidating care. When perspectives were clarified, consequences in the team included 'increased understanding', 'group strengthening' and 'decision grounding'. Additional analysis of the data was needed on conditions that could contribute to the quality of ECR sessions. The aim of this study was to explore conditions for clarifying perspectives during ECR sessions. Data were collected from observations and interviews and the results emerged from an inductive analysis using grounded theory. Participants and research context: Six observations during ECR sessions and 10 interviews were performed with healthcare professionals working in childhood cancer care and advanced paediatric homecare. Ethical considerations: The study was approved by a regional ethical review board. Participants were informed about their voluntary involvement and that they could withdraw their participation without explaining why. Two categories emerged: organizational enablers and barriers and team-related enablers and barriers. Organizational enablers and barriers included the following sub-categories: the timing of the ECR session, the structure during the ECR session and the climate during the ECR session. Sub-categories to team-related enablers and barriers were identified as space for inter-professional perspectives, varying levels of ethical skills and space for the patient's and the family's perspectives. Space for inter-professional perspectives included the dominance of a particular perspective that can result from hierarchical positions. The medical perspective is relevant for understanding the child's situation but should not dominate the ethical reflection. Conditions for ECR sessions have been explored and the new knowledge can be used when training

  17. Contextual Interaction Design Research: Enabling HCI

    OpenAIRE

    Murer , Martin; Meschtscherjakov , Alexander; Fuchsberger , Verena; Giuliani , Manuel; Neureiter , Katja; Moser , Christiane; Aslan , Ilhan; Tscheligi , Manfred

    2015-01-01

    International audience; Human-Computer Interaction (HCI) has always been about humans, their needs and desires. Contemporary HCI thinking investigates interactions in everyday life and puts an emphasis on the emotional and experiential qualities of interactions. At the Center for Human-Computer Interaction we seek to bridge meandering strands in the field by following a guiding metaphor that shifts focus to what has always been the core quality of our research field: Enabling HCI, as a leitmo...

  18. IT Enabled Agility in Organizational Ambidexterity

    OpenAIRE

    Röder, Nina; Schermann, Michael; Krcmar, Helmut

    2015-01-01

    The aim of ambidextrous organizations is to balance exploratory and exploitative learning concepts. They innovate through experiments and research, and capture the value of innovations through refinement and continuous improvement. In this paper, we study the relationship of organizational ambidexterity and IT enabled agility. Based on a case study with a German car manufacturer we find that (1) entrepreneurial agility impedes exploitative concepts, (2) adaptive agility impedes exploratory co...

  19. Naval Science & Technology: Enabling the Future Force

    Science.gov (United States)

    2013-04-01

    corn for disruptive technologies Laser Cooling Spintronics Bz 1st U.S. Intel satellite GRAB Semiconductors GaAs, GaN, SiC GPS...Payoff • Innovative and game-changing • Approved by Corporate Board • Delivers prototype Innovative Naval Prototypes (5-10 Year) Disruptive ... Technologies Free Electron Laser Integrated Topside EM Railgun Sea Base Enablers Tactical Satellite Large Displacement UUV AACUS Directed

  20. An animal model for Norrie disease (ND): gene targeting of the mouse ND gene.

    Science.gov (United States)

    Berger, W; van de Pol, D; Bächner, D; Oerlemans, F; Winkens, H; Hameister, H; Wieringa, B; Hendriks, W; Ropers, H H

    1996-01-01

    In order to elucidate the cellular and molecular processes which are involved in Norrie disease (ND), we have used gene targeting technology to generate ND mutant mice. The murine homologue of the ND gene was cloned and shown to encode a polypeptide that shares 94% of the amino acid sequence with its human counterpart. RNA in situ hybridization revealed expression in retina, brain and the olfactory bulb and epithelium of 2 week old mice. Hemizygous mice carrying a replacement mutation in exon 2 of the ND gene developed retrolental structures in the vitreous body and showed an overall disorganization of the retinal ganglion cell layer. The outer plexiform layer disappears occasionally, resulting in a juxtaposed inner and outer nuclear layer. At the same regions, the outer segments of the photoreceptor cell layer are no longer present. These ocular findings are consistent with observations in ND patients and the generated mouse line provides a faithful model for study of early pathogenic events in this severe X-linked recessive neurological disorder.

  1. Novel LIMK2 Inhibitor Blocks Panc-1 Tumor Growth in a mouse xenograft model.

    Science.gov (United States)

    Rak, Roni; Haklai, Roni; Elad-Tzfadia, Galit; Wolfson, Haim J; Carmeli, Shmuel; Kloog, Yoel

    2014-01-01

    LIM kinases (LIMKs) are important cell cytoskeleton regulators that play a prominent role in cancer manifestation and neuronal diseases. The LIMK family consists of two homologues, LIMK1 and LIMK2, which differ from one another in expression profile, intercellular localization, and function. The main substrate of LIMK is cofilin, a member of the actin-depolymerizing factor (ADF) protein family. When phosphorylated by LIMK, cofilin is inactive. LIMKs play a contributory role in several neurodevelopmental disorders and in cancer growth and metastasis. We recently reported the development and validation of a novel LIMK inhibitor, referred to here as T56-LIMKi, using a combination of computational methods and classical biochemistry techniques. Here we report that T56-LIMKi inhibits LIMK2 with high specificity, and shows little or no cross-reactivity with LIMK1. We found that T56-LIMKi decreases phosphorylated cofilin (p-cofilin) levels and thus inhibits growth of several cancerous cell lines, including those of pancreatic cancer, glioma and schwannoma. Because the most promising in-vitro effect of T56-LIMKi was observed in the pancreatic cancer cell line Panc-1, we tested the inhibitor on a nude mouse Panc-1 xenograft model. T56-LIMKi reduced tumor size and p-cofilin levels in the Panc-1 tumors, leading us to propose T56-LIMKi as a candidate drug for cancer therapy.

  2. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  3. Diffusion tensor imaging using multiple coils for mouse brain connectomics.

    Science.gov (United States)

    Nouls, John C; Badea, Alexandra; Anderson, Robert B J; Cofer, Gary P; Allan Johnson, G

    2018-04-19

    The correlation between brain connectivity and psychiatric or neurological diseases has intensified efforts to develop brain connectivity mapping techniques on mouse models of human disease. The neural architecture of mouse brain specimens can be shown non-destructively and three-dimensionally by diffusion tensor imaging, which enables tractography, the establishment of a connectivity matrix and connectomics. However, experiments on cohorts of animals can be prohibitively long. To improve throughput in a 7-T preclinical scanner, we present a novel two-coil system in which each coil is shielded, placed off-isocenter along the axis of the magnet and connected to a receiver circuit of the scanner. Preservation of the quality factor of each coil is essential to signal-to-noise ratio (SNR) performance and throughput, because mouse brain specimen imaging at 7 T takes place in the coil-dominated noise regime. In that regime, we show a shielding configuration causing no SNR degradation in the two-coil system. To acquire data from several coils simultaneously, the coils are placed in the magnet bore, around the isocenter, in which gradient field distortions can bias diffusion tensor imaging metrics, affect tractography and contaminate measurements of the connectivity matrix. We quantified the experimental alterations in fractional anisotropy and eigenvector direction occurring in each coil. We showed that, when the coils were placed 12 mm away from the isocenter, measurements of the brain connectivity matrix appeared to be minimally altered by gradient field distortions. Simultaneous measurements on two mouse brain specimens demonstrated a full doubling of the diffusion tensor imaging throughput in practice. Each coil produced images devoid of shading or artifact. To further improve the throughput of mouse brain connectomics, we suggested a future expansion of the system to four coils. To better understand acceptable trade-offs between imaging throughput and connectivity

  4. Cultures of preimplantation mouse embryos

    International Nuclear Information System (INIS)

    Streffer, C.; Molls, M.

    1987-01-01

    In the preimplantation mouse embryos the chromosomal damage develops through several postradiation cell cycles and mitoses. New chromosome aberrations are seen during the second and third postradiation mitoses. Also, more micronuclei appear during later postradiation interphases. This is in agreement with the assumption that unrepaired chromosomal radiation damage develops during the cell generation cycle to such a form (i.e. double-strand breaks in DNA) that chromosomal breaks occur. This proposition is strengthened by the observation that radiation-induced damage is more rapidly expressed after neutron exposure (first or second postradiation mitosis) than after exposure to X rays at the one- or two-cell stage. The preimplantation mouse embryo culture is an inviting system for additional studies at the molecular level, especially now that within the last few years more sensitive methods have been developed for study of DNA and protein structure, regulation, and synthesis. The results from these studies of cultures of preimplantation mouse embryos present a favorable case for the study of complex biological systems under very defined conditions in vitro for extrapolation to effects in vivo

  5. Mouse Models of Gastric Cancer

    Science.gov (United States)

    Hayakawa, Yoku; Fox, James G.; Gonda, Tamas; Worthley, Daniel L.; Muthupalani, Sureshkumar; Wang, Timothy C.

    2013-01-01

    Animal models have greatly enriched our understanding of the molecular mechanisms of numerous types of cancers. Gastric cancer is one of the most common cancers worldwide, with a poor prognosis and high incidence of drug-resistance. However, most inbred strains of mice have proven resistant to gastric carcinogenesis. To establish useful models which mimic human gastric cancer phenotypes, investigators have utilized animals infected with Helicobacter species and treated with carcinogens. In addition, by exploiting genetic engineering, a variety of transgenic and knockout mouse models of gastric cancer have emerged, such as INS-GAS mice and TFF1 knockout mice. Investigators have used the combination of carcinogens and gene alteration to accelerate gastric cancer development, but rarely do mouse models show an aggressive and metastatic gastric cancer phenotype that could be relevant to preclinical studies, which may require more specific targeting of gastric progenitor cells. Here, we review current gastric carcinogenesis mouse models and provide our future perspectives on this field. PMID:24216700

  6. Identification of crucial amino acids in mouse aldehyde oxidase 3 that determine substrate specificity.

    Directory of Open Access Journals (Sweden)

    Martin Mahro

    Full Text Available In order to elucidate factors that determine substrate specificity and activity of mammalian molybdo-flavoproteins we performed site directed mutagenesis of mouse aldehyde oxidase 3 (mAOX3. The sequence alignment of different aldehyde oxidase (AOX isoforms identified variations in the active site of mAOX3 in comparison to other AOX proteins and xanthine oxidoreductases (XOR. Based on the structural alignment of mAOX3 and bovine XOR, differences in amino acid residues involved in substrate binding in XORs in comparison to AOXs were identified. We exchanged several residues in the active site to the ones found in other AOX homologues in mouse or to residues present in bovine XOR in order to examine their influence on substrate selectivity and catalytic activity. Additionally we analyzed the influence of the [2Fe-2S] domains of mAOX3 on its kinetic properties and cofactor saturation. We applied UV-VIS and EPR monitored redox-titrations to determine the redox potentials of wild type mAOX3 and mAOX3 variants containing the iron-sulfur centers of mAOX1. In addition, a combination of molecular docking and molecular dynamic simulations (MD was used to investigate factors that modulate the substrate specificity and activity of wild type and AOX variants. The successful conversion of an AOX enzyme to an XOR enzyme was achieved exchanging eight residues in the active site of mAOX3. It was observed that the absence of the K889H exchange substantially decreased the activity of the enzyme towards all substrates analyzed, revealing that this residue has an important role in catalysis.

  7. Enrichment of Female Germline Stem Cells from Mouse Ovaries Using the Differential Adhesion Method

    Directory of Open Access Journals (Sweden)

    Meng Wu

    2018-04-01

    Full Text Available Background/Aims: The isolation and establishment of female germline stem cells (FGSCs is controversial because of questions regarding the reliability and stability of the isolation method using antibody targeting mouse vasa homologue (MVH, and the molecular mechanism of FGSCs self-renewal remains unclear. Thus, there needs to be a simple and reliable method for sorting FGSCs to study them. Methods: We applied the differential adhesion method to enrich FGSCs (DA-FGSCs from mouse ovaries. Through four rounds of purification and 7-9 subsequent passages, DA-FGSC lines were established. In addition, we assessed the role of the phosphoinositide-3 kinase (PI3K-AKT pathway in regulating FGSC self-renewal. Results: The obtained DA-FGSCs spontaneously differentiated into oocyte-like cells in vitro and formed functional eggs in vivo that were fertilized and produced healthy offspring. AKT was rapidly phosphorylated when the proliferation rate of FGSCs increased after 10 passages, and the addition of a chemical PI3K inhibitor prevented FGSCs self-renewal. Furthermore, over-expression of AKT-induced proliferation and differentiation of FGSCs, c-Myc, Oct-4 and Gdf-9 levels were increased. Conclusions: The differential adhesion method provides a more feasible approach and is an easier procedure to establish FGSC lines than traditional methods. The AKT pathway plays an important role in regulation of the proliferation and maintenance of FGSCs. These findings could help promote stem cell studies and provide a better understanding of causes of ovarian infertility, thereby providing potential treatments for infertility.

  8. Enrichment of Female Germline Stem Cells from Mouse Ovaries Using the Differential Adhesion Method.

    Science.gov (United States)

    Wu, Meng; Xiong, Jiaqiang; Ma, Lingwei; Lu, Zhiyong; Qin, Xian; Luo, Aiyue; Zhang, Jinjin; Xie, Huan; Shen, Wei; Wang, Shixuan

    2018-04-28

    The isolation and establishment of female germline stem cells (FGSCs) is controversial because of questions regarding the reliability and stability of the isolation method using antibody targeting mouse vasa homologue (MVH), and the molecular mechanism of FGSCs self-renewal remains unclear. Thus, there needs to be a simple and reliable method for sorting FGSCs to study them. We applied the differential adhesion method to enrich FGSCs (DA-FGSCs) from mouse ovaries. Through four rounds of purification and 7-9 subsequent passages, DA-FGSC lines were established. In addition, we assessed the role of the phosphoinositide-3 kinase (PI3K)-AKT pathway in regulating FGSC self-renewal. The obtained DA-FGSCs spontaneously differentiated into oocyte-like cells in vitro and formed functional eggs in vivo that were fertilized and produced healthy offspring. AKT was rapidly phosphorylated when the proliferation rate of FGSCs increased after 10 passages, and the addition of a chemical PI3K inhibitor prevented FGSCs self-renewal. Furthermore, over-expression of AKT-induced proliferation and differentiation of FGSCs, c-Myc, Oct-4 and Gdf-9 levels were increased. The differential adhesion method provides a more feasible approach and is an easier procedure to establish FGSC lines than traditional methods. The AKT pathway plays an important role in regulation of the proliferation and maintenance of FGSCs. These findings could help promote stem cell studies and provide a better understanding of causes of ovarian infertility, thereby providing potential treatments for infertility. © 2018 The Author(s). Published by S. Karger AG, Basel.

  9. Web-enabling technologies for the factory floor: a web-enabling strategy for emanufacturing

    Science.gov (United States)

    Velez, Ricardo; Lastra, Jose L. M.; Tuokko, Reijo O.

    2001-10-01

    This paper is intended to address the different technologies available for Web-enabling of the factory floor. It will give an overview of the importance of Web-enabling of the factory floor, in the application of the concepts of flexible and intelligent manufacturing, in conjunction with e-commerce. As a last section, it will try to define a Web-enabling strategy for the application in eManufacturing. This is made under the scope of the electronics manufacturing industry, so every application, technology or related matter is presented under such scope.

  10. Gene function in early mouse embryonic stem cell differentiation

    Directory of Open Access Journals (Sweden)

    Campbell Pearl A

    2007-03-01

    Full Text Available Abstract Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5 undergoing undirected differentiation into embryoid bodies (EBs over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1, our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2 that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of m

  11. Identifying enabling management practices for employee engagement

    Directory of Open Access Journals (Sweden)

    Marius Joubert

    2011-12-01

    Full Text Available Orientation: A currently emerging viewpoint is that today's management practices no longer add value to organisations. The focus of this article is to conduct a systematic review of the scholarly literature on management practices that could be related to employee engagement. Research purpose: This study searched for evidence in support of the notion of a management value chain, and enabling management practices within each value chain component that could relate to employee engagement. Motivation for the study: An alternative management value chain model could contribute towards a better understanding of which management practices may potentially impact employee engagement. Research design, approach, and method: This is a non-empirical (theoretical study, based on a systematic, in-depth literature review to identify the key management components and enabling practices within this proposed management value chain. Scholarly research databases were sourced for relevant peer reviewed research conducted since 1990, not excluding important contributions prior to 1990. The literature was systematically searched, selected, studied, and contextualized within this study. Main findings: Support was found for the notion of a management value chain, for enabling management practices within each proposed management value chain component, and it was also established these management practices indeed have an impact on employee engagement. Practical/managerial/implications: The possibility that management work can be presented as a generic management value chain allows managers to approach engaging management practices more systematically. Contribution/value-add: This study highlights the importance of some management practices that have never been seen as part of management work.

  12. A wireless sensor enabled by wireless power.

    Science.gov (United States)

    Lee, Da-Sheng; Liu, Yu-Hong; Lin, Chii-Ruey

    2012-11-22

    Through harvesting energy by wireless charging and delivering data by wireless communication, this study proposes the concept of a wireless sensor enabled by wireless power (WPWS) and reports the fabrication of a prototype for functional tests. One WPWS node consists of wireless power module and sensor module with different chip-type sensors. Its main feature is the dual antenna structure. Following RFID system architecture, a power harvesting antenna was designed to gather power from a standard reader working in the 915 MHz band. Referring to the Modbus protocol, the other wireless communication antenna was integrated on a node to send sensor data in parallel. The dual antenna structure integrates both the advantages of an RFID system and a wireless sensor. Using a standard UHF RFID reader, WPWS can be enabled in a distributed area with a diameter up to 4 m. Working status is similar to that of a passive tag, except that a tag can only be queried statically, while the WPWS can send dynamic data from the sensors. The function is the same as a wireless sensor node. Different WPWSs equipped with temperature and humidity, optical and airflow velocity sensors are tested in this study. All sensors can send back detection data within 8 s. The accuracy is within 8% deviation compared with laboratory equipment. A wireless sensor network enabled by wireless power should be a totally wireless sensor network using WPWS. However, distributed WPWSs only can form a star topology, the simplest topology for constructing a sensor network. Because of shielding effects, it is difficult to apply other complex topologies. Despite this limitation, WPWS still can be used to extend sensor network applications in hazardous environments. Further research is needed to improve WPWS to realize a totally wireless sensor network.

  13. Thermodynamic theory of dislocation-enabled plasticity

    International Nuclear Information System (INIS)

    Langer, J. S.

    2017-01-01

    The thermodynamic theory of dislocation-enabled plasticity is based on two unconventional hypotheses. The first of these is that a system of dislocations, driven by external forces and irreversibly exchanging heat with its environment, must be characterized by a thermodynamically defined effective temperature that is not the same as the ordinary temperature. The second hypothesis is that the overwhelmingly dominant mechanism controlling plastic deformation is thermally activated depinning of entangled pairs of dislocations. This paper consists of a systematic reformulation of this theory followed by examples of its use in analyses of experimentally observed phenomena including strain hardening, grain-size (Hall-Petch) effects, yielding transitions, and adiabatic shear banding.

  14. Enabling Rapid Naval Architecture Design Space Exploration

    Science.gov (United States)

    Mueller, Michael A.; Dufresne, Stephane; Balestrini-Robinson, Santiago; Mavris, Dimitri

    2011-01-01

    Well accepted conceptual ship design tools can be used to explore a design space, but more precise results can be found using detailed models in full-feature computer aided design programs. However, defining a detailed model can be a time intensive task and hence there is an incentive for time sensitive projects to use conceptual design tools to explore the design space. In this project, the combination of advanced aerospace systems design methods and an accepted conceptual design tool facilitates the creation of a tool that enables the user to not only visualize ship geometry but also determine design feasibility and estimate the performance of a design.

