WorldWideScience

Sample records for mother-infant transmission pairs

  1. Hepatitis c virus antibodies in mother-infant blood pair in Zaria

    African Journals Online (AJOL)

    2017-06-01

    Jun 1, 2017 ... Abstract: Objectives: To deter- mine the prevalence of Hepatitis. C virus (HCV) antibodies in mother-infant pair, and risk fac- tors for vertical transmission of. HCV in ABUTH Zaria. Method: One hundred mother- infant pair had serological deter- mination for HCV antibodies from birth to 28days and a repeat.

  2. Mother-Infant Attachment and the Intergenerational Transmission of Posttraumatic Stress Disorder

    OpenAIRE

    Enlow, Michelle Bosquet; Egeland, Byron; Carlson, Elizabeth; Blood, Emily; Wright, Rosalind J.

    2013-01-01

    Evidence for the intergenerational transmission of posttraumatic stress disorder (PTSD) is documented in the literature, though the underlying mechanisms are poorly understood. Attachment theory provides a framework for elucidating the ways in which maternal PTSD may increase offspring PTSD vulnerability. The current study utilized two independent prospective datasets to test the hypotheses that (a) maternal PTSD increases the probability of developing an insecure mother-infant attachment rel...

  3. Mother-infant attachment and the intergenerational transmission of posttraumatic stress disorder.

    Science.gov (United States)

    Bosquet Enlow, Michelle; Egeland, Byron; Carlson, Elizabeth; Blood, Emily; Wright, Rosalind J

    2014-02-01

    Evidence for the intergenerational transmission of posttraumatic stress disorder (PTSD) is documented in the literature, although the underlying mechanisms are poorly understood. Attachment theory provides a framework for elucidating the ways in which maternal PTSD may increase offspring PTSD vulnerability. The current study utilized two independent prospective data sets to test the hypotheses that (a) maternal PTSD increases the probability of developing an insecure mother-infant attachment relationship and (b) an insecure mother-infant attachment relationship increases the risk of developing PTSD following trauma exposure in later life. In the first study of urban, primarily low-income ethnic/racial minority mothers and infants (N = 45 dyads), elevated maternal PTSD symptoms at 6 months were associated with increased risk for an insecure, particularly disorganized, mother-infant attachment relationship at 13 months. In the second birth cohort of urban, low-income mothers and children (N = 96 dyads), insecure (avoidant or resistant) attachment in infancy was associated in a dose-response manner with increased lifetime risk for a diagnosis of PTSD by adolescence. A history of disorganized attachment in infancy predicted severity of PTSD symptoms, including reexperiencing, avoidance, hyperarousal, and total symptoms, at 17.5 years. In both studies, associations between attachment and PTSD were not attributable to numerous co-occurring risk factors. The findings suggest that promoting positive mother-child relationships in early development, particularly in populations at high risk for trauma exposure, may reduce the incidence of PTSD.

  4. Another Look Inside the Gap: Ecological Contributions to the Transmission of Attachment in a Sample of Adolescent Mother-Infant Dyads

    Science.gov (United States)

    Tarabulsy, George M.; Bernier, Annie; Provost, Marc A.; Maranda, Johanne; Larose, Simon; Moss, Ellen; Larose, Marie; Tessier, Rejean

    2005-01-01

    Ecological contributions to attachment transmission were studied in a sample of 64 adolescent mother-infant dyads. Maternal sensitivity was assessed when infants were 6 and 10 months old, and infant security was assessed at 15 and 18 months. Maternal attachment state of mind was measured with the Adult Attachment Interview (AAI) after the 1st…

  5. Breastfeeding, Bonding, and the Mother-Infant Relationship.

    Science.gov (United States)

    Else-Quest, Nicole M.; Hyde, Janet Shibley; Clark, Roseanne

    2003-01-01

    Analyzed data from a longitudinal study of 570 mother-infant pairs to test the bonding hypothesis and the good-enough caregiver hypothesis as they relate to breastfeeding with maternal bonding and the mother-infant relationship. Found that breastfeeding dyads tended to show higher-quality relationships at 12 months than did bottle-feeding dyads.…

  6. Influenza Transmission in the Mother-Infant Dyad Leads to Severe Disease, Mammary Gland Infection, and Pathogenesis by Regulating Host Responses.

    Science.gov (United States)

    Paquette, Stéphane G; Banner, David; Huang, Stephen S H; Almansa, Raquel; Leon, Alberto; Xu, Luoling; Bartoszko, Jessica; Kelvin, David J; Kelvin, Alyson A

    2015-10-01

    Seasonal influenza viruses are typically restricted to the human upper respiratory tract whereas influenza viruses with greater pathogenic potential often also target extra-pulmonary organs. Infants, pregnant women, and breastfeeding mothers are highly susceptible to severe respiratory disease following influenza virus infection but the mechanisms of disease severity in the mother-infant dyad are poorly understood. Here we investigated 2009 H1N1 influenza virus infection and transmission in breastfeeding mothers and infants utilizing our developed infant-mother ferret influenza model. Infants acquired severe disease and mortality following infection. Transmission of the virus from infants to mother ferrets led to infection in the lungs and mother mortality. Live virus was also found in mammary gland tissue and expressed milk of the mothers which eventually led to milk cessation. Histopathology showed destruction of acini glandular architecture with the absence of milk. The virus was localized in mammary epithelial cells of positive glands. To understand the molecular mechanisms of mammary gland infection, we performed global transcript analysis which showed downregulation of milk production genes such as Prolactin and increased breast involution pathways indicated by a STAT5 to STAT3 signaling shift. Genes associated with cancer development were also significantly increased including JUN, FOS and M2 macrophage markers. Immune responses within the mammary gland were characterized by decreased lymphocyte-associated genes CD3e, IL2Ra, CD4 with IL1β upregulation. Direct inoculation of H1N1 into the mammary gland led to infant respiratory infection and infant mortality suggesting the influenza virus was able to replicate in mammary tissue and transmission is possible through breastfeeding. In vitro infection studies with human breast cells showed susceptibility to H1N1 virus infection. Together, we have shown that the host-pathogen interactions of influenza virus

  7. Plasma and breast milk pharmacokinetics of emtricitabine, tenofovir and lamivudine using dried blood and breast milk spots in nursing African mother-infant pairs.

    Science.gov (United States)

    Waitt, Catriona; Olagunju, Adeniyi; Nakalema, Shadia; Kyohaire, Isabella; Owen, Andrew; Lamorde, Mohammed; Khoo, Saye

    2018-04-01

    Breast milk transfer of first-line ART from mother to infant is not fully understood. To determine the concentrations of lamivudine, emtricitabine and tenofovir in maternal blood, breast milk and infant blood from breastfeeding mother-infant pairs. Intensive pharmacokinetic sampling of maternal dried blood spots (DBS), dried breast milk spots (DBMS) and infant DBS from 30 Ugandan and 29 Nigerian mothers receiving first-line ART and their infants was conducted. DBS and DBMS were collected pre-dose and at 5-6 timepoints up to 12 h following observed dosing. Infant DBS were sampled twice during this period. Lamivudine, emtricitabine and tenofovir were quantified using LC-MS/MS, with non-compartmental analysis to calculate key pharmacokinetic parameters. Peak concentrations in breast milk from women taking lamivudine and emtricitabine occurred later than in plasma (4-8 h compared with 2 h for lamivudine and 2-4 h for emtricitabine). Consequently, the milk-to-plasma (M:P) ratio of lamivudine taken once daily was 0.95 (0.82-1.15) for AUC0-12, whereas for AUC12-20 this was 3.04 (2.87-4.16). Lamivudine was detectable in 36% (14/39) of infants [median 17.7 (16.3-22.7) ng/mL]. For 200 mg of emtricitabine once daily, the median M:P ratio was 3.01 (2.06-3.38). Three infants (19%) had measurable emtricitabine [median 18.5 (17.6-20.8) ng/mL]. For 300 mg of tenofovir once daily, the median M:P ratio was 0.015 (0-0.03) and no infant had measurable tenofovir concentrations. Emtricitabine and lamivudine accumulate in breast milk and were detected in breastfeeding infants. In contrast, tenofovir penetrates the breast milk to a small degree, but is undetectable in breastfeeding infants.

  8. Patterns of mother-infant interaction from 3 to 12 months among dyads with substance abuse and psychiatric problems.

    Science.gov (United States)

    Siqveland, Torill S; Haabrekke, Kristin; Wentzel-Larsen, Tore; Moe, Vibeke

    2014-11-01

    The aim of this study was to investigate the development of mother-infant interaction patterns from 3 to 12 months among three groups of mother-baby pairs recruited during pregnancy: one group from residential substance abuse treatment (n=28), a second group from psychiatric outpatient treatment (n=22), and a third group from well-baby clinics (n=30). The mother-infant interaction at 3 and 12 months was assessed by the Parent-Child Early Relational Assessment (PCERA), which consists of maternal, child and dyadic subscales (Clark, 2006). Linear mixed effects models were used to analyze group differences and the changes in mother-infant interaction from 3 to 12 months. At 3 months, pairwise comparisons showed that the group with psychiatric problems had significantly more difficulties in the mother-infant interaction than the two other groups. The group with substance abuse problems was not significantly different from the two other groups. At 12 months, the mother-infant pairs in the substance abuse group showed significantly more relational disturbances than the non-clinical pairs, as well as a poorer affective quality of interaction than the dyads in the group with psychiatric problems. Analysis of change from 3 to 12 months showed that difficulties in the interaction increased among the mother-baby pairs in the substance abuse group, while improvements were displayed in the two other groups. These results underline that mother-infant pairs at double risk due to maternal substance abuse and other non-optimal factors, are in need for long-term follow up in order to prevent the development of negative interactional patterns. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Breastfeeding and the Mother-Infant Relationship--A Review

    Science.gov (United States)

    Jansen, Jarno; de Weerth, Carolina; Riksen-Walraven, J. Marianne

    2008-01-01

    A positive effect of breastfeeding on the mother-infant relationship is often assumed in the scientific literature, but this has not been systematically reviewed. This review aims to clarify the role of breastfeeding in the mother-infant relationship, which is conceptualized as the maternal bond toward the infant and infant attachment toward the…

  10. Postpartum depression, suicidality, and mother-infant interactions.

    Science.gov (United States)

    Paris, Ruth; Bolton, Rendelle E; Weinberg, M Katherine

    2009-10-01

    To date, few studies have examined suicidality in women with postpartum depression. Reports of suicidal ideation in postpartum women have varied (Lindahl et al. Arch Womens Ment Health 8:77-87, 2005), and no known studies have examined the relationship between suicidality and mother-infant interactions. This study utilizes baseline data from a multi-method evaluation of a home-based psychotherapy for women with postpartum depression and their infants to examine the phenomenon of suicidality and its relationship to maternal mood, perceptions, and mother-infant interactions. Overall, women in this clinical sample (n = 32) had wide ranging levels of suicidal thinking. When divided into low and high groups, the mothers with high suicidality experienced greater mood disturbances, cognitive distortions, and severity of postpartum symptomotology. They also had lower maternal self-esteem, more negative perceptions of the mother-infant relationship, and greater parenting stress. During observer-rated mother-infant interactions, women with high suicidality were less sensitive and responsive to their infants' cues, and their infants demonstrated less positive affect and involvement with their mothers. Implications for clinical practice and future research directions are discussed.

  11. The Effect of Kangaroo Mother Care Immediately after Delivery on Mother-infant Attachment 3 Months after Delivery

    Directory of Open Access Journals (Sweden)

    Fatemeh Zahra Karimi

    2016-09-01

    Full Text Available Background  The aim of this study was determine the effect of kangaroo mother care (KMC immediately after delivery on mother-infant attachment 3-month after delivery. Materials and Methods: In this RCT study, 72 mother-infant pairs were randomly divided in to kangaroo mother care and routine care groups.The intervention group received kangaroo mother care (KMC in the first two hours post birth. The control group just received routine hospital care. Mothers in the intervention group were encouraged to keep the baby in KMC as much as possible during the day and night throughout the neonatal period. Participants were followed up for three months after birth. The Main outcome measure was mother-infant attachment at 3 months postpartum and maternal anxiety about the baby at the same time. The data was collected by questionnaire (demographic information of parents and neonates and maternal attachment scale. Analysis was performed using SPSS software (version 14. Results: There was no significant difference between two groups regarding their baseline data. Mean maternal attachment score in the KMC group and in the routine care group at three months after delivery was 52.40±3.30 and 49.86±4.18 respectively, which was significantly higher in the KMC group (P

  12. Mother-infant circadian rhythm: development of individual patterns and dyadic synchrony.

    Science.gov (United States)

    Thomas, Karen A; Burr, Robert L; Spieker, Susan; Lee, Jungeun; Chen, Jessica

    2014-12-01

    Mutual circadian rhythm is an early and essential component in the development of maternal-infant physiological synchrony. The aim of this to examine the longitudinal pattern of maternal-infant circadian rhythm and rhythm synchrony as measured by rhythm parameters. In-home dyadic actigraphy monitoring at infant age 4, 8, and 12 weeks. Forty-three healthy mother-infant pairs. Circadian parameters derived from cosinor and non-parametric analysis including mesor, magnitude, acrophase, L5 and M10 midpoints (midpoint of lowest 5 and highest 10h of activity), amplitude, interdaily stability (IS), and intradaily variability (IV). Mothers experienced early disruption of circadian rhythm, with re-establishment of rhythm over time. Significant time effects were noted in increasing maternal magnitude, amplitude, and IS and decreasing IV (pcircadian pattern with significant time effects for increasing mesor, magnitude, amplitude, L5, IS, and IV (pcircadian rhythm. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Mother-infant attachment styles as a predictor of aggression

    Directory of Open Access Journals (Sweden)

    Rozita Amani

    2016-01-01

    Full Text Available Background & aim: Aggression is a phenomenon that causes irreversible damage to a community. Psychodynamic theory suggests that aggression is rooted in early relationships with family members, especially mother. According to this theory, infant-mother relationship is a major predictor of an individual’s behavior from childhood to adulthood. This study aimed to investigate the correlation between mother-infant attachment styles and aggression. Methods:This study was conducted on 150 university students (75 female, 75 male randomly selected from Bu-Ali Sina University in Hamadan, Iran. Data were collected via demographic questionnaires, Persian version of Adult Attachment Inventory (AAS (Hazen and Shaver and Ahvaz Aggression Inventory (AAI. Data analysis was performed using Pearson correlation and regression analysis. Results: According to our findings, secure mother-infantattachment had a significant negative correlation with aggression. In addition, ambivalent mother-infantattachment had a significant positive correlation with aggression, while avoidant attachment style had no significant correlation with aggression. Conclusion: According to the results of this study, secure attachment of mother with infant could reduce aggression during adulthood. On the other hand, ambivalent attachment between mother and infant could clearly increase the risk of aggression. Therefore, it is recommended to train different attachment styles to pregnant women  through related workshops during pregnancy in order to prevent ambivalent mother-infant attachment.

  14. Transmission of mutans streptococci in mother-child pairs

    Directory of Open Access Journals (Sweden)

    S G Damle

    2016-01-01

    Full Text Available Background & objectives: Dental caries is an infectious, transmissible disease. Maternal transfer of mutans streptococci (MS has been a subject of research. The aim of this study was to evaluate the transmission of MS from mother to children through genetic analysis. Methods: Thirty mother-child pairs were included and divided into three groups according to the age of the children. Saliva samples were collected and MS colonies from each mother-child pair were isolated. After inoculation and incubation, MS colonies were submitted to amplification technique by polymerase chain reaction (PCR for identification and arbitrarily primed PCRs (AP-PCRs to determine various MS genotypes. Results: From birth to six months of age, 30 per cent of children exhibited MS colonization, and by the age of 30 months, 100 per cent harboured the bacteria (P < 0.001. Factors associated with MS colonization were eruption of teeth (P < 0.001, feeding habits with mean colony count being significantly lower in breast-fed as compared to bottle-fed children (P < 0.001 and a significant association between mean MS count of child and mother′s practice of sharing spoon with child (P < 0.001. The AP-PCR fingerprinting profile analysis showed 17 MS groups (clusters containing identical or highly related isolates in mother-child pairs with a high level of similarity (77.27 %. Interpretation & conclusions: The presence of matching MS genotypes suggested vertical transmission from mothers to children. Feeding habits, gum cleaning and number of erupted teeth in children had significant effect on MS colonization. There is a need to develop strategies to present MS colonization in children.

  15. Infant Abuse, Neglect, and Failure-to-Thrive: Mother-Infant Interaction.

    Science.gov (United States)

    Dietrich, Kim N.; And Others

    This study was designed to investigate whether or not degree of child maltreatment is related in some meaningful way to the interactional characteristics of the mother/infant dyad and to the infant's developmental status. A group of 53 mother/infant dyads was divided into five diagnostic groups: nonaccidental trauma combined with…

  16. Applying Intuition to Predict Maladaptive Interpersonal Outcomes in Mother-Infant Dyads.

    Science.gov (United States)

    Trad, Paul V.

    1994-01-01

    This article proposes that intuitive behaviors may be used to detect and resolve potential conflict in mother-infant relationships. Previewing, in which the caregiver introduces the infant to the physical sensations and interpersonal meaning of a new developmental skill, is suggested as a way of moving the mother-infant relationship in the…

  17. Effects of Birth Order and Spacing on Mother-Infant Interactions.

    Science.gov (United States)

    Lewis, Michael; Kreitzberg, Valerie S.

    1979-01-01

    Examines early differences in mother-infant interaction as a function of infant birth order and birth spacing. Mother and infant behaviors were observed and recorded in the home for a two-hour period. (SS)

  18. Impact of Depressive Symptoms on Mother Infant Attachment among Mothers of Preterm Neonates

    Directory of Open Access Journals (Sweden)

    Binu Margaret

    2018-05-01

    Full Text Available Objective: To assess the level of depressive symptoms and mother-infant-attachment among mothers of preterms admitted in Neonatal Intensive Care Unit (NICU and find the relationship between of depressive symptoms and mother-infant-attachment. Materials and methods: A cross sectional survey was conducted among 100 mothers whose preterm babies were admitted in NICU of Kasturba Hospital, Manipal, Karnataka using purposive sampling. Edinburgh Postnatal Depression Scale and Mother Infant Attachment Scale were used to collect the data. Data were analyzed using descriptive and inferential statistics. Results: The mother’s age ranged from 20 to 40 years. The mild depressive symptoms were experienced by 28 (28% mothers, moderate 25(25% and 17 (17% had severe level of depressive symptoms. Majority mothers 77(77% of preterms had good-attachment and 18% had moderate attachment. Mean depressive symptom score and mother-infant-attachment score was 14.36±7.47 and 58.00 ±12.95 respectively. Depressive symptoms and mother-infant-attachment showed moderate negative correlation, (ρ=--0.506, (p=0.001. Conclusion: Increased levels of depressive symptoms among the mothers of preterm neonates affects the mother–infant-interactions. Interventions to decrease the level of depressive symptoms need to be planned for promoting good mother infant interaction.

  19. Disruption to the development of maternal responsiveness? The impact of prenatal depression on mother-infant interactions.

    Science.gov (United States)

    Pearson, R M; Melotti, R; Heron, J; Joinson, C; Stein, A; Ramchandani, P G; Evans, J

    2012-12-01

    Both prenatal and postnatal maternal depression are independently associated with an increased risk of adverse infant development. The impact of postnatal depression on infants may be mediated through the effect of depression in reducing maternal responsiveness. However, the mechanisms underlying the effect of prenatal depression are unclear. Using longitudinal data from over 900 mother-infant pairs in a UK birth cohort (ALSPAC), we found that women with high depressive symptom scores during mid pregnancy, but NOT when their infants were 8 months, had a 30% increased risk of low maternal responsiveness when the infant was 12 months compared to women with consistently low depression. This may provide a mechanism to explain the independent association between prenatal depression and poorer infant development. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Enhanced extraordinary optical transmission (EOT) through arrays of bridged nanohole pairs and their sensing applications

    KAUST Repository

    Yue, Weisheng

    2014-01-01

    Extraordinary optical transmission (EOT) through arrays of gold nanoholes was studied with light across the visible to the near-infrared spectrum. The EOT effect was found to be improved by bridging pairs of nanoholes due to the concentration of the electromagnetic field in the slit between the holes. The geometrical shape and separation of the holes in these pairs of nanoholes affected the intensity of the transmission and the wavelength of resonance. Changing the geometrical shapes of these nanohole pairs from triangles to circles to squares leads to increased transmission intensity as well as red-shifting resonance wavelengths. The performance of bridged nanohole pairs as a plasmonic sensor was investigated. The bridged nanohole pairs were able to distinguish methanol, olive oil and microscope immersion oil for the different surface plasmon resonance in transmission spectra. Numerical simulation results were in agreement with experimental observations. © 2014 the Partner Organisations.

  1. Importance of mother-infant communication for social bond formation in mammals.

    Science.gov (United States)

    Okabe, Shota; Nagasawa, Miho; Mogi, Kazutaka; Kikusui, Takefumi

    2012-06-01

    Mother-infant bonding is a universal relationship of all mammalian species. Here, we describe the role of reciprocal communication between mother and infant in the formation of bonding for several mammalian species. Mother-infant bond formation is reinforced by various social cues or stimuli, including communicative signals, such as odor and vocalizations, or tactile stimuli. The mother also develops cross-modal sensory recognition of the infant, during bond formation. Many studies have indicated that the oxytocin neural system plays a pivotal role in bond formation by the mother; however, the underlying neural mechanisms for infants have not yet been clarified. The comparative understanding of cognitive functions of mother and infants may help us understand the biological significance of mother-infant communication in mammalian species. © 2012 The Authors. Animal Science Journal © 2012 Japanese Society of Animal Science.

  2. Interdyad Differences in Early Mother-Infant Face-to-Face Communication: Real-Time Dynamics and Developmental Pathways

    Science.gov (United States)

    Lavelli, Manuela; Fogel, Alan

    2013-01-01

    A microgenetic research design with a multiple case study method and a combination of quantitative and qualitative analyses was used to investigate interdyad differences in real-time dynamics and developmental change processes in mother-infant face-to-face communication over the first 3 months of life. Weekly observations of 24 mother-infant dyads…

  3. Enhanced extraordinary optical transmission (EOT) through arrays of bridged nanohole pairs and their sensing applications

    KAUST Repository

    Yue, Weisheng; Wang, Zhihong; Yang, Yang; Li, Jingqi; Wu, Ying; Chen, Longqing; Ooi, Boon S.; Wang, Xianbin; Zhang, Xixiang

    2014-01-01

    Extraordinary optical transmission (EOT) through arrays of gold nanoholes was studied with light across the visible to the near-infrared spectrum. The EOT effect was found to be improved by bridging pairs of nanoholes due to the concentration

  4. Motherhood in adolescent mothers: maternal attachment, mother-infant styles of interaction and emotion regulation at three months.

    Science.gov (United States)

    Riva Crugnola, Cristina; Ierardi, Elena; Gazzotti, Simona; Albizzati, Alessandro

    2014-02-01

    Early motherhood is considered a risk factor for an adequate relationship between mother and infant and for the subsequent development of the infant. The principal aim of the study is to analyze micro-analytically the effect of motherhood in adolescence on the quality of mother-infant interaction and emotion regulation at three months, considering at the same time the effect of maternal attachment on these variables. Participants were 30 adolescent mother-infant dyads compared to 30 adult mother-infant dyads. At infant 3 months, mother-infant interaction was video-recorded and coded with a modified version of the Infant Caregiver Engagement Phases and the Adult Attachment Interview was administered to the mother. Analysis showed that adolescent mothers (vs. adult mothers) spent more time in negative engagement and their infants spent less time in positive engagement and more time in negative engagement. Adolescent mothers are also less involved in play with their infants than adult mothers. Adolescent mother-infant dyads (vs. adult mother-infant dyads) showed a greater duration of negative matches and spent less time in positive matches. Insecure adolescent mother-infant dyads (vs. insecure adult mother-infant dyads) demonstrated less involvement in play with objects and spent less time in positive matches. To sum up adolescent mother-infant dyads adopt styles of emotion regulation and interaction with objects which are less adequate than those of dyads with adult mothers. Insecure maternal attachment in dyads with adolescent mothers (vs. adult mother infant dyads) is more influential as risk factor. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Antenatal interpersonal sensitivity is more strongly associated than perinatal depressive symptoms with postnatal mother-infant interaction quality.

    Science.gov (United States)

    Raine, Karen; Cockshaw, Wendell; Boyce, Philip; Thorpe, Karen

    2016-10-01

    Maternal mental health has enduring effects on children's life chances and is a substantial cost driver for child health, education and social services. A key linking mechanism is the quality of mother-infant interaction. A body of work associates maternal depressive symptoms across the antenatal and postnatal (perinatal) period with less-than-optimal mother-infant interaction. Our study aims to build on previous research in the field through exploring the association of a maternal personality trait, interpersonal sensitivity, measured in early pregnancy, with subsequent mother-infant interaction quality. We analysed data from the Avon Longitudinal Study of Parents and Children (ALSPAC) to examine the association between antenatal interpersonal sensitivity and postnatal mother-infant interaction quality in the context of perinatal depressive symptoms. Interpersonal sensitivity was measured during early pregnancy and depressive symptoms in the antenatal year and across the first 21 months of the postnatal period. In a subsample of the ALSPAC, mother-infant interaction was measured at 12 months postnatal through a standard observation. For the subsample that had complete data at all time points (n = 706), hierarchical regression examined the contribution of interpersonal sensitivity to variance in mother-infant interaction quality. Perinatal depressive symptoms predicted little variance in mother-infant interaction. Antenatal interpersonal sensitivity explained a greater proportion of variance in mother-infant interaction quality. The personality trait, interpersonal sensitivity, measured in early pregnancy, is a more robust indicator of subsequent mother-infant-interaction quality than perinatal depressive symptoms, thus affording enhanced opportunity to identify vulnerable mother-infant relationships for targeted early intervention.

  6. A Systems View of Mother-Infant Face-to-Face Communication

    Science.gov (United States)

    Beebe, Beatrice; Messinger, Daniel; Bahrick, Lorraine E.; Margolis, Amy; Buck, Karen A.; Chen, Henian

    2016-01-01

    Principles of a dynamic, dyadic systems view of mother-infant face-to-face communication, which considers self- and interactive processes in relation to one another, were tested. The process of interaction across time in a large low-risk community sample at infant age 4 months was examined. Split-screen videotape was coded on a 1-s time base for…

  7. Functioning within a relationship : Mother-infant synchrony and infant sleep

    NARCIS (Netherlands)

    de Graag, Jolien A.; Cox, Ralf F. A.; Hasselman, Fred; Jansen, Jarno; de Weerth, Carolina

    The aim of this study was to investigate the coupling of the biological system of infant sleep and the social system of mother-infant synchrony. Before birth and shortly after birth the systems appear to be connected, but it is unclear whether this remains the case over time. This study therefore

  8. Mother-Infant Dyadic State Behaviour: Dynamic Systems in the Context of Risk

    Science.gov (United States)

    Coburn, Shayna S.; Crnic, Keith A.; Ross, Emily K.

    2015-01-01

    Dynamic systems methods offer invaluable insight into the nuances of the early parent-child relationship. This prospective study aimed to highlight the characteristics of mother-infant dyadic behavior at 12?weeks post-partum using state space grid analysis (total n?=?322). We also examined whether maternal prenatal depressive symptoms and…

  9. Length of Maternity Leave and Quality of Mother-Infant Interactions.

    Science.gov (United States)

    Clark, Roseanne; And Others

    1997-01-01

    Assessed association between length of maternity leave and quality of mother-infant interaction. Found a direct association between shorter leave and more negative affect and behavior; mothers with more depressive symptoms or who perceived their infant as having a difficult temperament, and with shorter leaves expressed less positive affect,…

  10. Entangled-Pair Transmission Improvement Using Distributed Phase-Sensitive Amplification

    Directory of Open Access Journals (Sweden)

    Anjali Agarwal

    2014-12-01

    Full Text Available We demonstrate the transmission of time-bin entangled photon pairs through a distributed optical phase-sensitive amplifier (OPSA. We utilize four-wave mixing at telecom wavelengths in a 5-km dispersion-shifted fiber OPSA operating in the low-gain limit. Measurements of two-photon interference curves show no statistically significant degradation in the fringe visibility at the output of the OPSA. In addition, coincidence counting rates are higher than direct passive transmission because of constructive interference between amplitudes of input photon pairs and those generated in the OPSA. Our results suggest that application of distributed phase-sensitive amplification to transmission of entangled photon pairs could be highly beneficial towards advancing the rate and scalability of future quantum communications systems.

  11. How Does Microanalysis of Mother-Infant Communication Inform Maternal Sensitivity and Infant Attachment?

    Science.gov (United States)

    Beebe, Beatrice; Steele, Miriam

    2013-01-01

    Microanalysis research on 4-month mother-infant face-to-face communication operates like a “social microscope” and identifies aspects of maternal sensitivity and the origins of attachment with a more detailed lens. We hope to enhance a dialogue between these two paradigms, microanalysis of mother-infant communication and maternal sensitivity and emerging working models of attachment. The prediction of infant attachment from microanalytic approaches and their contribution to concepts of maternal sensitivity are described. We summarize aspects of one microanalytic study by Beebe and colleagues (2010) that documents new communication patterns between mothers and infants at 4 months that predict future disorganized (vs. secure) attachment. The microanalysis approach opens up a new window on the details of the micro-processes of face-to-face communication. It provides a new, rich set of behaviors with which to extend our understanding of the origins of infant attachment and of maternal sensitivity. PMID:24299136

  12. Psychometric Properties of an Instrument to Measure Mother-Infant Togetherness After Childbirth.

    Science.gov (United States)

    Lawrence, Carol L; Norris, Anne E

    2016-01-01

    The purpose of this research was to evaluate the psychometric properties of a new instrument to measure mother-infant togetherness, Mother-Infant Togetherness Survey (MITS). Stage 1 examined content validity. Stage 2 pretested the readability and understandability and further examined content validity. Stage 3 examined women's ability to accurately self-report on the Delivery Events subscale. Stages 4 and 5 examined construct validity. Good content validity was obtained at the scale/subscale level (CVI = .91-1.00). Internal consistency reliability was evaluated at the scale/subscale level (α = .62-.89). Construct validity was supported with known groups testing and factor analysis. Study findings provide support for the reliability and validity of the MITS. Future research should be done to improve the internal consistency reliability of the Postpartum Events subscale.

  13. Association between maternal childhood maltreatment and mother-infant attachment disorganization: Moderation by maternal oxytocin receptor gene and cortisol secretion.

    Science.gov (United States)

    Ludmer, Jaclyn A; Gonzalez, Andrea; Kennedy, James; Masellis, Mario; Meinz, Paul; Atkinson, Leslie

    2018-04-24

    This study examined maternal oxytocin receptor (OXTR, rs53576) genotype and cortisol secretion as moderators of the relation between maternal childhood maltreatment history and disorganized mother-infant attachment in the Strange Situation Procedure (SSP). A community sample of 314 mother-infant dyads completed the SSP at infant age 17 months. Self-reported maltreatment history more strongly predicted mother-infant attachment disorganization score and disorganized classification for mothers with more plasticity alleles of OXTR (G), relative to mothers with fewer plasticity alleles. Maltreatment history also more strongly predicted mother-infant attachment disorganization score and classification for mothers with higher SSP cortisol secretion, relative to mothers with lower SSP cortisol secretion. Findings indicate that maltreatment history is related to disorganization in the next generation, but that this relation depends on maternal genetic characteristics and cortisol. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. The Mother-Infant Relationship and Infant Attachment in a South African Peri-Urban Settlement

    Science.gov (United States)

    Tomlinson, Mark; Cooper, Peter; Murray, Lynne

    2005-01-01

    A sample of 147 mother-infant dyads was recruited from a peri-urban settlement outside Cape Town and seen at 2- and 18-months postpartum. At 18 months, 61.9% of the infants were rated as securely attached (B); 4.1% as avoidant (A); 8.2% as resistant (C); and 25.8% disorganized (D). Postpartum depression at 2 months, and indices of poor parenting…

  15. Prenatal ultrasound screening: false positive soft markers may alter maternal representations and mother-infant interaction.

    Directory of Open Access Journals (Sweden)

    Sylvie Viaux-Savelon

    Full Text Available In up to 5% of pregnancies, ultrasound screening detects a "soft marker" (SM that places the foetus at risk for a severe abnormality. In most cases, prenatal diagnostic work-up rules out a severe defect. We aimed to study the effects of false positive SM on maternal emotional status, maternal representations of the infant, and mother-infant interaction.Utilizing an extreme-case prospective case control design, we selected from a group of 244 women undergoing ultrasound, 19 pregnant women whose foetus had a positive SM screening and a reassuring diagnostic work up, and 19 controls without SM matched for age and education. In the third trimester of pregnancy, within one week after delivery, and 2 months postpartum, we assessed anxiety, depression, and maternal representations. Mother-infant interactions were videotaped during feeding within one week after delivery and again at 2 months postpartum and coded blindly using the Coding Interactive Behavior (CIB scales. Anxiety and depression scores were significantly higher at all assessment points in the SM group. Maternal representations were also different between SM and control groups at all study time. Perturbations to early mother-infant interactions were observed in the SM group. These dyads showed greater dysregulation, lower maternal sensitivity, higher maternal intrusive behaviour and higher infant avoidance. Multivariate analysis showed that maternal representation and depression at third trimester predicted mother-infant interaction.False positive ultrasound screenings for SM are not benign and negatively affect the developing maternal-infant attachment. Medical efforts should be directed to minimize as much as possible such false diagnoses, and to limit their psychological adverse consequences.