  15. PHM Enabled Autonomous Propellant Loading Operations

    Science.gov (United States)

    Walker, Mark; Figueroa, Fernando

    2017-01-01

    The utility of Prognostics and Health Management (PHM) software capability applied to Autonomous Operations (AO) remains an active research area within aerospace applications. The ability to gain insight into which assets and subsystems are functioning properly, along with the derivation of confident predictions concerning future ability, reliability, and availability, are important enablers for making sound mission planning decisions. When coupled with software that fully supports mission planning and execution, an integrated solution can be developed that leverages state assessment and estimation for the purposes of delivering autonomous operations. The authors have been applying this integrated, model-based approach to the autonomous loading of cryogenic spacecraft propellants at Kennedy Space Center.

  16. Camera-enabled techniques for organic synthesis

    Directory of Open Access Journals (Sweden)

    Steven V. Ley

    2013-05-01

    Full Text Available A great deal of time is spent within synthetic chemistry laboratories on non-value-adding activities such as sample preparation and work-up operations, and labour intensive activities such as extended periods of continued data collection. Using digital cameras connected to computer vision algorithms, camera-enabled apparatus can perform some of these processes in an automated fashion, allowing skilled chemists to spend their time more productively. In this review we describe recent advances in this field of chemical synthesis and discuss how they will lead to advanced synthesis laboratories of the future.

  17. Blended Learning: enabling Higher Education Reform

    Directory of Open Access Journals (Sweden)

    Kathleen Matheos

    2018-01-01

    Full Text Available Blended learning research and practice have been areas of growth for two decades in Canada, with over 95% of Canadian higher education institutions involved in some form of blended learning. Despite strong evidence based research and practice blended learning, for the most part, has remained at sidelined in Canadian universities. The article argues the need for blended learning to situate itself within the timely and crucial Higher Education Reform (HER agenda. By aligning the affordances of blended learning with the components of HER, blended learning can clearly serve as an enabler for HER.

  18. Product Line Enabled Intelligent Mobile Middleware

    DEFF Research Database (Denmark)

    Zhang, Weishan; Kunz, Thomas; Hansen, Klaus Marius

    2007-01-01

    research project called PLIMM that focuses on user-centered application scenarios. PLIMM is designed based on software product line ideas which make it possible for specialized customization and optimization for different purposes and hardware/software platforms. To enable intelligence, the middleware...... needs access to a range of context models. We model these contexts with OWL, focusing on user-centered concepts. The basic building block of PLIMM is the enhanced BDI agent where OWL context ontology logic reasoning will add indirect beliefs to the belief sets. Our approach also addresses the handling...

  19. Framework for Enabling User-Generated Content

    OpenAIRE

    Nilsson, Karin H

    2012-01-01

    User-generated content, UGC, is a modern topic today and refers to media and creative works created by Internet users and posted on the Internet. More and more application developers wants to offer sharing functionalities in their applications and on their websites. The alternatives of doing so today are to use UGC platforms API, like Facebook and Twitter, to upload the content to that specific platform or to implement the framework ShareKit that enables the user to share their content on mul...

  20. Enabling information sharing in a port

    DEFF Research Database (Denmark)

    Olesen, Peter Bjerg; Hvolby, Hans-Henrik; Dukovska-Popovska, Iskra

    2012-01-01

    Ports are integral parts of many supply chains and are as such a contributing factor to the overall efficiency of the supply chain. Ports are also dynamic entities where things changes continuously. The dynamic nature of ports is also a problem when trying to optimise the utilisation of resources...... and ensure a low lead-time. Information sharing is a very important tool to reduce the effect of dynamism. This paper attempts to explain how information sharing is enabled in such an environment, and which considerations are relevant, both in regards to the information and required technology. The paper...

  1. Nanoarchitecture Control Enabled by Ionic Liquids

    Science.gov (United States)

    Murdoch, Heather A.; Limmer, Krista R.; Labukas, Joseph P.

    2017-04-01

    Ionic liquids have many advantages over traditional aqueous electrosynthesis for fabrication of functional nanoarchitectures, including enabling the integration of nanoparticles into traditional coatings, superhydrophobicity, nanofoams, and other hierarchical structures. Shape and size control through ionic liquid selection and processing conditions can synthesize nanoparticles and nanoarchitectures without the use of capping agents, surfactants, or templates that are often deleterious to the functionality of the resultant system. Here we give a brief overview of some recent and interesting applications of ionic liquids to the synthesis of nanoparticles and nanoarchitectures.

  2. Principles for enabling deep secondary design

    DEFF Research Database (Denmark)

    Pries-Heje, Jan; Hansen, Magnus Rotvit Perlt

    2017-01-01

    design by analyzing two cases where secondary designers fundamentally change functionality, content and technology complexity level. The first case redesigns a decision model for agile development in an insurance company; the second creates a contingency model for choosing project management tools...... and techniques in a hospital. Our analysis of the two cases leads to the identification of four principles of design implementation that primary designers can apply to enable secondary design and four corresponding design implementation principles that secondary designers themselves need to apply....

  3. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  4. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  5. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  6. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  7. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  8. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  9. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  10. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  11. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  12. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  13. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  14. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  15. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  16. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  17. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  18. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  20. Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

    Science.gov (United States)

    Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

    1995-02-15

    The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

  1. Mouse forward genetics in the study of the peripheral nervous system and human peripheral neuropathy

    Science.gov (United States)

    Douglas, Darlene S.; Popko, Brian

    2009-01-01

    Forward genetics, the phenotype-driven approach to investigating gene identity and function, has a long history in mouse genetics. Random mutations in the mouse transcend bias about gene function and provide avenues towards unique discoveries. The study of the peripheral nervous system is no exception; from historical strains such as the trembler mouse, which led to the identification of PMP22 as a human disease gene causing multiple forms of peripheral neuropathy, to the more recent identification of the claw paw and sprawling mutations, forward genetics has long been a tool for probing the physiology, pathogenesis, and genetics of the PNS. Even as spontaneous and mutagenized mice continue to enable the identification of novel genes, provide allelic series for detailed functional studies, and generate models useful for clinical research, new methods, such as the piggyBac transposon, are being developed to further harness the power of forward genetics. PMID:18481175

  2. Enablers of and barriers to abortion training.

    Science.gov (United States)

    Guiahi, Maryam; Lim, Sahnah; Westover, Corey; Gold, Marji; Westhoff, Carolyn L

    2013-06-01

    Since the legalization of abortion services in the United States, provision of abortions has remained a controversial issue of high political interest. Routine abortion training is not offered at all obstetrics and gynecology (Ob-Gyn) training programs, despite a specific training requirement by the Accreditation Council for Graduate Medical Education. Previous studies that described Ob-Gyn programs with routine abortion training either examined associations by using national surveys of program directors or described the experience of a single program. We set out to identify enablers of and barriers to Ob-Gyn abortion training in the context of a New York City political initiative, in order to better understand how to improve abortion training at other sites. We conducted in-depth qualitative interviews with 22 stakeholders from 7 New York City public hospitals and focus group interviews with 62 current residents at 6 sites. Enablers of abortion training included program location, high-capacity services, faculty commitment to abortion training, external programmatic support, and resident interest. Barriers to abortion training included lack of leadership continuity, leadership conflict, lack of second-trimester abortion services, difficulty obtaining mifepristone, optional rather than routine training, and antiabortion values of hospital personnel. Supportive leadership, faculty commitment, and external programmatic support appear to be key elements for establishing routine abortion training at Ob-Gyn residency training programs.

  3. Enabling technologies for oil sands development

    International Nuclear Information System (INIS)

    Bailey, R.T.

    1998-01-01

    A review of oil sands production and expansion possibilities in Alberta were presented. The enabling technologies for oil sands projects include mining (bucketwheels, draglines, trucks, shovels conveyors, slurry hydrotransport); extraction (conditioning tumblers, pipelines, tanks, hot water, caustic, cold water, frothers); froth cleaning (centrifuges, solvent treatment); tailings (tailings ponds, consolidated tailings); and upgrading (coking, hydrotreating for SCO, hydrocracking and multiple products). The enabling technologies for in situ production include cyclic steam stimulation for vertical wells, steam assisted gravity drainage (SAGD) for dual horizontal wells, and cold production with wormholes. This paper described the recovery potentials of each of these processes. It also discussed the role of government and industry in research and cooperative research involving both the private and public sectors. Examples of each of these were described such as SAGD, the OSLO cold water extraction process, The consolidated tailings (CT) project, the low energy extraction process (slurry production, hydrotransport, pipeline conditioning and warm water extraction), and research in fine tailings, to demonstrate that although objectives may differ, government and industry research objectives are complementary

  4. Blue space geographies: Enabling health in place.

    Science.gov (United States)

    Foley, Ronan; Kistemann, Thomas

    2015-09-01

    Drawing from research on therapeutic landscapes and relationships between environment, health and wellbeing, we propose the idea of 'healthy blue space' as an important new development Complementing research on healthy green space, blue space is defined as; 'health-enabling places and spaces, where water is at the centre of a range of environments with identifiable potential for the promotion of human wellbeing'. Using theoretical ideas from emotional and relational geographies and critical understandings of salutogenesis, the value of blue space to health and wellbeing is recognised and evaluated. Six individual papers from five different countries consider how health can be enabled in mixed blue space settings. Four sub-themes; embodiment, inter-subjectivity, activity and meaning, document multiple experiences within a range of healthy blue spaces. Finally, we suggest a considerable research agenda - theoretical, methodological and applied - for future work within different forms of blue space. All are suggested as having public health policy relevance in social and public space. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Directory Enabled Policy Based Networking; TOPICAL

    International Nuclear Information System (INIS)

    KELIIAA, CURTIS M.

    2001-01-01

    This report presents a discussion of directory-enabled policy-based networking with an emphasis on its role as the foundation for securely scalable enterprise networks. A directory service provides the object-oriented logical environment for interactive cyber-policy implementation. Cyber-policy implementation includes security, network management, operational process and quality of service policies. The leading network-technology vendors have invested in these technologies for secure universal connectivity that transverses Internet, extranet and intranet boundaries. Industry standards are established that provide the fundamental guidelines for directory deployment scalable to global networks. The integration of policy-based networking with directory-service technologies provides for intelligent management of the enterprise network environment as an end-to-end system of related clients, services and resources. This architecture allows logical policies to protect data, manage security and provision critical network services permitting a proactive defense-in-depth cyber-security posture. Enterprise networking imposes the consideration of supporting multiple computing platforms, sites and business-operation models. An industry-standards based approach combined with principled systems engineering in the deployment of these technologies allows these issues to be successfully addressed. This discussion is focused on a directory-based policy architecture for the heterogeneous enterprise network-computing environment and does not propose specific vendor solutions. This document is written to present practical design methodology and provide an understanding of the risks, complexities and most important, the benefits of directory-enabled policy-based networking

  6. Steroid metabolism in the mouse placenta

    International Nuclear Information System (INIS)

    Okker-Reitsma, G.H.

    1976-01-01

    The purpose of the study described in this thesis was to investigate the capacity for steroid synthesis of the mouse placenta - especially the production of progesterone, androgens and estrogens - and to determine, if possible, the relation of steroid synthesis to special cell types. In an introductory chapter the androgen production in the mouse placenta is surveyed by means of a histochemical and bioindicator study of different stages of development of the placenta. The metabolism of [ 3 H]-dehydroepiandrosterone and [ 3 H]-progesterone by mouse placental tissue in vitro is studied. The metabolism of [ 3 H]-progesterone by the mouse fetal adrenal in vitro is also studied

  7. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  8. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  10. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Therapeutic cloning in the mouse

    Science.gov (United States)

    Mombaerts, Peter

    2003-01-01

    Nuclear transfer technology can be applied to produce autologous differentiated cells for therapeutic purposes, a concept termed therapeutic cloning. Countless articles have been published on the ethics and politics of human therapeutic cloning, reflecting the high expectations from this new opportunity for rejuvenation of the aging or diseased body. Yet the research literature on therapeutic cloning, strictly speaking, is comprised of only four articles, all in the mouse. The efficiency of derivation of embryonic stem cell lines via nuclear transfer is remarkably consistent among these reports. However, the efficiency is so low that, in its present form, the concept is unlikely to become widespread in clinical practice. PMID:12949262

  12. Microsystem enabled photovoltaic modules and systems

    Science.gov (United States)

    Nielson, Gregory N; Sweatt, William C; Okandan, Murat

    2015-05-12

    A microsystem enabled photovoltaic (MEPV) module including: an absorber layer; a fixed optic layer coupled to the absorber layer; a translatable optic layer; a translation stage coupled between the fixed and translatable optic layers; and a motion processor electrically coupled to the translation stage to controls motion of the translatable optic layer relative to the fixed optic layer. The absorber layer includes an array of photovoltaic (PV) elements. The fixed optic layer includes an array of quasi-collimating (QC) micro-optical elements designed and arranged to couple incident radiation from an intermediate image formed by the translatable optic layer into one of the PV elements such that it is quasi-collimated. The translatable optic layer includes an array of focusing micro-optical elements corresponding to the QC micro-optical element array. Each focusing micro-optical element is designed to produce a quasi-telecentric intermediate image from substantially collimated radiation incident within a predetermined field of view.

  13. Technology enabled evolutions in liquids marketing

    International Nuclear Information System (INIS)

    Manning, S.

    1998-01-01

    Deregulation, mergers, changing economic conditions, and downsizing have captured the headlines in the energy industry in recent times. To say that companies have struggled to react to these changes would be an understatement. Huge trading organizations have grown from nothing in a few years, while entire industry segments have been forced to restructure themselves. Information technology has enabled much of this change. By bringing information management out of the back office and onto the trading floors, companies have radically redesigned their work processes. The future promises even faster change, with business focus turning to innovative packaging of services with products, expanding asset bases, and reducing costs. Information technology will fuel this transformation by providing enterprise-wide trading solutions and, ultimately, linking the entire industry into a virtual supply chain. To remain competitive, companies need a strategy to manage information technology as a core asset

  14. Enabling opportunistic resources for CMS Computing Operations

    Energy Technology Data Exchange (ETDEWEB)

    Hufnagel, Dick [Fermilab

    2015-11-19

    With the increased pressure on computing brought by the higher energy and luminosity from the LHC in Run 2, CMS Computing Operations expects to require the ability to utilize “opportunistic” resources — resources not owned by, or a priori configured for CMS — to meet peak demands. In addition to our dedicated resources we look to add computing resources from non CMS grids, cloud resources, and national supercomputing centers. CMS uses the HTCondor/glideinWMS job submission infrastructure for all its batch processing, so such resources will need to be transparently integrated into its glideinWMS pool. Bosco and parrot wrappers are used to enable access and bring the CMS environment into these non CMS resources. Here we describe our strategy to supplement our native capabilities with opportunistic resources and our experience so far using them.

  15. Enabling MEMS technologies for communications systems

    Science.gov (United States)

    Lubecke, Victor M.; Barber, Bradley P.; Arney, Susanne

    2001-11-01

    Modern communications demands have been steadily growing not only in size, but sophistication. Phone calls over copper wires have evolved into high definition video conferencing over optical fibers, and wireless internet browsing. The technology used to meet these demands is under constant pressure to provide increased capacity, speed, and efficiency, all with reduced size and cost. Various MEMS technologies have shown great promise for meeting these challenges by extending the performance of conventional circuitry and introducing radical new systems approaches. A variety of strategic MEMS structures including various cost-effective free-space optics and high-Q RF components are described, along with related practical implementation issues. These components are rapidly becoming essential for enabling the development of progressive new communications systems technologies including all-optical networks, and low cost multi-system wireless terminals and basestations.

  16. Enabling Indoor Location-Based Services

    DEFF Research Database (Denmark)

    Radaelli, Laura

    Indoor spaces have always attracted interest from different scientific disciplines. Relatively recent interest in indoor settings by computer scientists is driven in part by the increasing use of smartphones, which serve as a platform for service delivery and can generate extensive volumes...... of trajectory data that can be used to study how people actually use indoor spaces. In this dissertation, we contribute partial solutions that address challenges in indoor positioning and indoor trajectory management and analysis. The key enabler of indoor location-based services and indoor movement analysis...... is a well-functioning positioning system that can be easily deployed in most public places. Different technologies are able to provide indoor positioning with different accuracy and coverage, but it is difficult to find a technology that by itself can provide good positioning in the many different layouts...

  17. Enabling women to achieve their breastfeeding goals.

    Science.gov (United States)

    Stuebe, Alison M

    2014-03-01

    In mammalian physiology, lactation follows pregnancy, and disruption of this physiology is associated with adverse health outcomes for mother and child. Although lactation is the physiologic norm, cultural norms for infant feeding have changed dramatically over the past century. Breastfeeding initiation fell from 70% in the early 1900s to 22% in 1972. In the past 40 years, rates have risen substantially, to 77% in 2010. Although more mothers are initiating breastfeeding, many report that they do not continue as long as they desire. As reproductive health care experts, obstetricians are uniquely positioned to assist women to make an informed feeding decision, offer anticipatory guidance, support normal lactation physiology, and evaluate and treat breastfeeding complications. Integration of care among the obstetrician, pediatric provider, and lactation consultant may enable more women to achieve their breastfeeding goals, thereby improving health outcomes across two generations.

  18. Flexibility-enabling Contracts in Electricity Markets

    DEFF Research Database (Denmark)

    Boscan, Luis; Poudineh, Rahmatallah

    As the share of intermittent renewable energy increases in the generation mix, power systems are exposed to greater levels of uncertainty and risk, which requires planners, policy and business decision makers to incentivise flexibility, that is: their adaptability to unforeseen variations....... Additionally, along with traditional sources, which already enable flexibility, a number of business models, such as thermostat-based demand response, aggregators and small storage providers, are emerging in electricity markets and expected to constitute important sources of flexibility in future decentralised...... power systems. However, due to presence of high transaction costs, relative to the size of resource, the emerging small resources cannot directly participate in an organised electricity market and/or compete. This paper asks the fundamental question of how should the provision of flexibility, as a multi...

  19. Provision of enabling technology in professional sports.

    Science.gov (United States)

    McBride, D K

    2000-06-01

    Multiple-round golf tournaments are designed intentionally to separate individuals' scores as play proceeds. Variance analyses and consideration of individual differences (vs group mean effects) for a sample of professional events confirm that 3-, 4-, and 5-round tournaments show significantly increased variability (though stable means) from first to last rounds. It is argued here that the dispersion of scores increases as play proceeds because the more physically or mentally fit players emerge and continue to perform best. Furthermore, a marginal income analysis indicates that the average gain in earnings from a one-shot improvement in score is approximately $8,000. An interpretation based on fatigue, competition, and stress supports the Professional Golf Association's claim that provision of enabling devices, like a golf cart for disabled players, is also an enhancement and is thus unfair.

  20. Bluetooth-enabled teleradiology: applications and complications.

    Science.gov (United States)

    Hura, Angela M

    2002-01-01

    Wireless personal area networks and local area networks are becoming increasingly more prevalent in the teleradiology and telemedicine industry. Although there has been much debate about the role that Bluetooth will play in the future of wireless technology, both promoters and doubters acknowledge that Bluetooth will have an impact on networking, even if only as a "niche" product. This article provides an overview of the Bluetooth standard and highlights current and future areas of inclusion for use in a teleradiology environment. The possibilities for Bluetooth in a teleradiology environment without wires are nearly boundless and an overview of current and proposed Bluetooth-enabled radiology equipment and vendors is provided. A comparison of Bluetooth and other wireless technologies is provided, including areas of similarity and potential conflict. Bluetooth and other wireless technologies can not only peacefully coexist but also complement each other and provide enhanced teleradiology services.

  1. Metasurface-Enabled Remote Quantum Interference.

    Science.gov (United States)

    Jha, Pankaj K; Ni, Xingjie; Wu, Chihhui; Wang, Yuan; Zhang, Xiang

    2015-07-10

    An anisotropic quantum vacuum (AQV) opens novel pathways for controlling light-matter interaction in quantum optics, condensed matter physics, etc. Here, we theoretically demonstrate a strong AQV over macroscopic distances enabled by a judiciously designed array of subwavelength-scale nanoantennas-a metasurface. We harness the phase-control ability and the polarization-dependent response of the metasurface to achieve strong anisotropy in the decay rate of a quantum emitter located over distances of hundreds of wavelengths. Such an AQV induces quantum interference among radiative decay channels in an atom with orthogonal transitions. Quantum vacuum engineering with metasurfaces holds promise for exploring new paradigms of long-range light-matter interaction for atom optics, solid-state quantum optics, quantum information processing, etc.

  2. Grid Enabled Geospatial Catalogue Web Service

    Science.gov (United States)

    Chen, Ai-Jun; Di, Li-Ping; Wei, Ya-Xing; Liu, Yang; Bui, Yu-Qi; Hu, Chau-Min; Mehrotra, Piyush

    2004-01-01

    Geospatial Catalogue Web Service is a vital service for sharing and interoperating volumes of distributed heterogeneous geospatial resources, such as data, services, applications, and their replicas over the web. Based on the Grid technology and the Open Geospatial Consortium (0GC) s Catalogue Service - Web Information Model, this paper proposes a new information model for Geospatial Catalogue Web Service, named as GCWS which can securely provides Grid-based publishing, managing and querying geospatial data and services, and the transparent access to the replica data and related services under the Grid environment. This information model integrates the information model of the Grid Replica Location Service (RLS)/Monitoring & Discovery Service (MDS) with the information model of OGC Catalogue Service (CSW), and refers to the geospatial data metadata standards from IS0 19115, FGDC and NASA EOS Core System and service metadata standards from IS0 191 19 to extend itself for expressing geospatial resources. Using GCWS, any valid geospatial user, who belongs to an authorized Virtual Organization (VO), can securely publish and manage geospatial resources, especially query on-demand data in the virtual community and get back it through the data-related services which provide functions such as subsetting, reformatting, reprojection etc. This work facilitates the geospatial resources sharing and interoperating under the Grid environment, and implements geospatial resources Grid enabled and Grid technologies geospatial enabled. It 2!so makes researcher to focus on science, 2nd not cn issues with computing ability, data locztic, processir,g and management. GCWS also is a key component for workflow-based virtual geospatial data producing.

  3. Take care of your mouse!

    CERN Multimedia

    IT Department

    2011-01-01

    “Stop --- Think --- Click" is the basic recommendation for securely browsing the Internet and for securely reading e-mails. Users who have followed this recommendation in the past were less likely to have their computer infected or their computing account compromised. We would like to thank all those who donated their mouse to the CERN Animal Shelter for Computer Mice (http://cern.ch/c-a-s). For those who still use a mouse, please stay vigilant and  alert: do not click on links whose origin you do not trust or which look like gibberish. Do not install untrusted software or plug-ins, since software from untrusted sources may infect or compromise your computer, or violate copyrights. Finally, take particular care with e-mails: Do not open unexpected or suspicious e-mails or attachments. Delete them if they do not concern you or if they appear strange. If in doubt, or if you have questions, please do not hesitate to contact Computer.Security@cern.ch

  4. Characterization of a male reproductive transcriptome for Peromyscus eremicus (Cactus mouse

    Directory of Open Access Journals (Sweden)

    Lauren L. Kordonowy

    2016-10-01

    Full Text Available Rodents of the genus Peromyscus have become increasingly utilized models for investigations into adaptive biology. This genus is particularly powerful for research linking genetics with adaptive physiology or behaviors, and recent research has capitalized on the unique opportunities afforded by the ecological diversity of these rodents. Well characterized genomic and transcriptomic data is intrinsic to explorations of the genetic architecture responsible for ecological adaptations. Therefore, this study characterizes the transcriptome of three male reproductive tissues (testes, epididymis and vas deferens of Peromyscus eremicus (Cactus mouse, a desert specialist. The transcriptome assembly process was optimized in order to produce a high quality and substantially complete annotated transcriptome. This composite transcriptome was generated to characterize the expressed transcripts in the male reproductive tract of P. eremicus, which will serve as a crucial resource for future research investigating our hypothesis that the male Cactus mouse possesses an adaptive reproductive phenotype to mitigate water-loss from ejaculate. This study reports genes under positive selection in the male Cactus mouse reproductive transcriptome relative to transcriptomes from Peromyscus maniculatus (deer mouse and Mus musculus. Thus, this study expands upon existing genetic research in this species, and we provide a high quality transcriptome to enable further explorations of our proposed hypothesis for male Cactus mouse reproductive adaptations to minimize seminal fluid loss.

  5. Mouse allergen exposure and immunologic responses: IgE-mediated mouse sensitization and mouse specific IgG and IgG4 levels

    NARCIS (Netherlands)

    Matsui, Elizabeth C.; Krop, Esmeralda J. M.; Diette, Gregory B.; Aalberse, Rob C.; Smith, Abigail L.; Eggleston, Peyton A.

    2004-01-01

    Although there is evidence that contact with mice is associated with IgE-mediated mouse sensitization and mouse specific antibody responses, the exposure-response relationships remain unclear. To determine whether IgE-mediated mouse sensitization and mouse specific IgG (mIgG) and mIgG4 levels

  6. The phenotype of FancB-mutant mouse embryonic stem cells

    OpenAIRE

    Kim, Tae Moon; Ko, Jun Ho; Choi, Yong Jun; Hu, Lingchuan; Hasty, Paul

    2011-01-01

    Fanconi anemia (FA) is a rare autosomal recessive disease characterized by bone marrow failure, developmental defects and cancer. There are multiple FA genes that enable the repair of interstrand crosslinks (ICLs) in coordination with a variety of other DNA repair pathways in a way that is poorly understood. Here we present the phenotype of mouse embryonic stem (ES) cells mutated for FancB. We found FancB-mutant cells exhibited reduced cellular proliferation, hypersensitivity to the crosslink...

  7. The wobbler mouse, an ALS animal model

    DEFF Research Database (Denmark)

    Moser, Jakob Maximilian; Bigini, Paolo; Schmitt-John, Thomas

    2013-01-01

    This review article is focused on the research progress made utilizing the wobbler mouse as animal model for human motor neuron diseases, especially the amyotrophic lateral sclerosis (ALS). The wobbler mouse develops progressive degeneration of upper and lower motor neurons and shows striking...

  8. Mouse adenovirus type 1 infection of macrophages

    NARCIS (Netherlands)

    Ashley, S.L.; Welton, A.R.; Harwood, K.M.; Rooijen, van N.; Spindler, K.R.

    2009-01-01

    Mouse adenovirus type 1 (MAV-1) causes acute and persistent infections in mice, with high levels of virus found in the brain, spinal cord and spleen in acute infections. MAV-1 infects endothelial cells throughout the mouse, and monocytes/macrophages have also been implicated as targets of the virus.

  9. Identification of two evolutionarily conserved 5' cis-elements involved in regulating spatiotemporal expression of Nolz-1 during mouse embryogenesis.

    Directory of Open Access Journals (Sweden)

    Sunny Li-Yun Chang

    Full Text Available Proper development of vertebrate embryos depends not only on the crucial funtions of key evolutionarily conserved transcriptional regulators, but also on the precisely spatiotemporal expression of these transcriptional regulators. The mouse Nolz-1/Znf503/Zfp503 gene is a mammalian member of the conserved zinc-finger containing NET family. The expression pattern of Nolz-1 in mouse embryos is highly correlated with that of its homologues in different species. To study the spatiotemporal regulation of Nolz-1, we first identified two evolutionarily conserved cis-elements, UREA and UREB, in 5' upstream regions of mouse Nolz-1 locus. We then generated UREA-LacZ and UREB-LacZ transgenic reporter mice to characterize the putative enhancer activity of UREA and UREB. The results indicated that both UREA and UREB contained tissue-specific enhancer activity for directing LacZ expression in selective tissue organs during mouse embryogensis. UREA directed LacZ expression preferentially in selective regions of developing central nervous system, including the forebrain, hindbrain and spinal cord, whereas UREB directed LacZ expression mainly in other developing tissue organs such as the Nolz-1 expressing branchial arches and its derivatives, the apical ectodermal ridge of limb buds and the urogenital tissues. Both UREA and UREB directed strong LacZ expression in the lateral plate mesoderm where endogenous Nolz-1 was also expressed. Despite that the LacZ expression pattern did not full recapitulated the endogenous Nolz-1 expression and some mismatched expression patterns were observed, co-expression of LacZ and Nolz-1 did occur in many cells of selective tissue organs, such as in the ventrolateral cortex and ventral spinal cord of UREA-LacZ embryos, and the urogenital tubes of UREB-LacZ embryos. Taken together, our study suggests that UREA and UREB may function as evolutionarily conserved cis-regulatory elements that coordinate with other cis-elements to regulate

  10. Realising the Uncertainty Enabled Model Web

    Science.gov (United States)

    Cornford, D.; Bastin, L.; Pebesma, E. J.; Williams, M.; Stasch, C.; Jones, R.; Gerharz, L.

    2012-12-01

    The FP7 funded UncertWeb project aims to create the "uncertainty enabled model web". The central concept here is that geospatial models and data resources are exposed via standard web service interfaces, such as the Open Geospatial Consortium (OGC) suite of encodings and interface standards, allowing the creation of complex workflows combining both data and models. The focus of UncertWeb is on the issue of managing uncertainty in such workflows, and providing the standards, architecture, tools and software support necessary to realise the "uncertainty enabled model web". In this paper we summarise the developments in the first two years of UncertWeb, illustrating several key points with examples taken from the use case requirements that motivate the project. Firstly we address the issue of encoding specifications. We explain the usage of UncertML 2.0, a flexible encoding for representing uncertainty based on a probabilistic approach. This is designed to be used within existing standards such as Observations and Measurements (O&M) and data quality elements of ISO19115 / 19139 (geographic information metadata and encoding specifications) as well as more broadly outside the OGC domain. We show profiles of O&M that have been developed within UncertWeb and how UncertML 2.0 is used within these. We also show encodings based on NetCDF and discuss possible future directions for encodings in JSON. We then discuss the issues of workflow construction, considering discovery of resources (both data and models). We discuss why a brokering approach to service composition is necessary in a world where the web service interfaces remain relatively heterogeneous, including many non-OGC approaches, in particular the more mainstream SOAP and WSDL approaches. We discuss the trade-offs between delegating uncertainty management functions to the service interfaces themselves and integrating the functions in the workflow management system. We describe two utility services to address

  11. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  12. BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

    Science.gov (United States)

    Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

    2017-09-01

    Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

  13. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  14. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  15. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  16. Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

    Science.gov (United States)

    Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

    2017-08-01

    In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Science.gov (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

    2014-01-01

    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  18. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  19. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

    1990-01-01

    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  20. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  1. Europium enabled luminescent nanoparticles for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Syamchand, S.S., E-mail: syamchand.ss@gmail.com; Sony, G., E-mail: emailtosony@gmail.com

    2015-09-15

    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  2. Enabling Wireless Avionics Intra-Communications

    Science.gov (United States)

    Torres, Omar; Nguyen, Truong; Mackenzie, Anne

    2016-01-01

    The Electromagnetics and Sensors Branch of NASA Langley Research Center (LaRC) is investigating the potential of an all-wireless aircraft as part of the ECON (Efficient Reconfigurable Cockpit Design and Fleet Operations using Software Intensive, Networked and Wireless Enabled Architecture) seedling proposal, which is funded by the Convergent Aeronautics Solutions (CAS) project, Transformative Aeronautics Concepts (TAC) program, and NASA Aeronautics Research Institute (NARI). The project consists of a brief effort carried out by a small team in the Electromagnetic Environment Effects (E3) laboratory with the intention of exposing some of the challenges faced by a wireless communication system inside the reflective cavity of an aircraft and to explore potential solutions that take advantage of that environment for constructive gain. The research effort was named EWAIC for "Enabling Wireless Aircraft Intra-communications." The E3 laboratory is a research facility that includes three electromagnetic reverberation chambers and equipment that allow testing and generation of test data for the investigation of wireless systems in reflective environments. Using these chambers, the EWAIC team developed a set of tests and setups that allow the intentional variation of intensity of a multipath field to reproduce the environment of the various bays and cabins of large transport aircraft. This setup, in essence, simulates an aircraft environment that allows the investigation and testing of wireless communication protocols that can effectively be used as a tool to mitigate some of the risks inherent to an aircraft wireless system for critical functions. In addition, the EWAIC team initiated the development of a computational modeling tool to illustrate the propagation of EM waves inside the reflective cabins and bays of aircraft and to obtain quantifiable information regarding the degradation of signals in aircraft subassemblies. The nose landing gear of a UAV CAD model was used

  3. Europium enabled luminescent nanoparticles for biomedical applications

    International Nuclear Information System (INIS)

    Syamchand, S.S.; Sony, G.

    2015-01-01

    Lanthanide based nanoparticles are receiving great attention ought to their excellent luminescent and magnetic properties and find challenging biomedical applications. Among the luminescent lanthanide NPs, europium based NPs (Eu-NPs) are better candidates for immunoassay and imaging applications. The Eu-NPs have an edge over quantum dots (QDs) by means of their stable luminescence, long fluorescence lifetime, sharp emission peaks with narrow band width, lack of blinking and biocompatibility. This review surveys the synthesis and properties of a variety of Eu-NPs consolidated from different research articles, for their applications in medicine and biology. The exquisite luminescent properties of Eu-NPs are explored for developing biomedical applications such as immunoassay and bioimaging including multimodal imaging. The biomedical applications of Eu-NPs are mostly diagnostic in nature and mainly focus on various key analytes present in biological systems. The luminescent properties of europium enabled NPs are influenced by a number of factors such as the site symmetry, the metal nanoparticles, metal ions, quantum dots, surfactants, morphology of Eu-NPs, crystal defect, phenomena like antenna effect and physical parameters like temperature. Through this review we explore and assimilate all the factors which affect the luminescence in Eu-NPs and coil a new thread of parameters that control the luminescence in Eu-NPs, which would provide further insight in developing Eu-based nanoprobes for future biomedical prospects. - Highlights: • The review describes 14 major factors that influence the luminescence properties of europium enabled luminescent nanoparticles (Eu-NPs). • Surveys different types of europium containing nanoparticles that have been reported for their biomedical applications. • Eu-NPs are conveniently divided into four different categories, based on the type of the substrates involved. The four categories are (1) virgin Eu-substrate based NPs; (2

  4. Glass ceramic ZERODUR enabling nanometer precision

    Science.gov (United States)

    Jedamzik, Ralf; Kunisch, Clemens; Nieder, Johannes; Westerhoff, Thomas

    2014-03-01

    The IC Lithography roadmap foresees manufacturing of devices with critical dimension of digit nanometer asking for nanometer positioning accuracy requiring sub nanometer position measurement accuracy. The glass ceramic ZERODUR® is a well-established material in critical components of microlithography wafer stepper and offered with an extremely low coefficient of thermal expansion (CTE), the tightest tolerance available on market. SCHOTT is continuously improving manufacturing processes and it's method to measure and characterize the CTE behavior of ZERODUR® to full fill the ever tighter CTE specification for wafer stepper components. In this paper we present the ZERODUR® Lithography Roadmap on the CTE metrology and tolerance. Additionally, simulation calculations based on a physical model are presented predicting the long term CTE behavior of ZERODUR® components to optimize dimensional stability of precision positioning devices. CTE data of several low thermal expansion materials are compared regarding their temperature dependence between - 50°C and + 100°C. ZERODUR® TAILORED 22°C is full filling the tight CTE tolerance of +/- 10 ppb / K within the broadest temperature interval compared to all other materials of this investigation. The data presented in this paper explicitly demonstrates the capability of ZERODUR® to enable the nanometer precision required for future generation of lithography equipment and processes.

  5. Enabling scientific workflows in virtual reality

    Science.gov (United States)

    Kreylos, O.; Bawden, G.; Bernardin, T.; Billen, M.I.; Cowgill, E.S.; Gold, R.D.; Hamann, B.; Jadamec, M.; Kellogg, L.H.; Staadt, O.G.; Sumner, D.Y.

    2006-01-01

    To advance research and improve the scientific return on data collection and interpretation efforts in the geosciences, we have developed methods of interactive visualization, with a special focus on immersive virtual reality (VR) environments. Earth sciences employ a strongly visual approach to the measurement and analysis of geologic data due to the spatial and temporal scales over which such data ranges, As observations and simulations increase in size and complexity, the Earth sciences are challenged to manage and interpret increasing amounts of data. Reaping the full intellectual benefits of immersive VR requires us to tailor exploratory approaches to scientific problems. These applications build on the visualization method's strengths, using both 3D perception and interaction with data and models, to take advantage of the skills and training of the geological scientists exploring their data in the VR environment. This interactive approach has enabled us to develop a suite of tools that are adaptable to a range of problems in the geosciences and beyond. Copyright ?? 2008 by the Association for Computing Machinery, Inc.

  6. Breakthrough Science Enabled by Smallsat Optical Communication

    Science.gov (United States)

    Gorjian, V.

    2017-12-01

    The recent NRC panel on "Achieving Science with Cubesats" found that "CubeSats have already proven themselves to be an important scientific tool. CubeSats can produce high-value science, as demonstrated by peer-reviewed publications that address decadal survey science goals." While some science is purely related to the size of the collecting aperture, there are plentiful examples of new and exciting experiments that can be achieved using the relatively inexpensive Cubesat platforms. We will present various potential science applications that can benefit from higher bandwidth communication. For example, on or near Earth orbit, Cubesats could provide hyperspectral imaging, gravity field mapping, atmospheric probing, and terrain mapping. These can be achieved either as large constellations of Cubesats or a few Cubesats that provide multi-point observations. Away from the Earth (up to 1AU) astrophysical variability studies, detections of solar particles between the Earth and Venus, mapping near earth objects, and high-speed videos of the Sun will also be enabled by high bandwidth communications.

  7. Enabling Semantic Queries Against the Spatial Database

    Directory of Open Access Journals (Sweden)

    PENG, X.

    2012-02-01

    Full Text Available The spatial database based upon the object-relational database management system (ORDBMS has the merits of a clear data model, good operability and high query efficiency. That is why it has been widely used in spatial data organization and management. However, it cannot express the semantic relationships among geospatial objects, making the query results difficult to meet the user's requirement well. Therefore, this paper represents an attempt to combine the Semantic Web technology with the spatial database so as to make up for the traditional database's disadvantages. In this way, on the one hand, users can take advantages of ORDBMS to store and manage spatial data; on the other hand, if the spatial database is released in the form of Semantic Web, the users could describe a query more concisely with the cognitive pattern which is similar to that of daily life. As a consequence, this methodology enables the benefits of both Semantic Web and the object-relational database (ORDB available. The paper discusses systematically the semantic enriched spatial database's architecture, key technologies and implementation. Subsequently, we demonstrate the function of spatial semantic queries via a practical prototype system. The query results indicate that the method used in this study is feasible.

  8. Enabler for the agile virtual enterprise

    Science.gov (United States)

    Fuerst, Karl; Schmidt, Thomas; Wippel, Gerald

    2001-10-01

    In this presentation, a new approach for a flexible low-cost Internet extended enterprise (project FLoCI-EE) will be presented. FLoCI-EE is a project in the fifth framework program of the European commission with 8 partners from 4 countries, which started in January 2001 and will be finished in December 2003. The main objective of FLoCI-EE is the development of a software prototype, which enables flexible enterprise cooperation with the aim to design, manufacture and sell products commonly, independent of enterprise borderlines. The needed IT-support includes functions of product data management (PDM), enterprise resource planning (ERP), supply chain management (SCM) and customer relationship management (CRM). Especially for small and medium sized enterprises, existing solutions are too expensive and inflexible to be of use under current turbulent market conditions. The second part of this paper covers the item Web Services, because in the role-specific support approach of FLoCI-EE, there are user- interface-components, which are tailored for specific roles in an enterprise. These components integrate automatically the services of the so-called basic-components, and the externally offered Web Services like UDDI.