  16. Measles Antibodies in Mother-Infant Dyads in Tianjin, China.

    Science.gov (United States)

    Boulton, Matthew L; Wang, Xiexiu; Wagner, Abram L; Zhang, Ying; Carlson, Bradley F; Gillespie, Brenda W; Ding, Yaxing

    2017-11-27

    Many measles cases in Tianjin, China, occur in infants whose mothers were born after widespread vaccination programs. We assessed age-specific decreases in maternal measles antibodies in infants and examined maternal and infant characteristics in relation to infant antibody titers. Infant and mother dyads were enrolled from a sample of immunization clinics in all Tianjin districts. Participants' antibody titers were measured from dried blood spots. A multivariable log-linear model regressed infant antibody titers onto infant and mother characteristics. Among 551 infants aged ≤8 months, protective levels of measles antibodies were observed in infants whose mothers had measles titers ≥800 IU/mL (mean antibody titer, 542.5 IU/mL) or 400 to measles and an accordingly low efficiency of transplacental transmission to a fetus. Current vaccination programs, which target children aged 8 months through adolescence may be ineffective in controlling transmission of measles to infants. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  17. Relations between maternal attachment representations and the quality of mother-infant interaction in preterm and full-term infants.

    Science.gov (United States)

    Korja, Riikka; Ahlqvist-Björkroth, Sari; Savonlahti, Elina; Stolt, Suvi; Haataja, Leena; Lapinleimu, Helena; Piha, Jorma; Lehtonen, Liisa

    2010-06-01

    The aim of the study was to assess the relationship between maternal representations and the quality of mother-infant interaction in a group of preterm and full-term infants. The study groups consisted of 38 mothers and their preterm infants (quality of mother-infant interaction was studied using the Parent-Child Early Relational Assessment (PCERA) method at 6 and 12 months of the infant's corrected age. The results showed that maternal representations are related to the quality of mother-infant interaction in a parallel manner in preterm and full-term infants and their mothers. Furthermore, distorted representations were more strongly related to a higher number of areas of concern in mother-infant interaction than other representation classifications. Our results underline the importance of combined assessment of the subjective experiences of the mother and the quality of mother-infant interaction in clinical follow-up. This is the first study to describe the relation between maternal attachment representations and the quality of mother-infant interaction involving preterm infants. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Effect of mother-infant early skin-to-skin contact on breast feeding status: a randomized controlled trial

    International Nuclear Information System (INIS)

    Mahmood, I.; Jamal, M.; Khan, N.

    2011-01-01

    Objective: To evaluate the effect of mother-infant early skin-to-skin contact on breast feeding behavior of infants. Study Design: A randomized controlled trial. Place and Duration of Study: The study was conducted in the Department of Obstetrics of Pakistan Institute of Medical Sciences, Islamabad, from November to December 2009. Methodology: Eligible mothers were assessed for the successful breast feeding by using IBFAT tool. The time to initiate the first feed, time to effective breast feeding, maternal satisfaction with the care provided, preference for the same care in future and level of exclusive breast feeding at the age of one month were also noted. The data was compared by using X2 and t-test. Significant p-value was taken as < 0.05. Results: A total of 183 mother-infant pairs (92 in skin-to-skin care [SSC] group and 91 in conventional care [CC] group) were analyzed for breast feeding behavior of the infants. The first breast feed was 26.25% more successful in SSC group (58.8% in SSC group as compared to 32.5% in CC group with p-value of 0.001). In SSC group, the mean time to initiate first breast feed was 61.6 minutes shorter than CC group (40.62 vs. 101.88; p < 0.001). Mean time to achieve effective breast feeding was 207 minutes earlier in SSC group (149.69 vs. 357.50; p < 0.001). The level of satisfaction in the mothers of SSC group was significantly high as compared to controls (56% vs. 6.2%). Similarly, 53.8% mothers of SSC group showed reference for similar care in future as compared to 5% in CC group. In SSC group 85.3% infants were exclusively breast fed at one month as compared to 65.7% in CC group (p=0.025). Conclusion: Maternal-infant early skin-to-skin contact significantly enhanced the success of first breast feed and continuation of exclusive breast feeding till one month of age. It also reduced the time to initiate first feed and time to effective breast feeding. (author)

  19. Analysis of transmission lines loaded with pairs of coupled resonant elements and application to sensors

    International Nuclear Information System (INIS)

    Naqui, J.; Su, L.; Mata, J.; Martín, F.

    2015-01-01

    This paper is focused on the analysis of transmission lines loaded with pairs of magnetically coupled resonators. We have considered two different structures: (i) a microstrip line loaded with pairs of stepped impedance resonators (SIRs), and (ii) a coplanar waveguide (CPW) transmission line loaded with pairs of split ring resonators (SRRs). In both cases, the line exhibits a single resonance frequency (transmission zero) if the resonators are identical (symmetric structure with regard to the line axis), and this resonance is different to the one of the line loaded with a single resonator due to inter-resonator coupling. If the structures are asymmetric, inter-resonator coupling enhances the distance between the two split resonance frequencies that arise. In spite that the considered lines and loading resonators are very different and are described by different lumped element equivalent circuit models, the phenomenology associated to the effects of coupling is exactly the same, and the resonance frequencies are given by identical expressions. The reported lumped element circuit models of both structures are validated by comparing the circuit simulations with extracted parameters with both electromagnetic simulations and experimental data. These structures can be useful for the implementation of microwave sensors based on symmetry properties. - Highlights: • Magnetic-coupling between resonant elements affects transmission properties. • Inter-resonant coupling enhances the distance of two resonant frequencies. • The structures are useful for sensors and comparators, etc

  20. Study of mother-infant attachment patterns and influence factors in Shanghai.

    Science.gov (United States)

    Ding, Yan-hua; Xu, Xiu; Wang, Zheng-yan; Li, Hui-rong; Wang, Wei-ping

    2012-05-01

    In contrast to the considerable volume of international research on infant attachment development, significantly less research has been conducted in China. The present study was designed to identify the patterns of mother-infant attachment in Shanghai and to explore the influence factors. The subjects included 160 healthy infant-mother dyads. Infant attachment and temperament were assessed with the Strange Situation Procedure and Carey's temperament questionnaire, respectively; the mother's personality, maternal sensitivity and marital satisfaction were assessed with Eysenck's personality questionnaire, Maternal Behavior Q-sort Manual Version 3.1 and Olson's marital questionnaire, respectively. A self-formulated questionnaire of family environment factors was completed by the infant's mother. Of the 160 infants, 68.2% were rated as securely attached (B) and 31.8% as insecurely attached. Of those infants rated as insecurely attached, 7.5% were characterized as avoidant (A), 21.8% as resistant (C) and 2.5% as disorganized (D). Maternal sensitivity and marital satisfaction as well as the approachability dimension of infant temperament, were significantly different between securely attached infants and insecurely attached infants. From a temperament perspective, resistant infants showed higher-level intensity of reaction than avoidant infants. Moreover, multiple caregivers in the family and infant's sleeping with other caregivers at night were more likely to be associated with insecure mother-infant attachment. There exist certain cultural characteristics in mother-infant attachment patterns in Shanghai. The influence factors are related with the high involvement of non-mother caregivers as well as maternal sensitivity, marital satisfaction and infant's temperament characteristics. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Is the Effect of Postpartum Depression on Mother-Infant Bonding Universal?

    Science.gov (United States)

    Badr, Lina Kurdahi; Ayvazian, Nelly; Lameh, Salma; Charafeddine, Lama

    2018-05-01

    Although the negative consequences of maternal depression on infants has been documented in several Western societies, similar studies have not been conducted in Middle-Eastern countries where cultural norms and traditions may differ. The main objective of this study was to determine the risk factors for postpartum depression (PPD) and its relationship to mother -infant bonding in a Lebanese population. One hundred and fifty participants were administered the Edinburgh Postpartum Depression Scale (EPDS), and the social support scale at 2-3 days postpartum. At 10-12 weeks mother-infant bonding using the Postpartum Bonding Questionnaire (PBQ) and depression using the Beck Inventory (BDI-II) were assessed during a telephone interview. The prevalence of depression was 19% with an average score of 10.9 ± 6.02 on the EPDS. At 10-12 weeks 2.7% of the whole sample was depressed with an average score of 18.60 ± 16.87 on the BDI-II. Risk factors of PPD on the EPDS were; history of alcohol use, complications during pregnancy, not a good marital relationship, baby admitted to an intensive care unit, history of depression and low social support. Risk factors for impaired bonding were age, history of depression, BDI-II scores above 20 and low social support. The multiple regression analysis found that impaired bonding was associated with older age, history of depression and low social support, which explained 39% of the variance, F = 7.12, p = 0.02. The prevalence of PPD was higher than previously reported at day 2-3 post-delivery, but lower at 10-12 weeks postpartum. Impaired mother- infant bonding was associated older mothers, history of depression, low social support and BDI-II scores above 20 which should alert practitioner to assessing these factors in post-partum mothers. Copyright © 2018. Published by Elsevier Inc.

  2. Mother, Infant, and Household Factors Associated with the Type of Food Infants Receive in Developing Countries

    Directory of Open Access Journals (Sweden)

    Benjamin eYarnoff

    2014-02-01

    Full Text Available Objectives: We explore the complex factors associated with infant feeding by analyzing what mother, infant, and household factors are associated with the types of food given to infants. We seek to quantify associations in order to inform public health policy about the importance of target populations for infant feeding programs. Methods: We used data from the Demographic Health Survey in 20 developing countries for multiple years to examine mother, infant, and household factors associated with six types of food given to infants (exclusive breastfeeding, non-exclusive breastfeeding, infant formula, milk liquids, non-milk liquids, and solid foods. We performed a seemingly unrelated regressions analysis with community-year fixed effects to account for correlation between food types and control for confounding factors associated with community resources, culture, time period, and geography in the pooled analysis.Results: We found that several mother, infant, and household characteristics were associated with each of the feeding types. Most notably, mother’s education, working status, and weight are significantly associated with the type of food given to infants. We provide quantified estimates of the association of each of these variables with six types of food given to infants. Conclusions: By identifying maternal characteristics associated with infant feeding and quantifying those associations, we help public health policymakers generate priorities for targeting infant feeding programs to specific populations that are at greatest risk. Higher educated, working mothers are best to target with exclusive breastfeeding programs for young infants. Mothers with lower education are best to target with complementary feeding programs in infants older than 1 year. Finally, while maternal weight is associated with higher levels of exclusive breastfeeding the association is too weak to merit targeting of breastfeeding programs to low-weight mothers.

  3. Tonal synchrony in mother-infant interaction based on harmonic and pentatonic series.

    Science.gov (United States)

    Van Puyvelde, Martine; Vanfleteren, Pol; Loots, Gerrit; Deschuyffeleer, Sara; Vinck, Bart; Jacquet, Wolfgang; Verhelst, Werner

    2010-12-01

    This study reports the occurrence of 'tonal synchrony' as a new dimension of early mother-infant interaction synchrony. The findings are based on a tonal and temporal analysis of vocal interactions between 15 mothers and their 3-month-old infants during 5 min of free-play in a laboratory setting. In total, 558 vocal exchanges were identified and analysed, of which 84% reflected harmonic or pentatonic series. Another 10% of the exchanges contained absolute and/or relative pitch and/or interval imitations. The total durations of dyads being in tonal synchrony were normally distributed (M=3.71, SD=2.44). Vocalisations based on harmonic series appeared organised around the major triad, containing significantly more simple frequency ratios (octave, fifth and third) than complex ones (non-major triad tones). Tonal synchrony and its characteristics are discussed in relation to infant-directed speech, communicative musicality, pre-reflective communication and its impact on the quality of early mother-infant interaction and child's development. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Chimpanzee social intelligence: selfishness, altruism, and the mother-infant bond.

    Science.gov (United States)

    Hirata, Satoshi

    2009-01-01

    To better understand the human mind from an evolutionary perspective, a great deal of research has focused on the closest living relative of humans, the chimpanzee, using various approaches, including studies of social intelligence. Here, I review recent research related to several aspects of social intelligence, including deception, understanding of perception and intention, social learning, trading, cooperation, and regard for others. Many studies have demonstrated that chimpanzees are proficient in using their social intelligence for selfish motives to benefit from their interactions with others. In contrast, it is not yet clear whether chimpanzees engage in prosocial behaviors that benefit others; however, chimpanzee mother-infant interactions indicate the possibility of such behaviors. Therefore, I propose that chimpanzees possess rudimentary traits of human mental competence not only in terms of theory of mind in a broader sense but also in terms of prosociality involving regard for others. Mother-infant interactions appear to be particularly important to understanding the manifestation of social intelligence from an evolutionary perspective.

  5. Early dyadic patterns of mother-infant interactions and outcomes of prematurity at 18 months.

    Science.gov (United States)

    Forcada-Guex, Margarita; Pierrehumbert, Blaise; Borghini, Ayala; Moessinger, Adrien; Muller-Nix, Carole

    2006-07-01

    With the increased survival of very preterm infants, there is a growing concern for their developmental and socioemotional outcomes. The quality of the early mother-infant relationship has been noted as 1 of the factors that may exacerbate or soften the potentially adverse impact of preterm birth, particularly concerning the infant's later competencies and development. The first purpose of the study was to identify at 6 months of corrected age whether there were specific dyadic mother-infant patterns of interaction in preterm as compared with term mother-infant dyads. The second purpose was to examine the potential impact of these dyadic patterns on the infant's behavioral and developmental outcomes at 18 months of corrected age. During a 12-month period (January-December 1998), all preterm infants who were compliance, difficult, and passivity). At 18 months, behavioral outcomes of the children were assessed on the basis of a semistructured interview of the mother, the Symptom Check List. The Symptom Check List explores 4 groups of behavioral symptoms: sleeping problems, eating problems, psychosomatic symptoms, and behavioral and emotional disorders. At the same age, developmental outcomes were evaluated using the Griffiths Developmental Scales. Five areas were evaluated: locomotor, personal-social, hearing and speech, eye-hand coordination, and performance. Among the possible dyadic patterns of interaction, 2 patterns emerge recurrently in mother-infant preterm dyads: a "cooperative pattern" with a sensitive mother and a cooperative-responsive infant (28%) and a "controlling pattern" with a controlling mother and a compulsive-compliant infant (28%). The remaining 44% form a heterogeneous group that gathers all of the other preterm dyads and is composed of 1 sensitive mother-passive infant; 10 controlling mothers with a cooperative, difficult, or passive infant; and 10 unresponsive mothers with a cooperative, difficult, or passive infant. Among the term control

  6. Taking Stress Response out of the Box: Stability, Discontinuity, and Temperament Effects on HPA and SNS across Social Stressors in Mother-Infant Dyads

    Science.gov (United States)

    Laurent, Heidemarie K.; Ablow, Jennifer C.; Measelle, Jeffrey

    2012-01-01

    This study investigated continuity and stability of hypothalamic-pituitary-adrenal (HPA) and sympathetic nervous system (SNS) response measures in mother-infant dyads across 2 different types of social stress sessions. Synchrony of response trajectories across systems (SNS-HPA coordination) and partners (mother-infant attunement) was addressed, as…

  7. Promoting mother-infant interaction and infant mental health in low-income Korean families: attachment-based cognitive behavioral approach.

    Science.gov (United States)

    Lee, Gyungjoo; McCreary, Linda; Breitmayer, Bonnie; Kim, Mi Ja; Yang, Soo

    2013-10-01

    This study evaluated the attachment-based cognitive behavioral approach (ACBA) to enhance mother-infant interaction and infant mental health. This quasi-experimental study used a pre-posttest control group design. Participants were 40 low-income, mother-infant (infant ages 12-36 months) dyads, 20 dyads per group. The ACBA group received 10 weekly 90-min sessions. Dependent variables were changes in mother-infant interaction and infant mental health. Additionally, we explored changes in mothers' attachment security. The groups differed significantly in changes in mother-infant interaction, infant mental health problems, and mothers' attachment security. ACBA may enhance mother-infant interaction and infants' mental health. © 2013, Wiley Periodicals, Inc.

  8. Quality-Improvement Effort to Reduce Hypothermia Among High-Risk Infants on a Mother-Infant Unit.

    Science.gov (United States)

    Andrews, Christine; Whatley, Colleen; Smith, Meaghan; Brayton, Emily Caron; Simone, Suzanne; Holmes, Alison Volpe

    2018-02-14

    Neonatal hypothermia is common in low birth weight (LBW) (preventive measures for LPIs and/or LBW infants in a mother-infant unit. We conducted plan-do-study-act (PDSA) cycles aimed at decreasing environmental hypothermia for LPIs and/or LBW infants in a mother-infant unit with no other indications for NICU-level care. Interventions included using warm towels after delivery, a risk identification card, an occlusive hat, delayed timing of first bath, submersion instead of sponge-bathing, and conducting all assessments under a radiant warmer during the initial hours of life. We implemented these interventions in 3 PDSA cycles and followed hypothermia rates by using statistical process control methods. The baseline mean monthly hypothermia rate among mother-infant unit LPIs and/or LBW infants was 29.8%. Postintervention, the rate fell to 13.3% (-16.5%; P = .002). This decrease occurred in a stepwise fashion in conjunction with the PDSA cycles. In the final, full-intervention period, the rate was 10.0% (-19.8%; P = .0003). A special-cause signal shift was observed in this final period. Targeted interventions can significantly reduce hypothermia in otherwise healthy LPIs and/or LBW newborns and allow them to safely remain in a mother-infant unit. If applied broadly, such preventive practices could decrease preventable hypothermia in high-risk populations. Copyright © 2018 by the American Academy of Pediatrics.

  9. Modeling Dyadic Processes Using Hidden Markov Models: A Time Series Approach to Mother-Infant Interactions during Infant Immunization

    Science.gov (United States)

    Stifter, Cynthia A.; Rovine, Michael

    2015-01-01

    The focus of the present longitudinal study, to examine mother-infant interaction during the administration of immunizations at 2 and 6?months of age, used hidden Markov modelling, a time series approach that produces latent states to describe how mothers and infants work together to bring the infant to a soothed state. Results revealed a…

  10. How does microanalysis of mother-infant communication inform maternal sensitivity and infant attachment?

    Science.gov (United States)

    Beebe, Beatrice; Steele, Miriam

    2013-01-01

    Microanalysis research on 4-month infant-mother face-to-face communication operates like a "social microscope" and identifies aspects of maternal sensitivity and the origins of attachment with a more detailed lens. We hope to enhance a dialogue between these two paradigms, microanalysis of mother-infant communication and maternal sensitivity and emerging working models of attachment. The prediction of infant attachment from microanalytic approaches and their contribution to concepts of maternal sensitivity are described. We summarize aspects of one microanalytic study by Beebe and colleagues published in 2010 that documents new communication patterns between mothers and infants at 4 months that predict future disorganized (vs. secure) attachment. The microanalysis approach opens up a new window on the details of the micro-processes of face-to-face communication. It provides a new, rich set of behaviors with which to extend our understanding of the origins of infant attachment and of maternal sensitivity.

  11. Mother-infant consultation during drug treatment: Research and innovative clinical practice

    Directory of Open Access Journals (Sweden)

    Lester Barry M

    2008-02-01

    Full Text Available Abstract Background This paper details a model for consulting with mothers and infants, and drug treatment staff used in a residential drug treatment program and relevant to other treatment settings. The role of parent-infant consultation based on the Neonatal Network Neurobehavioral Scale (NNNS was evaluated. Methods A sequential cohort model was used to assign participants to 1. NNNS consultation versus 2. standard care. The effects of NNNS consultation were evaluated using the Parenting Stress Index and NNNS summary scores. Results Participants in the NNNS consultation condition had significantly less stress overall, and less stress related to infant behavior than participants in standard care. There were no differences in infant behavior on the NNNS Summary scores. Conclusion The implications for NNNS consultation in drug treatment programs is outlined. The importance of prevention/intervention to establish satisfactory mother-infant interaction in recovery programs which include a central parenting component is indicated.

  12. A systems view of mother-infant face-to-face communication.

    Science.gov (United States)

    Beebe, Beatrice; Messinger, Daniel; Bahrick, Lorraine E; Margolis, Amy; Buck, Karen A; Chen, Henian

    2016-04-01

    Principles of a dynamic, dyadic systems view of mother-infant face-to-face communication, which considers self- and interactive processes in relation to one another, were tested. The process of interaction across time in a large low-risk community sample at infant age 4 months was examined. Split-screen videotape was coded on a 1-s time base for communication modalities of attention, affect, orientation, touch, and composite facial-visual engagement. Time-series approaches generated self- and interactive contingency estimates in each modality. Evidence supporting the following principles was obtained: (a) Significant moment-to-moment predictability within each partner (self-contingency) and between the partners (interactive contingency) characterizes mother-infant communication. (b) Interactive contingency is organized by a bidirectional, but asymmetrical, process: Maternal contingent coordination with infant is higher than infant contingent coordination with mother. (c) Self-contingency organizes communication to a far greater extent than interactive contingency. (d) Self- and interactive contingency processes are not separate; each affects the other in communication modalities of facial affect, facial-visual engagement, and orientation. Each person's self-organization exists in a dynamic, homoeostatic (negative feedback) balance with the degree to which the person coordinates with the partner. For example, those individuals who are less facially stable are likely to coordinate more strongly with the partner's facial affect and vice versa. Our findings support the concept that the dyad is a fundamental unit of analysis in the investigation of early interaction. Moreover, an individual's self-contingency is influenced by the way the individual coordinates with the partner. Our results imply that it is not appropriate to conceptualize interactive processes without simultaneously accounting for dynamically interrelated self-organizing processes. (c) 2016 APA, all

  13. Relations between Automatically Extracted Motion Features and the Quality of Mother-Infant Interactions at 4 and 13 Months.

    Science.gov (United States)

    Egmose, Ida; Varni, Giovanna; Cordes, Katharina; Smith-Nielsen, Johanne; Væver, Mette S; Køppe, Simo; Cohen, David; Chetouani, Mohamed

    2017-01-01

    Bodily movements are an essential component of social interactions. However, the role of movement in early mother-infant interaction has received little attention in the research literature. The aim of the present study was to investigate the relationship between automatically extracted motion features and interaction quality in mother-infant interactions at 4 and 13 months. The sample consisted of 19 mother-infant dyads at 4 months and 33 mother-infant dyads at 13 months. The coding system Coding Interactive Behavior (CIB) was used for rating the quality of the interactions. Kinetic energy of upper-body, arms and head motion was calculated and used as segmentation in order to extract coarse- and fine-grained motion features. Spearman correlations were conducted between the composites derived from the CIB and the coarse- and fine-grained motion features. At both 4 and 13 months, longer durations of maternal arm motion and infant upper-body motion were associated with more aversive interactions, i.e., more parent-led interactions and more infant negativity. Further, at 4 months, the amount of motion silence was related to more adaptive interactions, i.e., more sensitive and child-led interactions. Analyses of the fine-grained motion features showed that if the mother coordinates her head movements with her infant's head movements, the interaction is rated as more adaptive in terms of less infant negativity and less dyadic negative states. We found more and stronger correlations between the motion features and the interaction qualities at 4 compared to 13 months. These results highlight that motion features are related to the quality of mother-infant interactions. Factors such as infant age and interaction set-up are likely to modify the meaning and importance of different motion features.

  14. Affect recognition and the quality of mother-infant interaction: understanding parenting difficulties in mothers with schizophrenia.

    Science.gov (United States)

    Healy, Sarah J; Lewin, Jona; Butler, Stephen; Vaillancourt, Kyla; Seth-Smith, Fiona

    2016-02-01

    This study investigated the quality of mother-infant interaction and maternal ability to recognise adult affect in three study groups consisting of mothers with a diagnosis of schizophrenia, mothers with depression and healthy controls. Sixty-four mothers were recruited from a Mother and Baby Unit and local children's centres. A 5-min mother-infant interaction was coded on a number of caregiving variables. Affect recognition and discrimination abilities were tested via a series of computerised tasks. Group differences were found both in measures of affect recognition and in the mother-infant interaction. Mothers with schizophrenia showed consistent impairments across most of the parenting measures and all measures of affect recognition and discrimination. Mothers with depression fell between the mothers with schizophrenia and healthy controls on most measures. However, depressed women's parenting was not significantly poorer than controls on any of the measures, and only showed trends for differences with mothers with schizophrenia on a few measures. Regression analyses found impairments in affect recognition and a diagnosis of schizophrenia to predict the occurrence of odd or unusual speech in the mother-infant interaction. Results add to the growing body of knowledge on the mother-infant interaction in mothers with schizophrenia and mothers with depression compared to healthy controls, suggesting a need for parenting interventions aimed at mothers with these conditions. While affect recognition impairments were not found to fully explain differences in parenting among women with schizophrenia, further research is needed to understand the psychopathology of parenting disturbances within this clinical group.

  15. Option A Improved HIV-free Infant Survival and Mother to Child HIV Transmission at 9–18 Months in Zimbabwe

    Science.gov (United States)

    BUZDUGAN, Raluca; KANG DUFOUR, Mi-Suk; MCCOY, Sandra I; WATADZAUSHE, Constancia; DIRAWO, Jeffrey; MUSHAVI, Angela; MUJURU, Hilda Angela; MAHOMVA, Agnes; KANGWENDE, Rugare Abigail; HAKOBYAN, Anna; MUGURUNGI, Owen; COWAN, Frances M; PADIAN, Nancy S

    2016-01-01

    Objective We evaluated the impact of Option A on HIV-free infant survival and mother-to-child transmission (MTCT) in Zimbabwe. Design Serial cross-sectional community-based serosurveys. Methods We analyzed serosurvey data collected in 2012 and 2014 among mother-infant pairs from catchment areas (CAs) of 132 health facilities from 5 of 10 provinces in Zimbabwe. Eligible infants (alive or deceased) were born 9–18 months before each survey to mothers ≥16 years old. We randomly selected mother-infant pairs and conducted questionnaires, verbal autopsies and collected blood samples. We estimated: 1) the HIV-free infant survival and MTCT rate within each CA and compared the 2012 and 2014 estimates using a paired t-test, 2) number of HIV infections averted due to the intervention. Results We analyzed 7,249 mother-infant pairs with viable maternal specimens collected in 2012 and 8,551 in 2014. The mean difference in the CA-level MTCT between 2014 and 2012 was −5.2 percentage points (95% confidence interval (CI)=−8.1, −2.3, pOption A regimen. The association between HIV-free infant survival and duration of Option A implementation was not significant at the multivariate level (p=0.093). Conclusions We found a substantial and statistically significant increase in HIV-free survival and decrease in MTCT among infants aged 9–18 months following Option A rollout in Zimbabwe. This is the only impact evaluation of Option A and shows the effectiveness of Option A and Zimbabwe’s remarkable progress towards eMTCT. PMID:27058354

  16. Option A improved HIV-free infant survival and mother to child HIV transmission at 9-18 months in Zimbabwe.

    Science.gov (United States)

    Buzdugan, Raluca; Kang Dufour, Mi-Suk; McCoy, Sandra I; Watadzaushe, Constancia; Dirawo, Jeffrey; Mushavi, Angela; Mujuru, Hilda Angela; Mahomva, Agnes; Kangwende, Rugare Abigail; Hakobyan, Anna; Mugurungi, Owen; Cowan, Frances M; Padian, Nancy S

    2016-06-19

    We evaluated the impact of Option A on HIV-free infant survival and mother-to-child transmission (MTCT) in Zimbabwe. Serial cross-sectional community-based serosurveys. We analyzed serosurvey data collected in 2012 and 2014 among mother-infant pairs from catchment areas of 132 health facilities from five of 10 provinces in Zimbabwe. Eligible infants (alive or deceased) were born 9-18 months before each survey to mothers at least 16 years old. We randomly selected mother-infant pairs and conducted questionnaires, verbal autopsies, and collected blood samples. We estimated the HIV-free infant survival and MTCT rate within each catchment area and compared the 2012 and 2014 estimates using a paired t test and number of HIV infections averted because of the intervention. We analyzed 7249 mother-infant pairs with viable maternal specimens collected in 2012 and 8551 in 2014. The mean difference in the catchment area level MTCT between 2014 and 2012 was -5.2 percentage points (95% confidence interval = -8.1, -2.3, P Option A regimen. The association between HIV-free infant survival and duration of Option A implementation was NS at the multivariate level (P = 0.093). We found a substantial and statistically significant increase in HIV-free survival and decrease in MTCT among infants aged 9-18 months following Option A rollout in Zimbabwe. This is the only evaluation of Option A and shows the effectiveness of Option A and Zimbabwe's remarkable progress toward eMTCT.

  17. Risk adapted transmission prophylaxis to prevent vertical HIV–1 transmission: Effectiveness and safety of an abbreviated regimen of postnatal oral Zidovudine

    Directory of Open Access Journals (Sweden)

    Neubert Jennifer

    2013-01-01

    Full Text Available Abstract Background Antiretroviral drugs including zidovudine (ZDV are effective in reducing HIV mother to child transmission (MTCT, however safety concern remains. The optimal duration of postnatal ZDV has not been established in clinical studies and there is a lack of consensus regarding optimal management. The objective of this study was to investigate the effectiveness and safety of a risk adapted two week course of oral postnatal ZDV as part of a combined intervention to reduce MTCT. Methods 118 mother infant pairs were treated according to the German-Austrian recommendations for HIV therapy in pregnancy and in HIV exposed newborns between 2000–2010. In the absence of factors associated with an increased HIV–1 transmission risk, children were assigned to the low risk group and treated with an abbreviated postnatal regimen with oral ZDV for 2 weeks. In the presence of risk factors, postnatal ZDV was escalated accordingly. Results Of 118 mother-infant pairs 79 were stratified to the low risk group, 27 to the high risk group and 11 to the very high risk group for HIV–1 MTCT. 4 children were lost to follow up. Overall Transmission risk in the group regardless of risk factors and completion of prophylaxis was 1.8% (95% confidence interval (CI 0.09–6.6. If transmission prophylaxis was complete, transmission risk was 0.9% (95% CI 0.01-5.7. In the low risk group receiving two week oral ZDV transmission risk was 1.4% (95% CI 0.01–8.4 Conclusion These data demonstrate the effectiveness of a short neonatal ZDV regimen in infants of women on stable ART and effective HIV–1 suppression. Further evaluation is needed in larger studies.

  18. A comparison of transmission characteristics of Salmonella enterica serovar Enteritidis between pair-housed and group-housed laying hens

    Directory of Open Access Journals (Sweden)

    Thomas Ekelijn

    2011-02-01

    Full Text Available Abstract Human cases of bacterial gastro-enteritis are often caused by the consumption of eggs contaminated with Salmonella species, mainly Salmonella enterica serovar Enteriditis (Salmonella Enteritidis. To reduce human exposure, in several countries worldwide surveillance programmes are implemented to detect colonized layer flocks. The sampling schemes are based on the within-flock prevalence, and, as this changes over time, knowledge of the within-flock dynamics of Salmonella Enteritidis is required. Transmission of Salmonella Enteritidis has been quantified in pairs of layers, but the question is whether the dynamics in pairs is comparable to transmission in large groups, which are more representative for commercial layer flocks. The aim of this study was to compare results of transmission experiments between pairs and groups of laying hens. Experimental groups of either 2 or 200 hens were housed at similar densities, and 1 or 4 hens were inoculated with Salmonella Enteritidis, respectively. Excretion was monitored by regularly testing of fecal samples for the presence of Salmonella Enteritidis. Using mathematical modeling, the group experiments were simulated with transmission parameter estimates from the pairwise experiments. Transmission of the bacteria did not differ significantly between pairs or groups. This finding suggests that the transmission parameter estimates from small-scale experiments might be extrapolated to the field situation.

  19. Maternal Executive Functioning as a Mechanism in the Intergenerational Transmission of Parenting: Preliminary Evidence

    OpenAIRE

    Bridgett, David J.; Kanya, Meghan J.; Rutherford, Helena J. V.; Mayes, Linda C.

    2016-01-01

    Multiple lines of inquiry, including experimental animal models, have recently converged to suggest that executive functioning (EF) may be one mechanism by which parenting behavior is transmitted across generations. In the current investigation, we empirically test this notion by examining relations between maternal EF and parenting behaviors during mother-infant interactions, and by examining the role of maternal EF in the intergenerational transmission of parenting behavior. Mother-infant d...

  20. Stability and transitions in mother-infant face-to-face communication during the first 6 months: a microhistorical approach.