  9. Barriers and enablers to academic health leadership.

    Science.gov (United States)

    Bharwani, Aleem; Kline, Theresa; Patterson, Margaret; Craighead, Peter

    2017-02-06

    Purpose This study sought to identify the barriers and enablers to leadership enactment in academic health-care settings. Design/methodology/approach Semi-structured interviews ( n = 77) with programme stakeholders (medical school trainees, university leaders, clinical leaders, medical scientists and directors external to the medical school) were conducted, and the responses content-analysed. Findings Both contextual and individual factors were identified as playing a role in affecting academic health leadership enactment that has an impact on programme development, success and maintenance. Contextual factors included sufficient resources allocated to the programme, opportunities for learners to practise leadership skills, a competent team around the leader once that person is in place, clear expectations for the leader and a culture that fosters open communication. Contextual barriers included highly bureaucratic structures, fear-of-failure and non-trusting cultures and inappropriate performance systems. Programmes were advised to select participants based on self-awareness, strong communication skills and an innovative thinking style. Filling specific knowledge and skill gaps, particularly for those not trained in medical school, was viewed as essential. Ineffective decision-making styles and tendencies to get involved in day-to-day activities were barriers to the development of academic health leaders. Originality/value Programmes designed to develop academic health-care leaders will be most effective if they develop leadership at all levels; ensure that the organisation's culture, structure and processes reinforce positive leadership practices; and recognise the critical role of teams in supporting its leaders.

  10. BEST: barcode enabled sequencing of tetrads.

    Science.gov (United States)

    Scott, Adrian C; Ludlow, Catherine L; Cromie, Gareth A; Dudley, Aimée M

    2014-05-01

    Tetrad analysis is a valuable tool for yeast genetics, but the laborious manual nature of the process has hindered its application on large scales. Barcode Enabled Sequencing of Tetrads (BEST)1 replaces the manual processes of isolating, disrupting and spacing tetrads. BEST isolates tetrads by virtue of a sporulation-specific GFP fusion protein that permits fluorescence-activated cell sorting of tetrads directly onto agar plates, where the ascus is enzymatically digested and the spores are disrupted and randomly arrayed by glass bead plating. The haploid colonies are then assigned sister spore relationships, i.e. information about which spores originated from the same tetrad, using molecular barcodes read during genotyping. By removing the bottleneck of manual dissection, hundreds or even thousands of tetrads can be isolated in minutes. Here we present a detailed description of the experimental procedures required to perform BEST in the yeast Saccharomyces cerevisiae, starting with a heterozygous diploid strain through the isolation of colonies derived from the haploid meiotic progeny.

  11. Survey of Enabling Technologies for CAPS

    Science.gov (United States)

    Antol, Jeffrey; Mazanek, Daniel D.; Koons, Robert H.

    2005-01-01

    The enabling technologies required for the development of a viable Comet/Asteroid Protection System (CAPS) can be divided into two principal areas: detection and deflection/orbit modification. With the proper funding levels, many of the technologies needed to support a CAPS architecture could be achievable within the next 15 to 20 years. In fact, many advanced detection technologies are currently in development for future in-space telescope systems such as the James Webb Space Telescope (JWST), formerly known as the Next Generation Space Telescope. It is anticipated that many of the JWST technologies would be available for application for CAPS detection concepts. Deflection/orbit modification technologies are also currently being studied as part of advanced power and propulsion research. However, many of these technologies, such as extremely high-output power systems, advanced propulsion, heat rejection, and directed energy systems, would likely be farther term in availability than many of the detection technologies. Discussed subsequently is a preliminary examination of the main technologies that have been identified as being essential to providing the element functionality defined during the CAPS conceptual study. The detailed requirements for many of the technology areas are still unknown, and many additional technologies will be identified as future in-depth studies are conducted in this area.

  12. Enabling technologies for industrial energy demand management

    International Nuclear Information System (INIS)

    Dyer, Caroline H.; Hammond, Geoffrey P.; Jones, Craig I.; McKenna, Russell C.

    2008-01-01

    This state-of-science review sets out to provide an indicative assessment of enabling technologies for reducing UK industrial energy demand and carbon emissions to 2050. In the short term, i.e. the period that will rely on current or existing technologies, the road map and priorities are clear. A variety of available technologies will lead to energy demand reduction in industrial processes, boiler operation, compressed air usage, electric motor efficiency, heating and lighting, and ancillary uses such as transport. The prospects for the commercial exploitation of innovative technologies by the middle of the 21st century are more speculative. Emphasis is therefore placed on the range of technology assessment methods that are likely to provide policy makers with a guide to progress in the development of high-temperature processes, improved materials, process integration and intensification, and improved industrial process control and monitoring. Key among the appraisal methods applicable to the energy sector is thermodynamic analysis, making use of energy, exergy and 'exergoeconomic' techniques. Technical and economic barriers will limit the improvement potential to perhaps a 30% cut in industrial energy use, which would make a significant contribution to reducing energy demand and carbon emissions in UK industry. Non-technological drivers for, and barriers to, the take-up of innovative, low-carbon energy technologies for industry are also outlined

  13. Imaging enabled platforms for development of therapeutics

    Science.gov (United States)

    Celli, Jonathan; Rizvi, Imran; Blanden, Adam R.; Evans, Conor L.; Abu-Yousif, Adnan O.; Spring, Bryan Q.; Muzikansky, Alona; Pogue, Brian W.; Finkelstein, Dianne M.; Hasan, Tayyaba

    2011-03-01

    Advances in imaging and spectroscopic technologies have enabled the optimization of many therapeutic modalities in cancer and noncancer pathologies either by earlier disease detection or by allowing therapy monitoring. Amongst the therapeutic options benefiting from developments in imaging technologies, photodynamic therapy (PDT) is exceptional. PDT is a photochemistry-based therapeutic approach where a light-sensitive molecule (photosensitizer) is activated with light of appropriate energy (wavelength) to produce reactive molecular species such as free radicals and singlet oxygen. These molecular entities then react with biological targets such as DNA, membranes and other cellular components to impair their function and lead to eventual cell and tissue death. Development of PDT-based imaging also provides a platform for rapid screening of new therapeutics in novel in vitro models prior to expensive and labor-intensive animal studies. In this study we demonstrate how an imaging platform can be used for strategizing a novel combination treatment strategy for multifocal ovarian cancer. Using an in vitro 3D model for micrometastatic ovarian cancer in conjunction with quantitative imaging we examine dose and scheduling strategies for PDT in combination with carboplatin, a chemotherapeutic agent presently in clinical use for management of this deadly form of cancer.

  14. Multimode Communication Protocols Enabling Reconfigurable Radios

    Directory of Open Access Journals (Sweden)

    Berlemann Lars

    2005-01-01

    Full Text Available This paper focuses on the realization and application of a generic protocol stack for reconfigurable wireless communication systems. This focus extends the field of software-defined radios which usually concentrates on the physical layer. The generic protocol stack comprises common protocol functionality and behavior which are extended through specific parts of the targeted radio access technology. This paper considers parameterizable modules of basic protocol functions residing in the data link layer of the ISO/OSI model. System-specific functionality of the protocol software is realized through adequate parameterization and composition of the generic modules. The generic protocol stack allows an efficient realization of reconfigurable protocol software and enables a completely reconfigurable wireless communication system. It is a first step from side-by-side realized, preinstalled modes in a terminal towards a dynamic reconfigurable anymode terminal. The presented modules of the generic protocol stack can also be regarded as a toolbox for the accelerated and cost-efficient development of future communication protocols.

  15. Enabling electroweak baryogenesis through dark matter

    International Nuclear Information System (INIS)

    Lewicki, Marek; Rindler-Daller, Tanja; Wells, James D.

    2016-01-01

    We study the impact on electroweak baryogenesis from a swifter cosmological expansion induced by dark matter. We detail the experimental bounds that one can place on models that realize it, and we investigate the modifications of these bounds that result from a non-standard cosmological history. The modifications can be sizeable if the expansion rate of the Universe increases by several orders of magnitude. We illustrate the impact through the example of scalar field dark matter, which can alter the cosmological history enough to enable a strong-enough first-order phase transition in the Standard Model when it is supplemented by a dimension six operator directly modifying the Higgs boson potential. We show that due to the modified cosmological history, electroweak baryogenesis can be realized, while keeping deviations of the triple Higgs coupling below HL-LHC sensitivies. The required scale of new physics to effectuate a strong-enough first order phase transition can change by as much as twenty percent as the expansion rate increases by six orders of magnitude.

  16. Water: A Critical Material Enabling Space Exploration

    Science.gov (United States)

    Pickering, Karen D.

    2014-01-01

    Water is one of the most critical materials in human spaceflight. The availability of water defines the duration of a space mission; the volume of water required for a long-duration space mission becomes too large, heavy, and expensive for launch vehicles to carry. Since the mission duration is limited by the amount of water a space vehicle can carry, the capability to recycle water enables space exploration. In addition, water management in microgravity impacts spaceflight in other respects, such as the recent emergency termination of a spacewalk caused by free water in an astronaut's spacesuit helmet. A variety of separation technologies are used onboard spacecraft to ensure that water is always available for use, and meets the stringent water quality required for human space exploration. These separation technologies are often adapted for use in a microgravity environment, where water behaves in unique ways. The use of distillation, membrane processes, ion exchange and granular activated carbon will be reviewed. Examples of microgravity effects on operations will also be presented. A roadmap for future technologies, needed to supply water resources for the exploration of Mars, will also be reviewed.

  17. Enabling Process Alignment for IT Entrepreneurship

    Directory of Open Access Journals (Sweden)

    Sonia D. Bot

    2012-11-01

    Full Text Available All firms use information technology (IT. Larger firms have IT organizations whose business function is to supply and manage IT infrastructure and applications to support the firm's business objectives. Regardless of whether the IT function has been outsourced or is resident within a firm, the objectives of the IT organization must be aligned to the strategic needs of the business. It is often a challenge to balance the demand for IT against the available supply within the firm. Most IT organizations have little capacity to carry out activities that go beyond the incremental ones that are needed to run the immediate needs of the business. A process-ambidexterity framework for IT improves the IT organization's entrepreneurial ability, which in turn, better aligns the IT function with the business functions in the firm. Process ambidexterity utilizes both process alignment and process adaptability. This article presents a framework for process alignment in IT. This is useful for understanding how the processes in Business Demand Management, a core component of the process-ambidexterity framework for IT, relate to those in IT Governance and IT Supply Chain Management. The framework is presented through three lenses (governance, business, and technology along with real-world examples from major firms in the USA. Enabling process alignment in the IT function, and process ambidexterity overall, benefits those who govern IT, the executives who lead IT, as well as their peers in the business functions that depend on IT.

  18. Smart Sensors Enable Smart Air Conditioning Control

    Directory of Open Access Journals (Sweden)

    Chin-Chi Cheng

    2014-06-01

    Full Text Available In this study, mobile phones, wearable devices, temperature and human motion detectors are integrated as smart sensors for enabling smart air conditioning control. Smart sensors obtain feedback, especially occupants’ information, from mobile phones and wearable devices placed on human body. The information can be used to adjust air conditioners in advance according to humans’ intentions, in so-called intention causing control. Experimental results show that the indoor temperature can be controlled accurately with errors of less than ±0.1 °C. Rapid cool down can be achieved within 2 min to the optimized indoor capacity after occupants enter a room. It’s also noted that within two-hour operation the total compressor output of the smart air conditioner is 48.4% less than that of the one using On-Off control. The smart air conditioner with wearable devices could detect the human temperature and activity during sleep to determine the sleeping state and adjusting the sleeping function flexibly. The sleeping function optimized by the smart air conditioner with wearable devices could reduce the energy consumption up to 46.9% and keep the human health. The presented smart air conditioner could provide a comfortable environment and achieve the goals of energy conservation and environmental protection.

  19. A dystrophic Duchenne mouse model for testing human antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Marcel Veltrop

    Full Text Available Duchenne muscular dystrophy (DMD is a severe muscle-wasting disease generally caused by reading frame disrupting mutations in the DMD gene resulting in loss of functional dystrophin protein. The reading frame can be restored by antisense oligonucleotide (AON-mediated exon skipping, allowing production of internally deleted, but partially functional dystrophin proteins as found in the less severe Becker muscular dystrophy. Due to genetic variation between species, mouse models with mutations in the murine genes are of limited use to test and further optimize human specific AONs in vivo. To address this we have generated the del52hDMD/mdx mouse. This model carries both murine and human DMD genes. However, mouse dystrophin expression is abolished due to a stop mutation in exon 23, while the expression of human dystrophin is abolished due to a deletion of exon 52. The del52hDMD/mdx model, like mdx, shows signs of muscle dystrophy on a histological level and phenotypically mild functional impairment. Local administration of human specific vivo morpholinos induces exon skipping and dystrophin restoration in these mice. Depending on the number of mismatches, occasional skipping of the murine Dmd gene, albeit at low levels, could be observed. Unlike previous models, the del52hDMD/mdx model enables the in vivo analysis of human specific AONs targeting exon 51 or exon 53 on RNA and protein level and muscle quality and function. Therefore, it will be a valuable tool for optimizing human specific AONs and genome editing approaches for DMD.

  20. Genetic mouse models of brain ageing and Alzheimer's disease.

    Science.gov (United States)

    Bilkei-Gorzo, Andras

    2014-05-01

    Progression of brain ageing is influenced by a complex interaction of genetic and environmental factors. Analysis of genetically modified animals with uniform genetic backgrounds in a standardised, controlled environment enables the dissection of critical determinants of brain ageing on a molecular level. Human and animal studies suggest that increased load of damaged macromolecules, efficacy of DNA maintenance, mitochondrial activity, and cellular stress defences are critical determinants of brain ageing. Surprisingly, mouse lines with genetic impairment of anti-oxidative capacity generally did not show enhanced cognitive ageing but rather an increased sensitivity to oxidative challenge. Mouse lines with impaired mitochondrial activity had critically short life spans or severe and rapidly progressing neurodegeneration. Strains with impaired clearance in damaged macromolecules or defects in the regulation of cellular stress defences showed alterations in the onset and progression of cognitive decline. Importantly, reduced insulin/insulin-like growth factor signalling generally increased life span but impaired cognitive functions revealing a complex interaction between ageing of the brain and of the body. Brain ageing is accompanied by an increased risk of developing Alzheimer's disease. Transgenic mouse models expressing high levels of mutant human amyloid precursor protein showed a number of symptoms and pathophysiological processes typical for early phase of Alzheimer's disease. Generally, therapeutic strategies effective against Alzheimer's disease in humans were also active in the Tg2576, APP23, APP/PS1 and 5xFAD lines, but a large number of false positive findings were also reported. The 3xtg AD model likely has the highest face and construct validity but further studies are needed. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Radiosensitivity of mouse germ cells

    International Nuclear Information System (INIS)

    Matsuda, Yoichi; Takeuchi, Toyoko; Maemori, Mamiko; Seki, Naohiko; Tobari, Izuo

    1991-01-01

    To estimate radiosensitivity of mouse germ cells the analysis of chromosome aberrations was performed at diakinesis-metaphase I of spermatocytes and first-cleavage metaphase of one-cell embryos after exposure to radiations at various stages of primary spermatocytes and spermatids. The result provided evidence that there are two major types of DNA damage in X-irradiated sperm : (1) short-lived DNA lesions ; the lesions are subject to repair inhibition by agents added in G 1 , and are converted into chromosome-type aberrations during G 1 , and (2) long-lived DNA lesions ; the lesions persist until S phase and repair of the lesions is inhibited by caffeine, hydroxyurea and arabinofuranosyl cytosine in G 2 . The characteristic of X-ray damage induced in spermiogenic stage and repair mechanism for the damage in the fertilized egg were discussed comparing with the results with two chemicals, methyl methanesulfonate (MMS) and mitomycin C (MMC). (J.P.N.)

  2. Cusps enable line attractors for neural computation

    International Nuclear Information System (INIS)

    Xiao, Zhuocheng; Zhang, Jiwei; Sornborger, Andrew T.; Tao, Louis

    2017-01-01

    Here, line attractors in neuronal networks have been suggested to be the basis of many brain functions, such as working memory, oculomotor control, head movement, locomotion, and sensory processing. In this paper, we make the connection between line attractors and pulse gating in feed-forward neuronal networks. In this context, because of their neutral stability along a one-dimensional manifold, line attractors are associated with a time-translational invariance that allows graded information to be propagated from one neuronal population to the next. To understand how pulse-gating manifests itself in a high-dimensional, nonlinear, feedforward integrate-and-fire network, we use a Fokker-Planck approach to analyze system dynamics. We make a connection between pulse-gated propagation in the Fokker-Planck and population-averaged mean-field (firing rate) models, and then identify an approximate line attractor in state space as the essential structure underlying graded information propagation. An analysis of the line attractor shows that it consists of three fixed points: a central saddle with an unstable manifold along the line and stable manifolds orthogonal to the line, which is surrounded on either side by stable fixed points. Along the manifold defined by the fixed points, slow dynamics give rise to a ghost. We show that this line attractor arises at a cusp catastrophe, where a fold bifurcation develops as a function of synaptic noise; and that the ghost dynamics near the fold of the cusp underly the robustness of the line attractor. Understanding the dynamical aspects of this cusp catastrophe allows us to show how line attractors can persist in biologically realistic neuronal networks and how the interplay of pulse gating, synaptic coupling, and neuronal stochasticity can be used to enable attracting one-dimensional manifolds and, thus, dynamically control the processing of graded information.

  3. New Catalog of Resources Enables Paleogeosciences Research

    Science.gov (United States)

    Lingo, R. C.; Horlick, K. A.; Anderson, D. M.

    2014-12-01

    The 21st century promises a new era for scientists of all disciplines, the age where cyber infrastructure enables research and education and fuels discovery. EarthCube is a working community of over 2,500 scientists and students of many Earth Science disciplines who are looking to build bridges between disciplines. The EarthCube initiative will create a digital infrastructure that connects databases, software, and repositories. A catalog of resources (databases, software, repositories) has been produced by the Research Coordination Network for Paleogeosciences to improve the discoverability of resources. The Catalog is currently made available within the larger-scope CINERGI geosciences portal (http://hydro10.sdsc.edu/geoportal/catalog/main/home.page). Other distribution points and web services are planned, using linked data, content services for the web, and XML descriptions that can be harvested using metadata protocols. The databases provide searchable interfaces to find data sets that would otherwise remain dark data, hidden in drawers and on personal computers. The software will be described in catalog entries so just one click will lead users to methods and analytical tools that many geoscientists were unaware of. The repositories listed in the Paleogeosciences Catalog contain physical samples found all across the globe, from natural history museums to the basements of university buildings. EarthCube has over 250 databases, 300 software systems, and 200 repositories which will grow in the coming year. When completed, geoscientists across the world will be connected into a productive workflow for managing, sharing, and exploring geoscience data and information that expedites collaboration and innovation within the paleogeosciences, potentially bringing about new interdisciplinary discoveries.

  4. "Nanotechnology Enabled Advanced Industrial Heat Transfer Fluids"

    Energy Technology Data Exchange (ETDEWEB)

    Dr. Ganesh Skandan; Dr. Amit Singhal; Mr. Kenneth Eberts; Mr. Damian Sobrevilla; Prof. Jerry Shan; Stephen Tse; Toby Rossmann

    2008-06-12

    ABSTRACT Nanotechnology Enabled Advanced industrial Heat Transfer Fluids” Improving the efficiency of Industrial Heat Exchangers offers a great opportunity to improve overall process efficiencies in diverse industries such as pharmaceutical, materials manufacturing and food processing. The higher efficiencies can come in part from improved heat transfer during both cooling and heating of the material being processed. Additionally, there is great interest in enhancing the performance and reducing the weight of heat exchangers used in automotives in order to increase fuel efficiency. The goal of the Phase I program was to develop nanoparticle containing heat transfer fluids (e.g., antifreeze, water, silicone and hydrocarbon-based oils) that are used in transportation and in the chemical industry for heating, cooling and recovering waste heat. Much work has been done to date at investigating the potential use of nanoparticle-enhanced thermal fluids to improve heat transfer in heat exchangers. In most cases the effect in a commercial heat transfer fluid has been marginal at best. In the Phase I work, we demonstrated that the thermal conductivity, and hence heat transfer, of a fluid containing nanoparticles can be dramatically increased when subjected to an external influence. The increase in thermal conductivity was significantly larger than what is predicted by commonly used thermal models for two-phase materials. Additionally, the surface of the nanoparticles was engineered so as to have a minimal influence on the viscosity of the fluid. As a result, a nanoparticle-laden fluid was successfully developed that can lead to enhanced heat transfer in both industrial and automotive heat exchangers

  5. Cusps enable line attractors for neural computation

    Science.gov (United States)

    Xiao, Zhuocheng; Zhang, Jiwei; Sornborger, Andrew T.; Tao, Louis

    2017-11-01

    Line attractors in neuronal networks have been suggested to be the basis of many brain functions, such as working memory, oculomotor control, head movement, locomotion, and sensory processing. In this paper, we make the connection between line attractors and pulse gating in feed-forward neuronal networks. In this context, because of their neutral stability along a one-dimensional manifold, line attractors are associated with a time-translational invariance that allows graded information to be propagated from one neuronal population to the next. To understand how pulse-gating manifests itself in a high-dimensional, nonlinear, feedforward integrate-and-fire network, we use a Fokker-Planck approach to analyze system dynamics. We make a connection between pulse-gated propagation in the Fokker-Planck and population-averaged mean-field (firing rate) models, and then identify an approximate line attractor in state space as the essential structure underlying graded information propagation. An analysis of the line attractor shows that it consists of three fixed points: a central saddle with an unstable manifold along the line and stable manifolds orthogonal to the line, which is surrounded on either side by stable fixed points. Along the manifold defined by the fixed points, slow dynamics give rise to a ghost. We show that this line attractor arises at a cusp catastrophe, where a fold bifurcation develops as a function of synaptic noise; and that the ghost dynamics near the fold of the cusp underly the robustness of the line attractor. Understanding the dynamical aspects of this cusp catastrophe allows us to show how line attractors can persist in biologically realistic neuronal networks and how the interplay of pulse gating, synaptic coupling, and neuronal stochasticity can be used to enable attracting one-dimensional manifolds and, thus, dynamically control the processing of graded information.

  6. Integrated and Intelligent Manufacturing: Perspectives and Enablers

    Directory of Open Access Journals (Sweden)

    Yubao Chen

    2017-10-01

    Full Text Available With ever-increasing market competition and advances in technology, more and more countries are prioritizing advanced manufacturing technology as their top priority for economic growth. Germany announced the Industry 4.0 strategy in 2013. The US government launched the Advanced Manufacturing Partnership (AMP in 2011 and the National Network for Manufacturing Innovation (NNMI in 2014. Most recently, the Manufacturing USA initiative was officially rolled out to further “leverage existing resources... to nurture manufacturing innovation and accelerate commercialization” by fostering close collaboration between industry, academia, and government partners. In 2015, the Chinese government officially published a 10-year plan and roadmap toward manufacturing: Made in China 2025. In all these national initiatives, the core technology development and implementation is in the area of advanced manufacturing systems. A new manufacturing paradigm is emerging, which can be characterized by two unique features: integrated manufacturing and intelligent manufacturing. This trend is in line with the progress of industrial revolutions, in which higher efficiency in production systems is being continuously pursued. To this end, 10 major technologies can be identified for the new manufacturing paradigm. This paper describes the rationales and needs for integrated and intelligent manufacturing (i2M systems. Related technologies from different fields are also described. In particular, key technological enablers, such as the Internet of Things and Services (IoTS, cyber-physical systems (CPSs, and cloud computing are discussed. Challenges are addressed with applications that are based on commercially available platforms such as General Electric (GE’s Predix and PTC’s ThingWorx.

  7. The Grid-Enabled NMR Spectroscopy

    International Nuclear Information System (INIS)

    Lawenda, M.; Meyer, N.; Stroinski, M.; Popenda, L.; Gdaniec, Z.; Adamiak, R.W.

    2005-01-01

    The laboratory equipment used for experimental work is very expensive and unique as well. Only big regional or national centers could afford to purchase and use it, but on a very limited scale. That is a real problem that disqualifies all other research groups not having direct access to these instruments. Therefore the proposed framework plays a crucial role in equalizing the chances of all research groups. The Virtual Laboratory (VLab) project focuses its activity on embedding laboratory equipments in grid environments (handling HPC and visualization), touching some crucial issues not solved yet. In general the issues concern the standardization of the laboratory equipment definition to treat it as a simple grid resource, supporting the end user under the term of the workflow definition, introducing the accounting issues and prioritizing jobs which follow experiments on equipments. Nowadays, we have a lot of various equipments, which can be accessed remotely via network, but only on the way allowing the local management console/display to move through the network to make a simpler access. To manage an experimental and post-processing data as well as store them in a organized way, a special Digital Science Library was developed. The project delivers a framework to enable the usage of many different scientific facilities. The physical layer of the architecture includes the existing high-speed network like PIONIER in Poland, and the HPC and visualization infrastructure. The application, in fact the framework, can be used in all experimental disciplines, where access to physical equipments are crucial, e.g., chemistry (spectrometer), radio astronomy (radio telescope), and medicine (CAT scanner). The poster presentation will show how we deployed the concept in chemistry, supporting these disciplines with grid environment and embedding the Bruker Avance 600 MHz and Varian 300 MHz spectrometers. (author)

  8. Fractal Geometry Enables Classification of Different Lung Morphologies in a Model of Experimental Asthma

    Science.gov (United States)

    Obert, Martin; Hagner, Stefanie; Krombach, Gabriele A.; Inan, Selcuk; Renz, Harald

    2015-06-01

    Animal models represent the basis of our current understanding of the pathophysiology of asthma and are of central importance in the preclinical development of drug therapies. The characterization of irregular lung shapes is a major issue in radiological imaging of mice in these models. The aim of this study was to find out whether differences in lung morphology can be described by fractal geometry. Healthy and asthmatic mouse groups, before and after an acute asthma attack induced by methacholine, were studied. In vivo flat-panel-based high-resolution Computed Tomography (CT) was used for mice's thorax imaging. The digital image data of the mice's lungs were segmented from the surrounding tissue. After that, the lungs were divided by image gray-level thresholds into two additional subsets. One subset contained basically the air transporting bronchial system. The other subset corresponds mainly to the blood vessel system. We estimated the fractal dimension of all sets of the different mouse groups using the mass radius relation (mrr). We found that the air transporting subset of the bronchial lung tissue enables a complete and significant differentiation between all four mouse groups (mean D of control mice before methacholine treatment: 2.64 ± 0.06; after treatment: 2.76 ± 0.03; asthma mice before methacholine treatment: 2.37 ± 0.16; after treatment: 2.71 ± 0.03; p < 0.05). We conclude that the concept of fractal geometry allows a well-defined, quantitative numerical and objective differentiation of lung shapes — applicable most likely also in human asthma diagnostics.

  9. Gene expression profile data for mouse facial development

    Directory of Open Access Journals (Sweden)

    Sonia M. Leach

    2017-08-01

    Full Text Available This article contains data related to the research articles "Spatial and Temporal Analysis of Gene Expression during Growth and Fusion of the Mouse Facial Prominences" (Feng et al., 2009 [1] and “Systems Biology of facial development: contributions of ectoderm and mesenchyme” (Hooper et al., 2017 In press [2]. Embryonic mammalian craniofacial development is a complex process involving the growth, morphogenesis, and fusion of distinct facial prominences into a functional whole. Aberrant gene regulation during this process can lead to severe craniofacial birth defects, including orofacial clefting. As a means to understand the genes involved in facial development, we had previously dissected the embryonic mouse face into distinct prominences: the mandibular, maxillary or nasal between E10.5 and E12.5. The prominences were then processed intact, or separated into ectoderm and mesenchyme layers, prior analysis of RNA expression using microarrays (Feng et al., 2009, Hooper et al., 2017 in press [1,2]. Here, individual gene expression profiles have been built from these datasets that illustrate the timing of gene expression in whole prominences or in the separated tissue layers. The data profiles are presented as an indexed and clickable list of the genes each linked to a graphical image of that gene׳s expression profile in the ectoderm, mesenchyme, or intact prominence. These data files will enable investigators to obtain a rapid assessment of the relative expression level of any gene on the array with respect to time, tissue, prominence, and expression trajectory.

  10. Micromotor-enabled active drug delivery for in vivo treatment of stomach infection.

    Science.gov (United States)

    de Ávila, Berta Esteban-Fernández; Angsantikul, Pavimol; Li, Jinxing; Angel Lopez-Ramirez, Miguel; Ramírez-Herrera, Doris E; Thamphiwatana, Soracha; Chen, Chuanrui; Delezuk, Jorge; Samakapiruk, Richard; Ramez, Valentin; Obonyo, Marygorret; Zhang, Liangfang; Wang, Joseph

    2017-08-16

    Advances in bioinspired design principles and nanomaterials have led to tremendous progress in autonomously moving synthetic nano/micromotors with diverse functionalities in different environments. However, a significant gap remains in moving nano/micromotors from test tubes to living organisms for treating diseases with high efficacy. Here we present the first, to our knowledge, in vivo therapeutic micromotors application for active drug delivery to treat gastric bacterial infection in a mouse model using clarithromycin as a model antibiotic and Helicobacter pylori infection as a model disease. The propulsion of drug-loaded magnesium micromotors in gastric media enables effective antibiotic delivery, leading to significant bacteria burden reduction in the mouse stomach compared with passive drug carriers, with no apparent toxicity. Moreover, while the drug-loaded micromotors reach similar therapeutic efficacy as the positive control of free drug plus proton pump inhibitor, the micromotors can function without proton pump inhibitors because of their built-in proton depletion function associated with their locomotion.Nano- and micromotors have been demonstrated in vitro for a range of applications. Here the authors demonstrate the in-vivo therapeutic use of micromotors to treat H. pylori infection.

  11. Bioblendstocks that Enable High Efficiency Engine Designs

    Energy Technology Data Exchange (ETDEWEB)

    McCormick, Robert L.; Fioroni, Gina M.; Ratcliff, Matthew A.; Zigler, Bradley T.; Farrell, John

    2016-11-03

    The past decade has seen a high level of innovation in production of biofuels from sugar, lipid, and lignocellulose feedstocks. As discussed in several talks at this workshop, ethanol blends in the E25 to E50 range could enable more highly efficient spark-ignited (SI) engines. This is because of their knock resistance properties that include not only high research octane number (RON), but also charge cooling from high heat of vaporization, and high flame speed. Emerging alcohol fuels such as isobutanol or mixed alcohols have desirable properties such as reduced gasoline blend vapor pressure, but also have lower RON than ethanol. These fuels may be able to achieve the same knock resistance benefits, but likely will require higher blend levels or higher RON hydrocarbon blendstocks. A group of very high RON (>150) oxygenates such as dimethyl furan, methyl anisole, and related compounds are also produced from biomass. While providing no increase in charge cooling, their very high octane numbers may provide adequate knock resistance for future highly efficient SI engines. Given this range of options for highly knock resistant fuels there appears to be a critical need for a fuel knock resistance metric that includes effects of octane number, heat of vaporization, and potentially flame speed. Emerging diesel fuels include highly branched long-chain alkanes from hydroprocessing of fats and oils, as well as sugar-derived terpenoids. These have relatively high cetane number (CN), which may have some benefits in designing more efficient CI engines. Fast pyrolysis of biomass can produce diesel boiling range streams that are high in aromatic, oxygen and acid contents. Hydroprocessing can be applied to remove oxygen and consequently reduce acidity, however there are strong economic incentives to leave up to 2 wt% oxygen in the product. This oxygen will primarily be present as low CN alkyl phenols and aryl ethers. While these have high heating value, their presence in diesel fuel

  12. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L

    2002-10-01

    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  13. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

    Science.gov (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

    2003-10-01

    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  14. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  15. Social-ecological enabling conditions for payments for ecosystem services

    OpenAIRE

    Heidi R. Huber-Stearns; Drew E. Bennett; Stephen Posner; Ryan C. Richards; Jenn Hoyle. Fair; Stella J. M. Cousins; Chelsie L. Romulo

    2017-01-01

    The concept of "enabling conditions" centers on conditions that facilitate approaches to addressing social and ecological challenges. Although multiple fields have independently addressed the concept of enabling conditions, the literature lacks a shared understanding or integration of concepts. We propose a more synthesized understanding of enabling conditions beyond disciplinary boundaries by focusing on the enabling conditions that influence the implementation of a range of environmental p...

  16. People avoid situations that enable them to deceive others

    NARCIS (Netherlands)

    Shalvi, S.; Handgraaf, M.J.J.; de Dreu, C.K.W.

    2011-01-01

    Information advantage enables people to benefit themselves by deceiving their counterparts. Using a modified ultimatum bargaining game with an exit option, we find that people are more likely to avoid settings enabling them to privately deceive their counterparts than settings which do not enable

  17. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2011-11-01

    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  18. The Mouse Genome Database (MGD): facilitating mouse as a model for human biology and disease.

    Science.gov (United States)

    Eppig, Janan T; Blake, Judith A; Bult, Carol J; Kadin, James A; Richardson, Joel E

    2015-01-01

    The Mouse Genome Database (MGD, http://www.informatics.jax.org) serves the international biomedical research community as the central resource for integrated genomic, genetic and biological data on the laboratory mouse. To facilitate use of mouse as a model in translational studies, MGD maintains a core of high-quality curated data and integrates experimentally and computationally generated data sets. MGD maintains a unified catalog of genes and genome features, including functional RNAs, QTL and phenotypic loci. MGD curates and provides functional and phenotype annotations for mouse genes using the Gene Ontology and Mammalian Phenotype Ontology. MGD integrates phenotype data and associates mouse genotypes to human diseases, providing critical mouse-human relationships and access to repositories holding mouse models. MGD is the authoritative source of nomenclature for genes, genome features, alleles and strains following guidelines of the International Committee on Standardized Genetic Nomenclature for Mice. A new addition to MGD, the Human-Mouse: Disease Connection, allows users to explore gene-phenotype-disease relationships between human and mouse. MGD has also updated search paradigms for phenotypic allele attributes, incorporated incidental mutation data, added a module for display and exploration of genes and microRNA interactions and adopted the JBrowse genome browser. MGD resources are freely available to the scientific community. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Genetic enrichment of cardiomyocytes derived from mouse ...

    African Journals Online (AJOL)

    Jane

    2011-06-22

    Jun 22, 2011 ... Pluripotent embryonic stem cells (ESC) have the ability to differentiate into a ... We describe a simple method to generate relatively pure cardiomyocytes from mouse ... In this study, we described the generation of transgenic.

  20. Melatonin receptors: latest insights from mouse models

    Science.gov (United States)

    Tosini, Gianluca; Owino, Sharon; Guillame, Jean-Luc; Jockers, Ralf

    2014-01-01

    Summary Melatonin, the neuro-hormone synthesized during the night, has recently seen an unexpected extension of its functional implications towards type 2 diabetes development, visual functions, sleep disturbances and depression. Transgenic mouse models were instrumental for the establishment of the link between melatonin and these major human diseases. Most of the actions of melatonin are mediated by two types of G protein-coupled receptors, named MT1 and MT2, which are expressed in many different organs and tissues. Understanding the pharmacology and function of mouse MT1 and MT2 receptors, including MT1/MT2 heteromers, will be of crucial importance to evaluate the relevance of these mouse models for future therapeutic developments. This review will critically discuss these aspects, and give some perspectives including the generation of new mouse models. PMID:24903552

  1. Circadian oscillators in the mouse brain

    DEFF Research Database (Denmark)

    Rath, Martin F; Rovsing, Louise; Møller, Morten

    2014-01-01

    with conditional cell-specific clock gene deletions. This prompted us to analyze the molecular clockwork of the mouse neocortex and cerebellum in detail. Here, by use of in situ hybridization and quantitative RT-PCR, we show that clock genes are expressed in all six layers of the neocortex and the Purkinje...... and granular cell layers of the cerebellar cortex of the mouse brain. Among these, Per1, Per2, Cry1, Arntl, and Nr1d1 exhibit circadian rhythms suggesting that local running circadian oscillators reside within neurons of the mouse neocortex and cerebellar cortex. The temporal expression profiles of clock genes...... are similar in the neocortex and cerebellum, but they are delayed by 5 h as compared to the SCN, suggestively reflecting a master-slave relationship between the SCN and extra-hypothalamic oscillators. Furthermore, ARNTL protein products are detectable in neurons of the mouse neocortex and cerebellum...

  2. A catalog of the mouse gut metagenome

    DEFF Research Database (Denmark)

    Xiao, Liang; Feng, Qiang; Liang, Suisha

    2015-01-01

    laboratories and fed either a low-fat or high-fat diet. Similar to the human gut microbiome, >99% of the cataloged genes are bacterial. We identified 541 metagenomic species and defined a core set of 26 metagenomic species found in 95% of the mice. The mouse gut microbiome is functionally similar to its human......We established a catalog of the mouse gut metagenome comprising ∼2.6 million nonredundant genes by sequencing DNA from fecal samples of 184 mice. To secure high microbiome diversity, we used mouse strains of diverse genetic backgrounds, from different providers, kept in different housing...... counterpart, with 95.2% of its Kyoto Encyclopedia of Genes and Genomes (KEGG) orthologous groups in common. However, only 4.0% of the mouse gut microbial genes were shared (95% identity, 90% coverage) with those of the human gut microbiome. This catalog provides a useful reference for future studies....

  3. Expression of the Argonaute protein PiwiL2 and piRNAs in adult mouse mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qiuling; Ma, Qi; Shehadeh, Lina A.; Wilson, Amber; Xia, Linghui; Yu, Hong [Department of Molecular and Cellular Pharmacology, Vascular Biology Institute, University of Miami Miller School of Medicine, Miami, FL 33136 (United States); Webster, Keith A., E-mail: kwebster@med.miami.edu [Department of Molecular and Cellular Pharmacology, Vascular Biology Institute, University of Miami Miller School of Medicine, Miami, FL 33136 (United States)

    2010-06-11

    Piwi (P-element-induced wimpy testis) first discovered in Drosophila is a member of the Argonaute family of micro-RNA binding proteins with essential roles in germ-cell development. The murine homologue of PiwiL2, also known as Mili is selectively expressed in the testes, and mice bearing targeted mutations of the PiwiL2 gene are male-sterile. PiwiL2 proteins are thought to protect the germ line genome by suppressing retrotransposons, stabilizing heterochromatin structure, and regulating target genes during meiosis and mitosis. Here, we report that PiwiL2 and associated piRNAs (piRs) may play similar roles in adult mouse mesenchymal stem cells. We found that PiwiL2 is expressed in the cytoplasm of metaphase mesenchymal stem cells from the bone marrow of adult and aged mice. Knockdown of PiwiL2 with a specific siRNA enhanced cell proliferation, significantly increased the number of cells in G1/S and G2/M cell cycle phases and was associated with increased expression of cell cycle genes CCND1, CDK8, microtubule regulation genes, and decreased expression of tumor suppressors Cables 1, LATS, and Cxxc4. The results suggest broader roles for Piwi in genome surveillance beyond the germ line and a possible role in regulating the cell cycle of mesenchymal stem cells.

  4. Expression of the Argonaute protein PiwiL2 and piRNAs in adult mouse mesenchymal stem cells

    International Nuclear Information System (INIS)

    Wu, Qiuling; Ma, Qi; Shehadeh, Lina A.; Wilson, Amber; Xia, Linghui; Yu, Hong; Webster, Keith A.

    2010-01-01

    Piwi (P-element-induced wimpy testis) first discovered in Drosophila is a member of the Argonaute family of micro-RNA binding proteins with essential roles in germ-cell development. The murine homologue of PiwiL2, also known as Mili is selectively expressed in the testes, and mice bearing targeted mutations of the PiwiL2 gene are male-sterile. PiwiL2 proteins are thought to protect the germ line genome by suppressing retrotransposons, stabilizing heterochromatin structure, and regulating target genes during meiosis and mitosis. Here, we report that PiwiL2 and associated piRNAs (piRs) may play similar roles in adult mouse mesenchymal stem cells. We found that PiwiL2 is expressed in the cytoplasm of metaphase mesenchymal stem cells from the bone marrow of adult and aged mice. Knockdown of PiwiL2 with a specific siRNA enhanced cell proliferation, significantly increased the number of cells in G1/S and G2/M cell cycle phases and was associated with increased expression of cell cycle genes CCND1, CDK8, microtubule regulation genes, and decreased expression of tumor suppressors Cables 1, LATS, and Cxxc4. The results suggest broader roles for Piwi in genome surveillance beyond the germ line and a possible role in regulating the cell cycle of mesenchymal stem cells.