    Science.gov (United States)

    Hsu, Hui-Chin; Fogel, Alan

    2003-11-01

    In this study the authors attempted to unravel the relational, dynamical, and historical nature of mother-infant communication during the first 6 months. Thirteen mothers and their infants were videotaped weekly from 4 to 24 weeks during face-to-face interactions. Three distinct patterns of mother-infant communication were identified: symmetrical, asymmetrical, and unilateral. Guided by a dynamic systems perspective, the authors explored the stability of and transitions between these communication patterns. Findings from event history analysis showed that (a) there are regularly recurring dyadic communication patterns in early infancy, (b) these recurring patterns show differential stabilities and likelihoods of transitions, (c) dynamic stability in dyadic communication is shaped not only by individual characteristics (e.g., infant sex and maternal parity) but also by the dyad's communication history, and (d) depending on their recency, communication histories varying in temporal proximity exert differential effects on the self-organization processes of a dyadic system. ((c) 2003 APA, all rights reserved)

  1. Mother-Infant Emotion Regulation at Three Months: The Role of Maternal Anxiety, Depression and Parenting Stress.

    Science.gov (United States)

    Riva Crugnola, Cristina; Ierardi, Elena; Ferro, Valentino; Gallucci, Marcello; Parodi, Cinzia; Astengo, Marina

    While the association between anxiety and postpartum depression is well known, few studies have investigated the relationship between these two states and parenting stress. Furthermore, a number of studies have found that postpartum depression affects mother-infant emotion regulation, but there has been only one study on anxiety and emotion regulation and no studies at all on parenting stress and emotion regulation. Therefore, the primary aim of our study is to identify, in a community sample of 71 mothers, the relationship between maternal depression, anxiety, and parenting stress. The second aim is to examine the relationship between anxiety, postpartum depression, and parenting stress and mother-infant emotion regulation assessed at 3 months. Mother-infant interaction was coded with a modified version of the Infant Caregiver and Engagement Phases (ICEP) using a microanalytic approach. The Edinburgh Postnatal Depression Scale (EPDS), State-Trait Anxiety Inventory (STAI), and Parenting Stress Index-Short Form (PSI-SF) were administered to the mothers to assess depression, anxiety, and parenting stress, respectively. Analysis revealed correlations between anxiety and depression, showing that parenting stress is associated with both states. In a laboratory observation, depression was correlated with both negative maternal states and negative dyadic matches as well as infant positive/mother negative mismatches; anxiety was correlated with both negative maternal states and infant negative states as well as mismatches involving one of the partners having a negative state. Multiple regression analysis showed that anxiety is a greater predictor than depression of less adequate styles of mother-infant emotion regulation. Parenting stress was not shown to predict such regulation. © 2016 S. Karger AG, Basel.

  2. Mother-infant joint attention and sharing: relations to disorganized attachment and maternal disrupted communication.

    Science.gov (United States)

    Annie Yoon, Seungyeon; Kelso, Gwendolyn A; Lock, Anna; Lyons-Ruth, Karlen

    2014-01-01

    The normative development of infant shared attention has been studied extensively, but few studies have examined the impact of disorganized attachment and disturbed maternal caregiving on mother-infant shared attention. The authors examined both maternal initiations of joint attention and infants' responses to those initiations during the reunion episodes of the Strange Situation Procedure at 12 and 18 months of infant age. The mothers' initiations of joint attention and three forms of infant response, including shunning, simple joint attention, and sharing attention, were examined in relation to infant disorganized attachment and maternal disrupted communication. Mothers who were disrupted in communication with their infants at 18 months initiated fewer bids for joint attention at 12 months, and, at 18 months, mothers of infants classified disorganized initiated fewer bids. However, the infant' responses were unrelated to either the infant' or the mother' disturbed attachment. At both ages, disorganized infants and infants of disrupted mothers were as likely to respond to maternal bids as were their lower risk counterparts. Our results suggest that a disposition to share experiences with others is robust in infancy, even among infants with adverse attachment experiences, but this infant disposition may depend on adult initiation of bids to be realized.

  3. The music of containment: Addressing the participants in mother-infant psychoanalytic treatment.

    Science.gov (United States)

    Salomonsson, Björn

    2011-11-01

    The author discusses the psychoanalyst's approach in mother-infant treatments. Emphasis is given to the infant as an important, though often neglected, addressee. A clinical example is used in which a telephone call during a prior session triggered fretting in a 3-month-old girl and distress in her mother. It is suggested that in the session, nonverbal levels of the interventions reached the girl and contained her, and that this containment worked along similar lines as the communicative musicality between mother and baby. In the discussion, the psychoanalytic concept of containment (Bion, 1962) is linked with the concept of communicative musicality (Trevarthen & Aitken, 2001). The mother's need for containment also is emphasized, and the therapist must be on alert when it is essential to focus on either participant in the therapy room. This choice is guided both by explicit deliberations and by the unconscious countertransference. However, the therapist's wish to grasp the countertransference is countered by his or her unwillingness of being reminded of feelings of infantile helplessness. Similarly, when the mother's conscious and unconscious messages diverge, the baby's ability to receive her caretaking is compromised. In the article's clinical case, this happened when the mother tried to soothe her daughter while being preoccupied with anger at the therapist to an extent to which she was not fully aware. Copyright © 2011 Michigan Association for Infant Mental Health.

  4. Longitudinal effects of contextual and proximal factors on mother-infant interactions among Brazilian adolescent mothers.

    Science.gov (United States)

    Diniz, Eva; DeSousa, Diogo; Koller, Silvia H; Volling, Brenda L

    2016-05-01

    Adolescent mothers often come from vulnerable backgrounds which might impact the quality of both maternal and infant behavior. Despite the negative impact of adolescent motherhood for maternal and infant behavior, social support may decrease the risks and promote maternal behavior toward the infant. The aim of this study was to investigate longitudinally the effects of proximal (maternal behavior) and distal (mother's perceived social support) variables on infant development in a sample of Brazilian adolescent mothers and their infants. Thirty-nine adolescent mothers (Mage=17.26years; SD=1.71) were observed interacting with their infants at 3 and 6 months postpartum and reported on social support. Results revealed that maternal and infant behavior were associated within and across times. Mothers' perceived social support at 3 months had an indirect effect on infant behavior at 6 months, totally mediated by maternal behavior at 6 months. Our findings revealed the mutual influence between maternal and infant behavior, revealing a proximal process. The results also underscored the importance of the passage of time in the interplay between mother-infant interactions and their developmental context. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Mothers' alexithymia, depression and anxiety levels and their association with the quality of mother-infant relationship: a preliminary study.

    Science.gov (United States)

    Yürümez, Esra; Akça, Ömer Faruk; Uğur, Çağatay; Uslu, Runa Idil; Kılıç, Birim Günay

    2014-08-01

    To evaluate the relationship between mothers and their developmentally normal infants in terms of maternal alexithymia, depression and anxiety, and marital satisfaction. Fifty children between 18 and 48 months of age, and their mothers, were referred consecutively to the Infant Mental Health Unit of Ankara University School of Medicine, Department of Child and Adolescent Psychiatry. The sociodemographic features of the families and the depressive symptoms, anxiety, marital satisfaction and alexithymia levels of the mothers were assessed. The relationships between children in normal developmental stages and their mothers were evaluated and rated using a structured clinical procedure. There was a negative correlation between the mothers' alexithymia scores and the quality of the mother-infant relationship (p Mothers with high alexithymia showed higher depression and lower relationship qualities than mothers with low alexithymia, according to the correlation analysis. When depression and anxiety were controlled, high alexithymia levels were predictive of a low, impaired mother-infant relationship. Since alexithymia is a trait-like variable which has a negative correlation with impairment in a mother-infant relationship, it must be investigated in the assessment of mothers' interactions with their babies.

  6. Ultrastructural instability of paired helical filaments from corticobasal degeneration as examined by scanning transmission electron microscopy.

    Science.gov (United States)

    Ksiezak-Reding, H.; Tracz, E.; Yang, L. S.; Dickson, D. W.; Simon, M.; Wall, J. S.

    1996-01-01

    Paired helical filaments (PHFs) accumulate in the brains of subjects affected with Alzheimer's disease (AD) and certain other neurodegenerative disorders, including corticobasal degeneration (CBD). Electron microscope studies have shown that PHFs from CBD differ from those of AD by being wider and having a longer periodicity of the helical twist. Moreover, PHFs from CBD have been shown to be primarily composed of two rather than three highly phosphorylated polypeptides of tau (PHF-tau), with these polypeptides expressing no exons 3 and 10. To further explore the relationship between the heterogeneity of PHF-tau and the appearance of abnormal filaments, the ultrastructure and physical parameters such as mass per unit length and dimensions were compared in filaments from CBD and AD using high resolution scanning transmission electron microscopy (STEM). Filament-enriched fractions were isolated as Sarcosyl-insoluble pellets and for STEM studies, samples were freeze-dried without prior fixation or staining. Ultrastructurally, PHFs from CBD were shown to be a heterogeneous population as double- and single-stranded filaments could be identified based on their width and physical mass per unit length expressed in kilodaltons (kd) per nanometer (nm). Less abundant, double-stranded filaments had a maximal width of 29 nm and a mass per unit length of 133 kd/nm, whereas three times more abundant single-stranded filaments were 15 nm wide and bad a mass per unit length of 62 kd/nm. Double-stranded filaments also displayed a distinct axial region of less dense mass, which appeared to divide the PHFs into two protofilament-like strands. Furthermore, these filaments were frequently observed to physically separate along the long axis into two single strands or to break longitudinally. In contrast, PHFs from AD were ultrastructurally stable and uniform both in their width (22 nm) and physical mass per unit length (104 kd/nm). The ultrastructural features indicate that filaments of

  7. Maternal cognitions and mother-infant interaction in postnatal depression and generalized anxiety disorder.

    Science.gov (United States)

    Stein, Alan; Craske, Michelle G; Lehtonen, Annukka; Harvey, Allison; Savage-McGlynn, Emily; Davies, Beverley; Goodwin, Julia; Murray, Lynne; Cortina-Borja, Mario; Counsell, Nicholas

    2012-11-01

    Postnatal depression and anxiety have been shown to increase the risk of disturbances in mother-child interaction and child development. Research into mechanisms has focused on genetics and maternal behavior; maternal cognitions have received little attention. Our aim was to experimentally determine if worry and rumination in mothers with generalized anxiety disorder (GAD) and major depressive disorder (MDD), diagnosed in the postnatal 6 months, interfered with maternal responsiveness to their 10-month old infants. Mothers (N = 253: GAD n = 90; MDD n = 57; control n = 106) and their infants were randomized to either a worry/rumination prime (WRP) or a neutral prime (NP); mother-infant interactions were assessed before and after priming. Type of priming was a significant predictor of maternal cognitions, with WRP resulting in more negative thoughts, higher thought recurrence and more self-focus relative to NP across the entire sample. Interaction effects between group and priming were significant for two parenting variables: Compared with controls, WRP had a more negative impact on maternal responsiveness to infant vocalization for GAD, and to a lesser extent for MDD; WRP led to decreased maternal vocalization for GAD. Also, mothers with GAD used stronger control after the NP than WRP, as well as compared with other groups, and overall post-priming, their children exhibited lower emotional tone and more withdrawal. Across the entire sample, WRP was associated with increased child vocalization relative to NP. This study demonstrated that disturbances in maternal cognitions, in the context of postnatal anxiety and to a lesser degree depression, play a significant role in mother-child interaction. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

  8. The Effect of Psychological Intervention on Mother-Infant Bonding and Breastfeeding

    Directory of Open Access Journals (Sweden)

    Mamak Shariat

    2017-03-01

    Full Text Available ABSTRACT Background: The emotional bond that a mother feels towards her infant is critical to their social, emotional, and cognitive development. This concept has a major influence on an infant’s future health, and growth, so the assessment of parental-fetal attachment and related factors is of great importance. This study aimed to examine the effect of psychological intervention on attachment and persistency of lactation.Methods: This clinical trial was carried out on 71 pregnant women who visited Milad and Vali-Asr hospitals in Tehran, Iran. The subjects were selected by convenience sampling method and randomly divided into control (n=36 and intervention (n=35 groups. In the intervention group, the subjects received three sessions of supportive group psychotherapy supplemented by training packages. Avant’s mother-infant attachment behavior questionnaire, Maternal Attachment Inventory, 28-item General Health Questionnaire, and the short form of the Coopersmith Self-Esteem Inventory were used to evaluate attachment behaviors and related factors. Attachment of mothers was examined at six different times. Statistical data was analyzed using independent t-test, Fisher’s exact test.Results: The findings indicated that the intervention group had increased attachment and breastfeeding persistency (P˂0.001. Regression test also showed that maternal attachment was significantly influenced by psychological interventions, self-esteem, and depression (P˂0.001.Conclusion: According to the results, psychological interventions are suggested during pregnancy to increase attachment and breastfeeding persistency, and thereby, improve mental health of both mother and newborn.

  9. Mother's Emotional and Posttraumatic Reactions after a Preterm Birth: The Mother-Infant Interaction Is at Stake 12 Months after Birth.

    Science.gov (United States)

    Petit, Anne-Cécile; Eutrope, Julien; Thierry, Aurore; Bednarek, Nathalie; Aupetit, Laurence; Saad, Stéphanie; Vulliez, Lauriane; Sibertin-Blanc, Daniel; Nezelof, Sylvie; Rolland, Anne-Catherine

    2016-01-01

    Very preterm infants are known to be at risk of developmental disabilities and behavioural disorders. This condition is supposed to alter mother-infant interactions. Here we hypothesize that the parental coping with the very preterm birth may greatly influence mother-infant interactions. 100 dyads were included in 3 university hospitals in France. Preterm babies at higher risk of neurodevelopmental sequelae (PRI>10) were excluded to target the maternal determinants of mother-infant interaction. We report the follow-up of this cohort during 1 year after very preterm birth, with regular assessment of infant somatic state, mother psychological state and the assessment of mother-infant interaction at 12 months by validated scales (mPPQ, HADS, EPDS, PRI, DDST and PIPE). We show that the intensity of post-traumatic reaction of the mother 6 months after birth is negatively correlated with the quality of mother-infant interaction at 12 months. Moreover, the anxious and depressive symptoms of the mother 6 and 12 months after birth are also correlated with the quality of mother-infant interaction at 12 months. By contrast, this interaction is not influenced by the initial affective state of the mother in the 2 weeks following birth. In this particular population of infants at low risk of sequelae, we also show that the quality of mother-infant interaction is not correlated with the assessment of the infant in the neonatal period but is correlated with the fine motor skills of the baby 12 months after birth. This study suggests that mothers' psychological condition has to be monitored during the first year of very preterm infants' follow-up. It also suggests that parental interventions have to be proposed when a post-traumatic, anxious or depressive reaction is suspected.

  10. Mother's Emotional and Posttraumatic Reactions after a Preterm Birth: The Mother-Infant Interaction Is at Stake 12 Months after Birth.

    Directory of Open Access Journals (Sweden)

    Anne-Cécile Petit

    Full Text Available Very preterm infants are known to be at risk of developmental disabilities and behavioural disorders. This condition is supposed to alter mother-infant interactions. Here we hypothesize that the parental coping with the very preterm birth may greatly influence mother-infant interactions.100 dyads were included in 3 university hospitals in France. Preterm babies at higher risk of neurodevelopmental sequelae (PRI>10 were excluded to target the maternal determinants of mother-infant interaction. We report the follow-up of this cohort during 1 year after very preterm birth, with regular assessment of infant somatic state, mother psychological state and the assessment of mother-infant interaction at 12 months by validated scales (mPPQ, HADS, EPDS, PRI, DDST and PIPE.We show that the intensity of post-traumatic reaction of the mother 6 months after birth is negatively correlated with the quality of mother-infant interaction at 12 months. Moreover, the anxious and depressive symptoms of the mother 6 and 12 months after birth are also correlated with the quality of mother-infant interaction at 12 months. By contrast, this interaction is not influenced by the initial affective state of the mother in the 2 weeks following birth. In this particular population of infants at low risk of sequelae, we also show that the quality of mother-infant interaction is not correlated with the assessment of the infant in the neonatal period but is correlated with the fine motor skills of the baby 12 months after birth.This study suggests that mothers' psychological condition has to be monitored during the first year of very preterm infants' follow-up. It also suggests that parental interventions have to be proposed when a post-traumatic, anxious or depressive reaction is suspected.

  11. Maternal attitudinal inflexibility: longitudinal relations with mother-infant disrupted interaction and childhood hostile-aggressive behavior problems.

    Science.gov (United States)

    Najmi, Sadia; Bureau, Jean-Francois; Chen, Diyu; Lyons-Ruth, Karlen

    2009-12-01

    : The Personal Attitude Scale (PAS; Hooley, 2000) is a method that is under development for identifying individuals high in Expressed Emotion based on personality traits of inflexibility, intolerance, and norm-forming. In the current study, the goal was to measure the association between this maternal attitudinal inflexibility, early hostile or disrupted mother-infant interactions, and hostile-aggressive behavior problems in the child. In a prospective longitudinal study of 76 low-income mothers and their infants, it was predicted that maternal PAS scores, assessed at child age 20, would be related to difficulties in early observed mother-infant interaction and to hostile-aggressive behavioral difficulties in the child. Results indicated that maternal difficulties in interacting with the infant in the laboratory were associated with maternal PAS scores assessed 20 years later. Hostile-aggressive behavior problems in the child at age five were also predictive of PAS scores of mothers. However, contrary to prediction, these behavior problems did not mediate the association between mother-infant interaction difficulties and maternal PAS scores, indicating that the child's hostile-aggressive behavior problems did not produce the link between quality of early interaction and later maternal attitudinal inflexibility. The current results validate the PAS against observable mother-child interactions and child hostile-aggressive behavior problems and indicate the importance of future work investigating the maternal attitudes that are associated with, and may potentially precede, parent-infant interactive difficulties. These findings regarding the inflexible attitudes of mothers whose interactions with their infants are also disrupted have important clinical implications. First, once the stability of the PAS has been established, this measure may offer a valuable screening tool for the prenatal identification of parents at risk for difficult interactions with their children

  12. The Effects of Massage by Mothers on Mother-Infant Attachment.

    Science.gov (United States)

    Shoghi, Mahnaz; Sohrabi, Soroor; Rasouli, Mahboobe

    2017-11-04

    Context • Transferring a newborn to the intensive care unit due to a premature birth is a major obstacle in the establishment of emotional attachment between a mother and her child. Researchers believe that the formation and continuation of such an attachment have a profound effect on the child's mental development and behavior in the coming years of life. Not all studies have agreed, however, that skin contact alone, such as massage provides, can improve attachment. Objective • The aim of this study was to determine the effects on maternal attachment behaviors of infants hospitalized in a neonatal intensive care unit (NICU) of massage provided by mothers for their premature neonates. Design • The research team designed a randomized, controlled trial. Setting • The study took place at the Hazrat Ali Asghar Hospital of the Iran University of Medical Sciences (Tehran, Iran). Participants • Participants were 40 mothers and 40 newborns admitted to the NICU at the hospital. Intervention • The study divided participants randomly into a massage (intervention) group and a control group receiving no massages. Mothers in the intervention group trained by watching educational videos and practicing the massage on infant manikins. Subsequently, the intervention group massaged its infants according to a 5-d program, in which each neonate received a 15-min massage session per day. Outcome Measures • Mother-infant attachment behaviors were assessed in both groups 4 times. The maternal attachment scale was used for data collection. Results • According to the statistical analyses, the between-groups difference was not significant at baseline (P > .05). The study showed a statistically significant difference between baseline and postintervention in the mean frequencies of maternal attachment behaviors for both groups (P attachment between the intervention and control groups (P = .000). Conclusion • Massage given to premature neonates by their mothers on a daily

  13. The Impact of Socio-Demographic Variables, Social Support and Child Sex on Mother-Infant and Father-Infant Interaction

    Directory of Open Access Journals (Sweden)

    Cesar Augusto Piccinini

    2010-01-01

    Full Text Available In this study we examine the impact of family socioeconomic status (SES, of social support as perceived by mothers, and of their three-month-olds child's sex, on mother-infant and father-infant interaction. A total of 58 mothers and 52 fathers were observed interacting with their infants. Univariate Analysis of Variance (ANOVA revealed several significant differences, particularly regarding maternal behaviors. Mothers from the highest SES level both talked to and interpreted their infants' behavior more than did lowest SES mothers. Social support perceived as unsatisfactory was associated with a greater amount of touch and stimulation during mother-infant interaction and also more infant vocalization. Mothers and fathers tended to talk more to their same-sex infants, and fathers tended to kiss and caress their sons more than they did their daughters. These results suggest particularities in the mother-infant and fatherinfant interaction when the infant was three months old.

  14. The effects of preterm birth on mother-infant interaction and attachment during the infant's first two years.

    Science.gov (United States)

    Korja, Riikka; Latva, Reija; Lehtonen, Liisa

    2012-02-01

    Early mother-infant relationships in preterm populations were evaluated in the context of a systematic review of the literature. A systematic search of three electronic databases (PsychINFO, PubMed and Cochrane Library) was undertaken. Three studies of maternal attachment, 18 studies of mother-preterm infant interaction and eight studies of infant attachment were included. Studies of preterm infant attachment were also evaluated using a meta-analysis. Studies of mother-preterm infant interactions showed that the differences in maternal interaction behavior between mothers of preterm infants and mothers of full-term infants seem to be most evident during the first six months of life. Differences in the preterm infant's interaction behavior seem also to continue for six months after birth. However, five of 18 studies showed an equal or even higher quality of mother-infant interaction in groups of preterm compared to groups of full-term infants. Studies of maternal and infant attachment indicated that preterm infants and their mothers are not at higher risk of insecure attachment than full-term infants and their mothers. The mother-preterm infant relationship is complex, and some relational patterns forecast greater psychological risk than others. It is important to decrease maternal stress and early separation in every possible way during hospitalization as well as after discharge. © 2012 The Authors Acta Obstetricia et Gynecologica Scandinavica© 2012 Nordic Federation of Societies of Obstetrics and Gynecology.

  15. Children's responses to mother-infant and father-infant interaction with a baby sibling: jealousy or joy?

    Science.gov (United States)

    Volling, Brenda L; Yu, Tianyi; Gonzalez, Richard; Kennedy, Denise E; Rosenberg, Lauren; Oh, Wonjung

    2014-10-01

    Firstborn children's reactions to mother-infant and father-infant interaction after a sibling's birth were examined in an investigation of 224 families. Triadic observations of parent-infant-sibling interaction were conducted at 1 month after the birth. Parents reported on children's problem behaviors at 1 and 4 months after the birth and completed the Attachment Q-sort before the birth. Latent profile analysis (LPA) identified 4 latent classes (behavioral profiles) for mother-infant and father-infant interactions: regulated-exploration, disruptive-dysregulated, approach-avoidant, and anxious-clingy. A fifth class, attention-seeking, was found with fathers. The regulated-exploration class was the normative pattern (60%), with few children in the disruptive class (2.7%). Approach-avoidant children had more behavior problems at 4 months than any other class, with the exception of the disruptive children, who were higher on aggression and attention problems. Before the birth, anxious-clingy children had less secure attachments to their fathers than approach avoidant children but more secure attachments to their mothers. Results underscore individual differences in firstborns' behavioral responses to parent-infant interaction and the importance of a person-centered approach for understanding children's jealousy. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  16. Modeling dyadic processes using Hidden Markov Models: A time series approach to mother-infant interactions during infant immunization.

    Science.gov (United States)

    Stifter, Cynthia A; Rovine, Michael

    2015-01-01

    The focus of the present longitudinal study, to examine mother-infant interaction during the administration of immunizations at two and six months of age, used hidden Markov modeling, a time series approach that produces latent states to describe how mothers and infants work together to bring the infant to a soothed state. Results revealed a 4-state model for the dyadic responses to a two-month inoculation whereas a 6-state model best described the dyadic process at six months. Two of the states at two months and three of the states at six months suggested a progression from high intensity crying to no crying with parents using vestibular and auditory soothing methods. The use of feeding and/or pacifying to soothe the infant characterized one two-month state and two six-month states. These data indicate that with maturation and experience, the mother-infant dyad is becoming more organized around the soothing interaction. Using hidden Markov modeling to describe individual differences, as well as normative processes, is also presented and discussed.

  17. The Relationship between Maternal-Fetal Attachment and Mother-Infant Attachment Behaviors in Primiparous Women Referring to Mashhad Health Care Centers

    Directory of Open Access Journals (Sweden)

    Mahin Taffazoli

    2015-04-01

    Full Text Available Background & aim: Mother-infant bonding and interactions after childbirth are shaped by maternal-fetal attachment during pregnancy. Although many studies have shown the positive correlation between maternal-fetal attachment and mother-infant attachment behaviors, some controversial studies have shown otherwise. Therefore, this study aimed to evaluate the correlation between maternal-fetal attachment and mother-infant attachment behaviors in primiparous women. Methods:This descriptive correlational study was conducted on 100 primiparous women, referring to the selected heath care centers of Mashhad. Data were collected using Cranley's maternal–fetal attachment scale, Avant’s mother-infant attachment tool, Edinburgh postnatal depression scale, and a demographic/obstetric questionnaire including demographic data, obstetric information, delivery outcomes, and postpartum data. Pregnant women with a gestational age of 35-41 weeks, who met the inclusion criteria, completed Cranley's questionnaire, as well as the demographic/obstetric questionnaire. Four and eight weeks after delivery, the subjects were asked to complete the Edinburgh questionnaire and postpartum information; then, they were asked to breastfeed their infants on a chair in a quiet place for 15 minutes. The researcher observed the mothers’ behaviors toward their neonates. For data analysis, descriptive and analytical tests were performed, using SPSS version 16. Results: There was a direct positive relationship between maternal-fetal attachment and mothers’ emotional behaviors toward infants four and eight weeks after delivery. However, four and eight weeks after childbirth, no significant correlation was found between maternal-fetal attachment and mothers’ caring behaviors. Conclusion: According to the findings, maternal-fetal attachment is one of the most important factors for mother-infant attachment. These findings could be applied for enriching mother-infant attachment

  18. 'Touchpoints' by nurses: impact on maternal representations, child development, quality of mother-infant interaction, and mothers' perception of the quality of relationships with nurses.

    Science.gov (United States)

    Soares, Hélia

    2016-05-09

    To investigate the effect of implementing the Touchpoints methodology by nurses in the following variables: quality of mother-infant interaction; infant development; maternal representations of child temperament and mothers' perception of the quality of relationship with nurses. Quasi-experimental longitudinal study, including 86 child-mother dyads distributed equally for: Group with Intervention (GI) (n=43), Group without Intervention (GWI) (n=43). These groups belonged to paired samples according to the following criteria: maternal age; socio-economic class; family structure; child health; parents' physical or psychological health; twins; family's nationality; risk during pregnancy; baby APGAR. Paired samples with the same routine visits allowed comparing the impact of Touchpoints intervention on the above mentioned variables. The monitoring of the two groups took place in a period of between 11 and 24 months of children's life (four moments of assessment), being held two Touchpoints sessions in the GI at 12 and 18 months. Two Touchpoints interventions sessions were applied in the GI as follows: the first time, at 12 months; the second time, at 24 months, child age. The instruments used for data collection were: Schedule of Growing Skills II (SGS II); CARE-Index; Temperament Scale; Parent-Caregiver Relationship Scale - parents' version. Infant Locomotor development (p=.036) and maternal representations about the child and motherhood (Z=5.737; p=.019) improved in the GI. No significant results were found for mother-infant interaction in this direct comparison. Nevertheless, findings indicate that maternal sensitivity and infant cooperative behaviour increased from 12 to 24 months in the GI [t(41)=4.513; p<.001], whereas it decreased in the GWI (from 8.62 at 12 months to 8.40 at 24 months). The means of mothers' perceptions of Trust/Caring towards nurses in the GI were higher than in GWI after six months of the Touchpoints intervention [t(84)=2.146; p<.001; M_GI=34

  19. Infant Massage and Quality of Early Mother-Infant Interactions: Are There Associations with Maternal Psychological Wellbeing, Marital Quality, and Social Support?

    Science.gov (United States)

    Porreca, Alessio; Parolin, Micol; Bozza, Giusy; Freato, Susanna; Simonelli, Alessandra

    2016-01-01

    , seem to sustain the usefulness of infant massage and the importance of focusing on early mother-infant interactions.

  20. Three-dimensional visualization of material flow during friction stir welding by two pairs of X-ray transmission systems

    International Nuclear Information System (INIS)

    Morisada, Y.; Fujii, H.; Kawahito, Y.; Nakata, K.; Tanaka, M.

    2011-01-01

    Material flow during friction stir welding is crucial to obtaining sound joints. However, this phenomenon is still not fully understood despite many investigations and numerous models. In this study, the material flow is three-dimensionally visualized by X-ray radiography using a tiny spherical tungsten tracer. The movement of the tracer during the friction stir welding is observed by two pairs of X-ray transmission real-time imaging systems. The three-dimensional material flow is obtained by following the locus of the tracer.

  1. Pair distribution functions of amorphous organic thin films from synchrotron X-ray scattering in transmission mode

    Directory of Open Access Journals (Sweden)

    Chenyang Shi

    2017-09-01

    Full Text Available Using high-brilliance high-energy synchrotron X-ray radiation, for the first time the total scattering of a thin organic glass film deposited on a strongly scattering inorganic substrate has been measured in transmission mode. The organic thin film was composed of the weakly scattering pharmaceutical substance indomethacin in the amorphous state. The film was 130 µm thick atop a borosilicate glass substrate of equal thickness. The atomic pair distribution function derived from the thin-film measurement is in excellent agreement with that from bulk measurements. This ability to measure the total scattering of amorphous organic thin films in transmission will enable accurate in situ structural studies for a wide range of materials.

  2. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing

    2010-01-01

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  3. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)

    2010-04-15

    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  4. Can Social Support in the Guise of an Oral Health Education Intervention Promote Mother-Infant Bonding in Chinese Immigrant Mothers and Their Infants?

    Science.gov (United States)

    Yuan, Si-Yang; Freeman, Ruth

    2011-01-01

    Objective: To examine if social support in the guise of a culturally sensitive, community-based oral health intervention could promote mother-infant bonding in socially-isolated immigrant mothers. Design: A quasi-experimental design. Participants: A convenience sample of 36 Chinese immigrant mothers with 8-week-old infants was divided into…

  5. Mother-infant interaction during the first 3 months: the emergence of culture-specific contingency patterns.

    Science.gov (United States)

    Kärtner, Joscha; Keller, Heidi; Yovsi, Relindis D

    2010-01-01

    This study analyzed German and Nso mothers' auditory, proximal, and visual contingent responses to their infants' nondistress vocalizations in postnatal Weeks 4, 6, 8, 10, and 12. Visual contingency scores increased whereas proximal contingency scores decreased over time for the independent (German urban middle-class, N = 20) but not the interdependent sociocultural context (rural Nso farmers, N = 24). It seems, therefore, that culture-specific differences in the modal patterns of contingent responsiveness emerge during the 2nd and 3rd months of life. This differential development was interpreted as the result of the interplay between maturational processes associated with the 2-month shift that are selectively integrated and reinforced in culture-specific mother-infant interaction.

  6. The Origins of 12-Month Attachment: A Microanalysis of 4-Month Mother-Infant Interaction

    Science.gov (United States)

    Beebe, Beatrice; Jaffe, Joseph; Markese, Sara; Buck, Karen; Chen, Henian; Cohen, Patricia; Bahrick, Lorraine; Andrews, Howard; Feldstein, Stanley

    2013-01-01

    A detailed microanalysis of 4-month mother-infant face-to-face communication revealed a fine-grained specification of essential communication processes that predicted 12-month insecure attachment outcomes, particularly resistant and disorganized classifications. An urban community sample of 84 dyads were videotaped at 4 months during a face-to-face interaction, and at 12 months during the Ainsworth Strange Situation. Four-month mother and infant communication modalities of attention, affect, touch, and spatial orientation were coded from split-screen videotape on a 1s time base; mother and infant facial-visual “engagement” variables were constructed. We used contingency measures (multi-level time-series modeling) to examine the dyadic temporal process over time, and specific rates of qualitative features of behavior to examine the content of behavior. Self-contingency (auto-correlation) measured the degree of stability/lability within an individual’s own rhythms of behavior; interactive contingency (lagged cross-correlation) measured adjustments of the individual’s behavior that were correlated with the partner’s previous behavior. We documented that both self- and interactive contingency, as well as specific qualitative features, of mother and infant behavior were mechanisms of attachment formation by 4 months, distinguishing 12-month insecure, resistant, and disorganized attachment classifications from secure; avoidant were too few to test. All communication modalities made unique contributions. The separate analysis of different communication modalities identified intermodal discrepancies or conflict, both intrapersonal and interpersonal, that characterized insecure dyads. Contrary to dominant theories in the literature on face-to-face interaction, measures of maternal contingent coordination with infant yielded the fewest associations with 12-month attachment, whereas mother and infant self-contingency, and infant contingent coordination with mother

  7. Using grounded theory methodology to conceptualize the mother-infant communication dynamic: potential application to compliance with infant feeding recommendations.