  5. Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

    International Nuclear Information System (INIS)

    Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

    2007-01-01

    Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

  6. Interactions of mouse pinworms and trichomonads

    OpenAIRE

    Choutková, Jana

    2012-01-01

    Oxyurid nematodes Aspiculuris tetraptera and Syphacia obvelata are both common mouse intestinal parasites; in the same location several species of trichomonads occur. Tritrichomonas muris is the most often found, but there are also some others: Tritrichomonas minuta, Pentatrichomonas hominis or Hexamastix muris. It is known that, under some circumstances, trichomonads can be found in the intestine of mouse pinworms, as reported by Theiler and Farber (1936) for T. muris in A. tetraptera and S....

  7. A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype

    Science.gov (United States)

    Slee, R.; Grimes, B.; Speed, R. M.; Taggart, M.; Maguire, S. M.; Ross, A.; McGill, N. I.; Saunders, P. T. K.; Cooke, H. J.

    1999-01-01

    In a subset of infertile men, a spectrum of spermatogenic defects ranging from a complete absence of germ cells (sertoli cell only) to oligozoospermia is associated with microdeletions of the DAZ (deleted in azoospermia) gene cluster on human distal Yq. DAZ encodes a testis-specific protein with RNA-binding potential recently derived from a single-copy gene DAZL1 (DAZ-like) on chromosome 3. Y chromosomal DAZ homologues are confined to humans and higher primates. It remains unclear which function unique to higher primate spermatogenesis DAZ may serve, and the functional status of the gene recently has been questioned. To assess the extent of functional conservation we have tested the capacity of a human DAZ gene contained in a 225-kb yeast artificial chromosome to complement the sterile phenotype of the Dazl null mouse (Dazl−/−), which is characterized by severe germ-cell depletion and meiotic failure. Although Dazl−/− mice remained infertile when the DAZ transgene was introduced, histological examination revealed a partial and variable rescue of the mutant phenotype, manifest as a pronounced increase in the germ cell population of the seminiferous tubules and survival to the pachytene stage of meiosis. As well as constituting definitive proof of the spermatogenic role of the DAZ gene product, these findings confirm the high degree of functional conservation between the DAZ and DAZL1 genes, suggesting they may constitute a single target for contraceptive intervention and raising the possibility of therapeutic up-regulation of the DAZL1 gene in infertile men. PMID:10393944

  8. Heme synthesis in normal mouse liver and mouse liver tumors

    International Nuclear Information System (INIS)

    Stout, D.L.; Becker, F.F.

    1990-01-01

    Hepatic cancers from mice and rats demonstrate decreased levels of delta-aminolevulinic acid synthase, the rate-limiting enzyme in the heme synthetic pathway, and increased heme oxygenase, the heme-catabolizing enzyme. These findings suggest that diminution of P-450, b5, and catalase in these lesions may result from a heme supply that is limited by decreased heme synthesis and increased heme catabolism. Heme synthesis was measured in mouse liver tumors (MLT) and adjacent tumor-free lobes (BKG) by administering the radiolabeled heme precursors 55 FeCl3 and [2- 14 C]glycine and subsequently extracting the heme for determination of specific activity. Despite reduced delta-aminolevulinic acid synthase activity in MLT, both tissues incorporated [2-14C]glycine into heme at similar rates. At early time points, heme extracted from MLT contained less 55Fe than that from BKG. This was attributed to the findings that MLT took up 55Fe at a slower rate than BKG and had larger iron stores than BKG. The amount of heme per milligram of protein was also similar in both tissues. These findings militate against the hypothesis that diminished hemoprotein levels in MLT result from limited availability of heme. It is probable, therefore, that decreased hemoprotein levels in hepatic tumors are linked to a general program of dedifferentiation associated with the cancer phenotype. Diminution of hemoprotein in MLT may result in a relatively increased intracellular heme pool. delta-Aminolevulinic acid synthase and heme oxygenase are, respectively, negatively and positively regulated by heme. Thus, their alteration in MLT may be due to the regulatory influences of the heme pool

  9. Evaluation of synthetic vascular grafts in a mouse carotid grafting model.

    Directory of Open Access Journals (Sweden)

    Alex H P Chan

    Full Text Available Current animal models for the evaluation of synthetic grafts are lacking many of the molecular tools and transgenic studies available to other branches of biology. A mouse model of vascular grafting would allow for the study of molecular mechanisms of graft failure, including in the context of clinically relevant disease states. In this study, we comprehensively characterise a sutureless grafting model which facilitates the evaluation of synthetic grafts in the mouse carotid artery. Using conduits electrospun from polycaprolactone (PCL we show the gradual development of a significant neointima within 28 days, found to be greatest at the anastomoses. Histological analysis showed temporal increases in smooth muscle cell and collagen content within the neointima, demonstrating its maturation. Endothelialisation of the PCL grafts, assessed by scanning electron microscopy (SEM analysis and CD31 staining, was near complete within 28 days, together replicating two critical aspects of graft performance. To further demonstrate the potential of this mouse model, we used longitudinal non-invasive tracking of bone-marrow mononuclear cells from a transgenic mouse strain with a dual reporter construct encoding both luciferase and green fluorescent protein (GFP. This enabled characterisation of mononuclear cell homing and engraftment to PCL using bioluminescence imaging and histological staining over time (7, 14 and 28 days. We observed peak luminescence at 7 days post-graft implantation that persisted until sacrifice at 28 days. Collectively, we have established and characterised a high-throughput model of grafting that allows for the evaluation of key clinical drivers of graft performance.

  10. Approximating transcranial magnetic stimulation with electric stimulation in mouse: a simulation study.

    Science.gov (United States)

    Barnes, Walter L; Lee, Won Hee; Peterchev, Angel V

    2014-01-01

    Rodent models are valuable for preclinical examination of novel therapeutic techniques, including transcranial magnetic stimulation (TMS). However, comparison of TMS effects in rodents and humans is confounded by inaccurate scaling of the spatial extent of the induced electric field in rodents. The electric field is substantially less focal in rodent models of TMS due to the technical restrictions of making very small coils that can handle the currents required for TMS. We examine the electric field distributions generated by various electrode configurations of electric stimulation in an inhomogeneous high-resolution finite element mouse model, and show that the electric field distributions produced by human TMS can be approximated by electric stimulation in mouse. Based on these results and the limits of magnetic stimulation in mice, we argue that the most practical and accurate way to model focal TMS in mice is electric stimulation through either cortical surface electrodes or electrodes implanted halfway through the mouse cranium. This approach could allow much more accurate approximation of the human TMS electric field focality and strength than that offered by TMS in mouse, enabling, for example, focal targeting of specific cortical regions, which is common in human TMS paradigms.

  11. Evaluation of synthetic vascular grafts in a mouse carotid grafting model.

    Science.gov (United States)

    Chan, Alex H P; Tan, Richard P; Michael, Praveesuda L; Lee, Bob S L; Vanags, Laura Z; Ng, Martin K C; Bursill, Christina A; Wise, Steven G

    2017-01-01

    Current animal models for the evaluation of synthetic grafts are lacking many of the molecular tools and transgenic studies available to other branches of biology. A mouse model of vascular grafting would allow for the study of molecular mechanisms of graft failure, including in the context of clinically relevant disease states. In this study, we comprehensively characterise a sutureless grafting model which facilitates the evaluation of synthetic grafts in the mouse carotid artery. Using conduits electrospun from polycaprolactone (PCL) we show the gradual development of a significant neointima within 28 days, found to be greatest at the anastomoses. Histological analysis showed temporal increases in smooth muscle cell and collagen content within the neointima, demonstrating its maturation. Endothelialisation of the PCL grafts, assessed by scanning electron microscopy (SEM) analysis and CD31 staining, was near complete within 28 days, together replicating two critical aspects of graft performance. To further demonstrate the potential of this mouse model, we used longitudinal non-invasive tracking of bone-marrow mononuclear cells from a transgenic mouse strain with a dual reporter construct encoding both luciferase and green fluorescent protein (GFP). This enabled characterisation of mononuclear cell homing and engraftment to PCL using bioluminescence imaging and histological staining over time (7, 14 and 28 days). We observed peak luminescence at 7 days post-graft implantation that persisted until sacrifice at 28 days. Collectively, we have established and characterised a high-throughput model of grafting that allows for the evaluation of key clinical drivers of graft performance.

  12. Dimethyl amiloride improves glucose homeostasis in mouse models of type 2 diabetes.

    Science.gov (United States)

    Gunawardana, Subhadra C; Head, W Steven; Piston, David W

    2008-06-01

    Dimethyl amiloride (DMA) enhances insulin secretion in the pancreatic beta-cell. DMA also enhances time-dependent potentiation (TDP) and enables TDP to occur in situations where it is normally absent. As we have demonstrated before, these effects are mediated in part through inhibition of neuronal nitric oxide synthase (nNOS), resulting in increased availability of arginine. Thus both DMA and arginine have the potential to correct the secretory defect in diabetes by enabling or enhancing TDP. In the current study we have demonstrated the ability of these agents to improve blood glucose homeostasis in three mouse models of type 2 diabetes. The pattern of TDP under different conditions indicates that inhibition of NOS is not the only mechanism through which DMA exerts its positive effects. Thus we also have explored another possible mechanism through which DMA enables/enhances TDP, via the activation of mitochondrial alpha-ketoglutarate dehydrogenase.

  13. Identification of rat Rosa26 locus enables generation of knock-in rat lines ubiquitously expressing tdTomato.

    Science.gov (United States)

    Kobayashi, Toshihiro; Kato-Itoh, Megumi; Yamaguchi, Tomoyuki; Tamura, Chihiro; Sanbo, Makoto; Hirabayashi, Masumi; Nakauchi, Hiromitsu

    2012-11-01

    Recent discovery of a method for derivation and culture of germline-competent rat pluripotent stem cells (PSCs) enables generation of transgenic rats or knock-out rats via genetic modification of such PSCs. This opens the way to use rats, as is routine in mice, for analyses of gene functions or physiological features. In mouse or human, one widely used technique to express a gene of interest stably and ubiquitously is to insert that gene into the Rosa26 locus via gene targeting of PSCs. Rosa26 knock-in mice conditionally expressing a reporter or a toxin gene have contributed to tracing or ablation of specific cell lineages. We successfully identified a rat orthologue of the mouse Rosa26 locus. Insertion of tdTomato, a variant of red fluorescent protein, into the Rosa26 locus of PSCs of various rat strains allows ubiquitous expression of tdTomato. Through germline transmission of one Rosa26-tdTomato knock-in embryonic stem cell line, we also obtained tdTomato knock-in rats. These expressed tdTomato ubiquitously throughout their bodies, which indicates that the rat Rosa26 locus conserves functions of its orthologues in mouse and human. The new tools described here (targeting vectors, knock-in PSCs, and rats) should be useful for a variety of research using rats.

  14. Smartphone-controlled optogenetically engineered cells enable semiautomatic glucose homeostasis in diabetic mice.

    Science.gov (United States)

    Shao, Jiawei; Xue, Shuai; Yu, Guiling; Yu, Yuanhuan; Yang, Xueping; Bai, Yu; Zhu, Sucheng; Yang, Linfeng; Yin, Jianli; Wang, Yidan; Liao, Shuyong; Guo, Sanwei; Xie, Mingqi; Fussenegger, Martin; Ye, Haifeng

    2017-04-26

    With the increasingly dominant role of smartphones in our lives, mobile health care systems integrating advanced point-of-care technologies to manage chronic diseases are gaining attention. Using a multidisciplinary design principle coupling electrical engineering, software development, and synthetic biology, we have engineered a technological infrastructure enabling the smartphone-assisted semiautomatic treatment of diabetes in mice. A custom-designed home server SmartController was programmed to process wireless signals, enabling a smartphone to regulate hormone production by optically engineered cells implanted in diabetic mice via a far-red light (FRL)-responsive optogenetic interface. To develop this wireless controller network, we designed and implanted hydrogel capsules carrying both engineered cells and wirelessly powered FRL LEDs (light-emitting diodes). In vivo production of a short variant of human glucagon-like peptide 1 (shGLP-1) or mouse insulin by the engineered cells in the hydrogel could be remotely controlled by smartphone programs or a custom-engineered Bluetooth-active glucometer in a semiautomatic, glucose-dependent manner. By combining electronic device-generated digital signals with optogenetically engineered cells, this study provides a step toward translating cell-based therapies into the clinic. Copyright © 2017, American Association for the Advancement of Science.

  15. Retinoic acid combined with spermatogonial stem cell conditions facilitate the generation of mouse germ-like cells

    DEFF Research Database (Denmark)

    Dong, Guoyi; Shang, Zhouchun; Liu, Longqi

    2017-01-01

    Spermatogenic lineage has been directly generated in spermatogonial stem cell (SSC) conditions from human pluripotent stem cells (PSCs). However, it remains unknown whether mouse embryonic stem cells (ESCs) can directly differentiate into advanced male germ cell lineage in the same conditions. Here......, we showed rather low efficiency of germ-like cell generation from mouse ESCs in SSC conditions. Interestingly, addition of retinoic acid (RA) into SSC conditions enabled efficient differentiation of mouse ESCs into germ-like cells, as shown by the activation of spermatogenesis-associated genes...... such as Mvh, Dazl, Prdm14, Stella, Scp1, Scp3, Stra8 and Rec8. In contrast, for cells cultured in control medium, the activation of the above genes barely occurred. In addition, RA with SSC conditions yielded colonies of Acrosin-expressing cells and the positive ratio reached a peak at day 6. Our work thus...

  16. Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

    Directory of Open Access Journals (Sweden)

    Teruo Umemoto

    2012-03-01

    Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

  17. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  18. Web application for recording learners’ mouse trajectories and retrieving their study logs for data analysis

    Directory of Open Access Journals (Sweden)

    Yoshinori Miyazaki

    2012-03-01

    Full Text Available With the accelerated implementation of e-learning systems in educational institutions, it has become possible to record learners’ study logs in recent years. It must be admitted that little research has been conducted upon the analysis of the study logs that are obtained. In addition, there is no software that traces the mouse movements of learners during their learning processes, which the authors believe would enable teachers to better understand their students’ behaviors. The objective of this study is to develop a Web application that records students’ study logs, including their mouse trajectories, and to devise an IR tool that can summarize such diversified data. The results of an experiment are also scrutinized to provide an analysis of the relationship between learners’ activities and their study logs.

  19. Transgenic Mouse Models Transferred into the Test Tube: New Perspectives for Developmental Toxicity Testing In Vitro?

    Science.gov (United States)

    Kugler, Josephine; Luch, Andreas; Oelgeschläger, Michael

    2016-10-01

    Despite our increasing understanding of molecular mechanisms controlling embryogenesis, the identification and characterization of teratogenic substances still heavily relies on animal testing. Embryonic development depends on cell-autonomous and non-autonomous processes including spatiotemporally regulated extracellular signaling activities. These have been elucidated in transgenic mouse models harboring easily detectable reporter genes under the control of evolutionarily conserved signaling cascades. We propose combining these transgenic mouse models and cells derived thereof with existing alternative toxicological testing strategies. This would enable the plausibility of in vitro data to be verified in light of in vivo data and, ultimately, facilitate regulatory acceptance of in vitro test methods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Semantic Sensor Web Enablement for COAST, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Sensor Web Enablement (SWE) is an Open Geospatial Consortium (OGC) standard Service Oriented Architecture (SOA) that facilitates discovery and integration of...

  1. Logistics Reduction: RFID Enabled Autonomous Logistics Management (REALM)

    Data.gov (United States)

    National Aeronautics and Space Administration — The Advanced Exploration Systems (AES) Logistics Reduction (LR) project Radio-frequency identification (RFID) Enabled Autonomous Logistics Management (REALM) task...

  2. Web-Enabled Analysis of a Large-Scale Deactivation and Decommissioning Program

    International Nuclear Information System (INIS)

    Bollinger, James S.; Austin, William E.

    2008-01-01

    From the mid-1950's through the 1980's, the U.S. Department of Energy's Savannah River Site produced nuclear materials for the weapons stockpile, for medical and industrial applications, and for space exploration. Although SRS has a continuing defense-related mission, the overall site mission is now oriented toward environmental restoration and management of legacy chemical and nuclear waste. With the change in mission, SRS no longer has a need for much of the infrastructure developed to support the weapons program. This excess infrastructure, which includes over 1000 facilities, will be decommissioned and demolished over the forthcoming years. A comprehensive environmental management plan was developed in 2003 detailing the schedule and sequence for decommissioning and demolition (D and D) activities. Implementation of this plan was anticipated to have a significant impact at SRS; therefore, a sophisticated web-enabled mapping capability was developed to allow SRS management, employees, and other stakeholders, to view the contents of the plan in an interactive fashion. Web-enabled mapping allows users to view the overall impact of the plan from a unique geographic perspective that can be quickly updated to reflect changes on the ground. Development of the web-based D and D mapping and management system provides SRS personnel the ability to see the detailed contents of the facilities D and D plan in a geographic context and highly interactive environment. As the plan changes due to internal and external dynamic factors, updates can be quickly made so that the latest and most accurate information is available. Information content can be easily managed by the user in the application, allowing change in granularity with the click of a mouse button. As a result, the use of GIS and web-enabled mapping has had a revolutionary impact on the development and dissemination of D and D information at SRS

  3. Chemically-induced photoreceptor degeneration and protection in mouse iPSC-derived three-dimensional retinal organoids

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Ito

    2017-10-01

    Full Text Available Induced pluripotent stem cells (iPSCs, which can be differentiated into various tissues and cell types, have been used for clinical research and disease modeling. Self-organizing three-dimensional (3D tissue engineering has been established within the past decade and enables researchers to obtain tissues and cells that almost mimic in vivo development. However, there are no reports of practical experimental procedures that reproduce photoreceptor degeneration. In this study, we induced photoreceptor cell death in mouse iPSC-derived 3D retinal organoids (3D-retinas by 4-hydroxytamoxifen (4-OHT, which induces photoreceptor degeneration in mouse retinal explants, and then established a live-cell imaging system to measure degeneration-related properties. Furthermore, we quantified the protective effects of representative ophthalmic supplements for treating the photoreceptor degeneration. This drug evaluation system enables us to monitor drug effects in photoreceptor cells and could be useful for drug screening.

  4. Ultrasound imaging of the mouse pancreatic duct using lipid microbubbles

    Science.gov (United States)

    Banerjee, B.; McKeown, K. R.; Skovan, B.; Ogram, E.; Ingram, P.; Ignatenko, N.; Paine-Murrieta, G.; Witte, R.; Matsunaga, T. O.

    2012-03-01

    Research requiring the murine pancreatic duct to be imaged is often challenging due to the difficulty in selectively cannulating the pancreatic duct. We have successfully catheterized the pancreatic duct through the common bile duct in severe combined immune deficient (SCID) mice and imaged the pancreatic duct with gas filled lipid microbubbles that increase ultrasound imaging sensitivity due to exquisite scattering at the gas/liquid interface. A SCID mouse was euthanized by CO2, a midline abdominal incision made, the common bile duct cut at its midpoint, a 2 cm, 32 gauge tip catheter was inserted about 1 mm into the duct and tied with suture. The duodenum and pancreas were excised, removed in toto, embedded in agar and an infusion pump was used to instill normal saline or lipid-coated microbubbles (10 million / ml) into the duct. B-mode images before and after infusion of the duct with microbubbles imaged the entire pancreatic duct (~ 1 cm) with high contrast. The microbubbles were cavitated by high mechanical index (HMI) ultrasound for imaging to be repeated. Our technique of catheterization and using lipid microbubbles as a contrast agent may provide an effective, affordable technique of imaging the murine pancreatic duct; cavitation with HMI ultrasound would enable repeated imaging to be performed and clustering of targeted microbubbles to receptors on ductal cells would allow pathology to be localized accurately. This research was supported by the Experimental Mouse Shared Service of the AZ Cancer Center (Grant Number P30CA023074, NIH/NCI and the GI SPORE (NIH/NCI P50 CA95060).