    Science.gov (United States)

    Waller, Jennifer; Bower, Katherine M; Spence, Marsha; Kavanagh, Katherine F

    2015-10-01

    Excessive, rapid weight gain in early infancy has been linked to risk of later overweight and obesity. Inappropriate infant feeding practices associated with this rapid weight gain are currently of great interest. Understanding the origin of these practices may increase the effectiveness of interventions. Low-income populations in the Southeastern United States are at increased risk for development of inappropriate infant feeding practices, secondary to the relatively low rates of breastfeeding reported from this region. The objective was to use grounded theory methodology (GTM) to explore interactions between mothers and infants that may influence development of feeding practices, and to do so among low-income, primiparous, Southeastern United States mothers. Analysis of 15 in-depth phone interviews resulted in development of a theoretical model in which Mother-Infant Communication Dynamic emerged as the central concept. The central concept suggests a communication pattern developed over the first year of life, based on a positive feedback loop, which is harmonious and results in the maternal perception of mother and infant now speaking the same language. Importantly, though harmonious, this dynamic may result from inaccurate maternal interpretation of infant cues and behaviours, subsequently leading to inappropriate infant feeding practices. Future research should test this theoretical model using direct observation of mother-infant communication, to increase the understanding of maternal interpretation of infant cues. Subsequently, interventions targeting accurate maternal interpretation of and response to infant cues, and impact on rate of infant weight gain could be tested. If effective, health care providers could potentially use these concepts to attenuate excess rapid infant weight gain. © 2013 John Wiley & Sons Ltd.

  8. Effects of an early intervention on maternal post-traumatic stress symptoms and the quality of mother-infant interaction: the case of preterm birth.

    Science.gov (United States)

    Borghini, Ayala; Habersaat, Stephanie; Forcada-Guex, Margarita; Nessi, Jennifer; Pierrehumbert, Blaise; Ansermet, François; Müller-Nix, Carole

    2014-11-01

    Preterm birth may represent a traumatic situation for both parents and a stressful situation for the infant, potentially leading to difficulties in mother-infant relationships. This study aimed to investigate the impact of an early intervention on maternal posttraumatic stress symptoms, and on the quality of mother-infant interactions, in a sample of very preterm infants and their mothers. Half of the very preterm infants involved in the study (n=26) were randomly assigned to a 3-step early intervention program (at 33 and 42 weeks after conception and at 4 months' corrected age). Both groups of preterm infants (with and without intervention) were compared to a group of full-term infants. The impact of the intervention on maternal posttraumatic stress symptoms was assessed 42 weeks after conception and when the infants were 4 and 12 months of age. The impact of the intervention on the quality of mother-infant interactions was assessed when the infants were 4 months old. Results showed a lowering of mothers' posttraumatic stress symptoms between 42 weeks and 12 months in the group of preterm infants who received the intervention. Moreover, an enhancement in maternal sensitivity and infant cooperation during interactions was found at 4 months in the group with intervention. In the case of a preterm birth, an early intervention aimed at enhancing the quality of the mother-infant relationship can help to alleviate maternal post-traumatic stress symptoms and may have a positive impact on the quality of mother-infant interactions. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. The Effects of Maternal Social Phobia on Mother-Infant Interactions and Infant Social Responsiveness

    Science.gov (United States)

    Murray, Lynne; Cooper, Peter; Creswell, Cathy; Schofield, Elizabeth; Sack, Caroline

    2007-01-01

    Background: Social phobia aggregates in families. The genetic contribution to intergenerational transmission is modest, and parenting is considered important. Research on the effects of social phobia on parenting has been subject to problems of small sample size, heterogeneity of samples and lack of specificity of observational frameworks. We…

  10. The Impact of Socio-Demographic Variables, Social Support and Child Sex on Mother-Infant and Father-Infant Interaction

    OpenAIRE

    Cesar Augusto Piccinini; Jonathan Tudge; Angela Helena Marin; Giana Bitencourt Frizzo; Rita de Cássia Sobreira Lopes

    2010-01-01

    In this study we examine the impact of family socioeconomic status (SES), of social support as perceived by mothers, and of their three-month-olds child's sex, on mother-infant and father-infant interaction. A total of 58 mothers and 52 fathers were observed interacting with their infants. Univariate Analysis of Variance (ANOVA) revealed several significant differences, particularly regarding maternal behaviors. Mothers from the highest SES level both talked to and interpreted their infants' ...

  11. Mother-Infant Face-to-Face Interaction: The Communicative Value of Infant-Directed Talking and Singing.

    Science.gov (United States)

    Arias, Diana; Peña, Marcela

    Across culture, healthy infants show a high interest in infant-directed (ID) talking and singing. Despite ID talking and ID singing being very similar in physical properties, infants differentially respond to each of them. The mechanisms underpinning these different responses are still under discussion. This study explored the behavioral (n = 26) and brain (n = 14) responses from 6- to 8-month-old infants to ID talking and ID singing during a face-to-face mother-infant interaction with their own mother. Behavioral response was analyzed from offline video coding, and brain response was estimated from the analysis of electrophysiological recordings. We found that during ID talking, infants displayed a significantly higher number of visual contacts, vocalizations, and body movements than during ID singing. Moreover, only during ID talking were the number of visual contacts and vocalizations positively correlated with the number of questions and pauses in the mother's speech. Our results suggest that ID talking provides infants with specific cues that allow them not only to react to mother stimulation, but also to act toward them, displaying a rudimentary version of turn-taking behavior. Brain activity partially supported that interpretation. The relevance of our results for bonding is discussed. © 2016 S. Karger AG, Basel.

  12. Paid parental leave supports breastfeeding and mother-infant relationship: a prospective investigation of maternal postpartum employment.

    Science.gov (United States)

    Cooklin, Amanda R; Rowe, Heather J; Fisher, Jane R W

    2012-06-01

    To investigate the association between the mother-infant relationship, defined as maternal-infant emotional attachment, maternal separation anxiety and breastfeeding, and maternal employment status at 10 months following first childbirth. Samples of employed, pregnant women, over 18 years of age and with sufficient English literacy were recruited systematically from one public and one private maternity hospital in Victoria. Data were collected by structured interview and self-report questionnaire in the third trimester, and at 3 and 10 months postpartum. Socio-demographic, employment, and breastfeeding information was collected. Participants completed standardised assessments of maternal separation anxiety and mother-to-infant emotional attachment. Of 205 eligible women, 165 (81%) agreed to participate and 129 (78%) provided complete data. A reduced odds of employment participation was independently associated with continuing to breastfeed at 10 months (OR=0.22, p=0.004) and reporting higher maternal separation anxiety (OR=0.23, p=0.01) when maternal age, education, occupational status and use of paid maternity leave and occupational status were adjusted for in analyses. Employment participation in the first 10 months postpartum is associated with lower maternal separation anxiety, and shorter breastfeeding duration. Paid parental leave has public health implications for mothers and infants. These include permitting sufficient time to protect sustained breastfeeding, and the development of optimal maternal infant attachment, reflected in confidence about separation from her infant. © 2012 The Authors. ANZJPH © 2012 Public Health Association of Australia.

  13. Psychotherapy process and relationship in the context of a brief attachment-based mother-infant intervention.

    Science.gov (United States)

    Woodhouse, Susan S; Lauer, Maria; Beeney, Julie R S; Cassidy, Jude

    2015-03-01

    The present study investigated links between the observer-rated process of psychotherapy and 2 key psychotherapy relationship constructs (i.e., working alliance and attachment to the therapist) in the context of a brief, attachment-based, home-visiting, mother-infant intervention that aimed to promote later secure infant attachment. Additionally, links between observer ratings of intervener and mother contributions to process were examined. Participants included 85 economically stressed mothers of first-born, 5.5-month-old, temperamentally irritable infants. Therapists included 2 doctoral-level and 4 master's-level home visitors. Observer-rated therapist psychotherapy process variables (i.e., warmth, exploration, and negative attitude) were not linked to maternal ratings of working alliance. Therapist warmth, however, was positively associated with maternal ratings of security of attachment to the therapist, and therapist negative attitude was positively related to maternal ratings of preoccupied-merger attachment to the therapist. As expected, both therapist warmth and exploration were positively associated with both maternal participation and exploration. Therapist negative attitude was inversely related to maternal exploration, but not to maternal participation. Results support the idea that attention to the psychotherapy process and relationship may be important in the context of a brief home-visiting parenting intervention with a nonclinical sample. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

  14. Attachment representations among substance-abusing women in transition to motherhood: implications for prenatal emotions and mother-infant interaction.

    Science.gov (United States)

    Isosävi, Sanna; Flykt, Marjo; Belt, Ritva; Posa, Tiina; Kuittinen, Saija; Puura, Kaija; Punamäki, Raija-Leena

    2016-08-01

    We studied how attachment representations contribute to central components of transition to motherhood, prenatal emotion processing (EP) and emotional availability (EA) of mother-infant interaction, and whether there are group specific differences. Participants were 51 treatment-enrolled substance-abusing (SA) mothers and their infants and 50 non-using comparison dyads with obstetric risk. Mother's attachment representations (AAI) and EP were assessed prenatally and EA when infants were four months. Results showed that autonomous attachment only had a buffering effect on prenatal EP among comparisons. All SA mothers showed more dysfunctional EP than comparisons and, contrary to comparisons, autonomous SA mothers reported more negative cognitive appraisals and less meta-evaluation of emotions than dismissing SA mothers. Preoccupied SA mothers showed high negative cognitive appraisals, suggesting under-regulation of emotions. Attachment representations were not associated with EA in either group; rather, SA status contributed to global risk in the relationship. Surprisingly, autonomous SA mothers showed a tendency towards intrusiveness. We propose that obstetric risk among comparisons and adverse relational experiences among almost all SA mothers might override the protective role of mother's autonomous representations for dyadic interaction. We conclude that prenatal emotional turbulence and high interaction risk of all SA mothers calls for holistic treatment for the dyad.

  15. A WEB-BASED SURVEY OF MOTHER-INFANT BOND, ATTACHMENT EXPERIENCES, AND METACOGNITION IN POSTTRAUMATIC STRESS FOLLOWING CHILDBIRTH.

    Science.gov (United States)

    Williams, Charlotte; Patricia Taylor, Emily; Schwannauer, Matthias

    2016-05-01

    Postnatal depression is linked to adverse outcomes for parent and child, with metacognition and parenting experiences key variables in the development and maintenance of depression. The attachment between mother and infant is especially vulnerable to the effects of untreated postnatal depression. Despite high levels of reported postnatal stress symptoms, less attention has been given the relationship between attachment, metacognition, and postnatal traumatic symptoms in the context of birth trauma. This study tested several hypotheses regarding the relationships between recalled parenting experiences, metacognition, postnatal symptoms of posttraumatic stress disorder and depression and perceptions of the mother-infant bond, confirming and extending upon metacognitive and mentalization theories. A Web-based, cross-sectional, self-report questionnaire design was employed in an analog sample of new mothers. Participants were 502 women recruited via open-access Web sites associated with birth organizations. Structural equation modeling was employed for the principal analysis. Metacognition fully mediated the relationship between recalled parenting experiences and postnatal psychological outcomes. Posttraumatic stress was indirectly associated with maternal perceptions of the bond, with this relationship mediated by depression. Metacognition may have a key role in postnatal psychological distress. Where postnatal depression or traumatic birth experiences are identified, screening for posttraumatic stress is strongly indicated. © 2016 Michigan Association for Infant Mental Health.

  16. Maternal postpartum depression and infant social withdrawal among human immunodeficiency virus (HIV) positive mother-infant dyads.

    Science.gov (United States)

    Hartley, C; Pretorius, K; Mohamed, A; Laughton, B; Madhi, S; Cotton, M F; Steyn, B; Seedat, S

    2010-05-01

    Maternal postpartum depression poses significant risks for mother-child interaction and long-term infant outcomes. Human immunodeficiency virus (HIV) status has also been implicated in the development of postpartum depression, but the association between maternal depression and infant social behavior in the context of HIV infection has not been fully investigated. First, we examined the relationship between maternal postpartum depression and infant social withdrawal at 10-12 months of age in HIV-infected mothers and infants. Second, we ascertained whether infant social withdrawal could be significantly predicted by maternal postpartum depression. The sample consisted of 83 HIV-infected mother-infant dyads. Mothers were assessed for postpartum depression with the Edinburgh Postnatal Depression Scale (EPDS), and infant social withdrawal behavior was rated using the Modified Alarm Distress Baby Scale (m-ADBB). 42.2% of the mothers scored above the cut-off point for depression on the EPDS, and a third of infants (31%) were socially withdrawn. Notably, maternal depression did not predict infant social withdrawal as measured by the m-ADBB. Infant social withdrawal was also not significantly associated with failure to thrive or gender. These preliminary findings need further investigation with respect to the impact on long-term neurodevelopmental and behavioral outcomes.

  17. Parenting and mother-infant interactions in the context of maternal postpartum obsessive-compulsive disorder: Effects of obsessional symptoms and mood.

    Science.gov (United States)

    Challacombe, Fiona L; Salkovskis, Paul M; Woolgar, Matthew; Wilkinson, Esther L; Read, Julie; Acheson, Rachel

    2016-08-01

    Maternal mental illness is associated with negative effects on the infant and child. Increased attention has been paid to the effects of specific perinatal disorders on parenting and interactions as an important mechanism of influence. OCD can be a debilitating disorder for the sufferer and those around them. Although OCD is a common perinatal illness, no previous studies have characterized parenting and mother infant interactions in detail for mothers with OCD. 37 mothers with postpartum OCD and a 6 month old infant were compared with 37 community control dyads on a variety of measures of psychological distress and parenting. Observed mother-infant interactions were assessed independently. Obsessions and compulsions were reported in both groups, although they did not cause interference in the control group. Mothers with OCD were troubled by their symptoms for a mean of 9.6 hours/day. Mothers with OCD were less confident, reported more marital distress and less social support than healthy peers and were less likely to be breastfeeding. Infant temperament ratings did not differ. Mothers with OCD were rated as less sensitive in interactions than the comparison group, partly attributable to levels of concurrent depression. Maternal postpartum OCD is a disorder that can affect experiences of parenting and mother-infant interactions although this may not be driven by OCD symptoms. Longitudinal studies are required to assess the trajectory and impact of maternal difficulties as the infant develops. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Innate immune function in placenta and cord blood of hepatitis C--seropositive mother-infant dyads.

    Science.gov (United States)

    Hurtado, Christine Waasdorp; Golden-Mason, Lucy; Brocato, Megan; Krull, Mona; Narkewicz, Michael R; Rosen, Hugo R

    2010-08-30

    Vertical transmission accounts for the majority of pediatric cases of hepatitis C viral (HCV) infection. In contrast to the adult population who develop persistent viremia in approximately 80% of cases following exposure, the rate of mother-to-child transmission (2-6%) is strikingly low. Protection from vertical transmission likely requires the coordination of multiple components of the immune system. Placenta and decidua provide a direct connection between mother and infant. We hypothesized that innate immune responses would differ across the three compartments (decidua, placenta and cord blood) and that hepatitis C exposure would modify innate immunity in these tissues. The study was comprised of HCV-infected and healthy control mother and infant pairs from whom cord blood, placenta and decidua were collected with isolation of mononuclear cells. Multiparameter flow cytometry was performed to assess the phenotype, intracellular cytokine production and cytotoxicity of the cells. In keeping with a model where the maternal-fetal interface provides antiviral protection, we found a gradient in proportional frequencies of NKT and gammadelta-T cells being higher in placenta than cord blood. Cytotoxicity of NK and NKT cells was enhanced in placenta and placental NKT cytotoxicity was further increased by HCV infection. HCV exposure had multiple effects on innate cells including a decrease in activation markers (CD69, TRAIL and NKp44) on NK cells and a decrease in plasmacytoid dendritic cells in both placenta and cord blood of exposed infants. In summary, the placenta represents an active innate immunological organ that provides antiviral protection against HCV transmission in the majority of cases; the increased incidence in preterm labor previously described in HCV-seropositive mothers may be related to enhanced cytotoxicity of NKT cells.

  19. Neurobiology of mother-infant interactions: experience and central nervous system plasticity across development and generations.

    Science.gov (United States)

    Fleming, A S; O'Day, D H; Kraemer, G W

    1999-05-01

    The optimal coordination between the new mammalian mother and her young involves a sequence of behaviors on the part of each that ensures that the young will be adequately cared for and show healthy physical, emotional, and social development. This coordination is accomplished by each member of the relationship having the appropriate sensitivities and responses to cues that characterize the other. Among many mammalian species, new mothers are attracted to their infants' odors and some recognize them based on their odors; they also respond to their infants' vocalizations, thermal properties, and touch qualities. Together these cues ensure that the mother will nurse and protect the offspring and provide them with the appropriate physical and stimulus environment in which to develop. The young, in turn, orient to the mother and show a suckling pattern that reflects a sensitivity to the mothers odor, touch, and temperature characteristics. This article explores the sensory, endocrine, and neural mechanisms that underlie this early mother-young relationship, from the perspective of, first, the mother and, then, the young, noting the parallels between them. It emphasizes the importance of learning and plasticity in the formation and maintenance of the mother-young relationship and mediation of these experience effects by the brain and its neurochemistry. Finally, it discusses ways in which the infants' early experiences with their mothers (or the absence of these experiences) may come to influence how they respond to their own infants when they grow up, providing a psychobiological mechanism for the inter-generational transmission of parenting styles and responsiveness.

  20. A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

    Science.gov (United States)

    Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

    2012-12-01

    A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

  1. Maternally Administered Interventions for Preterm Infants in the NICU: Effects on Maternal Psychological Distress and Mother-Infant Relationship

    Science.gov (United States)

    Holditch-Davis, Diane; White-Traut, Rosemary C.; Levy, Janet A.; O’Shea, T. Michael; Geraldo, Victoria; David, Richard J.

    2014-01-01

    Although studies have examined the effects of interventions focused on preterm infants, few studies have examined the effects on maternal distress (anxiety, depressive symptoms, post-traumatic stress symptoms, parenting stress) or parenting. This study examined the effects of the auditory-tactile-visual-vestibular (ATVV) intervention and kangaroo care (KC) on maternal distress and the mother-infant relationship compared to an attention control group. 240 mothers from four hospitals were randomly assigned to the three groups. Maternal characteristics in the three groups were similar: 64.1% of ATVV mothers, 64.2% of KC mothers, and 76.5% of control mothers were African American; maternal age averaged 26.3 years for ATVV mothers, 28.1 for KC mothers, and 26.6 for control mothers; and years of education averaged 13.6 for ATVV and KC mothers, and 13.1 for control mothers. Mothers only differed on parity: 68.4% of ATVV and 54.7% of KC mothers were first-time mothers as compared to 43.6% of control mothers. Their infants had a similar mean gestational ages (27.0 weeks for ATVV, 27.2 for KC, and 27.4 for control) and mean birthweights (993 grams for ATVV, 1022 for KC, and 1023 for control). Mothers completed questionnaires during hospitalization, and at 2, 6 and 12 months corrected age on demographic characteristics, depressive symptoms, state anxiety, post-traumatic stress symptoms, parenting stress, worry about child health, and child vulnerability (only at 12 months). At 2 and 6 months, 45-minute videotapes of mother-infant interactions were made, and the HOME Inventory was scored. Behaviors coded from the videotapes and a HOME subscale were combined into five interactive dimensions: maternal positive involvement and developmental stimulation and child social behaviors, developmental maturity, and irritability. Intervention effects were examined using general linear mixed models controlling for parity and recruitment site. The groups did not differ on any maternal

  2. A cluster randomised controlled effectiveness trial evaluating perinatal home visiting among South African mothers/infants.

    Directory of Open Access Journals (Sweden)

    Mary Jane Rotheram-Borus

    Full Text Available Interventions are needed to reduce poor perinatal health. We trained community health workers (CHWs as home visitors to address maternal/infant risks.In a cluster randomised controlled trial in Cape Town townships, neighbourhoods were randomised within matched pairs to 1 the control, healthcare at clinics (n = 12 neighbourhoods; n = 594 women, or 2 a home visiting intervention by CBW trained in cognitive-behavioural strategies to address health risks (by the Philani Maternal, Child Health and Nutrition Programme, in addition to clinic care (n = 12 neighbourhoods; n = 644 women. Participants were assessed during pregnancy (2% refusal and 92% were reassessed at two weeks post-birth, 88% at six months and 84% at 18 months later. We analysed 32 measures of maternal/infant well-being over the 18 month follow-up period using longitudinal random effects regressions. A binomial test for correlated outcomes evaluated overall effectiveness over time. The 18 month post-birth assessment outcomes also were examined alone and as a function of the number of home visits received.Benefits were found on 7 of 32 measures of outcomes, resulting in significant overall benefits for the intervention compared to the control when using the binomial test (p = 0.008; nevertheless, no effects were observed when only the 18 month outcomes were analyzed. Benefits on individual outcomes were related to the number of home visits received. Among women living with HIV, intervention mothers were more likely to implement the PMTCT regimens, use condoms during all sexual episodes (OR = 1.25; p = 0.014, have infants with healthy weight-for-age measurements (OR = 1.42; p = 0.045, height-for-age measurements (OR = 1.13, p<0.001, breastfeed exclusively for six months (OR = 3.59; p<0.001, and breastfeed longer (OR = 3.08; p<0.001. Number of visits was positively associated with infant birth weight ≥2500 grams (OR = 1.07; p = 0

  3. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  4. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  5. Emotional reactions of mothers facing premature births: study of 100 mother-infant dyads 32 gestational weeks.

    Science.gov (United States)

    Eutrope, Julien; Thierry, Aurore; Lempp, Franziska; Aupetit, Laurence; Saad, Stéphanie; Dodane, Catherine; Bednarek, Nathalie; De Mare, Laurence; Sibertin-Blanc, Daniel; Nezelof, Sylvie; Rolland, Anne-Catherine

    2014-01-01

    This current study has been conducted to clarify the relationship between the mother's post-traumatic reaction triggered by premature birth and the mother-infant interactions. In this article, the precocious maternal feelings are described. A multicenter prospective study was performed in three French hospitals. 100 dyads with 100 very premature infants and their mothers were recruited. Mothers completed, at two different times self-questionnaires of depression/anxiety, trauma and social support. The quality of interactions in the dyads was evaluated. Thirty-nine percent of the mothers obtained a score at HADS suggesting a high risk of depression at the first visit and approximately one-third at visit two. Seventy-five percent of the mothers were at risk of suffering from an anxiety disorder at visit one and half remained so at visit two. A "depressed" score at visits one and two correlated with a hospitalization for a threatened premature labor. We noted a high risk of trauma for 35% of the mothers and high interactional synchrony was observed for approximately two-thirds of the dyads. The mothers' psychological reactions such as depression and anxiety or postnatal depression correlate strongly with the presence of an initial trauma. At visit one and visit two, a high score of satisfaction concerning social support correlates negatively with presence of a trauma. A maternal risk of trauma is more frequent with a C-section delivery. Mothers' psychological reactions such as depression and anxiety correlate greatly with the presence of an initial trauma. The maternal traumatic reaction linked to premature birth does not correlate with the term at birth, but rather with the weight of the baby. Social support perceived by the mother is correlated with the absence of maternal trauma before returning home, and also seems to inhibit from depressive symptoms from the time of the infant's premature birth.

  6. Emotional reactions of mothers facing premature births: study of 100 mother-infant dyads 32 gestational weeks.

    Directory of Open Access Journals (Sweden)

    Julien Eutrope

    Full Text Available OBJECTIVES: This current study has been conducted to clarify the relationship between the mother's post-traumatic reaction triggered by premature birth and the mother-infant interactions. In this article, the precocious maternal feelings are described. METHODS: A multicenter prospective study was performed in three French hospitals. 100 dyads with 100 very premature infants and their mothers were recruited. Mothers completed, at two different times self-questionnaires of depression/anxiety, trauma and social support. The quality of interactions in the dyads was evaluated. RESULTS: Thirty-nine percent of the mothers obtained a score at HADS suggesting a high risk of depression at the first visit and approximately one-third at visit two. Seventy-five percent of the mothers were at risk of suffering from an anxiety disorder at visit one and half remained so at visit two. A "depressed" score at visits one and two correlated with a hospitalization for a threatened premature labor. We noted a high risk of trauma for 35% of the mothers and high interactional synchrony was observed for approximately two-thirds of the dyads. The mothers' psychological reactions such as depression and anxiety or postnatal depression correlate strongly with the presence of an initial trauma. At visit one and visit two, a high score of satisfaction concerning social support correlates negatively with presence of a trauma. A maternal risk of trauma is more frequent with a C-section delivery. CONCLUSIONS: Mothers' psychological reactions such as depression and anxiety correlate greatly with the presence of an initial trauma. The maternal traumatic reaction linked to premature birth does not correlate with the term at birth, but rather with the weight of the baby. Social support perceived by the mother is correlated with the absence of maternal trauma before returning home, and also seems to inhibit from depressive symptoms from the time of the infant's premature birth.

  7. Reasons for mother-infant bed-sharing: a systematic narrative synthesis of the literature and implications for future research.

    Science.gov (United States)

    Ward, Trina C Salm

    2015-03-01

    Mother-infant bed-sharing has been a common practice for centuries. Understanding the reasons parents choose to bed-share can help tailor safe sleep education. The purpose of this article was to systematically review the international literature on: (1) reasons parents bed-share, (2) the cultural context of bed-sharing, and (3) implications for interventions and future research. The search occurred August-September 2013 via PubMed, CINAHL, and Psyc INFO using the terms: "infant," "sleep," "bed shar*," "co sleep*," "sleep location," "sleep practices," and "sleep arrangements," alone or in combination. Google Scholar was searched using: "bed share," "bed sharing," "co sleep," and "co sleeping." Inclusion criteria were: (1) referenced bed-sharing with infants 12 months or younger; (2) provided reasons for bed-sharing; and (3) published between 1990 and 2013. Studies were excluded if they focused on disorders such as epilepsy, breathing disorders, or among multi-gestational infants. Narrative synthesis was used to summarize findings. Thirty-four studies met inclusion criteria. The main themes around bed-sharing based on this synthesis included: (1) breastfeeding, (2) comforting, (3) better/more sleep, (4) monitoring, (5) bonding/attachment, (6) environmental, (7) crying, (8) tradition, (9) disagree with danger, and (10) maternal instinct. Findings suggest that future research should examine parents' decision-making process on infant sleep location, including how they weigh personal reasons and sources of advice. Public health interventions should incorporate the particular reasons of the population they are targeting. Clinicians should discuss infant sleep environment with each family, along with their motivations for choosing this environment, and work within that framework to address the safety of the sleep environment.

  8. A Norwegian prospective study of preterm mother-infant interactions at 6 and 18 months and the impact of maternal mental health problems, pregnancy and birth complications.

    Science.gov (United States)

    Misund, Aud R; Bråten, Stein; Nerdrum, Per; Pripp, Are Hugo; Diseth, Trond H

    2016-05-04

    Pregnancy, birth and health complications, maternal mental health problems following preterm birth and their possible impact on early mother-infant interaction at 6 and 18 months corrected age (CA) were explored. Predictors of mother-infant interaction at 18 months CA were identified. This prospective longitudinal and observational study included 33 preterm mother-infant (interactions at 6 and 18 months CA from a socioeconomic low-risk, middle-class sample. The Parent-Child Early Relational Assessment (PCERA) scale was used to assess the mother-infant interaction. 'Bleeding in pregnancy' predicted lower quality in preterm mother-infant interaction in 6 PCERA scales, while high 'maternal trait anxiety' predicted higher interactional quality in 2 PCERA scales and 'family size' predicted lower interactional quality in 1 PCERA scale at 18 months CA. Mothers with symptoms of post-traumatic stress reactions, general psychological distress and anxiety at 2 weeks postpartum (PP) showed significantly better outcome than mothers without symptoms in 6 PCERA subscales at 6 months CA and 2 PCERA subscales at 18 months CA. Our study detected a correspondence between early pregnancy complications and lower quality of preterm mother-infant interaction, and an association between high levels of maternal mental health problems and better quality in preterm mother-infant interaction. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  9. The effects of parental sensitivity and involvement in caregiving on mother-infant and father-infant attachment in a Portuguese sample.

    Science.gov (United States)

    Fuertes, Marina; Faria, Anabela; Beeghly, Marjorie; Lopes-dos-Santos, Pedro

    2016-02-01

    In the present longitudinal study, we investigated attachment quality in Portuguese mother-infant and in father-infant dyads, and evaluated whether attachment quality was related to parental sensitivity during parent-infant social interaction or to the amount of time each parent spent with the infant during play and in routine caregiving activities (e.g., feeding, bathing, play). The sample consisted of 82 healthy full-term infants (30 girls, 53 boys, 48 first born), and their mothers and fathers from mostly middle-class households. To assess parental sensitivity, mothers and fathers were independently observed during free play interactions with their infants when infants were 9 and 15 months old. The videotaped interactions were scored by masked coders using the Crittenden's CARE-Index. When infants were 12 and 18 months old, mother-infant and father-infant dyads were videotaped during an adaptation of Ainsworth's Strange Situation. Parents also described their level of involvement in infant caregiving activities using a Portuguese version of the McBride and Mills Parent Responsibility Scale. Mothers were rated as being more sensitive than fathers during parent-infant free play at both 9 and 15 months. There also was a higher prevalence of secure attachment in mother-infant versus father-infant dyads at both 12 and 18 months. Attachment security was predicted by the amount of time mothers and fathers were involved in caregiving and play with the infant, and with parents' behavior during parent-infant free play. (c) 2016 APA, all rights reserved).

  10. Mother-Infant and Extra-Dyadic Interactions with a New Social Partner: Developmental Trajectories of Early Social Abilities during Play.

    Science.gov (United States)

    Fadda, Roberta; Lucarelli, Loredana

    2017-01-01

    Mother-infant interactions during feeding and play are pivotal experiences in the development of infants' early social abilities (Stern, 1985, 1995; Biringen, 2000). Stern indicated distinctive characteristics of mother-infant interactions, respectively, during feeding and play, suggesting to evaluate both to better describe the complexity of such early affective and social experiences (Stern, 1996). Moreover, during the first years of life, infants acquire cognitive and social skills that allow them to interact with new social partners in extra-dyadic interactions. However, the relations between mother-child interactions and infants' social skills in extra-dyadic interactions are still unknown. We investigated longitudinally the relations between mother-child interactions during feeding and play and child's pre-verbal communicative abilities in extra-dyadic interactions during play. 20 dyads were evaluated at T 1 (infants aged between 9-22 months) and 6 months later, at T 2 . The interdyadic differences in mother-infant interactions during feeding and play were evaluated, respectively, with the "Feeding Scale" (Chatoor et al., 1997) and with the "Play Scale" (Chatoor, 2006) and the socio-communicative abilities of children with a new social partner during play were evaluated with the "Early Social Communication Scales" (Mundy et al., 2003). We distinguished the dyads into two categories: dyads with functional interactions (high dyadic reciprocity, low dyadic conflict) and dyads with dysfunctional interactions (lower dyadic reciprocity, higher dyadic conflict). At T 1 , infants belonging to dyads with dysfunctional interactions were significantly lower in "Initiating Joint Attention" and in "Responding to Joint Attention" in interaction with a new social partner compared to the infants belonging to dyads with functional interactions. At T 2 , infants belonging to dyads with dysfunctional interactions were significantly lower in "Initiating Social Interactions" with

  11. Effect of Early Intervention to Promote Mother - Infant Interaction and Maternal Sensitivity in Japan: A Parenting Support Program based on Infant Mental Health.

    Science.gov (United States)

    Komoto, Keiko; Hirose, Taiko; Omori, Takahide; Takeo, Naoko; Okamitsu, Motoko; Okubo, Noriko; Okawa, Hiroji

    2015-01-01

    This study investigated the effects of the Japanese Early Promotion Program (JEPP), which is based on the Infant Mental Health (IMH) program. The JEPP aims to promote mother-infant interactions by enhancing the mother's ability to respond appropriately her child. Mothers in the JEPP group (n = 15) received support from IMH nurses in a pediatric clinic until their infants reached 12 months of age. The nurses provided positive feedback that emphasized strength of parenting, and assisted the mothers in understanding the construct of their infants. Mother-infant interactions and mother's mental health status were assessed at intake (1-3 months), and at 6, 9, and 12 months of infants' age. The JEPP group data were compared with cross-sectional data of the control group (n = 120). Although JEPP dyads were not found to be significantly different from the control group in general dyadic synchrony, both before and after intervention, JEPP mothers significantly improved their ability to understand their infant's cues and to respond promptly. In the JEPP group, unresponsiveness to infants was reduced in mothers, while infants showed reduced passiveness and enhanced responsiveness to the mother. Furthermore, the intervention reduced the mothers' parenting stress and negative emotions, thereby enhancing their self-esteem.

  12. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  13. Characterization of a quadrant diamond transmission X-ray detector including a precise determination of the mean electron-hole pair creation energy.

    Science.gov (United States)

    Keister, Jeffrey W; Cibik, Levent; Schreiber, Swenja; Krumrey, Michael

    2018-03-01

    Precise monitoring of the incoming photon flux is crucial for many experiments using synchrotron radiation. For photon energies above a few keV, thin semiconductor photodiodes can be operated in transmission for this purpose. Diamond is a particularly attractive material as a result of its low absorption. The responsivity of a state-of-the art diamond quadrant transmission detector has been determined, with relative uncertainties below 1% by direct calibration against an electrical substitution radiometer. From these data and the measured transmittance, the thickness of the involved layers as well as the mean electron-hole pair creation energy were determined, the latter with an unprecedented relative uncertainty of 1%. The linearity and X-ray scattering properties of the device are also described.

  14. Polymorphisms in ATP-binding cassette transporters associated with maternal methylmercury disposition and infant neurodevelopment in mother-infant pairs in the Seychelles Child Development Study.

    Science.gov (United States)

    Engström, Karin; Love, Tanzy M; Watson, Gene E; Zareba, Grazyna; Yeates, Alison; Wahlberg, Karin; Alhamdow, Ayman; Thurston, Sally W; Mulhern, Maria; McSorley, Emeir M; Strain, J J; Davidson, Philip W; Shamlaye, Conrad F; Myers, G J; Rand, Matthew D; van Wijngaarden, Edwin; Broberg, Karin

    2016-09-01

    ATP-binding cassette (ABC) transporters have been associated with methylmercury (MeHg) toxicity in experimental animal models. To evaluate the association of single nucleotide polymorphisms (SNPs) in maternal ABC transporter genes with 1) maternal hair MeHg concentrations during pregnancy and 2) child neurodevelopmental outcomes. Nutrition Cohort 2 (NC2) is an observational mother-child cohort recruited in the Republic of Seychelles from 2008-2011. Total mercury (Hg) was measured in maternal hair growing during pregnancy as a biomarker for prenatal MeHg exposure (N=1313) (mean 3.9ppm). Infants completed developmental assessments by Bayley Scales of Infant Development II (BSID-II) at 20months of age (N=1331). Genotyping for fifteen SNPs in ABCC1, ABCC2 and ABCB1 was performed for the mothers. Seven of fifteen ABC SNPs (ABCC1 rs11075290, rs212093, and rs215088; ABCC2 rs717620; ABCB1 rs10276499, rs1202169, and rs2032582) were associated with concentrations of maternal hair Hg (pmothers with rs11075290 CC genotype (mean hair Hg 3.6ppm) scored on average 2 points lower on the Mental Development Index (MDI) and 3 points lower on the Psychomotor Development Index (PDI) than children born to mothers with TT genotype (mean hair Hg 4.7ppm) while children with the CT genotype (mean hair Hg 4.0ppm) had intermediate BSID scores. Genetic variation in ABC transporter genes was associated with maternal hair Hg concentrations. The implications for MeHg dose in the developing child and neurodevelopmental outcomes need to be further investigated. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. No perinatal HIV-1 transmission from women with effective antiretroviral therapy starting before conception.

    Science.gov (United States)

    Mandelbrot, Laurent; Tubiana, Roland; Le Chenadec, Jerome; Dollfus, Catherine; Faye, Albert; Pannier, Emmanuelle; Matheron, Sophie; Khuong, Marie-Aude; Garrait, Valerie; Reliquet, Veronique; Devidas, Alain; Berrebi, Alain; Allisy, Christine; Elleau, Christophe; Arvieux, Cedric; Rouzioux, Christine; Warszawski, Josiane; Blanche, Stéphane

    2015-12-01

    The efficacy of preventing perinatal transmission (PT) of human immunodeficiency virus type 1 (HIV-1) depends on both viral load (VL) and treatment duration. The objective of this study was to determine whether initiating highly active antiretroviral therapy (ART) before conception has the potential to eliminate PT. A total of 8075 HIV-infected mother/infant pairs included from 2000 to 2011 in the national prospective multicenter French Perinatal Cohort (ANRS-EPF) received ART, delivered live-born children with determined HIV infection status, and did not breastfeed. PT was analyzed according to maternal VL at delivery and timing of ART initiation. The overall rate of PT was 0.7% (56 of 8075). No transmission occurred among 2651 infants born to women who were receiving ART before conception, continued ART throughout the pregnancy, and delivered with a plasma VL women starting ART before conception to 0.4% (3 of 709), 0.9% (24 of 2810), and 2.2% (23 of 1051) for those starting during the first, second, or third trimester (P women with VLs of 50-400 copies/mL near delivery than for those with suppression of plasma VL. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Responses of free-ranging rhesus monkeys to a natural form of social separation. I. Parallels with mother-infant separation in captivity.

    Science.gov (United States)

    Berman, C M; Rasmussen, K L; Suomi, S J

    1994-08-01

    Observations of 23 free-ranging rhesus monkey infants on Cayo Santiago, Puerto Rico, indicated that mothers' first postpartum estrous periods were marked by large increases in the amount of time infants were separated from their mothers, by disturbances in mother-infant relationships, and by increases in infant distress behavior. When their mothers resumed mating, most infants showed signs of agitation; a few briefly showed indications of depression. Male infants responded to their mothers' resumption of mating by playing more, whereas females engaged in less play and more allogrooming. The results suggest (a) that basic parallels exist between the behavioral responses of rhesus infants to their mothers' resumption of mating in the field and to forcible separation from their mothers in captivity and (b) that early separation experiences may play a role in the normal development or manifestation of sex differences in behavior.

  17. Red palm oil in the maternal diet increases provitamin A carotenoids in breastmilk and serum of the mother-infant dyad.

    Science.gov (United States)

    Canfield, L M; Kaminsky, R G; Taren, D L; Shaw, E; Sander, J K

    2001-02-01

    Despite vitamin A supplementation programs, vitamin A deficiency in children remains a public health concern in Honduras. We investigated the effectiveness of short-term dietary supplementation of mothers with red palm oil as a strategy for improving the vitamin A status of the mother-infant dyad. Lactating mothers in Colonia Los Pinos, a barrio of Tegucigalpa, Honduras, consumed a total of 90-mg beta-carotene as red palm oil (n = 32) supplements (n = 36) or placebo (n = 18) in six equal doses over 10 days. Carotenoids and retinol in maternal and infant serum, and breastmilk carotenoids and retinol were measured before and after supplementation. Maternal diet was evaluated by 24-hour recall. Maternal serum alpha-carotene and beta-carotene concentrations were increased 2 fold by palm oil compared with 1.2 fold by beta-carotene supplements. Changes were significantly different in infant serum alpha-carotene but not beta-carotene among the three experimental groups. Increases in breastmilk beta-carotene were greater for the palm oil group (2.5 fold) than for the beta-carotene supplement group (1.6 fold) and increases in milk alpha-carotene concentrations (3.2 fold) were slightly greater than those of beta-carotene. There were also small but significant changes among groups in breastmilk lutein and lycopene. Breastmilk retinol was not significantly different among the groups over the treatment period. Red palm oil in the maternal diet increases provitamin A carotenoids in breastmilk and serum of the mother-infant dyad. The use of dietary red palm oil to improve the vitamin A status of this population should be further investigated.

  18. Mother-infant bonding impairment across the first 6 months postpartum: the primacy of psychopathology in women with childhood abuse and neglect histories.

    Science.gov (United States)

    Muzik, Maria; Bocknek, Erika London; Broderick, Amanda; Richardson, Patricia; Rosenblum, Katherine L; Thelen, Kelsie; Seng, Julia S

    2013-02-01

    Our goal was to examine the trajectory of bonding impairment across the first 6 months postpartum in the context of maternal risk, including maternal history of childhood abuse and neglect and postpartum psychopathology, and to test the association between self-reported bonding impairment and observed positive parenting behaviors. In a sample of women with childhood abuse and neglect histories (CA+, n = 97) and a healthy control comparison group (CA-, n = 53), participants completed questionnaires related to bonding with their infants at 6 weeks, 4 months, and 6 months postpartum and psychopathology at 6 months postpartum. In addition, during a 6-month postpartum home visit, mothers and infants participated in a dyadic play interaction subsequently coded for positive parenting behaviors by blinded coders. We found that all women, independent of risk status, increased in bonding with their infant over the first 6 months postpartum; however, women with postpartum psychopathology (depression and posttraumatic stress disorder [PTSD]) showed consistently greater bonding impairment scores at all timepoints. Moreover, we found that, at the 6-month assessment, bonding impairment and observed parenting behaviors were significantly associated. These results highlight the adverse effects of maternal postpartum depression and PTSD on mother-infant bonding in early postpartum in women with child abuse and neglect histories. These findings also shed light on the critical need for early detection and effective treatment of postpartum mental illness in order to prevent problematic parenting and the development of disturbed mother-infant relationships. Results support the use of the Postpartum Bonding Questionnaire as a tool to assess parenting quality by its demonstrated association with observed parenting behaviors.

  19. Combined evaluation of sexually transmitted infections in HIV-infected pregnant women and infant HIV transmission

    Science.gov (United States)

    Xu, Jiahong; Yeganeh, Nava; Camarca, Margaret; Morgado, Mariza G.; Watts, D. Heather; Mofenson, Lynne M.; Veloso, Valdilea G.; Pilotto, Jose Henrique; Joao, Esau; Gray, Glenda; Theron, Gerhard; Santos, Breno; Fonseca, Rosana; Kreitchmann, Regis; Pinto, Jorge; Mussi-Pinhata, Marisa M.; Ceriotto, Mariana; Machado, Daisy Maria; Bryson, Yvonne J.; Grinsztejn, Beatriz; Moye, Jack; Klausner, Jeffrey D.; Bristow, Claire C.; Dickover, Ruth; Mirochnick, Mark; Nielsen-Saines, Karin

    2018-01-01

    Background Sexually transmitted infections (STIs) including Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Treponema pallidum (TP), and cytomegalovirus (CMV) may lead to adverse pregnancy and infant outcomes. The role of combined maternal STIs in HIV mother-to-child transmission (MTCT) was evaluated in mother-infant pairs from NICHD HPTN 040. Methodology Urine samples from HIV-infected pregnant women during labor were tested by polymerase chain reaction (PCR) for CT, NG, and CMV. Infant HIV infection was determined by serial HIV DNA PCR testing. Maternal syphilis was tested by VDRL and confirmatory treponemal antibodies. Results A total of 899 mother-infant pairs were evaluated. Over 30% had at least one of the following infections (TP, CT, NG, and/or CMV) detected at the time of delivery. High rates of TP (8.7%), CT (17.8%), NG (4%), and CMV (6.3%) were observed. HIV MTCT was 9.1% (n = 82 infants). HIV MTCT was 12.5%, 10.3%, 11.1%, and 26.3% among infants born to women with CT, TP, NG or CMV respectively. Forty-two percent of HIV-infected infants were born to women with at least one of these 4 infections. Women with these infections were nearly twice as likely to have an HIV-infected infant (aOR 1.9, 95% CI 1.1–3.0), particularly those with 2 STIs (aOR 3.4, 95% CI 1.5–7.7). Individually, maternal CMV (aOR 4.4 1.5–13.0) and infant congenital CMV (OR 4.1, 95% CI 2.2–7.8) but not other STIs (TP, CT, or NG) were associated with an increased risk of HIV MTCT. Conclusion HIV-infected pregnant women identified during labor are at high risk for STIs. Co-infection with STIs including CMV nearly doubles HIV MTCT risk. CMV infection appears to confer the largest risk of HIV MTCT. Trial registration NCT00099359. PMID:29304083

  20. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning

    Energy Technology Data Exchange (ETDEWEB)

    Deymier, Martin J., E-mail: mdeymie@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Claiborne, Daniel T., E-mail: dclaibo@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Ende, Zachary, E-mail: zende@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Ratner, Hannah K., E-mail: hannah.ratner@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Kilembe, William, E-mail: wkilembe@rzhrg-mail.org [Zambia-Emory HIV Research Project (ZEHRP), B22/737 Mwembelelo, Emmasdale Post Net 412, P/BagE891, Lusaka (Zambia); Allen, Susan, E-mail: sallen5@emory.edu [Zambia-Emory HIV Research Project (ZEHRP), B22/737 Mwembelelo, Emmasdale Post Net 412, P/BagE891, Lusaka (Zambia); Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Hunter, Eric, E-mail: eric.hunter2@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States)

    2014-11-15

    The high genetic diversity of HIV-1 impedes high throughput, large-scale sequencing and full-length genome cloning by common restriction enzyme based methods. Applying novel methods that employ a high-fidelity polymerase for amplification and an unbiased fusion-based cloning strategy, we have generated several HIV-1 full-length genome infectious molecular clones from an epidemiologically linked transmission pair. These clones represent the transmitted/founder virus and phylogenetically diverse non-transmitted variants from the chronically infected individual's diverse quasispecies near the time of transmission. We demonstrate that, using this approach, PCR-induced mutations in full-length clones derived from their cognate single genome amplicons are rare. Furthermore, all eight non-transmitted genomes tested produced functional virus with a range of infectivities, belying the previous assumption that a majority of circulating viruses in chronic HIV-1 infection are defective. Thus, these methods provide important tools to update protocols in molecular biology that can be universally applied to the study of human viral pathogens. - Highlights: • Our novel methodology demonstrates accurate amplification and cloning of full-length HIV-1 genomes. • A majority of plasma derived HIV variants from a chronically infected individual are infectious. • The transmitted/founder was more infectious than the majority of the variants from the chronically infected donor.

  1. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning

    International Nuclear Information System (INIS)

    Deymier, Martin J.; Claiborne, Daniel T.; Ende, Zachary; Ratner, Hannah K.; Kilembe, William; Allen, Susan; Hunter, Eric

    2014-01-01

    The high genetic diversity of HIV-1 impedes high throughput, large-scale sequencing and full-length genome cloning by common restriction enzyme based methods. Applying novel methods that employ a high-fidelity polymerase for amplification and an unbiased fusion-based cloning strategy, we have generated several HIV-1 full-length genome infectious molecular clones from an epidemiologically linked transmission pair. These clones represent the transmitted/founder virus and phylogenetically diverse non-transmitted variants from the chronically infected individual's diverse quasispecies near the time of transmission. We demonstrate that, using this approach, PCR-induced mutations in full-length clones derived from their cognate single genome amplicons are rare. Furthermore, all eight non-transmitted genomes tested produced functional virus with a range of infectivities, belying the previous assumption that a majority of circulating viruses in chronic HIV-1 infection are defective. Thus, these methods provide important tools to update protocols in molecular biology that can be universally applied to the study of human viral pathogens. - Highlights: • Our novel methodology demonstrates accurate amplification and cloning of full-length HIV-1 genomes. • A majority of plasma derived HIV variants from a chronically infected individual are infectious. • The transmitted/founder was more infectious than the majority of the variants from the chronically infected donor

  2. Uptake and predictors of early postnatal follow-up care amongst mother-baby pairs in South Africa: Results from three population-based surveys, 2010-2013.

    Science.gov (United States)

    Larsen, Anna; Cheyip, Mireille; Aynalem, Getahun; Dinh, Thu-Ha; Jackson, Debra; Ngandu, Nobubelo; Chirinda, Witness; Mogashoa, Mary; Kindra, Gupreet; Lombard, Carl; Goga, Ameena

    2017-12-01

    Achieving World Health Organization (WHO) recommendations for postnatal care (PNC) within the first few weeks of life is vital to eliminating early mother-to-child transmission of HIV (MTCT) and improving infant health. Almost half of the annual global deaths among children under five occur during the first six weeks of life. This study aims to identify uptake of three PNC visits within the first six weeks of life as recommended by WHO among South African mother-infant pairs, and factors associated with uptake. We analyzed data from three facility-based, nationally representative surveys (2010, 2011/12 and 2012/13) primarily designed to determine the effectiveness of the South African program to prevent MTCT. This analysis describes the proportion of infants achieving the WHO recommendation of at least 3 PNC visits. Interviews from 27 699 HIV-negative and HIV-positive mothers of infants aged 4-8 weeks receiving their six week immunization were included in analysis. Data were analyzed using STATA 13.0 and weighted for sample ascertainment and South African live births. We fitted a multivariable logistic regression model to estimate factors associated with early PNC uptake. Over half (59.6%, 95% confidence interval (CI) = 59.0-60.3) of mother-infant pairs received the recommended three PNC visits during the first 6 weeks; uptake was 63.1% (95% CI = 61.9-64.3) amongst HIV exposed infants and 58.1% (95% CI = 57.3-58.9) amongst HIV unexposed infants. Uptake of early PNC improved significantly with each survey, but varied significantly by province. Multivariable analysis of the pooled data, controlling for survey year, demonstrated that number of antenatal visits (4+ vs 12 weeks, aOR = 1.13, 95% CI = 1.04-1.23), place of delivery (clinic vs hospital aOR = 1.5, 1.3-1.6), and infant HIV exposure (exposed vs unexposed aOR = 1.2, 95% CI = 1.1-1.2) were the key factors associated with receiving recommended PNC visits. Approximately 40% of

  3. Viral and immunological factors associated with breast milk transmission of SIV in rhesus macaques

    Directory of Open Access Journals (Sweden)

    Fresh Lynn

    2004-07-01

    Full Text Available Abstract Background The viral and host factors involved in transmission of HIV through breastfeeding are largely unknown, and intervention strategies are urgently needed to protect at-risk populations. To evaluate the viral and immunological factors directly related to milk transmission of virus, we have evaluated the disease course of Simian Immunodeficiency Virus (SIV in lactating rhesus macaques (Macaca mulatta as a model of natural breast milk transmission of HIV. Results Fourteen lactating macaques were infected intravenously with SIV/DeltaB670, a pathogenic isolate of SIV and were pair-housed with their suckling infants throughout the disease course. Transmission was observed in 10 mother-infant pairs over a one-year period. Two mothers transmitted virus during the period of initial viremia 14–21 days post inoculation (p.i. and were classified as early transmitters. Peak viral loads in milk and plasma of early transmitters were similar to other animals, however the early transmitters subsequently displayed a rapid progressor phenotype and failed to control virus expression as well as other animals at 56 days p.i. Eight mothers were classified as late transmitters, with infant infection detected at time points in the chronic stage of the maternal SIV disease course (81 to 360 days. Plasma viral loads, CD4+ T cell counts and SIV-specific antibody titers were similar in late transmitters and non-transmitters. Late breast milk transmission, however, was correlated with higher average milk viral loads and more persistent viral expression in milk 12 to 46 weeks p.i. as compared to non-transmitters. Four mothers failed to transmit virus, despite disease progression and continuous lactation. Conclusion These studies validate the SIV-infected rhesus macaque as a model for breast milk transmission of HIV. As observed in studies of HIV-infected women, transmission occurred at time points throughout the period of lactation. Transmission during the

  4. On the Origins of Disorganized Attachment and Internal Working Models: Paper II. An Empirical Microanalysis of 4-Month Mother-Infant Interaction

    Science.gov (United States)

    Beebe, Beatrice; Lachmann, Frank; Markese, Sara; Buck, Karen A.; Bahrick, Lorraine E.; Chen, Henian; Cohen, Patricia; Andrews, Howard; Feldstein, Stanley; Jaffe, Joseph

    2012-01-01

    A microanalysis of 4-month mother-infant face-to-face communication predicted 12-month infant disorganized (vs. secure) attachment outcomes in an urban community sample. We documented a dyadic systems view of the roles of both partners, the roles of both self- and interactive contingency, and the importance of attention, orientation and touch, and as well as facial and vocal affect, in the co-construction of attachment disorganization. The analysis of different communication modalities identified striking intrapersonal and interpersonal intermodal discordance or conflict, in the context of intensely distressed infants, as the central feature of future disorganized dyads at 4 months. Lowered maternal contingent coordination, and failures of maternal affective correspondence, constituted maternal emotional withdrawal from distressed infants. This maternal withdrawal compromises infant interactive agency and emotional coherence. We characterize of the nature of emerging internal working models of future disorganized infants as follows: Future disorganized infants represent states of not being sensed and known by their mothers, particularly in moments of distress; they represent confusion about both their own and their mothers’ basic emotional organization, and about their mothers’ response to their distress. This internal working model sets a trajectory in development which may disturb the fundamental integration of the person. The remarkable specificity of our findings has the potential to lead to more finely-focused clinical interventions. PMID:23066334

  5. Maternal singing of lullabies during pregnancy and after birth: Effects on mother-infant bonding and on newborns' behaviour. Concurrent Cohort Study.

    Science.gov (United States)

    Persico, Giuseppina; Antolini, Laura; Vergani, Patrizia; Costantini, Walter; Nardi, Maria Teresa; Bellotti, Lidia

    2017-08-01

    Mother-infant bonding is of great importance for the development and the well-being of the baby. The aim of this Concurrent Cohort Study was to investigate the effects of mothers singing lullabies on bonding, newborns' behaviour and maternal stress. Eighty-three (singing cohort) and 85 (concurrent cohort) women were recruited at antenatal classes at 24 weeks g.a. and followed up to 3 months after birth. The Prenatal Attachment Inventory (PAI) and the Mother-to-Infant Bonding Scale (MIBS) were used to assess maternal-foetal attachment and postnatal bonding. No significant influence was found on Prenatal Attachment; by contrast, Postnatal Bonding was significantly greater (i.e. lower MIBS) in the singing group 3 months after birth (mean 1.28 vs 1.96; p=0.001). In the same singing group, the incidence of neonatal crying episodes in the first month was significantly lower (18.5% vs 28.2; psinging group, even in the second month after birth (22.8% vs 36.5; p=0.002). At the same time, a reduction was observed in the neonatal nightly awakening (1.5% vs 4.7; psinging lullabies could improve maternal-infant bonding. It could also have positive effects on neonatal behaviour and maternal stress. Copyright © 2017 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  6. The outcome of prevention of mother to child transmission (PMTCT) of HIV infection programme in Nnewi, southeast Nigeria.

    Science.gov (United States)

    Ikechebelu, J I; Ugboaja, J O; Kalu, S O; Ugochukwu, E F

    2011-01-01

    A lot of challenges face the current efforts at reducing Mother to Child transmission of HIV infection (MTCT) in Sub Saharan Africa due to limited access to Highly active antiretroviral therapy (HAART) and breast feeding practices. A regular review of progress is necessary in order to identify areas of need. This is a one year prospective descriptive study of seven hundred and twenty six mother-infant pairs managed in the PMTCT programme in Nnamdi Azikiwe University Teaching Hospital, Nnewi Southeast Nigeria. The babies HIV status was tested with PCR for HIV DNA while the mothers provided information on infant feeding pattern and the use of antiretroviral (ARV) drugs including prophylaxis for the baby. Information was augmented from the antenatal records. The transmission rate was 2.8% for mothers, who were on HAART, did not breastfeed and whose babies received ARV prophylactic therapy. But for mothers who did not receive HAART, did breastfeed and whose babies did not received ARV prophylactic therapy, the transmission rate was 37.5%. When both the mother and child received ARV drugs, the transmission rate was significantly lower in those who did not breastfeed (2.8%) than in those who breastfed (12.5%)(P < 0.001). When both the mother and child did not receive ARV drugs, the transmission rate significantly lower in those who did not breastfeed (21.1%)than in those who breastfed (37.5%) (P < 0.02). The use of HAART in PMTCT programme in the under resourced areas can achieve similar success rates to that in the industrialized countries. Breastfeeding reduces the efficacy achieved by the use of ARV drugs. Provision of wider access to HAART as well as adequate counselling and support for safer infant feeding practices is recommended.

  7. Research on a Nonlinear Robust Adaptive Control Method of the Elbow Joint of a Seven-Function Hydraulic Manipulator Based on Double-Screw-Pair Transmission

    Directory of Open Access Journals (Sweden)

    Gaosheng Luo

    2014-01-01

    Full Text Available A robust adaptive control method with full-state feedback is proposed based on the fact that the elbow joint of a seven-function hydraulic manipulator with double-screw-pair transmission features the following control characteristics: a strongly nonlinear hydraulic system, parameter uncertainties susceptible to temperature and pressure changes of the external environment, and unknown outer disturbances. Combined with the design method of the back-stepping controller, the asymptotic stability of the control system in the presence of disturbances from uncertain systematic parameters and unknown external disturbances was demonstrated using Lyapunov stability theory. Based on the elbow joint of the seven-function master-slave hydraulic manipulator for the 4500 m Deep-Sea Working System as the research subject, a comparative study was conducted using the control method presented in this paper for unknown external disturbances. Simulations and experiments of different unknown outer disturbances showed that (1 the proposed controller could robustly track the desired reference trajectory with satisfactory dynamic performance and steady accuracy and that (2 the modified parameter adaptive laws could also guarantee that the estimated parameters are bounded.

  8. Evaluating the Impact of Zimbabwe's Prevention of Mother-to-Child HIV Transmission Program: Population-Level Estimates of HIV-Free Infant Survival Pre-Option A.

    Science.gov (United States)

    Buzdugan, Raluca; McCoy, Sandra I; Watadzaushe, Constancia; Kang Dufour, Mi-Suk; Petersen, Maya; Dirawo, Jeffrey; Mushavi, Angela; Mujuru, Hilda Angela; Mahomva, Agnes; Musarandega, Reuben; Hakobyan, Anna; Mugurungi, Owen; Cowan, Frances M; Padian, Nancy S

    2015-01-01

    We estimated HIV-free infant survival and mother-to-child HIV transmission (MTCT) rates in Zimbabwe, some of the first community-based estimates from a UNAIDS priority country. In 2012 we surveyed mother-infant pairs residing in the catchment areas of 157 health facilities randomly selected from 5 of 10 provinces in Zimbabwe. Enrolled infants were born 9-18 months before the survey. We collected questionnaires, blood samples for HIV testing, and verbal autopsies for deceased mothers/infants. Estimates were assessed among i) all HIV-exposed infants, as part of an impact evaluation of Option A of the 2010 WHO guidelines (rolled out in Zimbabwe in 2011), and ii) the subgroup of infants unexposed to Option A. We compared province-level MTCT rates measured among women in the community with MTCT rates measured using program monitoring data from facilities serving those communities. Among 8568 women with known HIV serostatus, 1107 (12.9%) were HIV-infected. Among all HIV-exposed infants, HIV-free infant survival was 90.9% (95% confidence interval (CI): 88.7-92.7) and MTCT was 8.8% (95% CI: 6.9-11.1). Sixty-six percent of HIV-exposed infants were still breastfeeding. Among the 762 infants born before Option A was implemented, 90.5% (95% CI: 88.1-92.5) were alive and HIV-uninfected at 9-18 months of age, and 9.1% (95%CI: 7.1-11.7) were HIV-infected. In four provinces, the community-based MTCT rate was higher than the facility-based MTCT rate. In Harare, the community and facility-based rates were 6.0% and 9.1%, respectively. By 2012 Zimbabwe had made substantial progress towards the elimination of MTCT. Our HIV-free infant survival and MTCT estimates capture HIV transmissions during pregnancy, delivery and breastfeeding regardless of whether or not mothers accessed health services. These estimates also provide a baseline against which to measure the impact of Option A guidelines (and subsequently Option B+).

  9. Influential Factors of Mother-Infant Skin-to-Skin Contact Based on the Precede-Proceed Model from the Perspective of Midwives in Torbat Heydariyeh Hospitals

    Directory of Open Access Journals (Sweden)

    Mohadeseh Adeli

    2016-07-01

    Full Text Available Background & aim: Skin-to-skin contact immediately after birth plays a pivotal role in proper breastfeeding and mother-infant interaction. Despite numerous benefits of mother-infant skin-to-skin contact, this health behavior is not performed by many midwives. This study aimed to evaluate the influential factors for mother-infant skin-to-skin contact based on the Precede-Proceed model from the perspective of midwives in Torbat Heydariyeh hospitals. Methods:This cross-sectional study was conducted on 50 midwives working in hospitals of Torbat Heydariyeh, Iran in 2015. Demographic data of all participants were collected, and Mother-Newborn Skin-to-Skin Contact Questionnaire was also used based on the Precede-Proceed model. Data analysis was performed in SPSS V.16 using descriptive statistics, tables and graphs. Results: In this study, 88.1% of the midwives had positive attitudes towards skin-to-skin contact, and 90.5% had high perceived self-efficacy in performing the procedure. Major obstacles against establishing proper skin-to-skin contact were neonatal diseases and maternal fatigue (83.3% from the perspective of midwives. Moreover, 87.5% and 90.5% of the midwives emphasized the pivotal role of social support and motivation, respectively in implementing skin-to-skin contact. Also, more than 90% of the midwives considered training programs, service access and adequate facilities to be influential in the proper establishment of skin-to-skin contact. Conclusion: According to the results of this study, the majority of midwives believed that enabling and reinforcing factors had significant effects on the proper establishment of mother-infant skin-to-skin contact. Therefore, it is recommended thateducational interventions be planned for parents, their family members and health care personnel involved in processes of childbirth and infant care. Furthermore, organizational planning and executive procedures should be developed to study the

  10. Care of the mother-infant dyad: a novel approach to conducting and evaluating neonatal resuscitation simulation training in Bihar, India.

    Science.gov (United States)

    Vail, Brennan; Spindler, Hilary; Morgan, Melissa C; Cohen, Susanna R; Christmas, Amelia; Sah, Pramod; Shah, Malay B; Das, Aritra; Walker, Dilys M

    2017-07-28

    demands for higher-level triage and management. Although further evaluation of the PRONTO methodology is necessary to understand the full scope of its impact, this analysis highlights the importance of conducting and evaluating simulation training in low-resource settings based on simultaneous care of the mother-infant dyad.

  11. DHA supplementation during pregnancy does not reduce BMI or body fat mass in children: follow-up of the DHA to Optimize Mother Infant Outcome randomized controlled trial.

    Science.gov (United States)

    Muhlhausler, Beverly S; Yelland, Lisa N; McDermott, Robyn; Tapsell, Linda; McPhee, Andrew; Gibson, Robert A; Makrides, Maria

    2016-06-01

    The omega-3 (n-3) long-chain polyunsaturated fatty acid (LCPUFA) docosahexaenoic acid (DHA) has proven effective at reducing fat storage in animal studies. However, a systematic review of human trials showed a lack of quality data to support or refute this hypothesis. We sought to determine whether maternal DHA supplementation during the second half of pregnancy results in a lower body mass index (BMI) and percentage of body fat in children. We conducted a follow-up at 3 and 5 y of age of children who were born to mothers enrolled in the DOMInO (DHA to Optimize Mother Infant Outcome) double-blind, randomized controlled trial, in which women with a singleton pregnancy were provided with DHA-rich fish-oil capsules (800 mg DHA/d) or vegetable-oil capsules (control group) in the second half of pregnancy. Primary outcomes were the BMI z score and percentage of body fat at 3 and 5 y of age. Potential interactions between prenatal DHA and the peroxisome proliferator-activated receptor-γ (PPARγ) genotype as a measure of the genetic predisposition to obesity were investigated. A total of 1614 children were eligible for the follow-up. Parent or caregiver consent was obtained for 1531 children (95%), and these children were included in the analysis. BMI z scores and percentages of body fat of children in the DHA group did not differ from those of children in the control group at either 3 y of age [BMI z score adjusted mean difference: 0.03 (95% CI: -0.07, 0.13; P = 0.61); percentage of body fat adjusted mean difference: -0.26 (95% CI: -0.99, 0.46; P = 0.47)] or 5 y of age [BMI z score adjusted mean difference: 0.02 (95% CI: -0.08, 0.12; P = 0.66); percentage of body fat adjusted mean difference: 0.11 (95% CI: -0.60, 0.82; P = 0.75)]. No treatment effects were modified by the PPARγ genotype of the child. Independent of a genetic predisposition to obesity, maternal intake of DHA-rich fish oil during the second half of pregnancy does not affect the growth or body composition

  12. Mother-infant interaction assessment at discharge and at 6 months in a French cohort of infants born very preterm: The OLIMPE study.

    Directory of Open Access Journals (Sweden)

    Gilles Cambonie

    Full Text Available The principal aim was to investigate the feasibility of assessing mother-infant interactions at discharge and at 6 months infant corrected age in singletons born before 32 weeks of gestation. The secondary aims were to describe these interactions and their disorders, explore the association between maternal emotional state and the interactions, and assess the relationship between disordered interactions and infant social withdrawal behaviour.OLIMPE is an ancillary study of the population-based study EPIPAGE 2, which recruited preterm neonates in France in 2011. 163 dyads participated at discharge and 148 at 6 months. Interactions were observed with the Attachment During Stress (ADS scale, which includes two behavioural subscales, for the mother (m-ADS and her infant (i-ADS. Two professionals independently completed the ADS scales for one third of the observations. Maternal emotional state was assessed using self-administered questionnaires of depression, anxiety, and stress. Infant's social withdrawal behaviour at 6 months was measured by the Alarm Distress Baby scale.At discharge, 15.3% of the m-ADS scales and 43.3% of the i-ADS scales had at least one unobserved component. At 6 months, all items on both scales were noticeable in >90% of the dyads. Reliability, estimated by the kappa coefficient, ranged between 0.39 and 0.76 at discharge, and between 0.21 and 0.69 at 6 months. Disordered interactions were indicated on 48.6% of the m-ADS scales and 36.5% of the i-ADS scales at discharge. At 6 months, these rates were 32.6% and 26.0%. Disordered interactions at 6 months were associated with identified disorder at discharge. Insecure infant attachment was not influenced by maternal mental health but was strongly associated with infant social withdrawal behaviour.The ADS scale can be used to screen for early interaction disorders after premature birth and may help to target dyads that would most benefit from early intervention.