  5. Usability of human Infinium MethylationEPIC BeadChip for mouse DNA methylation studies.

    Science.gov (United States)

    Needhamsen, Maria; Ewing, Ewoud; Lund, Harald; Gomez-Cabrero, David; Harris, Robert Adam; Kular, Lara; Jagodic, Maja

    2017-11-15

    The advent of array-based genome-wide DNA methylation methods has enabled quantitative measurement of single CpG methylation status at relatively low cost and sample input. Whereas the use of Infinium Human Methylation BeadChips has shown great utility in clinical studies, no equivalent tool is available for rodent animal samples. We examined the feasibility of using the new Infinium MethylationEPIC BeadChip for studying DNA methylation in mouse. In silico, we identified 19,420 EPIC probes (referred as mEPIC probes), which align with a unique best alignment score to the bisulfite converted reference mouse genome mm10. Further annotation revealed that 85% of mEPIC probes overlapped with mm10.refSeq genes at different genomic features including promoters (TSS1500 and TSS200), 1st exons, 5'UTRs, 3'UTRs, CpG islands, shores, shelves, open seas and FANTOM5 enhancers. Hybridization of mouse samples to Infinium Human MethylationEPIC BeadChips showed successful measurement of mEPIC probes and reproducibility between inter-array biological replicates. Finally, we demonstrated the utility of mEPIC probes for data exploration such as hierarchical clustering. Given the absence of cost and labor convenient genome-wide technologies in the murine system, our findings show that the Infinium MethylationEPIC BeadChip platform is suitable for investigation of the mouse methylome. Furthermore, we provide the "mEPICmanifest" with genomic features, available to users of Infinium Human MethylationEPIC arrays for mouse samples.

  6. Longitudinal Multiplexed Measurement of Quantitative Proteomic Signatures in Mouse Lymphoma Models Using Magneto-Nanosensors.

    Science.gov (United States)

    Lee, Jung-Rok; Appelmann, Iris; Miething, Cornelius; Shultz, Tyler O; Ruderman, Daniel; Kim, Dokyoon; Mallick, Parag; Lowe, Scott W; Wang, Shan X

    2018-01-01

    Cancer proteomics is the manifestation of relevant biological processes in cancer development. Thus, it reflects the activities of tumor cells, host-tumor interactions, and systemic responses to cancer therapy. To understand the causal effects of tumorigenesis or therapeutic intervention, longitudinal studies are greatly needed. However, most of the conventional mouse experiments are unlikely to accommodate frequent collection of serum samples with a large enough volume for multiple protein assays towards single-object analysis. Here, we present a technique based on magneto-nanosensors to longitudinally monitor the protein profiles in individual mice of lymphoma models using a small volume of a sample for multiplex assays. Methods: Drug-sensitive and -resistant cancer cell lines were used to develop the mouse models that render different outcomes upon the drug treatment. Two groups of mice were inoculated with each cell line, and treated with either cyclophosphamide or vehicle solution. Serum samples taken longitudinally from each mouse in the groups were measured with 6-plex magneto-nanosensor cytokine assays. To find the origin of IL-6, experiments were performed using IL-6 knock-out mice. Results: The differences in serum IL-6 and GCSF levels between the drug-treated and untreated groups were revealed by the magneto-nanosensor measurement on individual mice. Using the multiplex assays and mouse models, we found that IL-6 is secreted by the host in the presence of tumor cells upon the drug treatment. Conclusion: The multiplex magneto-nanosensor assays enable longitudinal proteomic studies on mouse tumor models to understand tumor development and therapy mechanisms more precisely within a single biological object.

  7. Perception of Information Technology Enablers for Effective Supply Chain Management

    NARCIS (Netherlands)

    Fedor Brookman; Jakobus Smit; Gilbert Gilbert Silvius

    2012-01-01

    This paper reports a study on the importance of enablers in order for IT to support effective supply chain management, as perceived defined by different positions in the supply chain. In the study, a significant difference for the enabler “Funds for IT enablement” is found between the supplier

  8. Microgrid Enabled Distributed Energy Solutions (MEDES) Fort Bliss Military Reservation

    Science.gov (United States)

    2014-02-01

    FINAL REPORT Microgrid Enabled Distributed Energy Solutions (MEDES) Fort Bliss Military Reservation ESTCP Project EW-201140 FEBRUARY...TITLE AND SUBTITLE Microgrid Enabled Distributed Energy Solutions (MEDES) 5a. CONTRACT NUMBER W912HQ-11-C-0082 Fort Bliss, Texas...Lockheed Martin’s Intelligent Microgrid Solution can provide more energy security while also lowering electric utility costs and greenhouse gas emissions

  9. Humanized mouse models: Application to human diseases.

    Science.gov (United States)

    Ito, Ryoji; Takahashi, Takeshi; Ito, Mamoru

    2018-05-01

    Humanized mice are superior to rodents for preclinical evaluation of the efficacy and safety of drug candidates using human cells or tissues. During the past decade, humanized mouse technology has been greatly advanced by the establishment of novel platforms of genetically modified immunodeficient mice. Several human diseases can be recapitulated using humanized mice due to the improved engraftment and differentiation capacity of human cells or tissues. In this review, we discuss current advanced humanized mouse models that recapitulate human diseases including cancer, allergy, and graft-versus-host disease. © 2017 Wiley Periodicals, Inc.

  10. Infra Red 3D Computer Mouse

    DEFF Research Database (Denmark)

    Harbo, Anders La-Cour; Stoustrup, Jakob

    2000-01-01

    The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use of bandw......The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use...

  11. Mouse Model of Burn Wound and Infection

    DEFF Research Database (Denmark)

    Calum, Henrik; Høiby, Niels; Moser, Claus

    2017-01-01

    The immunosuppression induced by thermal injury renders the burned victim susceptible to infection. A mouse model was developed to examine the immunosuppression, which was possible to induce even at a minor thermal insult of 6% total body surface area. After induction of the burn (48 hr) a depres......The immunosuppression induced by thermal injury renders the burned victim susceptible to infection. A mouse model was developed to examine the immunosuppression, which was possible to induce even at a minor thermal insult of 6% total body surface area. After induction of the burn (48 hr...

  12. Immunohistochemical visualization of mouse interneuron subtypes

    DEFF Research Database (Denmark)

    Jensen, Simon Mølgaard; Ulrichsen, Maj; Boggild, Simon

    2014-01-01

    , and calretinin are also commonly used as markers to narrow down the specific interneuron subtype. Here, we describe a journey to find the necessary immunological reagents for studying GABAergic interneurons of the mouse hippocampus. Based on web searches there are several hundreds of different antibodies...... of the hippocampus where they have previously been described. Additionally, the antibodies were also tested on sections from mouse spinal cord with similar criteria for specificity of the antibodies. Using the antibodies with a high rating on pAbmAbs, stainings with high signal-to-noise ratios and location...

  13. Microscopic validation of whole mouse micro-metastatic tumor imaging agents using cryo-imaging and sliding organ image registration

    OpenAIRE

    Liu, Yiqiao; Zhou, Bo; Qutaish, Mohammed; Wilson, David L.

    2016-01-01

    We created a metastasis imaging, analysis platform consisting of software and multi-spectral cryo-imaging system suitable for evaluating emerging imaging agents targeting micro-metastatic tumor. We analyzed CREKA-Gd in MRI, followed by cryo-imaging which repeatedly sectioned and tiled microscope images of the tissue block face, providing anatomical bright field and molecular fluorescence, enabling 3D microscopic imaging of the entire mouse with single metastatic cell sensitivity. To register ...

  14. Host genetic diversity enables Ebola hemorrhagic fever pathogenesis and resistance.

    Science.gov (United States)

    Rasmussen, Angela L; Okumura, Atsushi; Ferris, Martin T; Green, Richard; Feldmann, Friederike; Kelly, Sara M; Scott, Dana P; Safronetz, David; Haddock, Elaine; LaCasse, Rachel; Thomas, Matthew J; Sova, Pavel; Carter, Victoria S; Weiss, Jeffrey M; Miller, Darla R; Shaw, Ginger D; Korth, Marcus J; Heise, Mark T; Baric, Ralph S; de Villena, Fernando Pardo-Manuel; Feldmann, Heinz; Katze, Michael G

    2014-11-21

    Existing mouse models of lethal Ebola virus infection do not reproduce hallmark symptoms of Ebola hemorrhagic fever, neither delayed blood coagulation and disseminated intravascular coagulation nor death from shock, thus restricting pathogenesis studies to nonhuman primates. Here we show that mice from the Collaborative Cross panel of recombinant inbred mice exhibit distinct disease phenotypes after mouse-adapted Ebola virus infection. Phenotypes range from complete resistance to lethal disease to severe hemorrhagic fever characterized by prolonged coagulation times and 100% mortality. Inflammatory signaling was associated with vascular permeability and endothelial activation, and resistance to lethal infection arose by induction of lymphocyte differentiation and cellular adhesion, probably mediated by the susceptibility allele Tek. These data indicate that genetic background determines susceptibility to Ebola hemorrhagic fever. Copyright © 2014, American Association for the Advancement of Science.

  15. Simple and efficient expression of codon-optimized mouse leukemia ...

    African Journals Online (AJOL)

    Purpose: To obtain a higher yield of mouse leukemia inhibitory factor to maintain the proliferation potential of pluripotent ... It induces mouse myeloid leukemic M1 cells of terminal ... induces the production of acute phase proteins by lipocyte ...

  16. Social-ecological enabling conditions for payments for ecosystem services

    Directory of Open Access Journals (Sweden)

    Heidi R. Huber-Stearns

    2017-03-01

    Full Text Available The concept of "enabling conditions" centers on conditions that facilitate approaches to addressing social and ecological challenges. Although multiple fields have independently addressed the concept of enabling conditions, the literature lacks a shared understanding or integration of concepts. We propose a more synthesized understanding of enabling conditions beyond disciplinary boundaries by focusing on the enabling conditions that influence the implementation of a range of environmental policies termed payments for ecosystem services (PES. Through an analysis of key literature from different disciplinary perspectives, we examined how researchers and practitioners refer to and identify enabling conditions within the context of PES. Through our synthesis, we identified 24 distinct enabling conditions organized within 4 broad themes: biophysical, economic, governance, and social-cultural conditions. We found that the literature coalesces around certain enabling conditions, such as strong ecosystem science and existing institutions, regardless of disciplinary background or journal audience. We also observed key differences in how authors perceive the direction of influence for property type, program objectives, and number of actors. Additionally, we noted an emphasis on the importance of the contextual nature of many enabling conditions that may cause certain conditions to have a disproportionate impact on successful implementation in some circumstances. Unraveling the relative importance of specific enabling conditions in diverse contexts remains a research frontier. Ultimately, no single disciplinary perspective is likely to provide all necessary insights for PES creation, and given the intertwined nature of enabling conditions, practitioners need to consider insights from multiple dimensions. Our work suggests opportunities to better connect diverse conversations through integration of concepts, a common vocabulary, and a synthetic framework.

  17. Polycomb enables primitive endoderm lineage priming in embryonic stem cells

    DEFF Research Database (Denmark)

    Illingworth, Robert S; Hölzenspies, Jurriaan J; Roske, Fabian V

    2016-01-01

    Mouse embryonic stem cells (ESCs), like the blastocyst from which they are derived, contain precursors of the epiblast (Epi) and primitive endoderm (PrEn) lineages. While transient in vivo, these precursor populations readily interconvert in vitro. We show that altered transcription is the driver...... polycomb with dynamic changes in transcription and stalled lineage commitment, allowing cells to explore alternative choices prior to a definitive decision....

  18. Sequence and chromosomal localization of the mouse brevican gene

    DEFF Research Database (Denmark)

    Rauch, U; Meyer, H; Brakebusch, C

    1997-01-01

    Brevican is a brain-specific proteoglycan belonging to the aggrecan family. Phage clones containing the complete mouse brevican open reading frame of 2649 bp and the complete 3'-untranslated region of 341 bp were isolated from a mouse brain cDNA library, and cosmid clones containing the mouse...

  19. 9 CFR 113.33 - Mouse safety tests.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Mouse safety tests. 113.33 Section 113.33 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Procedures § 113.33 Mouse safety tests. One of the mouse safety tests provided in this section shall be...

  20. Disrupted epithelial/macrophage crosstalk via Spinster homologue 2-mediated S1P signaling may drive defective macrophage phagocytic function in COPD.

    Science.gov (United States)

    Tran, Hai B; Jersmann, Hubertus; Truong, Tung Thanh; Hamon, Rhys; Roscioli, Eugene; Ween, Miranda; Pitman, Melissa R; Pitson, Stuart M; Hodge, Greg; Reynolds, Paul N; Hodge, Sandra

    2017-01-01

    We have previously established a link between impaired phagocytic capacity and deregulated S1P signaling in alveolar macrophages from COPD subjects. We hypothesize that this defect may include a disruption of epithelial-macrophage crosstalk via Spns2-mediated intercellular S1P signaling. Primary alveolar macrophages and bronchial epithelial cells from COPD subjects and controls, cell lines, and a mouse model of chronic cigarette smoke exposure were studied. Cells were exposed to 10% cigarette smoke extract, or vehicle control. Spns2 expression and subcellular localization was studied by immunofluorescence, confocal microscopy and RT-PCR. Phagocytosis was assessed by flow-cytometry. Levels of intra- and extracellular S1P were measured by S1P [3H]-labeling. Spns2 expression was significantly increased (pS1P in the airway and that there is a possible disruption of epithelial/macrophage cross talk via Spns2-mediated S1P signaling in COPD and in response to cigarette smoke exposure.

  1. Mouse Genome Informatics (MGI) Is the International Resource for Information on the Laboratory Mouse.

    Science.gov (United States)

    Law, MeiYee; Shaw, David R

    2018-01-01

    Mouse Genome Informatics (MGI, http://www.informatics.jax.org/ ) web resources provide free access to meticulously curated information about the laboratory mouse. MGI's primary goal is to help researchers investigate the genetic foundations of human diseases by translating information from mouse phenotypes and disease models studies to human systems. MGI provides comprehensive phenotypes for over 50,000 mutant alleles in mice and provides experimental model descriptions for over 1500 human diseases. Curated data from scientific publications are integrated with those from high-throughput phenotyping and gene expression centers. Data are standardized using defined, hierarchical vocabularies such as the Mammalian Phenotype (MP) Ontology, Mouse Developmental Anatomy and the Gene Ontologies (GO). This chapter introduces you to Gene and Allele Detail pages and provides step-by-step instructions for simple searches and those that take advantage of the breadth of MGI data integration.

  2. Mouse manipulation through single-switch scanning.

    Science.gov (United States)

    Blackstien-Adler, Susie; Shein, Fraser; Quintal, Janet; Birch, Shae; Weiss, Patrice L Tamar

    2004-01-01

    Given the current extensive reliance on the graphical user interface, independent access to computer software requires that users be able to manipulate a pointing device of some type (e.g., mouse, trackball) or be able to emulate a mouse by some other means (e.g., scanning). The purpose of the present study was to identify one or more optimal single-switch scanning mouse emulation strategies. Four alternative scanning strategies (continuous Cartesian, discrete Cartesian, rotational, and hybrid quadrant/continuous Cartesian) were selected for testing based on current market availability as well as on theoretical considerations of their potential speed and accuracy. Each strategy was evaluated using a repeated measures study design by means of a test program that permitted mouse emulation via any one of four scanning strategies in a motivating environment; response speed and accuracy could be automatically recorded and considered in view of the motor, cognitive, and perceptual demands of each scanning strategy. Ten individuals whose disabilities required them to operate a computer via single-switch scanning participated in the study. Results indicated that Cartesian scanning was the preferred and most effective scanning strategy. There were no significant differences between results from the Continuous Cartesian and Discrete Cartesian scanning strategies. Rotational scanning was quite slow with respect to the other strategies, although it was equally accurate. Hybrid Quadrant scanning improved access time but at the cost of fewer correct selections. These results demonstrated the importance of testing and comparing alternate single-switch scanning strategies.

  3. Chemical Aspects of Lesser Mouse Deer Meat

    Directory of Open Access Journals (Sweden)

    Djalal Rosyidi

    2012-02-01

    Full Text Available An experiment aiming for studying chemical aspects of lesser mouse deer meat (Tragulus javanicus. This research explored the chemical aspects of lesser mouse deer meat (Tragulus javanicus. Eight lesser mouse deer (four female and four male were used in chemical aspects of lesser mouse deer meat. The parameters observed included proximate analysis, amino acid, fatty acid, cholesterol and EPA-DHA of the meat. The results showed that average meat chemical composition were content of water, protein, fat, ash and cholesterol were 76.33 %, 21.42 %, 0.51 %, 1.20% and 50.00 mg/100 g, respectively. Fatty acid consist of lauric acid, miristate, palmitate, stearic, oleic, linoleic, and linolenic were 1.04 % 3.09%, 30.97, 0.77%., 59.41%, 3.22% and 1.12%, respectively. The total EPA and DHA was 0.13% and 0.05%,   Keywords: amino acid, fatty acid, cholesterol and EPA-DHA

  4. the production of mouse embryonic stem cells

    Indian Academy of Sciences (India)

    MADU

    What history tells us VII. Twenty-five years ago: the production of mouse embryonic stem cells ... cells into the cavity of the blastocyst, it will be possible to test the effect of .... to the use of efficient immunosuppressive drugs like cyclosporin – was ...

  5. Pathology of Mouse Models of Accelerated Aging

    NARCIS (Netherlands)

    Harkema, L.; Youssef, S. A.; de Bruin, A.

    Progeroid mouse models display phenotypes in multiple organ systems that suggest premature aging and resemble features of natural aging of both mice and humans. The prospect of a significant increase in the global elderly population within the next decades has led to the emergence of geroscience,

  6. Genetic enrichment of cardiomyocytes derived from mouse ...

    African Journals Online (AJOL)

    Genetic enrichment of cardiomyocytes derived from mouse embryonic stem cells. WJ He, SC Li, LL Ye, H Liu, QW Wang, WD Han, XB Fu, ZL Chen. Abstract. Pluripotent embryonic stem cells (ESC) have the ability to differentiate into a variety of cell lineages in vitro, including cardiomyocytes. Successful applications of ...

  7. An update on the mouse liver proteome

    Directory of Open Access Journals (Sweden)

    Borlak Jürgen

    2009-09-01

    Full Text Available Abstract Background Decoding of the liver proteome is subject of intense research, but hampered by methodological constraints. We recently developed an improved protocol for studying rat liver proteins based on 2-DE-MALDI-TOF-MS peptide mass finger printing. This methodology was now applied to develop a mouse liver protein database. Results Liver proteins were extracted by two different lysis buffers in sequence followed by a liquid-phase IEF pre-fractionation and separation of proteins by 2 DE at two different pH ranges, notably 5-8 and 7-10. Based on 9600 in gel digests a total of 643 mouse liver proteins with high sequence coverage (> 20 peptides per protein could be identified by MALDI-TOF-MS peptide mass finger printing. Notably, 255 proteins are novel and have not been reported so far by conventional two-dimensional electrophoresis proteome mapping. Additionally, the results of the present findings for mouse liver were compared to published data of the rat proteome to compile as many proteins as possible in a rodent liver database. Conclusion Based on 2-DE MALDI-TOF-MS a significantly improved proteome map of mouse liver was obtained. We discuss some prominent members of newly identified proteins for a better understanding of liver biology.

  8. Construction of expression vectors carrying mouse peroxisomal ...

    African Journals Online (AJOL)

    The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene (PEP-cDNA) in prokaryotic and mammalian expression vectors in ... pGEX6p2-PEP and pUcD3-FLAG-PEP constructed vectors were transformed into the one shot TOP10 and JM105 bacterial competent cells, respectively.

  9. Construction of expression vectors carrying mouse peroxisomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-16

    Nov 16, 2009 ... The aim of this study was to construct expression vectors carrying mouse peroxisomal protein gene. (PEP-cDNA) in prokaryotic and mammalian expression vectors in chimeric cDNA types, encompassing. GST and FLAG with PEP-cDNA. PEP-cDNA was sub-cloned in pGEX6p2 prokaryotic expression ...