  13. The effect of an interactive weekly mobile phone messaging on retention in prevention of mother to child transmission (PMTCT) of HIV program: study protocol for a randomized controlled trial (WELTEL PMTCT).

    Science.gov (United States)

    Awiti, Patricia Opondo; Grotta, Alessandra; van der Kop, Mia; Dusabe, John; Thorson, Anna; Mwangi, Jonathan; Belloco, Rino; Lester, Richard; Ternent, Laura; Were, Edwin; Ekström, Anna Mia

    2016-07-11

    Improving retention in prevention of mother to child transmission (PMTCT) of HIV programs is critical to optimize maternal and infant health outcomes, especially now that lifelong treatment is immediate regardless of CD4 cell count). The WelTel strategy of using weekly short message service (SMS) to engage patients in care in Kenya, where mobile coverage even in poor areas is widespread has been shown to improve adherence to antiretroviral therapy (ART) and viral load suppression among those on ART. The aim of this study is to determine the effect of the WelTel SMS intervention compared to standard care on retention in PMTCT program in Kenya. WelTel PMTCT is a four to seven-centers, two-arm open randomized controlled trial (RCT) that will be conducted in urban and rural Kenya. Over 36 months, we plan to recruit 600 pregnant women at their first antenatal care visit and follow the mother-infant pair until they are discharged from the PMTCT program (when infant is aged 24 months). Participants will be randomly allocated to the intervention or control arm (standard care) at a 1:1 ratio. Intervention arm participants will receive an interactive weekly SMS 'How are you?' to which they are supposed to respond within 24 h. Depending on the response (ok, problem or no answer), a PMTCT nurse will follow-up and triage any problems that are identified. The primary outcome will be retention in care defined as the proportion of mother-infant pairs coming for infant HIV testing at 24 months from delivery. Secondary outcomes include a) adherence to WelTel; (b) adherence to antiretroviral medicine; (c) acceptance of WelTel and (d) cost-effectiveness of the WelTel intervention. This trial will provide evidence on the effectiveness of mHealth for PMTCT retention. Trial results and the cost-effectiveness evaluation will be used to inform policy and potential scale-up of mHealth among mothers living with HIV. ISRCTN98818734 ; registered on 9th December 2014.

  14. Impact of Maternal HIV Seroconversion during Pregnancy on Early Mother to Child Transmission of HIV (MTCT Measured at 4-8 Weeks Postpartum in South Africa 2011-2012: A National Population-Based Evaluation.

    Directory of Open Access Journals (Sweden)

    Thu-Ha Dinh

    Full Text Available Mother-to-child transmission of HIV (MTCT depends on the timing of HIV infection. We estimated HIV-seroconversion during pregnancy (HSP after having a HIV-negative result antenatally, and its contribution to early MTCT in South Africa (SA.Between August 2011 and March 2012, we recruited a nationally representative sample of mother-infant pairs with infants aged 4-to-8 weeks from 578 health facilities. Data collection included mother interviews, child health-card reviews, and infant dried-blood-spots sample (iDBS. iDBS were tested for HIV antibodies and HIV-deoxyribonucleic-acid (HIV-DNA. HSP was defined as maternal self-report of an HIV-negative test during this pregnancy, no documented use of antiretroviral drugs and a matched HIV sero-positive iDBS. We used 20 imputations from a uniform distribution for time from reported antenatal HIV-negative result to delivery to estimate time of HSP. Early MTCT was defined based on detection of HIV-DNA in iDBS. Estimates were adjusted for clustering, nonresponse, and weighted by SA's 2011 live-births.Of 9802 mother-infant pairs, 2738 iDBS were HIV sero-positive, including 212 HSP, resulting in a nationally weighted estimate of 3.3% HSP (95% Confidence Interval: 2.8%-3.8%. Median time of HIV-seroconversion was 32.8weeks gestation;28.3% (19.7%- 36.9% estimated to be >36 weeks. Early MTCT was 10.7% for HSP (6.2%-16.8% vs. 2.2% (1.7%-2.8% for mothers with known HIV-positive status. Although they represent 2.2% of all mothers and 6.7% of HIV-infected mothers, HSP accounted for 26% of early MTCT. Multivariable analysis indicated the highest risk for HSP was among women who knew the baby's father was HIV-infected (adjusted-hazard ratio (aHR 4.71; 1.49-14.99, or who had been screened for tuberculosis (aHR 1.82; 1.43-2.32.HSP risk is high and contributes significantly to early MTCT. Identification of HSP by repeat-testing at 32 weeks gestation, during labor, 6 weeks postpartum, in tuberculosis-exposed women, and in

  15. Impact of Maternal HIV Seroconversion during Pregnancy on Early Mother to Child Transmission of HIV (MTCT) Measured at 4-8 Weeks Postpartum in South Africa 2011-2012: A National Population-Based Evaluation

    Science.gov (United States)

    Dinh, Thu-Ha; Delaney, Kevin P.; Goga, Ameena; Jackson, Debra; Lombard, Carl; Woldesenbet, Selamawit; Mogashoa, Mary; Pillay, Yogan; Shaffer, Nathan

    2015-01-01

    Background Mother-to-child transmission of HIV (MTCT) depends on the timing of HIV infection. We estimated HIV-seroconversion during pregnancy (HSP) after having a HIV-negative result antenatally, and its contribution to early MTCT in South Africa (SA). Methods and Findings Between August 2011 and March 2012, we recruited a nationally representative sample of mother-infant pairs with infants aged 4-to-8 weeks from 578 health facilities. Data collection included mother interviews, child health-card reviews, and infant dried-blood-spots sample (iDBS). iDBS were tested for HIV antibodies and HIV-deoxyribonucleic-acid (HIV-DNA). HSP was defined as maternal self-report of an HIV-negative test during this pregnancy, no documented use of antiretroviral drugs and a matched HIV sero-positive iDBS. We used 20 imputations from a uniform distribution for time from reported antenatal HIV-negative result to delivery to estimate time of HSP. Early MTCT was defined based on detection of HIV-DNA in iDBS. Estimates were adjusted for clustering, nonresponse, and weighted by SA’s 2011 live-births. Results Of 9802 mother-infant pairs, 2738 iDBS were HIV sero-positive, including 212 HSP, resulting in a nationally weighted estimate of 3.3% HSP (95% Confidence Interval: 2.8%-3.8%). Median time of HIV-seroconversion was 32.8weeks gestation;28.3% (19.7%- 36.9%) estimated to be >36 weeks. Early MTCT was 10.7% for HSP (6.2%-16.8%) vs. 2.2% (1.7%-2.8%) for mothers with known HIV-positive status. Although they represent 2.2% of all mothers and 6.7% of HIV-infected mothers, HSP accounted for 26% of early MTCT. Multivariable analysis indicated the highest risk for HSP was among women who knew the baby’s father was HIV-infected (adjusted-hazard ratio (aHR) 4.71; 1.49-14.99), or who had been screened for tuberculosis (aHR 1.82; 1.43-2.32). Conclusions HSP risk is high and contributes significantly to early MTCT. Identification of HSP by repeat-testing at 32 weeks gestation, during labor, 6

  16. Evaluating the Impact of Zimbabwe’s Prevention of Mother-to-Child HIV Transmission Program: Population-Level Estimates of HIV-Free Infant Survival Pre-Option A

    Science.gov (United States)

    Buzdugan, Raluca; McCoy, Sandra I.; Watadzaushe, Constancia; Kang Dufour, Mi-Suk; Petersen, Maya; Dirawo, Jeffrey; Mushavi, Angela; Mujuru, Hilda Angela; Mahomva, Agnes; Musarandega, Reuben; Hakobyan, Anna; Mugurungi, Owen; Cowan, Frances M.; Padian, Nancy S.

    2015-01-01

    Objective We estimated HIV-free infant survival and mother-to-child HIV transmission (MTCT) rates in Zimbabwe, some of the first community-based estimates from a UNAIDS priority country. Methods In 2012 we surveyed mother-infant pairs residing in the catchment areas of 157 health facilities randomly selected from 5 of 10 provinces in Zimbabwe. Enrolled infants were born 9–18 months before the survey. We collected questionnaires, blood samples for HIV testing, and verbal autopsies for deceased mothers/infants. Estimates were assessed among i) all HIV-exposed infants, as part of an impact evaluation of Option A of the 2010 WHO guidelines (rolled out in Zimbabwe in 2011), and ii) the subgroup of infants unexposed to Option A. We compared province-level MTCT rates measured among women in the community with MTCT rates measured using program monitoring data from facilities serving those communities. Findings Among 8568 women with known HIV serostatus, 1107 (12.9%) were HIV-infected. Among all HIV-exposed infants, HIV-free infant survival was 90.9% (95% confidence interval (CI): 88.7–92.7) and MTCT was 8.8% (95% CI: 6.9–11.1). Sixty-six percent of HIV-exposed infants were still breastfeeding. Among the 762 infants born before Option A was implemented, 90.5% (95% CI: 88.1–92.5) were alive and HIV-uninfected at 9–18 months of age, and 9.1% (95%CI: 7.1–11.7) were HIV-infected. In four provinces, the community-based MTCT rate was higher than the facility-based MTCT rate. In Harare, the community and facility-based rates were 6.0% and 9.1%, respectively. Conclusion By 2012 Zimbabwe had made substantial progress towards the elimination of MTCT. Our HIV-free infant survival and MTCT estimates capture HIV transmissions during pregnancy, delivery and breastfeeding regardless of whether or not mothers accessed health services. These estimates also provide a baseline against which to measure the impact of Option A guidelines (and subsequently Option B+). PMID:26248197

  17. A pilot randomized controlled trial of time-intensive cognitive-behaviour therapy for postpartum obsessive-compulsive disorder: effects on maternal symptoms, mother-infant interactions and attachment.

    Science.gov (United States)

    Challacombe, F L; Salkovskis, P M; Woolgar, M; Wilkinson, E L; Read, J; Acheson, R

    2017-06-01

    There is increasing recognition that perinatal anxiety disorders are both common and potentially serious for mother and child. Obsessive-compulsive disorder (OCD) can be triggered or exacerbated in the postpartum period, with mothers reporting significant effects on parenting tasks. However, there is little evidence concerning their effective treatment or the impact of successful treatment on parenting. A total of 34 mothers with OCD and a baby of 6 months old were randomized into either time-intensive cognitive-behaviour therapy (iCBT) or treatment as usual (TAU). iCBT took place after randomization at 6 months postpartum and was completed by 9 months. Maternal symptomatology, sensitivity in mother-infant interactions and parenting were assessed at baseline and reassessed at 12 months postpartum. At 12 months attachment was also assessed using Ainsworth's Strange Situation Procedure. A healthy control group of mothers and infants (n = 37) underwent the same assessments as a benchmark. iCBT was successful in ameliorating maternal symptoms of OCD (controlled effect size = 1.31-1.90). However, mother-infant interactions were unchanged by treatment and remained less sensitive in both OCD groups than a healthy control group. The distribution of attachment categories was similar across both clinical groups and healthy controls with approximately 72% classified as secure in each group. iCBT is an effective intervention for postpartum OCD. Sensitive parenting interactions are affected by the presence of postpartum OCD and this is not improved by successful treatment of OCD symptoms. However, the overall attachment bond appears to be unaffected. Longitudinal studies are needed to explore the impact of postpartum OCD as the child develops.

  18. Does a triplet birth pose a special risk for infant development? Assessing cognitive development in relation to intrauterine growth and mother-infant interaction across the first 2 years.

    Science.gov (United States)

    Feldman, Ruth; Eidelman, Arthur I

    2005-02-01

    To examine whether a triplet birth per se poses a risk to the development of infants' cognitive competencies and to the mother-infant relationship. Twenty-three sets of triplets were matched with 23 sets of twins and 23 singleton infants (n = 138) with respect to gestational age, birth weight, and medical and demographic features. Infants with perinatal asphyxia, intraventricular hemorrhage of grade 3 or 4, periventricular leukomalacia, or central nervous system infection were excluded from the study. At 6, 12, and 24 months of age, mother-infant interaction was observed and infants' cognitive development was tested with the Bayley II test. Mothers of triplets displayed lower levels of sensitivity at 6, 12, and 24 months and infants were less socially involved at 6 and 24 months, compared with singletons and twins. Triplets scored lower than singletons and twins on the Bayley Mental Developmental Index at 6, 12, and 24 months. A weight discordance of >15% was found for 15 triplet sets (65.2%). The discordant triplets showed decreased cognitive skills at 12 and 24 months, compared with their siblings, and received the lowest scores for maternal sensitivity. Hierarchical multivariate regression analysis revealed that greater medical risk at birth, multiple-birth status, lower maternal sensitivity, and reduced infant social involvement in the first 2 years were each predictive of lower cognitive outcomes at 2 years (R2 = 0.33). Triplets appear to be at higher risk for cognitive delays in the first 2 years of life, and discordant infants are at especially high risk. This delay is related in part to the difficulty of providing sensitive mothering to 3 infants at the same time. The findings may assist practitioners in guiding prenatal and postpartum parental care and management.

  19. Single-Genome Sequencing of Hepatitis C Virus in Donor-Recipient Pairs Distinguishes Modes and Models of Virus Transmission and Early Diversification.

    Science.gov (United States)

    Li, Hui; Stoddard, Mark B; Wang, Shuyi; Giorgi, Elena E; Blair, Lily M; Learn, Gerald H; Hahn, Beatrice H; Alter, Harvey J; Busch, Michael P; Fierer, Daniel S; Ribeiro, Ruy M; Perelson, Alan S; Bhattacharya, Tanmoy; Shaw, George M

    2016-01-01

    Despite the recent development of highly effective anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and development of an effective vaccine. A precise molecular identification of transmitted/founder (T/F) HCV genomes that lead to productive clinical infection could play a critical role in vaccine research, as it has for HIV-1. However, the replication schema of these two RNA viruses differ substantially, as do viral responses to innate and adaptive host defenses. These differences raise questions as to the certainty of T/F HCV genome inferences, particularly in cases where multiple closely related sequence lineages have been observed. To clarify these issues and distinguish between competing models of early HCV diversification, we examined seven cases of acute HCV infection in humans and chimpanzees, including three examples of virus transmission between linked donors and recipients. Using single-genome sequencing (SGS) of plasma vRNA, we found that inferred T/F sequences in recipients were identical to viral sequences in their respective donors. Early in infection, HCV genomes generally evolved according to a simple model of random evolution where the coalescent corresponded to the T/F sequence. Closely related sequence lineages could be explained by high multiplicity infection from a donor whose viral sequences had undergone a pretransmission bottleneck due to treatment, immune selection, or recent infection. These findings validate SGS, together with mathematical modeling and phylogenetic analysis, as a novel strategy to infer T/F HCV genome sequences. Despite the recent development of highly effective, interferon-sparing anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and the development of an effective

  20. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  1. Study protocol: An investigation of mother-infant signalling during breastfeeding using a randomised trial to test the effectiveness of breastfeeding relaxation therapy on maternal psychological state, breast milk production and infant behaviour and growth.

    Science.gov (United States)

    Shukri, N H M; Wells, J; Mukhtar, F; Lee, M H S; Fewtrell, M

    2017-01-01

    The physiological and psychological signalling between mother and infant during lactation is one of the prominent mother-infant factors that may influence breastfeeding outcomes. The infant can 'signal' his needs through vocalisation, and the mother can respond by allowing or restricting nipple access, which might alter the breast milk composition or volume. This may lead to parent-offspring conflict during the lactation period. Challenging infant behaviour has also been associated with maternal psychological distress, which might affect breastfeeding performance. Most attempts to improve breastfeeding rates focus on providing additional support, yet many aspects of the breastfeeding process are poorly understood. Thus, our objective is to investigate mother-infant signalling during breastfeeding by manipulating maternal psychological state using a relaxation therapy intervention. The study will test the hypothesis that mothers who listen to the therapy will be more relaxed/less stressed and this will favourably alter breast milk composition and/or affect milk volume and hence influence infant outcomes. A randomised controlled trial will be conducted in first-time breastfeeding mothers and their new-born infants. Pregnant mothers will be recruited at antenatal clinics in Selangor, Malaysia, and four home visits will be carried out at 2, 6, 12 and 14 weeks postnatally. Participants will be randomised into a control and an intervention group in the early post-partum period. Mothers from the intervention group will be asked to listen daily to an audio recording with relaxation therapy during breastfeeding. Maternal psychological state, breastfeeding practices and infant behaviour will be assessed using validated questionnaires. Milk volume will be measured using stable isotopes. Breast milk samples will be collected to measure macronutrient content and hormone levels. Anthropometric measurements (weight, length and head circumference) will be performed during all

  2. Maternal DRD2, SLC6A3, and OXTR genotypes as potential moderators of the relation between maternal history of care and maternal cortisol secretion in the context of mother-infant separation.

    Science.gov (United States)

    Ludmer, Jaclyn A; Jamieson, Brittany; Gonzalez, Andrea; Levitan, Robert; Kennedy, James; Villani, Vanessa; Masellis, Mario; Basile, Vincenzo S; Atkinson, Leslie

    2017-10-01

    A mother's cortisol secretion is importantly associated with her own mental health and her infant's cortisol secretion. This study investigated the influences of maternal history of care and maternal DRD2, SLC6A3, and OXTR genotypes on maternal cortisol in the context of infant stress. A community sample of 296 mother-infant dyads completed a maternal separation at infant age 17 months. Maternal salivary cortisol, buccal cells, and self-reported history of care were collected. Multilevel models revealed that history of care had a greater influence on maternal baseline cortisol (but not cortisol trajectory) for mothers with more plasticity alleles of SLC6A3 (10R) and OXTR (G), relative to mothers with fewer or no plasticity alleles. Findings indicate that a mother's history of care is related to her cortisol secretion in anticipation of infant stress, but that this relation depends on her genetic characteristics. Findings are discussed in relation to the maternal protective system and anticipatory cortisol secretion. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Use of combination neonatal prophylaxis for the prevention of mother-to-child transmission of HIV infection in European high-risk infants.

    Science.gov (United States)

    Chiappini, Elena; Galli, Luisa; Giaquinto, Carlo; Ene, Luminita; Goetghebuer, Tessa; Judd, Ali; Lisi, Catiuscia; Malyuta, Ruslan; Noguera-Julian, Antoni; Ramos, Jose Tomas; Rojo-Conejo, Pablo; Rudin, Christoph; Tookey, Pat; de Martino, Maurizio; Thorne, Claire

    2013-03-27

    To evaluate use of combination neonatal prophylaxis (CNP) in infants at high risk for mother-to-child transmission (MTCT) of HIV in Europe and investigate whether CNP is more effective in preventing MTCT than single drug neonatal prophylaxis (SNP). Individual patient-data meta-analysis across eight observational studies. Factors associated with CNP receipt and with MTCT were explored by logistic regression using data from nonbreastfed infants, born between 1996 and 2010 and at high risk for MTCT. In 5285 mother-infant pairs, 1463 (27.7%) had no antenatal or intrapartum antiretroviral prophylaxis, 915 (17.3%) had only intrapartum prophylaxis and 2907 (55.0%) mothers had detectable delivery viral load despite receiving antenatal antiretroviral therapy. Any neonatal prophylaxis was administered to 4623 (87.5%) infants altogether; 1105 (23.9%) received CNP. Factors significantly associated with the receipt of CNP were later calendar birth year, no elective caesarean section, maternal CD4 cell count less than 200 cells/μl, maternal delivery viral load more than 1000 copies/ml, no antenatal antiretroviral therapy, receipt of intrapartum single-dose nevirapine and cohort. After adjustment, absence of neonatal prophylaxis was associated with higher risk of MTCT compared to neonatal prophylaxis [adjusted odds ratio (aOR) 2.29; 95% confidence interval (95% CI) 1.46-2.59; P use is increasing and associated with presence of MTCT risk factors. The finding of no observed difference in MTCT risk between one drug and CNP may reflect residual confounding or the fact that CNP may be effective only in a subgroup of infants rather than the whole population of high-risk infants.

  4. Blended Infant Massage-Parenting Enhancement Program on Recovering Substance-Abusing Mothers' Parenting Stress, Self-Esteem, Depression, Maternal Attachment, and Mother-Infant Interaction.

    Science.gov (United States)

    Porter, Luz S; Porter, Brian O; McCoy, Virginia; Bango-Sanchez, Vivian; Kissel, Bonnie; Williams, Marjorie; Nunnewar, Sachin

    2015-12-01

    This study aimed to determine whether a blended Infant Massage-Parenting Enhancement Program (IMPEP) improved maternal psychosocial health outcomes (parenting stress, depressive symptoms, self-esteem, maternal attachment) and maternal-infant interaction among substance-addicted mothers (SAMs) actively engaged in outpatient rehabilitation. Designed as a randomized, three-group controlled trial testing two levels of psychoeducational intervention (IMPEP vs. PEP) and a control group (standard care parenting resources), the study was conducted in two substance abuse centers in southeast Florida on a convenience sample of 138 recovering SAM-infant pairs. IMPEP or PEP classes were held weekly on Weeks 2-5, with data collected at baseline (Week 1), Week 6, and Week 12 via structured interviews, observation (Observation Checklist on Maternal-Infant Interaction), and self-administered questionnaires (Abidin Parenting Stress Index, Beck Depression Inventory, Rosenberg Self-Esteem Scale, Muller's Maternal Attachment Inventory), analyzed descriptively and inferentially using Kruskall-Wallis analysis of variance and post hoc Wilcoxon rank sum and Mann-Whitney U tests. Both IMPEP and PEP groups had significantly increased Parenting Stress Index scores (decreased parenting stress) and decreased Beck Depression Inventory scores (decreased depressive symptoms) compared to controls at Week 12, whereas there were no clinically meaningful differences among study groups in Rosenberg Self-Esteem Scale, Muller's Maternal Attachment Inventory, or Observation Checklist on Maternal-Infant Interaction scores. Only the IMPEP group showed significant improvements in both psychological and physical (waist-hip ratio) measures of parenting stress over time. The findings suggest that infant massage blended into a structured parenting program has value-added effects in decreasing parenting stress and maternal depressive symptoms, but not on SAM's self-esteem, attachment, or maternal

  5. A systematic review of interventions to improve prevention of mother-to-child HIV transmission service delivery and promote retention.

    Science.gov (United States)

    Ambia, Julie; Mandala, Justin

    2016-01-01

    The success of prevention of mother-to-child transmission of HIV (PMTCT) is dependent upon high retention of mother-infant pairs within these programmes. This is a systematic review to evaluate the effectiveness of interventions that aim to improve PMTCT service delivery and promote retention throughout the PMTCT steps. Selected databases were searched for studies published in English (up to September 2015). Outcomes of interest included antiretroviral (ARV) drugs or antiretroviral therapy (ART) initiation among HIV-positive pregnant and/or breastfeeding women and their infants, retention into PMTCT programs, the uptake of early infant diagnosis (EID) of HIV and infant HIV status. Risk ratios and random-effect meta-analysis were used in the analysis. Interventions assessed in the 34 identified studies included male partner involvement in PMTCT, peer mentoring, the use of community health workers (CHWs), mobile phone-based reminders, conditional cash transfer, training of midwives, integration of PMTCT services and enhanced referral. Five studies (two randomized) that evaluated mobile phone-based interventions showed a statistically significant increase (pooled RR 1.18; 95% CI 1.05 to 1.32, I(2)=83%) in uptake of EID of HIV at around six weeks postpartum. Male partner involvement in PMTCT was associated with reductions in infant HIV transmission (pooled RR 0.61; 95% CI 0.39 to 0.94, I(2)=0%) in four studies (one randomized). Four studies (three randomized) that were grounded on psychological interventions reported non-significant results (pooled RR 1.01; 95% CI 0.93 to 1.09, I(2)=69%) in increasing ARV/ART uptake among HIV-positive pregnant and/or breastfeeding women and infant HIV testing (pooled RR 1.00; 95% CI 0.94 to 1.07, I(2)=45%). The effect of the other interventions on the effectiveness of improving PMTCT uptake was unclear. Heterogeneity of interventions limits these findings. Our findings indicate that mobile phone-based reminders may increase the uptake

  6. Socio-economic, clinical and biological risk factors for mother - to - child transmission of HIV-1 in Muhima health centre (Rwanda): a prospective cohort study.

    Science.gov (United States)

    Bucagu, Maurice; Bizimana, Jean de Dieu; Muganda, John; Humblet, Claire Perrine

    2013-02-28

    Three decades since the first HIV-1 infected patients in Rwanda were identified in 1983; the Acquired Immunodeficiency Syndrome epidemic has had a devastating history and is still a major public health challenge in the country. This study was aimed at assessing socioeconomic, clinical and biological risk factors for mother - to - child transmission of HIV- in Muhima health centre (Kigali/Rwanda). The prospective cohort study was conducted at Muhima Health centre (Kigali/Rwanda).During the study period (May 2007 - April 2010), of 8,669 pregnant women who attended antenatal visits and screened for HIV-1, 736 tested HIV-1 positive and among them 700 were eligible study participants. Hemoglobin, CD4 count and viral load tests were performed for participant mothers and HIV-1 testing using DNA PCR technique for infants.Follow up data for eligible mother-infant pairs were obtained from women themselves and log books in Muhima health centre and maternity, using a structured questionnaire.Predictors of mother-to-child transmission of HIV-1 were assessed by multivariable logistic regression analysis. Among the 679 exposed and followed-up infants, HIV-1 status was significantly associated with disclosure of HIV status to partner both at 6 weeks of age (non-disclosure of HIV status, adjusted odds ratio [AOR] 4.68, CI 1.39 to 15.77, p  = 1000 copies/ml, AOR 7.30, CI 2.65 to 20.08, p  = 1000 copies/ml, AOR 4.60, CI 1.84 to 11.49, p < 0.01, compared to <1000 copies/ml). In this study, the most relevant factors independently associated with increased risk of mother - to - child transmission of HIV-1 included non-disclosure of HIV status to partner and high HIV-1 RNA. Members of this cohort also showed socioeconomic inequalities, with unmarried status carrying higher risk of undisclosed HIV status. The monitoring of maternal HIV-1 RNA level might be considered as a routinely used test to assess the risk of transmission with the goal of achieving viral suppression as

  7. Delivery Unit Costs for Antiretroviral Treatment and Prevention of Mother-to-Child-Transmission of HIV

    Science.gov (United States)

    Galárraga, Omar; Wirtz, Veronika J.; Figueroa-Lara, Alejandro; Santa-Ana-Tellez, Yared; Coulibaly, Ibrahima; Viisainen, Kirsi; Medina-Lara, Antonieta; Korenromp, Eline L.

    2013-01-01

    Background As antiretroviral treatment (ART) for HIV/AIDS is scaled-up globally, information on per-person costs is critical to improve efficiency in service delivery and maximize coverage and health impact. Objective To review studies on delivery unit costs for adult and pediatric ART provision per-patient-year, and prevention of mother-to-child transmission (PMTCT) interventions per mother-infant pair screened or treated, in low- and middle-income countries. Methods Systematic review of English, French and Spanish publications from 2001 to 2009, reporting empirical costing that accounted for at least antiretroviral (ARV) medicines, laboratory testing and personnel. Expenditures were analyzed by country income level and cost component. All costs were standardized to 2009 US dollars. Results Analyses covered 29 eligible, comprehensive costing studies. In the base case, in low-income countries (LIC), median, ART cost per patient-year was $792 (mean: $839, range: $682-$1089); for lower-middle-income countries (LMIC), the median was $932 (mean: $1246, range: $156-$3904); and for upper-middle-income countries (UMIC) the median was $1454 (mean: $2783, range: $1230-$5667). ARV drugs were largest component of overall ART cost in all settings (62%, 50% and 47% in LIC, LMIC and UMIC respectively). Out of 26 ART studies, 14 report which drug regimes were used, and only one study explicitly reported second line treatment costs. The second cost driver was laboratory cost in LIC and LMIC (14% and 19.5%) whereas it was personnel costs in UMIC (26%). Two studies specified the types of laboratory tests costed, and three studies specifically included above-facility-level personnel costs. Three studies reported detailed PMTCT costs, and two studies reported on pediatric ART. Conclusions There is a paucity of data on the full ART and PMTCT delivery unit costs, in particular for low-and middle-income countries. Heterogeneity in activities costed and insufficient detail regarding

  8. Effect of situation on mother infant interaction

    NARCIS (Netherlands)

    Maas, A.J.B.M.; Vreeswijk, C.M.J.M.; van Bakel, H.J.A.

    2013-01-01

    Research has shown that the early parent–infant relationship is of critical importance for children's developmental outcomes. While the effect of different settings on mother–infant interactive behavior is well studied, only few researchers systematically examined the effect of situational variables

  9. Comparison of anti-retroviral therapy treatment strategies in prevention of mother-to-child transmission in a teaching hospital in Ethiopia.

    Science.gov (United States)

    Kumela, Kabaye; Amenu, Demisew; Chelkeba, Legese

    2015-01-01

    More than 90% of Human immunodeficiency virus (HIV) infection in children is acquired due to mother-to-child transmission, which is spreading during pregnancy, delivery or breastfeeding. To determine the effectiveness of highly active antiretroviral and short course antiretroviral regimens in prevention of mother-to-child transmission of HIV and associated factors Jimma University Specialized Hospital (JUSH). A hospital based retrospective cohort study was conducted on HIV infected pregnant mothers who gave birth and had follow up at anti-retroviral therapy (ART) clinic for at least 6 months during a time period paired with their infants. The primary and secondary outcomes were rate of infant infection by HIV at 6 weeks and 6 months respectively. The Chi-square was used for the comparison of categorical data multivariate logistic regression model was used to identify the determinants of early mother-to-child transmission of HIV at 6 weeks. Cox proportional hazard model was used to analyze factors that affect the 6 month HIV free survival of infants born to HIV infected mothers. A total of 180 mother infant pairs were considered for the final analysis, 90(50%) mothers received single dose nevirapine (sdNVP) designated as regimen-3, 67 (37.2%) mothers were on different types of ARV regimens commonly AZT + 3TC + NVP (regimen-1), while the rest 23 (12.8%) mothers were on short course dual regimen AZT + 3TC + sdNVP (regimen-2). Early mother-to-child transmission rate at 6 weeks for regimens 1, 2 and 3 were 5.9% (4/67), 8.6% (2/23), and 15.5% (14/90) respectively. The late cumulative mother-to-child transmission rate of HIV at 6 months regardless of regimen type was 15.5% (28/180). Postnatal transmission at 6 months was 28.5% (8/28) of infected children. Factors that were found to be associated with high risk of early mother-to-child transmission of HIV include duration of ARV regimen shorter than 2 months during pregnancy (OR=4.3, 95%CI =1.38-13.46), base line CD4 less

  10. Outcomes of prevention of mother to child transmission of the human immunodeficiency virus-1 in rural Kenya--a cohort study.

    Science.gov (United States)

    Nduati, Eunice Wambui; Hassan, Amin Shaban; Knight, Miguel Garcia; Muema, Daniel Muli; Jahangir, Margaret Nassim; Mwaringa, Shalton Lwambi; Etyang, Timothy Juma; Rowland-Jones, Sarah; Urban, Britta Christina; Berkley, James Alexander

    2015-10-03

    Success in prevention of mother-to-child transmission (PMTCT) raises the prospect of eliminating pediatric HIV infection. To achieve global elimination, however, strategies are needed to strengthen PMTCT interventions. This study aimed to determine PMTCT outcomes and identify challenges facing its successful implementation in a rural setting in Kenya. A retrospective cohort design was used. Routine demographic and clinical data for infants and mothers enrolling for PMTCT care at a rural hospital in Kenya were analysed. Cox and logistic regression were used to determine factors associated with retention and vertical transmission respectively. Between 2006 and 2012, 1338 infants were enrolled and followed up for PMTCT care with earlier age of enrollment and improved retention observed over time. Mother to child transmission of HIV declined from 19.4 % in 2006 to 8.9 % in 2012 (non-parametric test for trend p = 0.024). From 2009 to 2012, enrolling for care after 6 months of age, adjusted Odds Ratio [aOR]: 23.3 [95 % confidence interval (CI): 8.3-65.4], presence of malnutrition ([aOR]: 2.3 [95 % CI: 1.1-5.2]) and lack of maternal use of highly active antiretroviral therapy (HAART) (aOR: 6.5 [95 % CI: 1.4-29.4]) was associated with increased risk of HIV infection. Infant's older age at enrollment, malnutrition and maternal HAART status, were also associated with drop out from care. Infants who were not actively followed up were more likely to drop out from care (adjusted Hazard Ratio: 6.6 [95 % CI: 2.9-14.6]). We report a temporal increase in the proportion of infants enrolling for PMTCT care before 3 months of age, improved retention in PMTCT and a significant reduction in the proportion of infants enrolled who became HIV-infected, emphasizing the benefits of PMTCT. A simple set of risk factors at enrollment can identify mother-infant pairs most at risk of infection or drop out for targeted intervention.

  11. Pair formation models for sexually transmitted infections : A primer

    NARCIS (Netherlands)

    Kretzschmar, MEE; Heijne, Janneke C M

    For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward

  12. Maternal executive functioning as a mechanism in the intergenerational transmission of parenting: Preliminary evidence.

    Science.gov (United States)

    Bridgett, David J; Kanya, Meghan J; Rutherford, Helena J V; Mayes, Linda C

    2017-02-01

    Multiple lines of inquiry, including experimental animal models, have recently converged to suggest that executive functioning (EF) may be one mechanism by which parenting behavior is transmitted across generations. In the current investigation, we empirically test this notion by examining relations between maternal EF and parenting behaviors during mother-infant interactions, and by examining the role of maternal EF in the intergenerational transmission of parenting behavior. Mother-infant dyads (N = 150) in a longitudinal study participated. Mothers were administered measures of EF (working memory and inhibition), reported on the parenting they received from their parents (i.e., the infants' maternal grandparents), and were observed interacting with their 8-month-old infants. SEM findings indicated that the negative parenting mothers received from their own parents was significantly related to poorer maternal EF, and that poorer maternal EF was significantly related to subsequent engagement in more negative parenting practices (e.g., intrusiveness, displays of negativity) with their own infant. A significant indirect effect, through maternal EF, was observed between maternal report of her experiences of negative parenting received while growing up and her own use of negative parenting practices. Our findings make two contributions. First, we add to existing work that has primarily considered relations between parent EF and parenting behavior while interacting with older children by showing that maternal EF affects children, via maternal parenting behavior, beginning very early in life. Second, we provide key evidence of the role of EF in the intergenerational transmission of parenting. Additional implications of these findings, as well as important future directions, are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  13. The effects of maternal haemoglobin as an indicator of maternal ...

    African Journals Online (AJOL)

    EB

    relationship could exist between MMA of mother-infant pairs and maternal nutritional indicator (haemoglobin). Objectives: This study reviewed the effects of maternal haemoglobin (Hb) on MMA of mother-infant pairs at birth. Methods: One hundred and fifty three mother-infant pairs were enrolled in this study using the ...

  14. Neuroglial Transmission

    DEFF Research Database (Denmark)

    Gundersen, Vidar; Storm-Mathisen, Jon; Bergersen, Linda Hildegard

    2015-01-01

    as a signaling substance recently shown to act on specific lactate receptors in the brain. Complementing neurotransmission at a synapse, neuroglial transmission often implies diffusion of the transmitter over a longer distance and concurs with the concept of volume transmission. Transmission from glia modulates...... synaptic neurotransmission based on energetic and other local conditions in a volume of tissue surrounding the individual synapse. Neuroglial transmission appears to contribute significantly to brain functions such as memory, as well as to prevalent neuropathologies....

  15. Padrões de organização do sistema de comunicação mãe-bebê nas interações face a face: estudo de cinco díades Patterns of organization of the mother-infant communication in face-to-face interactions: the study of five dyads

    Directory of Open Access Journals (Sweden)

    Maria da Conceição Diniz Pereira de Lyra

    2012-04-01

    Full Text Available Apresentamos os que emergem do processo de desenvolvimento da comunicação mãe-bebê nas interações do tipo face a face. Este processo é concebido como compondo um sistema dinâmico em constante transformação e construção. Os padrões de organização descrevem as fases de maior estabilidade desse sistema, propostas pelo modelo EEA como constituindo três padrões que se sucedem: um estabelecimento inicial, seguido de um período de extensão e, finalmente, um período de abreviação das trocas comunicativas. Analisamos os dados longitudinais das trocas comunicativas do tipo face a face de cinco díades mãe-bebê, descrevendo o processo através do qual esses padrões se organizam. Identificamos uma tendência geral de manutenção da mesma sequência de aparecimento e dominância desses três padrões nas cinco díades, tal como proposto pelo modelo EEA. Todavia, cada díade difere na idade de aparecimento, de dominância e na duração de cada um dos padrões referidos.We present the patterns of organization that emerge from the developmental process of mother-infant communication in face-to-face exchanges. This process is conceived as creating a dynamic system in constant transformation and construction. The patterns of organization describe the periods of stability of this system, proposed by the EEA model as corresponding to three successive patterns, starting by an initial establishment, followed by a period of extension, and finally by an abbreviation of the dyadic exchanges. We analyzed the longitudinal mother-infant face-to-face exchanges from five dyads, describing the process of organization of these patterns. We identified a general tendency toward maintenance of the sequence of emergence and dominance of these three patterns in all five dyads, according to the proposals of the EEA model. However, each dyad differs in terms of age of appearance, dominance and duration of each of these patterns.

  16. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  17. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  18. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  19. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  20. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  1. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  2. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  3. Interactions between social structure, demography, and transmission determine disease persistence in primates.

    Science.gov (United States)

    Ryan, Sadie J; Jones, James H; Dobson, Andrew P

    2013-01-01

    Catastrophic declines in African great ape populations due to disease outbreaks have been reported in recent years, yet we rarely hear of similar disease impacts for the more solitary Asian great apes, or for smaller primates. We used an age-structured model of different primate social systems to illustrate that interactions between social structure and demography create 'dynamic constraints' on the pathogens that can establish and persist in primate host species with different social systems. We showed that this varies by disease transmission mode. Sexually transmitted infections (STIs) require high rates of transmissibility to persist within a primate population. In particular, for a unimale social system, STIs require extremely high rates of transmissibility for persistence, and remain at extremely low prevalence in small primates, but this is less constrained in longer-lived, larger-bodied primates. In contrast, aerosol transmitted infections (ATIs) spread and persist at high prevalence in medium and large primates with moderate transmissibility;, establishment and persistence in small-bodied primates require higher relative rates of transmissibility. Intragroup contact structure - the social network - creates different constraints for different transmission modes, and our model underscores the importance of intragroup contacts on infection prior to intergroup movement in a structured population. When alpha males dominate sexual encounters, the resulting disease transmission dynamics differ from when social interactions are dominated by mother-infant grooming events, for example. This has important repercussions for pathogen spread across populations. Our framework reveals essential social and demographic characteristics of primates that predispose them to different disease risks that will be important for disease management and conservation planning for protected primate populations.

  4. Transmission issues

    International Nuclear Information System (INIS)

    Bradford, J.; Wilson, L.; Thon, S.; Millar, N.

    2005-01-01

    This session on transmission issues focused on the role that transmission plays in electricity markets and the importance of getting the market structure right in terms of generation divestiture with buy back contracts, demand side responsive programs, transmission upgrades and long term contracts. The difficulties of distinguishing between market power and scarcity were examined along with some of the complications that ensue if transmission experiences congestion, as exemplified by the August 2003 blackout in eastern North America. The presentations described the best ways to handle transmission issues, and debated whether transmission should be deregulated or follow market forces. Issues of interconnections and reliability of connections were also debated along with the attempt to integrate renewables into the grid. Some presentations identified what new transmission must be built and what must be done to ensure that transmission gets built. The challenges and business opportunities for transmission in Alberta were discussed with reference to plans to invest in new infrastructure, where it is going outside of the province and how it works with other jurisdictions. Manitoba's Conawapa Hydro Project and its 2000 MW tie line to Ontario was also discussed. Some examples of non-optimal use of interconnections in Europe were also discussed in an effort to learn from these mistakes and avoid them in Canada. tabs., figs

  5. Transmission eigenvalues

    Science.gov (United States)

    Cakoni, Fioralba; Haddar, Houssem

    2013-10-01

    In inverse scattering theory, transmission eigenvalues can be seen as the extension of the notion of resonant frequencies for impenetrable objects to the case of penetrable dielectrics. The transmission eigenvalue problem is a relatively late arrival to the spectral theory of partial differential equations. Its first appearance was in 1986 in a paper by Kirsch who was investigating the denseness of far-field patterns for scattering solutions of the Helmholtz equation or, in more modern terminology, the injectivity of the far-field operator [1]. The paper of Kirsch was soon followed by a more systematic study by Colton and Monk in the context of developing the dual space method for solving the inverse scattering problem for acoustic waves in an inhomogeneous medium [2]. In this paper they showed that for a spherically stratified media transmission eigenvalues existed and formed a discrete set. Numerical examples were also given showing that in principle transmission eigenvalues could be determined from the far-field data. This first period of interest in transmission eigenvalues was concluded with papers by Colton et al in 1989 [3] and Rynne and Sleeman in 1991 [4] showing that for an inhomogeneous medium (not necessarily spherically stratified) transmission eigenvalues, if they existed, formed a discrete set. For the next seventeen years transmission eigenvalues were ignored. This was mainly due to the fact that, with the introduction of various sampling methods to determine the shape of an inhomogeneous medium from far-field data, transmission eigenvalues were something to be avoided and hence the fact that transmission eigenvalues formed at most a discrete set was deemed to be sufficient. In addition, questions related to the existence of transmission eigenvalues or the structure of associated eigenvectors were recognized as being particularly difficult due to the nonlinearity of the eigenvalue problem and the special structure of the associated transmission

  6. Transmission eigenvalues and thermoacoustic tomography

    International Nuclear Information System (INIS)

    Finch, David; Hickmann, Kyle S

    2013-01-01

    The spectrum of the interior transmission problem is related to the unique determination of the acoustic properties of a body in thermoacoustic imaging. Under a non-trapping hypothesis, we show that sparsity of the interior transmission spectrum implies a range separation condition for the thermoacoustic operator. In odd dimensions greater than or equal to 3, we prove that the interior transmission spectrum for a pair of radially symmetric non-trapping sound speeds is countable, and conclude that the ranges of the associated thermoacoustic maps have only trivial intersection. (paper)

  7. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  8. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  9. Quantifying Transmission.

    Science.gov (United States)

    Woolhouse, Mark

    2017-07-01

    Transmissibility is the defining characteristic of infectious diseases. Quantifying transmission matters for understanding infectious disease epidemiology and designing evidence-based disease control programs. Tracing individual transmission events can be achieved by epidemiological investigation coupled with pathogen typing or genome sequencing. Individual infectiousness can be estimated by measuring pathogen loads, but few studies have directly estimated the ability of infected hosts to transmit to uninfected hosts. Individuals' opportunities to transmit infection are dependent on behavioral and other risk factors relevant given the transmission route of the pathogen concerned. Transmission at the population level can be quantified through knowledge of risk factors in the population or phylogeographic analysis of pathogen sequence data. Mathematical model-based approaches require estimation of the per capita transmission rate and basic reproduction number, obtained by fitting models to case data and/or analysis of pathogen sequence data. Heterogeneities in infectiousness, contact behavior, and susceptibility can have substantial effects on the epidemiology of an infectious disease, so estimates of only mean values may be insufficient. For some pathogens, super-shedders (infected individuals who are highly infectious) and super-spreaders (individuals with more opportunities to transmit infection) may be important. Future work on quantifying transmission should involve integrated analyses of multiple data sources.

  10. Narrowband polarization entangled telecom photon pair source

    OpenAIRE

    Kaiser , Florian; Issautier , Amandine; Alibart , Olivier; Martin , Anthony; Tanzilli , Sébastien

    2011-01-01

    Contributed Talk; International audience; During the last decade, quantum entanglement has paved the way out to of the lab modern applications such as quantum computation and communication. Today, small scale quantum networks exist already, but they are limited to a few 100 km distance, due to intrinsic fiber transmission losses and non perfect detectors. These networks are typically established using photon pair sources based on spontaneous parametric down conversion (SPDC). Widely used enta...

  11. Force transmissibility versus displacement transmissibility

    Science.gov (United States)

    Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

    2014-10-01

    It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

  12. Data transmission

    National Research Council Canada - National Science Library

    Tugal, Dogan A; Tugal, Osman

    1989-01-01

    This updated second edition provides working answers to today's critical questions about designing and managing all types of data transmission systems and features a new chapter on local area networks (LANs...

  13. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  14. Relationship of Cord Blood Immunoglobulin E and Maternal Immunoglobulin E with Birth Order and Maternal History of Allergy in Albanian Mother/Neonate Pairs.

    Science.gov (United States)

    Latifi-Pupovci, Hatixhe; Lokaj-Berisha, Violeta; Lumezi, Besa

    2017-10-15

    Previous studies reported that familial factors such as birth order and mothers atopy might influence cord blood levels and development of allergies. The aim of the study was to evaluate the relationship of cord blood IgE and maternal IgE with birth order and mothers history of allergy in Albanian mother/neonate pairs. Study population represented 291 mother-infant pairs. Mothers were interviewed with a questionnaire for personal history of allergy and pregnancy history whereas serum IgE levels were determined using sandwich IRMA assay. The mean level of cIgE in neonates with detectable levels was 1.59 (n = 78). No significant difference in means of cIgE was found between first born and later born neonates (p = 0.232) and between neonates of mothers with a negative and positive history of allergy (p = 0.125). Also, no significant difference was found between means of mIgE by birth order, whereas there was a significant difference of mIgE between mothers with and without a history of allergy (p = 0.01). In a group of neonates with detectable cIgE levels, maternal IgE levels were moderately correlated with cIgE levels. Cord blood IgE is not affected by birth order and mothers history of allergy, whereas mothers IgE are affected by the history of allergy but not by birth order.

  15. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  16. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  17. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  18. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  19. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  20. Electrical transmission

    Energy Technology Data Exchange (ETDEWEB)

    Sayers, D P

    1960-05-01

    After briefly tracing the history of electricity transmission, trends in high voltage transmission and experiments being conducted on 650 kV are discussed. 5000 miles of the U.K. grid are operated at 132 kV and 1000 at 275 kV, ultimately to provide a super grid at 380 kV. Problems are insulation, radio interference and the cost of underground lines (16 times that of overhead lines). Also considered are the economics of the grid as a means of transporting energy and as a means of spreading the peak load over the power stations in the most efficient manner. Finally, the question of amenities is discussed.

  1. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  2. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  3. Asymmetric information capacities of reciprocal pairs of quantum channels

    Science.gov (United States)

    Rosati, Matteo; Giovannetti, Vittorio

    2018-05-01

    Reciprocal pairs of quantum channels are defined as completely positive transformations which admit a rigid, distance-preserving, yet not completely positive transformation that allows one to reproduce the outcome of one from the corresponding outcome of the other. From a classical perspective these transmission lines should exhibit the same communication efficiency. This is no longer the case in the quantum setting: explicit asymmetric behaviors are reported studying the classical communication capacities of reciprocal pairs of depolarizing and Weyl-covariant channels.

  4. The Potts model and flows. 1. The pair correlation function

    International Nuclear Information System (INIS)

    Essam, J.W.; Tsallis, C.

    1985-01-01

    It is shown that the partition function for the lambda-state Potts model with pair-interactions is related to the expected number of integer mod-lambda flows in a percolation model. The relation is generalised to the pair correlation function. The resulting high temperature expansion coefficients are shown to be the flow polynomials of graph theory. An observation of Tsallis and Levy concerning the equivalent transmissivity of a cluster is also proved. (Author) [pt

  5. Hybridized plasmon in an asymmetric cut-wire-pair structure

    Energy Technology Data Exchange (ETDEWEB)

    Tung, Nguyen Thanh [Vietnamese Military Academy of Science and Technology, Hanoi (Viet Nam); Hanyang University, Seoul (Korea, Republic of); Rhee, Joo Yull [Sungkyunkwan University, Suwon (Korea, Republic of); Park, Jin Woo; Lee, Young Pak [Hanyang University, Seoul (Korea, Republic of)

    2010-12-15

    In this report, we discuss an electromagnetic analog of the molecular-orbital theory for metamaterial structures. We show that the electromagnetic responses of a metamagnetic structure consisting of paired cut-wires can be well understood by using the plasmon-hybridization mechanism. The simulated transmission spectra of the asymmetric cut-wire-pair structure, which were obtained utilizing the transfer-matrix method, strongly support our suggestion.

  6. Coulomb pair-creation

    International Nuclear Information System (INIS)

    Hrasko, P.; Foeldy, L.; Toth, A.

    1986-07-01

    Electron-positron pair production in strong Coulomb fields is outlined. It is shown that the singular behaviour of the adiabatic basis can be removed if solutions of the time dependent external field Dirac equation are used as a basis to expand the fermion field operator. This latter 'asymptotic basis' makes it possible to introduce Feynman-propagator. Applying the reduction technique, the computation of all of the basic quantities can be reduced to the solution of an integral equation. The positron spectrum for separable potential model with Lorentzian time dependence and for potential jump is analyzed in the pole approximation. (author)

  7. Pairing correlations around scission

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    2001-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler-box potential with a δ-function diaphragm to mimic scission

  8. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  9. Breastfeeding and the mother-infant relationship-A review

    NARCIS (Netherlands)

    Jansen, J.; Weerth, C. de; Riksen-Walraven, J.M.A.

    2008-01-01

    A positive effect of breastfeeding on the mother–infant relationship is often assumed in the scientific literature, but this has not been systematically reviewed. This review aims to clarify the role of breastfeeding in the mother–infant relationship, which is conceptualized as the maternal bond

  10. Mother-Infant Interaction: a Process of Discoveries

    Directory of Open Access Journals (Sweden)

    Dorian Mônica Arpini

    2016-08-01

    Full Text Available Considering the importance of the first experiences to the psychological constitution and that such constitution is based on parental relationships, this study aimed to comprehend the aspects that indicate health and well-being in the mother-baby relationship, focusing on the moments of breastfeeding, cry, communication and interaction of the dyad. The study was grounded on observation and an interview with the mothers. Results emerged from content analysis and highlight the presence of indicators of the Child Development Risks Index (IRDIs in the relationship of the dyad, evidencing mothers hold knowledge about their babies. Final considerations emphasize the importance of the mother-baby relationship and suggest the inclusion of Clinical Indicators of Risk regarding Child Development in services of primary health care.

  11. Mother-Infant and Father-Infant Interaction Behavior.

    Science.gov (United States)

    Miller, Carol J.

    A total of 20 infants 8 months of age were videotaped in dyads with each parent during 10 minutes of free play in a laboratory setting, to investigate reciprocal behavior among parents and their infants. Questionnaire data on parents' caretaking involvement were also collected. Findings indicated that mothers and fathers did not differ on the…

  12. Depressed mothers' infants are less responsive to faces and voices.

    Science.gov (United States)

    Field, Tiffany; Diego, Miguel; Hernandez-Reif, Maria

    2009-06-01

    A review of our recent research suggests that infants of depressed mothers appeared to be less responsive to faces and voices as early as the neonatal period. At that time they have shown less orienting to the live face/voice stimulus of the Brazelton scale examiner and to their own and other infants' cry sounds. This lesser responsiveness has been attributed to higher arousal, less attentiveness and less "empathy." Their delayed heart rate decelerations to instrumental and vocal music sounds have also been ascribed to their delayed attention and/or slower processing. Later at 3-6 months they showed less negative responding to their mothers' non-contingent and still-face behavior, suggesting that they were more accustomed to this behavior in their mothers. The less responsive behavior of the depressed mothers was further compounded by their comorbid mood states of anger and anxiety and their difficult interaction styles including withdrawn or intrusive interaction styles and their later authoritarian parenting style. Pregnancy massage was effectively used to reduce prenatal depression and facilitate more optimal neonatal behavior. Interaction coaching was used during the postnatal period to help these dyads with their interactions and ultimately facilitate the infants' development.

  13. Mother-infant bonding in pregnant drug addicts

    Directory of Open Access Journals (Sweden)

    Carolina Henriques

    2011-08-01

    Full Text Available In female addicts, pregnancy carries risks associated with lifestyles, modes of consumption and effect of drugs on the developing fetus. This investigation tried to determine the level of antenatal attachment in pregnant addicts, as well as assess the relationship between the number of nursing visits and held attendance of the preparation for childbirth, with the level of prenatal attachment. We conducted a correlational study (Fortin, 2009, applied to a single point. Regarding the level of prenatal attachment, and considering that the maximum value for scale is 80, pregnant drug users have an average of 53.53 (SD=24.10, a value above the average value of the scale, it emphasizes that these pregnant have a value of linking prenatal satisfactory. It was found that the greater the number of nurse consultations conducted surveillance of the pregnancy, the greater the level of prenatal attachment, noting also that pregnant addicts who attend the course in preparation for childbirth, have higher levels of binding prenatal care (p <0.05.

  14. Available transmission capacity assessment

    Directory of Open Access Journals (Sweden)

    Škokljev Ivan

    2012-01-01

    Full Text Available Effective power system operation requires the analysis of vast amounts of information. Power market activities expose power transmission networks to high-level power transactions that threaten normal, secure operation of the power system. When there are service requests for a specific sink/source pair in a transmission system, the transmission system operator (TSO must allocate the available transfer capacity (ATC. It is common that ATC has a single numerical value. Additionally, the ATC must be calculated for the base case configuration of the system, while generation dispatch and topology remain unchanged during the calculation. Posting ATC on the internet should benefit prospective users by aiding them in formulating their requests. However, a single numerical value of ATC offers little for prospect for analysis, planning, what-if combinations, etc. A symbolic approach to the power flow problem (DC power flow and ATC offers a numerical computation at the very end, whilst the calculation beforehand is performed by using symbols for the general topology of the electrical network. Qualitative analysis of the ATC using only qualitative values, such as increase, decrease or no change, offers some new insights into ATC evaluation, multiple transactions evaluation, value of counter-flows and their impact etc. Symbolic analysis in this paper is performed after the execution of the linear, symbolic DC power flow. As control variables, the mathematical model comprises linear security constraints, ATC, PTDFs and transactions. The aim is to perform an ATC sensitivity study on a five nodes/seven lines transmission network, used for zonal market activities tests. A relatively complicated environment with twenty possible bilateral transactions is observed.

  15. Assessing Intimacy: The Pair Inventory.

    Science.gov (United States)

    Schaefer, Mark T.; Olson, David H.

    1981-01-01

    Personal Assessment of Intimacy in Relationships (PAIR) provides systematic information in five types of intimacy: emotional, social, sexual, intellectual and recreational. PAIR can be used with couples in marital therapy and enrichment groups. (Author)

  16. QSO Pairs across Active Galaxies

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...

  17. Estudio de la expresividad emocional y la regulación afectiva en díadas madre-bebé durante el primer año de vida y su relación con la autoestima materna Study of emotional expressivity and affective regulation in mother-infant dyads during the first year of life and its relation to maternal self esteem

    Directory of Open Access Journals (Sweden)

    Clara Raznoszczyk de Schejtman

    2005-12-01

    Full Text Available El presente trabajo presenta una articulación entre resultados provenientes de la investigación empírica observacional en díadas madre-bebé y conceptualizaciones psicoanalíticas acerca de la estructuración psíquica. Se recorren conceptos freudianos acerca del rol del auxiliar externo en los primeros tiempos de la vida y especialmente en la constitución de yo. Estos conceptos se ligan a los aportes acerca de la regulación afectiva y el Modelo de Regulación Mutua producidos por los investigadores de infantes. Se filmaron 40 díadas madre bebé y se evaluó la regulación afectiva a través del microanálisis de 3 minutos de interacción cara a cara madre-bebé y 5 minutos de juego libre. Se estudió la autoestima materna a través de una entrevista y de instrumentos autoadministrados. Se presentan los resultados obtenidos acerca de las relaciones entre: la expresividad observada en la madre y el bebé, la expresividad y la autoestima materna y las diferencias obtenidas en las variables según el género de los bebés.The present paper deals with the overlapping between data obtained from observational mother-infant research and psychoanalytical conceptualizations on psychic structure. Freudian concepts, such as the function of the helping external object in the first time of life are presented and specially ego constitution is described. These concepts are linked to the contributions of infant researchers on affective regulation and Mutual Regulation Model. 40 mother-infant dyads were videotaped and affective regulation was studied through the microanalysis of 3 minutes face to face interaction and 5 minutes free play. Maternal self esteem was studied through an interview and self administered instruments offered to the mothers. Results are presented on: the relations obtained between the observed expressivity in the mother and the infant, the relations obtained between Maternal Self Esteem and expressivity and the relation obtained in

  18. Pairing in hadron structure

    International Nuclear Information System (INIS)

    Chela-Flores, J.

    1981-08-01

    A many-body approach to hadron structure is presented, in which we consider two parton species: spin-0 (b-partons), and spin-1/2 (f-partons). We extend a boson and a fermion pairing scheme for the b-, and f-partons respectively, into a Yang-Mills gauge theory. The main feature of this theory is that the gauge field is not identified with the usual gluon field variable in QCD. We study the confinement problem of the hadron constituents, and obtain, for low temperatures, partons that are confined by energy gaps. As the critical temperatures for the corresponding phase transitions are approached, the energy gap gradually disappears, and confinement is lost. The theory goes beyond the non-relativistic harmonic oscillator quark model, in the sense of giving physical reasons why a non-relativistic approximation is adequate in describing the internal dynamics of hadron structure. (author)

  19. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  20. Transcending Transmission

    DEFF Research Database (Denmark)

    Schoeneborn, Dennis; Trittin, Hannah

    2013-01-01

    Purpose – Extant research on corporate social responsibility (CSR) communication primarily relies on a transmission model of communication that treats organizations and communication as distinct phenomena. This approach has been criticized for neglecting the formative role of communication...... in the emergence of organizations. This paper seeks to propose to reconceptualize CSR communication by drawing on the “communication constitutes organizations” (CCO) perspective. Design/methodology/approach – This is a conceptual paper that explores the implications of switching from an instrumental...... to a constitutive notion of communication. Findings – The study brings forth four main findings: from the CCO view, organizations are constituted by several, partly dissonant, and potentially contradictory communicative practices. From that viewpoint, the potential impact of CSR communication becomes a matter...

  1. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  2. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.

    1980-01-01

    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  3. Experimental many-pairs nonlocality

    Science.gov (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

    2017-08-01

    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  4. Real-time controller for hydrostatic transmission

    OpenAIRE

    2014-01-01

    M. Ing. (Electrical and Electronic Engineering) This dissertation describes the development of a modular real-time controller implemented on a personal computer for a hydrostatically driven vehicle. In such a vehicle the conventional mechanical transmission is replaced with a hydrostatic pump and two hydrostatic motors, making use of the secondary control principle. The infinitely variable transmission and wheel pair controller gives the vehicle superior traction and mobility over conventi...

  5. Pair formation by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.

    1987-01-01

    We obtain solutions of the Dirac and Klein-Gordon equations for a symmetric one-dimensional potential well with a flat bottom, and arbitrary depth, width, and field strength at the walls. Quasistationary solutions are found describing pair creation by the well, and the inverse process. It is shown that when the probability of pair creation by the well is small, it can be expressed in terms of the probability of pair creation at one of the walls and the oscillation frequency of the particle in the well. Among the states of the lower continuum, there are positron resonance scattering states for supercritical well depths. The energies of these states are close to the real part of the quasistationary energy level (the Zel'dovich effect). The qualitative dependence of the transmission coefficient of the positron through the well on its energy and the well width supports the idea that the solution of the so-called one-particle Dirac equation describes a many-particle system with charge 0 or 1

  6. Pair formation models for sexually transmitted infections: A primer

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2017-08-01

    Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number

  7. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total ...

  8. Property (RD) for Hecke Pairs

    International Nuclear Information System (INIS)

    Shirbisheh, Vahid

    2012-01-01

    As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

  9. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan

    2013-01-01

    Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  10. Survey of Transmission Cost Allocation Methodologies for Regional Transmission Organizations

    Energy Technology Data Exchange (ETDEWEB)

    Fink, S.; Porter, K.; Mudd, C.; Rogers, J.

    2011-02-01

    The report presents transmission cost allocation methodologies for reliability transmission projects, generation interconnection, and economic transmission projects for all Regional Transmission Organizations.

  11. Implementation of dictionary pair learning algorithm for image quality improvement

    Science.gov (United States)

    Vimala, C.; Aruna Priya, P.

    2018-04-01

    This paper proposes an image denoising on dictionary pair learning algorithm. Visual information is transmitted in the form of digital images is becoming a major method of communication in the modern age, but the image obtained after transmissions is often corrupted with noise. The received image needs processing before it can be used in applications. Image denoising involves the manipulation of the image data to produce a visually high quality image.

  12. The Peak Pairs algorithm for strain mapping from HRTEM images

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, Pedro L. [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)], E-mail: pedro.galindo@uca.es; Kret, Slawomir [Institute of Physics, PAS, AL. Lotnikow 32/46, 02-668 Warsaw (Poland); Sanchez, Ana M. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Laval, Jean-Yves [Laboratoire de Physique du Solide, UPR5 CNRS-ESPCI, Paris (France); Yanez, Andres; Pizarro, Joaquin; Guerrero, Elisa [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Ben, Teresa; Molina, Sergio I. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)

    2007-11-15

    Strain mapping is defined as a numerical image-processing technique that measures the local shifts of image details around a crystal defect with respect to the ideal, defect-free, positions in the bulk. Algorithms to map elastic strains from high-resolution transmission electron microscopy (HRTEM) images may be classified into two categories: those based on the detection of peaks of intensity in real space and the Geometric Phase approach, calculated in Fourier space. In this paper, we discuss both categories and propose an alternative real space algorithm (Peak Pairs) based on the detection of pairs of intensity maxima in an affine transformed space dependent on the reference area. In spite of the fact that it is a real space approach, the Peak Pairs algorithm exhibits good behaviour at heavily distorted defect cores, e.g. interfaces and dislocations. Quantitative results are reported from experiments to determine local strain in different types of semiconductor heterostructures.

  13. Pairing induced superconductivity in holography

    Science.gov (United States)

    Bagrov, Andrey; Meszena, Balazs; Schalm, Koenraad

    2014-09-01

    We study pairing induced superconductivity in large N strongly coupled systems at finite density using holography. In the weakly coupled dual gravitational theory the mechanism is conventional BCS theory. An IR hard wall cut-off is included to ensure that we can controllably address the dynamics of a single confined Fermi surface. We address in detail the interplay between the scalar order parameter field and fermion pairing. Adding an explicitly dynamical scalar operator with the same quantum numbers as the fermion-pair, the theory experiences a BCS/BEC crossover controlled by the relative scaling dimensions. We find the novel result that this BCS/BEC crossover exposes resonances in the canonical expectation value of the scalar operator. This occurs not only when the scaling dimension is degenerate with the Cooper pair, but also with that of higher derivative paired operators. We speculate that a proper definition of the order parameter which takes mixing with these operators into account stays finite nevertheless.

  14. Nuclear scissors mode with pairing

    International Nuclear Information System (INIS)

    Balbutsev, E. B.; Malov, L. A.; Schuck, P.; Urban, M.; Vinas, X.

    2008-01-01

    The coupled dynamics of the scissors mode and the isovector giant quadrupole resonance are studied using a generalized Wigner function moments method, taking into account pair correlations. Equations of motion for angular momentum, quadrupole moment, and other relevant collective variables are derived on the basis of the time-dependent Hartree-Fock-Bogolyubov equations. Analytical expressions for energy centroids and transition probabilities are found for the harmonic-oscillator model with the quadrupole-quadrupole residual interaction and monopole pairing force. Deformation dependences of energies and B(M1) values are correctly reproduced. The inclusion of pair correlations leads to a drastic improvement in the description of qualitative and quantitative characteristics of the scissors mode.

  15. Pairing mechanism in oxide superconductors

    International Nuclear Information System (INIS)

    Hirsch, J.E.

    1988-01-01

    A useful way to learn about the pairing mechanism that is responsible for high T c superconductivity is to study properties of model Hamiltonians on small systems. The goal is to find the simplest model that can describe the essential physics of high T c superconductivity. The authors have used Monte Carlo simulation and exact diagonalization techniques to study properties of systems of up to 64 sites. Their results show that spin fluctuations and other spin related mechanisms induced by a Hubbard on-site repulsion U are not likely to give rise to pairing, neither in one nor in multiple band models. In contrast, charge fluctuations in a model with both strong U and V (repulsion between Cu and O) are shown to give rise to pairing and it is suggested that this model provides a plausible mechanism for high T c superconductivity

  16. QCD pairing in primordial nuggets

    Science.gov (United States)

    Lugones, G.; Horvath, J. E.

    2003-08-01

    We analyze the problem of boiling and surface evaporation of quark nuggets in the cosmological quark-hadron transition. Recently, it has been shown that QCD pairing modifies the stability properties of strange quark matter. More specifically, strange quark matter in a color-flavor locked state was found to be absolutely stable for a much wider range of the parameters than ordinary unpaired strange quark matter (G. Lugones and J. E. Horvath, Phys. Rev. D, 66, 074017 (2002)). Assuming that primordial quark nuggets are actually formed we analyze the consequences of pairing on the rates of boiling and surface evaporation in order to determine whether they could have survived.

  17. Exclusive electroproduction of pion pairs

    International Nuclear Information System (INIS)

    Warkentin, N.; Schaefer, A.; Diehl, M.; Ivanov, D. Yu.