  10. Pathology of Mouse Models of Accelerated Aging

    NARCIS (Netherlands)

    Harkema, L; Youssef, S A; de Bruin, A

    2016-01-01

    Progeroid mouse models display phenotypes in multiple organ systems that suggest premature aging and resemble features of natural aging of both mice and humans. The prospect of a significant increase in the global elderly population within the next decades has led to the emergence of "geroscience,"

  11. Myelination competent conditionally immortalized mouse Schwann cells

    NARCIS (Netherlands)

    Saavedra, José T.; Wolterman, Ruud A.; Baas, Frank; ten Asbroek, Anneloor L. M. A.

    2008-01-01

    Numerous mouse myelin mutants are available to analyze the biology of the peripheral nervous system related to health and disease in vivo. However, robust in vitro biochemical characterizations of players in peripheral nerve processes are still not possible due to the limited growth capacities of

  12. Organizational Enablers for Governance and Governmentality of Projects

    DEFF Research Database (Denmark)

    Müller, Ralf; Pemsel, Sofia; Shao, Jingting

    2014-01-01

    This study identifies the organizational enablers for governance in the realm of projects. We first conceptualize organizational enablers as comprising of process facilitators and discursive abilities, each with its own factors and mechanisms. Then we apply this concept to the literature on proje......, and through development of self-responsible, self-organizing people for governmentality in project settings. Questions for future research are indicated....... governance, governance of projects and governmentality. Outcomes indicate that governance is enabled through different forms of flexibility at different levels of governance, institutional setup and authority at the project level, flexible structures and mindsets of people at the organizational level...

  13. Implementation analysis of lean enablers for managing engineering programs

    DEFF Research Database (Denmark)

    von Arnim, Joachim; Oehmen, Josef; Rebentisch, Eric

    2014-01-01

    This paper presents research to improve the applicability of the Lean Enablers and consists of two parts. The first is a case study of a very successful project management maturity improvement initiative at Siemens Industry Sector’s Industry Automation division in the US. It views the initiative...... from the perspective of the Lean Enablers [Oehmen 2012] and is based on information from [Sopko 2012a], [Sopko 2012b], [Sopko 2010], [Sopko 2009], interviews, internal documentation, and the used MSP program management methodology [UK 2011]. The analysis of Lean Enablers incorporated in the MSP...

  14. Internet-enabled collaborative agent-based supply chains

    Science.gov (United States)

    Shen, Weiming; Kremer, Rob; Norrie, Douglas H.

    2000-12-01

    This paper presents some results of our recent research work related to the development of a new Collaborative Agent System Architecture (CASA) and an Infrastructure for Collaborative Agent Systems (ICAS). Initially being proposed as a general architecture for Internet based collaborative agent systems (particularly complex industrial collaborative agent systems), the proposed architecture is very suitable for managing the Internet enabled complex supply chain for a large manufacturing enterprise. The general collaborative agent system architecture with the basic communication and cooperation services, domain independent components, prototypes and mechanisms are described. Benefits of implementing Internet enabled supply chains with the proposed infrastructure are discussed. A case study on Internet enabled supply chain management is presented.

  15. SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

    Directory of Open Access Journals (Sweden)

    Yi-Ting Lee

    2016-09-01

    Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

  16. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    Science.gov (United States)

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  17. Mouse Activity across Time Scales: Fractal Scenarios

    Science.gov (United States)

    Lima, G. Z. dos Santos; Lobão-Soares, B.; do Nascimento, G. C.; França, Arthur S. C.; Muratori, L.; Ribeiro, S.; Corso, G.

    2014-01-01

    In this work we devise a classification of mouse activity patterns based on accelerometer data using Detrended Fluctuation Analysis. We use two characteristic mouse behavioural states as benchmarks in this study: waking in free activity and slow-wave sleep (SWS). In both situations we find roughly the same pattern: for short time intervals we observe high correlation in activity - a typical 1/f complex pattern - while for large time intervals there is anti-correlation. High correlation of short intervals ( to : waking state and to : SWS) is related to highly coordinated muscle activity. In the waking state we associate high correlation both to muscle activity and to mouse stereotyped movements (grooming, waking, etc.). On the other side, the observed anti-correlation over large time scales ( to : waking state and to : SWS) during SWS appears related to a feedback autonomic response. The transition from correlated regime at short scales to an anti-correlated regime at large scales during SWS is given by the respiratory cycle interval, while during the waking state this transition occurs at the time scale corresponding to the duration of the stereotyped mouse movements. Furthermore, we find that the waking state is characterized by longer time scales than SWS and by a softer transition from correlation to anti-correlation. Moreover, this soft transition in the waking state encompass a behavioural time scale window that gives rise to a multifractal pattern. We believe that the observed multifractality in mouse activity is formed by the integration of several stereotyped movements each one with a characteristic time correlation. Finally, we compare scaling properties of body acceleration fluctuation time series during sleep and wake periods for healthy mice. Interestingly, differences between sleep and wake in the scaling exponents are comparable to previous works regarding human heartbeat. Complementarily, the nature of these sleep-wake dynamics could lead to a better

  18. Deep Eutectic Solvents Enable More Robust Chemoenzymatic Epoxidation Reactions

    NARCIS (Netherlands)

    Zhou, Pengfei; Wang, Xuping; Zeng, Chaoxi; Wang, Weifei; Yang, Bo; Hollmann, F.; Wang, Yonghua

    2017-01-01

    A chemoenzymatic method for the production of epoxidized vegetable oils was developed. The unique combination of the commercial lipase G from Penicillieum camembertii with certain deep eutectic solvents enabled the efficient production of epoxidized vegetable oils.

  19. Web-Enabled ATR/Fusion Development System

    National Research Council Canada - National Science Library

    Ruda, Harald

    2001-01-01

    .... We have designed a Web-Enabled ATR/Fusion Development System (WEADS) that will allow distributed development and execution of AIR and fusion algorithms using currently available infrastructures...

  20. Enabling search services on outsourced private spatial data

    KAUST Repository

    Yiu, Man Lung; Ghinita, Gabriel; Jensen, Christian Sø ndergaard; Kalnis, Panos

    2009-01-01

    Cloud computing services enable organizations and individuals to outsource the management of their data to a service provider in order to save on hardware investments and reduce maintenance costs. Only authorized users are allowed to access the data

  1. Prognostics-Enabled Power Supply for ADAPT Testbed, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Ridgetop's role is to develop electronic prognostics for sensing power systems in support of NASA/Ames ADAPT testbed. The prognostic enabled power systems from...

  2. An IT-enabled supply chain model: a simulation study

    Science.gov (United States)

    Cannella, Salvatore; Framinan, Jose M.; Barbosa-Póvoa, Ana

    2014-11-01

    During the last decades, supply chain collaboration practices and the underlying enabling technologies have evolved from the classical electronic data interchange (EDI) approach to a web-based and radio frequency identification (RFID)-enabled collaboration. In this field, most of the literature has focused on the study of optimal parameters for reducing the total cost of suppliers, by adopting operational research (OR) techniques. Herein we are interested in showing that the considered information technology (IT)-enabled structure is resilient, that is, it works well across a reasonably broad range of parameter settings. By adopting a methodological approach based on system dynamics, we study a multi-tier collaborative supply chain. Results show that the IT-enabled supply chain improves operational performance and customer service level. Nonetheless, benefits for geographically dispersed networks are of minor entity.

  3. Starshade Assembly Enabled by the Deep Space Gateway Architecture

    Science.gov (United States)

    Grunsfeld, J. M.; Siegler, N.; Mukherjee, R.

    2018-02-01

    A starshade is a large external coronagraph which will allow the direct imaging and analysis of planets around nearby stars. We present how the Deep Space Gateway would enable the robotic/astronaut construction of a starshade.

  4. Enabling legislation and regulatory determinations for a nuclear power programme

    International Nuclear Information System (INIS)

    Ha Vinh Phuong

    1977-01-01

    General remarks on objectives and scope of enabling legislation, on the regulatory body and on the IAEA activities and assistance in regulatory matters e.g. the IAEA Safety Guides which are in preparation. (HP) [de

  5. Distributed Collaborative Learning Communities Enabled by Information Communication Technology

    NARCIS (Netherlands)

    H.L. Alvarez (Heidi Lee)

    2006-01-01

    textabstractHow and why can Information Communication Technology (ICT) contribute to enhancing learning in distributed Collaborative Learning Communities (CLCs)? Drawing from relevant theories concerned with phenomenon of ICT enabled distributed collaborative learning, this book identifies gaps in

  6. Intercultural Knowledge Flows in Edge Organizations: Trust as an Enabler

    National Research Council Canada - National Science Library

    Gavrieli, Dana A; Scott, W. R

    2005-01-01

    ...., across military services and coalition partners) and knowledge flows. A major factor that emerges as an enabler of knowledge flows, especially in dynamic environments such as those in which Edge organizations operate, is trust...

  7. Excavating obstacles and enablers to internationalization at home

    NARCIS (Netherlands)

    Beelen, Jos; Woldegiyorgis, Ayenachew A.; Rumbley, Laura E.; de Wit, Hans

    2017-01-01

    Gives an overview of my research as a visiting scholar at The Boston College Center for International Higher Education. This research classifies these obstacles and enablers in four categories: disciplinary, external, internal and personal.

  8. Utility Energy Services Contracts: Enabling Documents, May 2009 (Book)

    Energy Technology Data Exchange (ETDEWEB)

    2009-05-01

    Enabling Documents, delivered by the U.S. Department of Energy's Federal Energy Management Program (FEMP) to provide materials that clarify the authority for federal agencies to enter into utility energy services contracts (UESCs).

  9. Make or buy of IT-enabled innovation

    DEFF Research Database (Denmark)

    Mahnke, Volker; Overby, Mikkel Lucas; Özcan, Serden

    2004-01-01

    , an analysis of three companies in the financial sector - Charles Schwab, Fidelity Investment, and Merrill Lynch - reveals that governance choices influence a company's ap-propriable learning curve advantage to slow down or speed up adoption and imitation of IT-enabled innovation. Moreover, we discuss...... the implications of governance choices in techno-logical environments characterised by either accumulation or disruption. Keywords: IT-enabled innovation, outsourcing, technological regime, strategic posture, first-mover advantages, financial services, online brokerage...

  10. Experimental Studies of Hydrocarbon Flame Phenomena: Enabling Combustion Control

    Science.gov (United States)

    2016-07-30

    flames," Physics of Fluids , vol. 7, no. 6, pp. 1447-54, 1995. [8] K. Lyons, " Toward an understanding of the stabilization mechanisms of lifted...Experimental Studies of Hydrocarbon Flame Phenomena: Enabling Combustion Control This report summarizes the research accomplished in the project...34Experimental Studies of Hydrocarbon Flame Phenomena: Enabling Combustion Control". The main areas of activity are: a) electrostatic flame and flow

  11. Biometrics Enabling Capability Increment 1 (BEC Inc 1)

    Science.gov (United States)

    2016-03-01

    modal biometrics submissions to include iris, face, palm and finger prints from biometrics collection devices, which will support the Warfighter in...2016 Major Automated Information System Annual Report Biometrics Enabling Capability Increment 1 (BEC Inc 1) Defense Acquisition Management...Phone: 227-3119 DSN Fax: Date Assigned: July 15, 2015 Program Information Program Name Biometrics Enabling Capability Increment 1 (BEC Inc 1) DoD

  12. Robotics to Enable Older Adults to Remain Living at Home

    OpenAIRE

    Pearce, Alan J.; Adair, Brooke; Miller, Kimberly; Ozanne, Elizabeth; Said, Catherine; Santamaria, Nick; Morris, Meg E.

    2012-01-01

    Given the rapidly ageing population, interest is growing in robots to enable older people to remain living at home. We conducted a systematic review and critical evaluation of the scientific literature, from 1990 to the present, on the use of robots in aged care. The key research questions were as follows: (1) what is the range of robotic devices available to enable older people to remain mobile, independent, and safe? and, (2) what is the evidence demonstrating that robotic devices are effec...

  13. Mechanical Engineering Design Project report: Enabler control systems

    Science.gov (United States)

    Cullen, Christian; Delvecchio, Dave; Scarborough, Alan; Havics, Andrew A.

    1992-01-01

    The Controls Group was assigned the responsibility for designing the Enabler's control system. The requirement for the design was that the control system must provide a simple user interface to control the boom articulation joints, chassis articulation joints, and the wheel drive. The system required controlling hydraulic motors on the Enabler by implementing 8-bit microprocessor boards. In addition, feedback to evaluate positions and velocities must be interfaced to provide the operator with confirmation as well as control.

  14. On the security of SSL/TLS-enabled applications

    Directory of Open Access Journals (Sweden)

    Manik Lal Das

    2014-01-01

    Full Text Available SSL/TLS (Secure Socket Layer/Transport Layer Security-enabled web applications aim to provide public key certificate based authentication, secure session key establishment, and symmetric key based traffic confidentiality. A large number of electronic commerce applications, such as stock trading, banking, shopping, and gaming rely on the security strength of the SSL/TLS protocol. In recent times, a potential threat, known as main-in-the-middle (MITM attack, has been exploited by attackers of SSL/TLS-enabled web applications, particularly when naive users want to connect to an SSL/TLS-enabled web server. In this paper, we discuss about the MITM threat to SSL/TLS-enabled web applications. We review the existing space of solutions to counter the MITM attack on SSL/TLS-enabled applications, and then, we provide an effective solution which can resist the MITM attack on SSL/TLS-enabled applications. The proposed solution uses a soft-token based approach for user authentication on top of the SSL/TLS’s security features. We show that the proposed solution is secure, efficient and user friendly in comparison to other similar approaches.

  15. Physician communication via Internet-enabled technology: A systematic review.

    Science.gov (United States)

    Barr, Neil G; Randall, Glen E; Archer, Norman P; Musson, David M

    2017-10-01

    The use of Internet-enabled technology (information and communication technology such as smartphone applications) may enrich information exchange among providers and, consequently, improve health care delivery. The purpose of this systematic review was to gain a greater understanding of the role that Internet-enabled technology plays in enhancing communication among physicians. Studies were identified through a search in three electronic platforms: the Association for Computing Machinery Digital Library, ProQuest, and Web of Science. The search identified 5140 articles; of these, 21 met all inclusion criteria. In general, physicians were satisfied with Internet-enabled technology, but consensus was lacking regarding whether Internet-enabled technology improved efficiency or made a difference to clinical decision-making. Internet-enabled technology can play an important role in enhancing communication among physicians, but the extent of that benefit is influenced by (1) the impact of Internet-enabled technology on existing work practices, (2) the availability of adequate resources, and (3) the nature of institutional elements, such as privacy legislation.

  16. Evaluación de un modelo de infección murino para la evaluación de vacunas homólogas y heterólogas contra Brucella canis Evaluation of a mouse infection model to evaluate homologue and heterologue vaccines against Brucella canis in mouse model

    OpenAIRE

    M Clausse; S.M. Estein

    2011-01-01

    La brucelosis canina es una enfermedad zoonótica que afecta a los caninos y provoca importantes pérdidas económicas en criaderos. En la actualidad, no existe una vacuna para la prevención de esta enfermedad. Una limitante en el desarrollo de una vacuna eficaz es la falta de un modelo experimental que permita evaluar la infección con Brucella canis. En este trabajo, se desarrolló un modelo ratón para evaluar la infección esplénica por B. canis empleando distintas dosis, tiempos de sacrificio y...

  17. MouseMine: a new data warehouse for MGI.

    Science.gov (United States)

    Motenko, H; Neuhauser, S B; O'Keefe, M; Richardson, J E

    2015-08-01

    MouseMine (www.mousemine.org) is a new data warehouse for accessing mouse data from Mouse Genome Informatics (MGI). Based on the InterMine software framework, MouseMine supports powerful query, reporting, and analysis capabilities, the ability to save and combine results from different queries, easy integration into larger workflows, and a comprehensive Web Services layer. Through MouseMine, users can access a significant portion of MGI data in new and useful ways. Importantly, MouseMine is also a member of a growing community of online data resources based on InterMine, including those established by other model organism databases. Adopting common interfaces and collaborating on data representation standards are critical to fostering cross-species data analysis. This paper presents a general introduction to MouseMine, presents examples of its use, and discusses the potential for further integration into the MGI interface.

  18. Lessons learned using different mouse models during space radiation-induced lung tumorigenesis experiments.

    Science.gov (United States)

    Wang, Jian; Zhang, Xiangming; Wang, Ping; Wang, Xiang; Farris, Alton B; Wang, Ya

    2016-06-01

    Unlike terrestrial ionizing radiation, space radiation, especially galactic cosmic rays (GCR), contains high energy charged (HZE) particles with high linear energy transfer (LET). Due to a lack of epidemiologic data for high-LET radiation exposure, it is highly uncertain how high the carcinogenesis risk is for astronauts following exposure to space radiation during space missions. Therefore, using mouse models is necessary to evaluate the risk of space radiation-induced tumorigenesis; however, which mouse model is better for these studies remains uncertain. Since lung tumorigenesis is the leading cause of cancer death among both men and women, and low-LET radiation exposure increases human lung carcinogenesis, evaluating space radiation-induced lung tumorigenesis is critical to enable safe Mars missions. Here, by comparing lung tumorigenesis obtained from different mouse strains, as well as miR-21 in lung tissue/tumors and serum, we believe that wild type mice with a low spontaneous tumorigenesis background are ideal for evaluating the risk of space radiation-induced lung tumorigenesis, and circulating miR-21 from such mice model might be used as a biomarker for predicting the risk. Copyright © 2016 The Committee on Space Research (COSPAR). Published by Elsevier Ltd. All rights reserved.

  19. Lessons learned using different mouse models during space radiation-induced lung tumorigenesis experiments

    Science.gov (United States)

    Wang, Jian; Zhang, Xiangming; Wang, Ping; Wang, Xiang; Farris, Alton B.; Wang, Ya

    2016-06-01

    Unlike terrestrial ionizing radiation, space radiation, especially galactic cosmic rays (GCR), contains high energy charged (HZE) particles with high linear energy transfer (LET). Due to a lack of epidemiologic data for high-LET radiation exposure, it is highly uncertain how high the carcinogenesis risk is for astronauts following exposure to space radiation during space missions. Therefore, using mouse models is necessary to evaluate the risk of space radiation-induced tumorigenesis; however, which mouse model is better for these studies remains uncertain. Since lung tumorigenesis is the leading cause of cancer death among both men and women, and low-LET radiation exposure increases human lung carcinogenesis, evaluating space radiation-induced lung tumorigenesis is critical to enable safe Mars missions. Here, by comparing lung tumorigenesis obtained from different mouse strains, as well as miR-21 in lung tissue/tumors and serum, we believe that wild type mice with a low spontaneous tumorigenesis background are ideal for evaluating the risk of space radiation-induced lung tumorigenesis, and circulating miR-21 from such mice model might be used as a biomarker for predicting the risk.

  20. Automated Computational Processing of 3-D MR Images of Mouse Brain for Phenotyping of Living Animals.

    Science.gov (United States)

    Medina, Christopher S; Manifold-Wheeler, Brett; Gonzales, Aaron; Bearer, Elaine L

    2017-07-05

    Magnetic resonance (MR) imaging provides a method to obtain anatomical information from the brain in vivo that is not typically available by optical imaging because of this organ's opacity. MR is nondestructive and obtains deep tissue contrast with 100-µm 3 voxel resolution or better. Manganese-enhanced MRI (MEMRI) may be used to observe axonal transport and localized neural activity in the living rodent and avian brain. Such enhancement enables researchers to investigate differences in functional circuitry or neuronal activity in images of brains of different animals. Moreover, once MR images of a number of animals are aligned into a single matrix, statistical analysis can be done comparing MR intensities between different multi-animal cohorts comprising individuals from different mouse strains or different transgenic animals, or at different time points after an experimental manipulation. Although preprocessing steps for such comparisons (including skull stripping and alignment) are automated for human imaging, no such automated processing has previously been readily available for mouse or other widely used experimental animals, and most investigators use in-house custom processing. This protocol describes a stepwise method to perform such preprocessing for mouse. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.