    2007-01-01

    We investigate electroproduction of pion pairs on the nucleon in the framework of QCD factorization for hard exclusive processes. We extend previous analyses by taking the hard-scattering coefficients at next-to-leading order in α s . The dynamics of the produced pion pair is described by two-pion distribution amplitudes, for which we perform a detailed theoretical and phenomenological analysis. In particular, we obtain constraints on these quantities by comparing our results with measurements of angular observables that are sensitive to the interference between two-pion production in the isoscalar and isovector channels. (orig.)

  18. Instantons in lepton pair production

    International Nuclear Information System (INIS)

    Brandenburg, A.; Ringwald, A.; Utermann, A.

    2006-05-01

    We consider QCD instanton-induced contributions to lepton pair production in hadron-hadron collisions. We relate these contributions to those known from deep inelastic scattering and demonstrate that they can be calculated reliably for sufficiently large momentum transfer. We observe that the instanton contribution to the angular distribution of the lepton pairs at finite momentum transfer strongly violates the Lam-Tung relation - a relation between coefficient functions of the angular distribution which is valid within the framework of ordinary perturbation theory. The drastic violation of this relation, as seen in experimental data, might be related to such instanton-induced effects. (Orig.)

  19. Guanidinium Pairing Facilitates Membrane Translocation

    Czech Academy of Sciences Publication Activity Database

    Allolio, Christoph; Baxová, Katarína; Vazdar, M.; Jungwirth, Pavel

    2016-01-01

    Roč. 120, č. 1 (2016), s. 143-153 ISSN 1520-6106 R&D Projects: GA ČR GA13-06181S Institutional support: RVO:61388963 Keywords : ab initio molecular dynamics * guanidinium * like charge pairing * membrane Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.177, year: 2016

  20. Pairing Linguistic and Music Intelligences

    Science.gov (United States)

    DiEdwardo, MaryAnn Pasda

    2005-01-01

    This article describes how music in the language classroom setting can be a catalyst for developing reading, writing, and understanding skills. Studies suggest that pairing music and linguistic intelligences in the college classroom improves students' grades and abilities to compose theses statements for research papers in courses that emphasize…

  1. Conjugal Pairing in Escherichia Coli

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 13; Issue 8. Conjugal Pairing in Escherichia Coli. Joshua Lederberg. Classics Volume 13 Issue 8 August 2008 pp 793-794. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/013/08/0793-0794 ...

  2. Rank error-correcting pairs

    DEFF Research Database (Denmark)

    Martinez Peñas, Umberto; Pellikaan, Ruud

    2017-01-01

    Error-correcting pairs were introduced as a general method of decoding linear codes with respect to the Hamming metric using coordinatewise products of vectors, and are used for many well-known families of codes. In this paper, we define new types of vector products, extending the coordinatewise ...

  3. 'Leonard pairs' in classical mechanics

    International Nuclear Information System (INIS)

    Zhedanov, Alexei; Korovnichenko, Alyona

    2002-01-01

    Leonard pairs (LP) are matrices with the property of mutual tri-diagonality. We introduce and study a classical analogue of LP. We show that corresponding classical 'Leonard' dynamical variables satisfy non-linear relations of the AW-type with respect to Poisson brackets. (author)

  4. Space power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kuribayashi, Shizuma [Mitsubishi Heavy Industries, Ltd., Tokyo, (Japan)

    1989-10-05

    There being a conception to utilize solar energy by use of a space power station (SPS), a method to bring that universal grace to mankind is wireless energy transmission. The wireless energy transmission is regarded to be microwave transmission or laser beam transmission. The microwave transmission is to transmit 2.45GHz band microwave from the SPS to a receiving station on the ground to meet power demand on earth. The microwave, as small in attenuation in atmosphere and resistant against rain and cloud, is made candidate and, however, problematic in influence on organism, necessary large area of receiving antenna and many other points to be studied. While the laser transmission, as more convergent of beam than the microwave transmission, is advantageous with enabling the receiving area to be small and, however, disadvantageous with being not resistant against dust, rain and cloud, if used for the energy transmission between the space and earth. 2 refs., 2 figs.

  5. Transmission on Balance 2006

    International Nuclear Information System (INIS)

    2007-02-01

    Every year he Dutch Transmission System Operator (TSO) TenneT issues the title publication 'Transmission on Balance'. This report provides information about the main technical operating results in the past year.

  6. The automotive transmission book

    CERN Document Server

    Fischer, Robert; Jürgens, Gunter; Najork, Rolf; Pollak, Burkhard

    2015-01-01

    This book presents essential information on systems and interactions in automotive transmission technology and outlines the methodologies used to analyze and develop transmission concepts and designs. Functions of and interactions between components and subassemblies of transmissions are introduced, providing a basis for designing transmission systems and for determining their potentials and properties in vehicle-specific applications: passenger cars, trucks, buses, tractors, and motorcycles. With these fundamentals the presentation provides universal resources for both state-of-the-art and future transmission technologies, including systems for electric and hybrid electric vehicles.

  7. Pair plasma relaxation time scales.

    Science.gov (United States)

    Aksenov, A G; Ruffini, R; Vereshchagin, G V

    2010-04-01

    By numerically solving the relativistic Boltzmann equations, we compute the time scale for relaxation to thermal equilibrium for an optically thick electron-positron plasma with baryon loading. We focus on the time scales of electromagnetic interactions. The collisional integrals are obtained directly from the corresponding QED matrix elements. Thermalization time scales are computed for a wide range of values of both the total-energy density (over 10 orders of magnitude) and of the baryonic loading parameter (over 6 orders of magnitude). This also allows us to study such interesting limiting cases as the almost purely electron-positron plasma or electron-proton plasma as well as intermediate cases. These results appear to be important both for laboratory experiments aimed at generating optically thick pair plasmas as well as for astrophysical models in which electron-positron pair plasmas play a relevant role.

  8. Statistical deprojection of galaxy pairs

    Science.gov (United States)

    Nottale, Laurent; Chamaraux, Pierre

    2018-06-01

    Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

  9. Pellicle transmission uniformity requirements

    Science.gov (United States)

    Brown, Thomas L.; Ito, Kunihiro

    1998-12-01

    Controlling critical dimensions of devices is a constant battle for the photolithography engineer. Current DUV lithographic process exposure latitude is typically 12 to 15% of the total dose. A third of this exposure latitude budget may be used up by a variable related to masking that has not previously received much attention. The emphasis on pellicle transmission has been focused on increasing the average transmission. Much less, attention has been paid to transmission uniformity. This paper explores the total demand on the photospeed latitude budget, the causes of pellicle transmission nonuniformity and examines reasonable expectations for pellicle performance. Modeling is used to examine how the two primary errors in pellicle manufacturing contribute to nonuniformity in transmission. World-class pellicle transmission uniformity standards are discussed and a comparison made between specifications of other components in the photolithographic process. Specifications for other materials or parameters are used as benchmarks to develop a proposed industry standard for pellicle transmission uniformity.

  10. Computational studies of a cut-wire pair and combined metamaterials

    International Nuclear Information System (INIS)

    Nguyen, Thanh Tung; Lievens, Peter; Lee, Young Pak; Vu, Dinh Lam

    2011-01-01

    The transfer-matrix method and finite-integration simulations show how the transmission properties of combined metamaterials, which consist of metallic cut-wire pairs and continuous wires, are affected by geometric parameters. The corresponding effective permittivity and permeability are retrieved from the complex scattering parameters using the standard retrieval procedure. The electromagnetic properties of the cut-wire pair as well as the left-handed behavior of the combined structure are understood by the effective medium theory. In addition, the dimensional dependence of transmission properties, the shapes of cut-wire pairs and continuous wire, and the impact of dielectric spacer are both examined. Finally, by expanding the results of previous research (Koschny et al 2003 Phys. Rev. Lett. 93 016608), we generalize the transmission picture of combined structures in terms of the correlation between electric and magnetic responses. (review)

  11. Resonance control of mid-infrared metamaterials using arrays of split-ring resonator pairs

    KAUST Repository

    Yue, Weisheng

    2016-01-11

    We present our design, fabrication and characterization of resonance-controllable metamaterials operating at mid-infrared wavelengths. The metamaterials are composed of pairs of back-to-back or face-to-face U-shape split-ring resonators (SRRs). Transmission spectra of the metamaterials are measured using Fourier-transform infrared spectroscopy. The results show that the transmission resonance is dependent on the distance between the two SRRs in each SRR pair. The dips in the transmission spectrum shift to shorter wavelengths with increasing distance between the two SRRs for both the back-to-back and face-to-face SRR pairs. The position of the resonance dips in the spectrum can hence be controlled by the relative position of the SRRs. This mechanism of resonance control offers a promising way of developing metamaterials with tunability for optical filters and bio/chemical sensing devices in integrated nano-optics.

  12. Resonance control of mid-infrared metamaterials using arrays of split-ring resonator pairs

    KAUST Repository

    Yue, Weisheng; Wang, Zhihong; Whittaker, John; Schedin, Fredrik; Wu, Zhipeng; Han, Jiaguang

    2016-01-01

    We present our design, fabrication and characterization of resonance-controllable metamaterials operating at mid-infrared wavelengths. The metamaterials are composed of pairs of back-to-back or face-to-face U-shape split-ring resonators (SRRs). Transmission spectra of the metamaterials are measured using Fourier-transform infrared spectroscopy. The results show that the transmission resonance is dependent on the distance between the two SRRs in each SRR pair. The dips in the transmission spectrum shift to shorter wavelengths with increasing distance between the two SRRs for both the back-to-back and face-to-face SRR pairs. The position of the resonance dips in the spectrum can hence be controlled by the relative position of the SRRs. This mechanism of resonance control offers a promising way of developing metamaterials with tunability for optical filters and bio/chemical sensing devices in integrated nano-optics.

  13. Congenital toxoplasma infection: monthly prenatal screening decreases transmission rate and improves clinical outcome at age 3 years.

    Science.gov (United States)

    Wallon, M; Peyron, F; Cornu, C; Vinault, S; Abrahamowicz, M; Kopp, C Bonithon; Binquet, C

    2013-05-01

    Toxoplasma infection during pregnancy exposes the fetus to risks of congenital infection and sequelae that depend heavily on gestational age (GA) at time of infection. Accurate risk estimates by GA are necessary to counsel parents and improve clinical decisions. We analyzed data from pregnant women diagnosed with acute Toxoplasma infection in Lyon (France) from 1987 to 2008 and assessed how the risks of congenital toxoplasmosis and of clinical signs at age 3 years vary depending on GA at the time of maternal infection. Among 2048 mother-infant pairs, 93.2% of mothers received prenatal treatment and 513 (24.7%) fetuses were infected. Because of a significant reduction in risk since 1992 when monthly screening was introduced (59.4% vs 46.6% at 26 GA weeks; P = .038), probabilities of infection were estimated on the basis of maternal infections diagnosed after mid-1992 (n = 1624). Probabilities of congenital infection were <10% for maternal infections before 12 weeks of gestation, rose to 20.0% at 19 weeks, and then continued increasing to 52.3% and almost 70% at 28 and 39 GA weeks, respectively. Because of a significant reduction in risk of clinical signs of congenital toxoplasmosis in infected children born from mothers diagnosed after 1995 when polymerase chain reaction testing on amniotic fluid was initiated (87/794 vs 46/1150; P = .012), probabilities of clinical signs at 3 years were estimated based on 1015 maternal infections diagnosed after 1995 including 207 infected children, with symptoms in 46 (22.2%). These analyses demonstrated that introduction of monthly prenatal screening and improvement in antenatal diagnosis were associated with a significant reduction in the rate of congenital infection and a better outcome at 3 years of age in infected children. Our updated estimates will improve individual management and counseling in areas where genotype II Toxoplasma is predominant.

  14. Biological characterization of HIV type 1 envelope V3 regions from mothers and infants associated with perinatal transmission.

    Science.gov (United States)

    Matala, E; Hahn, T; Yedavalli, V R; Ahmad, N

    2001-12-10

    Our previous study has shown that the human immunodeficiency virus type 1 (HIV-1) envelope V3 region minor genotypes of infected mothers were transmitted to their infants and predominated initially as a homogeneous virus population in the infants (Ahmad N, Baroudy BM, Baker RC, et al.: J Virol 1995;69:1001-1012). Here we have characterized the biological properties, including cellular tropism, replication efficiency, cytopathic effects, and coreceptor utilization, of these V3 region isolates from mothers and infants. Nineteen V3 region sequences from three mother-infant pairs, including the minor variants of mothers and the major variants of infants as characterized in our previous study, were reciprocally inserted into an HIV-1 infectious molecular clone, pNL4-3, and chimeric viruses were generated by DNA transfections into HeLa cells. Equal amounts of chimeric viruses were then used to infect T lymphocyte cell lines (A3.01 and MT-2), primary blood lymphocytes (PBLs), primary monocyte-derived macrophages (MDMs), and coreceptor cell lines. We found that the V3 region chimeras failed to replicate in T lymphocyte cell lines but replicated in MDMs and PBLs, albeit at reduced levels compared with R5 laboratory HIV-1 strains. In addition, the V3 region chimeras were able to infect the HOS-CD4(+)CCR5(+) cell line, suggesting CCR5 coreceptor utilization. Moreover, the V3 region chimeras were unable to induce syncytia in MT-2 cells, indicative of non-syncytium-inducing (NSI) phenotypes. In conclusion, the HIV-1 minor genotypes of infected mothers with macrophage-tropic and NSI or R5 phenotypes are transmitted to their infants and are initially maintained with the same properties.

  15. Charge Aspects of Composite Pair Superconductivity

    Science.gov (United States)

    Flint, Rebecca

    2014-03-01

    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

  16. Transmission Integration | Grid Modernization | NREL

    Science.gov (United States)

    Transmission Integration Transmission Integration The goal of NREL's transmission integration integration issues and provide data, analysis, and models to enable the electric power system to more and finding solutions to address them to enable transmission grid integration. Capabilities Power

  17. Kinetic equations with pairing correlations

    International Nuclear Information System (INIS)

    Fauser, R.

    1995-12-01

    The Gorkov equations are derived for a general non-equilibrium system. The Gorkov factorization is generalized by the cumulant expansion of the 2-particle correlation and by a generalized Wick theorem in the case of a perturbation expansion. A stationary solution for the Green functions in the Schwinger-Keldysh formalism is presented taking into account pairing correlations. Especially the effects of collisional broadening on the spectral functions and Green functions is discussed. Kinetic equations are derived in the quasi-particle approximation and in the case of particles with width. Explicit expressions for the self-energies are given. (orig.)

  18. Endocrine factors of pair bonding.

    Science.gov (United States)

    Stárka, L

    2007-01-01

    Throughout literature--fiction and poetry, fine arts and music--falling in love and enjoying romantic love plays a central role. While several psychosocial conceptions of pair attachment consider the participation of hormones, human endocrinology has dealt with this theme only marginally. According to some authors in addictology, falling in love shows some signs of hormonal response to stressors with changes in dopamine and serotonin signalling and neurotrophin (transforming growth factor b) concentration. Endorphins, oxytocin and vasopressin may play a role during the later phases of love. However, proof of hormonal events associated with love in humans has, until recently, been lacking.

  19. Pairs of dual periodic frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Goh, Say Song

    2012-01-01

    The time–frequency analysis of a signal is often performed via a series expansion arising from well-localized building blocks. Typically, the building blocks are based on frames having either Gabor or wavelet structure. In order to calculate the coefficients in the series expansion, a dual frame...... is needed. The purpose of the present paper is to provide constructions of dual pairs of frames in the setting of the Hilbert space of periodic functions L2(0,2π). The frames constructed are given explicitly as trigonometric polynomials, which allows for an efficient calculation of the coefficients...

  20. Series Transmission Line Transformer

    Science.gov (United States)

    Buckles, Robert A.; Booth, Rex; Yen, Boris T.

    2004-06-29

    A series transmission line transformer is set forth which includes two or more of impedance matched sets of at least two transmissions lines such as shielded cables, connected in parallel at one end ans series at the other in a cascading fashion. The cables are wound about a magnetic core. The series transmission line transformer (STLT) which can provide for higher impedance ratios and bandwidths, which is scalable, and which is of simpler design and construction.

  1. New Values of Cross-Talk Parameters for Twisted Pair Model

    OpenAIRE

    Milos Kozak; Lukas Cepa; Jiri Vodrazka

    2010-01-01

    Near-end Crosstalk (NEXT) and Far-end Crosstalk (FEXT) of unshielded twisted pair (UTP) cable are the main factors limiting the information capacity in data transmission. Crosstalk depends mostly on the frequency. Frequency dependent transfer functions and crosstalk attenuation may be obtained by measurement, but for the analytical description of the transmission channel's parameters is useful to define functions modelling the crosstalk. The paper describes the measuri...

  2. Filipino au pairs on the move

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...

  3. ANALYSIS AND SIMULATION OF MAIN MAGNET TRANSMISSION LINE EFFECT

    Energy Technology Data Exchange (ETDEWEB)

    ZHANG,W.; MARNERIS, I.; SANDBERG, J.

    2007-06-25

    A main magnet chain forms a pair of transmission lines. Pulse-reflection-caused voltage and current differentiation throughout the magnet chain can have adverse effect on main magnet field quality. This effect is associated with magnet system configuration, coupling efficiency, and parasitic parameters. A better understanding of this phenomenon will help us in new design and existing system upgrade. In this paper, we exam the transmission line effect due to different input functions as well as configuration, coupling, and other parameters.

  4. Drivers of Tuberculosis Transmission.

    Science.gov (United States)

    Mathema, Barun; Andrews, Jason R; Cohen, Ted; Borgdorff, Martien W; Behr, Marcel; Glynn, Judith R; Rustomjee, Roxana; Silk, Benjamin J; Wood, Robin

    2017-11-03

    Measuring tuberculosis transmission is exceedingly difficult, given the remarkable variability in the timing of clinical disease after Mycobacterium tuberculosis infection; incident disease can result from either a recent (ie, weeks to months) or a remote (ie, several years to decades) infection event. Although we cannot identify with certainty the timing and location of tuberculosis transmission for individuals, approaches for estimating the individual probability of recent transmission and for estimating the fraction of tuberculosis cases due to recent transmission in populations have been developed. Data used to estimate the probable burden of recent transmission include tuberculosis case notifications in young children and trends in tuberculin skin test and interferon γ-release assays. More recently, M. tuberculosis whole-genome sequencing has been used to estimate population levels of recent transmission, identify the distribution of specific strains within communities, and decipher chains of transmission among culture-positive tuberculosis cases. The factors that drive the transmission of tuberculosis in communities depend on the burden of prevalent tuberculosis; the ways in which individuals live, work, and interact (eg, congregate settings); and the capacity of healthcare and public health systems to identify and effectively treat individuals with infectious forms of tuberculosis. Here we provide an overview of these factors, describe tools for measurement of ongoing transmission, and highlight knowledge gaps that must be addressed. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  5. Quantum secure direct communication by EPR pairs and entanglement swapping

    CERN Document Server

    Gao, T; Yan, F L; 10.1393/ncb/i2004-10090-1

    2004-01-01

    We present, a quantum secure direct communication scheme achieved by swapping quantum entanglement. In this scheme a set of ordered Einstein-Podolsky-Rosen (HPIl) pairs is used as a quantum information channel for sending secret messages directly. After insuring the safety of the quantum channel, the sender Alice encodes the secret messages directly by applying a series local operations on her particle sequences according to their stipulation. Using three EPR pairs, three bits of secret classical information can be faithfully transmitted from Alice to remote Bob without revealing any information to a potential eavesdropper. By both Alice and Bob's GHZ state measurement results, Bob is able to read out the encoded secret messages directly. The protocol is completely secure if perfect quantum channel is used, because there is not a transmission of the qubits carrying the secret message between Alice and Bob in the public channel.

  6. Ion pairing in ionic liquids

    International Nuclear Information System (INIS)

    Kirchner, Barbara; Malberg, Friedrich; Firaha, Dzmitry S; Hollóczki, Oldamur

    2015-01-01

    In the present article we briefly review the extensive discussion in literature about the presence or absence of ion pair-like aggregates in ionic liquids. While some experimental studies point towards the presence of neutral subunits in ionic liquids, many other experiments cannot confirm or even contradict their existence. Ion pairs can be detected directly in the gas phase, but no direct method is available to observe such association behavior in the liquid, and the corresponding indirect experimental proofs are based on such assumptions as unity charges at the ions. However, we have shown by calculating ionic liquid clusters of different sizes that assuming unity charges for ILs is erroneous, because a substantial charge transfer is taking place between the ionic liquid ions that reduce their total charge. Considering these effects might establish a bridge between the contradicting experimental results on this matter. Beside these results, according to molecular dynamics simulations the lifetimes of ion–ion contacts and their joint motions are far too short to verify the existence of neutral units in these materials. (topical review)

  7. Some advances in pairing theory

    International Nuclear Information System (INIS)

    Rowe, D.J.

    2001-01-01

    Two advances are reviewed in the application of pairing-force theory in the nuclear shell model. The first exploits a discovery that a wide range of two-nucleon interactions conserve seniority as a good quantum number. As a consequence, the eigenstates of a Hamiltonian with such an interaction belong to irreducible representations of a compact unitary-symplectic group. This makes it possible to extend the simply-solvable models with J=0 pairing forces to a much richer set of models and still obtain states uniquely classified by their seniority and angular momentum quantum numbers. Moreover, many of the low-lying energy levels of such models can be obtained algebraically; in technical terms, the models are in some cases completely solvable and in other cases partially solvable by algebraic methods. The second advance exploits the discovery that, in a coherent state representation, states of good nucleon number can be projected analytically from BCS vacuum and excited quasiparticle states. This makes it possible to perform calculations in a number-projected BCS basis without losing much of the advantage of working of the quasiparticle scheme. (Author)

  8. Cultural Transmission of Civicness

    DEFF Research Database (Denmark)

    Ljunge, Jan Martin

    2012-01-01

    This paper estimates the intergeneration transmission of civicness by studying second generation immigrants in 29 European countries with ancestry in 83 nations. There is significant transmission of civicness both on the mother’s and the father’s side. The estimates are quantitatively significant...

  9. Cultural Transmission of Civicness

    DEFF Research Database (Denmark)

    Ljunge, Jan Martin

    This paper estimates the intergeneration transmission of civicness by studying second generation immigrants in 29 European countries with ancestry in 83 nations. There is significant transmission of civicness both on the mother’s and the father’s side. The estimates are quantitatively significant...

  10. Poverty and price transmission

    DEFF Research Database (Denmark)

    Elleby, Christian

    A key parameter determining the welfare impact from a world market shock is the transmission elasticity which measures the average domestic response to an international price change. Many studies have estimated price transmission elasticities for a large number of countries but the variation in t...

  11. Transmission market support system

    International Nuclear Information System (INIS)

    Reinschmidt, K.F.; Coles, B.C.

    1995-01-01

    An interactive, computer-based market support system has been developed for transmission access that is efficient, equitable, and fair to all parties concerned with electrical transmission: utilities, electric generators, owners of transmission networks, and wholesale purchasers of electrical power. Each participant transmits electronically to the computer system his proposed price schedule for buying, selling, or transmitting power for each future time period. The price for transmission on a single line in one direction can differ from the price in the other direction. The total quantity offered in the transmission bid represents the capacity of the line, and the flow on the line cannot exceed this value. The system automatically computes the prices that clear the market; that is, the price that each generator receives at each bus, the price that each transmission operator receives on each line, and the price that each customer pays at each bus. The computer system maximizes the benefits to all three classes while satisfying the electrical characteristics of the transmission system by means of load flow calculations. Customers never pay more than their bid prices (but may pay less), and generators and transmission operators never receive less than their bid prices (but may receive more). The price at each bus applies to all buyers and sellers at that bus: all buyers at the same bus pay the same price and all generators at a bus receive the same price

  12. Pricing transmission services

    International Nuclear Information System (INIS)

    Haaden, E.

    1995-01-01

    The price structure for transmission of electric power through the main lines in Sweden is analyzed. After deregulation of the electricity market, the main transmission lines are owned by a separate national company, with no interests from the power producers. Comparisons are made to ideal marginal price structures. 6 refs

  13. Eliminating Perinatal HIV Transmission

    Centers for Disease Control (CDC) Podcasts

    In this podcast, CDC’s Dr. Steve Nesheim discusses perinatal HIV transmission, including the importance of preventing HIV among women, preconception care, and timely HIV testing of the mother. Dr. Nesheim also introduces the revised curriculum Eliminating Perinatal HIV Transmission intended for faculty of OB/GYN and pediatric residents and nurse midwifery students.

  14. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

    2014-01-01

    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  15. Dynamical pairing correlations in rotating nuclei

    International Nuclear Information System (INIS)

    Szymanski, Z.

    1985-01-01

    When the atomic nucleus rotates fast enough the static pair correlations may be destroyed. In this situation the pair-vibrations become an important manifestation of the short-range attractive pairing force. The influence of this effect on nuclear properties at high spin is discussed. (orig.)

  16. Electric transmission technology

    International Nuclear Information System (INIS)

    Shah, K.R.

    1990-01-01

    Electric transmission technology has matured and can transmit bulk power more reliably and economically than the technology 10 years ago.In 1882, Marcel Depres transmitted 15 kW electric power at 2 kV, using a constant direct current; present transmission voltages have risen to ± 600 kV direct current (DC) and 765 kV alternating current (AC), and it is now possible to transmit bulk electric power at voltages as high as ± 1000 kV DC and 1500 kV AC. Affordable computer systems are now available to optimize transmission reliably. New materials have reduced the bulk of insulation for lines and equipment. New conducting materials and configurations have reduced losses in transmission. Advances in line structures and conductor motion, understanding of flashover characteristics of insulators and air-gaps and electrical performance of lines have resulted in more compact urban transmission lines. (author). 15 refs., 7 tabs., 11 figs

  17. Microwave energy transmission

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Hiroshi [Kyoto Univ. (Japan)

    1989-03-05

    Laying stress on the technological problems and effect on the environment of microwave energy transmission, recent scientific and engineering problems and related subjects are described. Because no fuel is required for the solar power generation, the power generation system can not be considered as an expensive one when the unit cost of energy is taken into consideration. Some of the important technological problems in the microwave energy transmission are accurate microwave beam control technology to receiving stations and improvement in the efficiency of transmission system. Microwave energy beam has effects on living bodies, communication, and plasma atmosphere of the earth. Microwave energy transmission using a space flyer unit is scheduled. Its objective is the development of microwave wireless transmission technology and the study of the correlation between high power microwave and ionosphere plasma. Experiments on such a small scale application as a microwave driven space ship to bring results seem also important. 12 refs., 13 figs.

  18. Pair shell model description of collective motions

    International Nuclear Information System (INIS)

    Chen Hsitseng; Feng Dahsuan

    1996-01-01

    The shell model in the pair basis has been reviewed with a case study of four particles in a spherical single-j shell. By analyzing the wave functions according to their pair components, the novel concept of the optimum pairs was developed which led to the proposal of a generalized pair mean-field method to solve the many-body problem. The salient feature of the method is its ability to handle within the framework of the spherical shell model a rotational system where the usual strong configuration mixing complexity is so simplified that it is now possible to obtain analytically the band head energies and the moments of inertia. We have also examined the effects of pair truncation on rotation and found the slow convergence of adding higher spin pairs. Finally, we found that when the SDI and Q .Q interactions are of equal strengths, the optimum pair approximation is still valid. (orig.)

  19. Cost characteristics of transmission

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    FERC regulation of transmission is predicated, at least in part, on a belief that, in the absence of regulation, some utilities would be able to exercise monopoly power and the ability to extract monopoly profits. This monopoly power follows from the view that transmission facilities inevitably are a natural monopoly for both economic and social/regulatory reasons. In the first part of this section the authors present the argument that transmission is a natural monopoly. They then consider the impact of this on regulation and the problems that that view creates

  20. Understanding Ebola Virus Transmission

    Directory of Open Access Journals (Sweden)

    Seth Judson

    2015-02-01

    Full Text Available An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

  1. Nonlinear dynamics modelling of multistage micro-planetary gear transmission

    Directory of Open Access Journals (Sweden)

    Li Jianying

    2018-01-01

    Full Text Available The transmission structure of a 2K-H multistage micro-planetary gear transmission reducer is described in detail, and three assumptions are supposed in dynamic modelling. On basis of these assumptions, a three stages 2K-H micro-planetary gear transmission dynamic model is established, in which the relative displacement each meshing gear pairs can be obtained after including the comprehensive transmission error. According to gear kinematics, the friction arms between the sun gear, the ring gear and the nth planet are also obtained, and the friction coefficient in the mixed elastohydrodynamic lubrication is considered, the transmission system motion differential equations are obtained, including above factors and the time-varying meshing stiffness, damping and backlash, inter-stage coupling stiffness, it can be provided an theoretical foundation for further analysing the parameter sensitivity, dynamic stability and designing.

  2. Adaptation of H9N2 AIV in guinea pigs enables efficient transmission by direct contact and inefficient transmission by respiratory droplets

    Science.gov (United States)

    Sang, Xiaoyu; Wang, Airong; Ding, Jie; Kong, Huihui; Gao, Xiaolong; Li, Lin; Chai, Tongjie; Li, Yuanguo; Zhang, Kun; Wang, Chengyu; Wan, Zhonghai; Huang, Geng; Wang, Tiecheng; Feng, Na; Zheng, Xuexing; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Qian, Jun; Hu, Guixue; Gao, Yuwei; Xia, Xianzhu

    2015-01-01

    H9N2 avian influenza viruses circulate worldwide in poultry and have sporadically infected humans, raising concern whether H9N2 viruses have pandemic potential. Here, we use a guinea pig model to examine whether serial passage results in adaptive viral changes that confer a transmissible phenotype to a wild-type H9N2 virus. After nine serial passages of an H9N2 virus through guinea pigs, productive transmission by direct contact occurred in 2/3 guinea pig pairs. The efficiency of transmission by direct contact increased following the fifteenth passage and occurred in 3/3 guinea pig pairs. In contrast, airborne transmission of the passaged virus was less efficient and occurred in 1/6 guinea pig pairs and 0/6 ferret pairs after the fifteenth passage. Three amino acid substitutions, HA1-Q227P, HA2-D46E, and NP-E434K, were sufficient for contact transmission in guinea pigs (2/3 pairs). The two HA amino acid substitutions enhanced receptor binding to α2,3-linked sialic acid receptors. Additionally, the HA2-D46E substitution increased virus thermostability whereas the NP-E434K mutation enhanced viral RNA polymerase activity in vitro. Our findings suggest that adaptive changes that enhance viral receptor binding, thermostability, and replicative capacity in mammalian cells can collectively enhance the transmissibility of H9N2 AIVs by direct contact in the guinea pig model. PMID:26552719

  3. Transmissions in vehicles 2010

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-07-01

    Within the international VDI congress 'Gears in vehicles 2010' of the VDI Wissensforum GmbH (Duesseldorf, Federal Republic of Germany) between 22nd and 23rd June, 2010, in Friedrichshafen (Federal Republic of Germany), the following lectures were held: (1) 8HP70H - The moldhybrid transmission from ZF - Cjallenges and achievements (P. Gutmann); (2) GETRAG boosted range extender - A highly flexible electric powertrain for maximum CO{sub 2} reduction (S. Huepkes); (3) E-Transmission between full-hybrid and E-drive (P. Tenberge); (4) Reducing NO{sub x} and particulate emissions in electrified drivelines (R. Kuberczyk); (5) Simulation aided HEV and EV development: from the component to the whole powertrain (A. Gacometti); (6) Investigations on operating behaviour of the optimized CVT hybrid driveline (B.-R. Hoehn); (7) Customer-oriented dimensioning of electrified drivetrains (M. Eghtessad); (8) Decentralized optimal control strategy for parallel hybrid electric vehicles (A. Frenkel); (9) The new generation 6-speed automatic transmission AF40 (G. Bednarek); (10) Customized mechatronic solutions for integrated transmission control units (M. Wieczorek); (11) The optimal automatic transmission for front-transverse applications - Planetary transmissions or dual clutch transmissions? (G. Gumpoltsberger); (12) The new shift-by-wire gearshift lever for the Audi A8 - Requirements and concept (T. Guttenbergere); (13) The new shift-by-wire gearshift lever for the Audi A8 - Realization (A. Giefer); (14) Fuel-efficient transmissions of the future: Calculation of the efficiency factor for vehicle transmissions (B. Volpert); (15) HT-ACM: A new polymer generation for static and dynamic gearbox sealing solutions (E. Osen); (16) 'Energy efficiency equipped solutions by SKF' for power train applications - A contribution to CO{sub 2} - emission reduction and sustainability (T. Bobke); (17) 6-Ratio planetary shift transmission controlled by 4 external brakes, and design

  4. Solar Drift-Pair Bursts

    Science.gov (United States)

    Stanislavsky, A.; Volvach, Ya.; Konovalenko, A.; Koval, A.

    2017-08-01

    In this paper a new sight on the study of solar bursts historically called drift pairs (DPs) is presented. Having a simple morphology on dynamic spectra of radio records (two short components separated in time, and often they are very similar) and discovered at the dawn of radio astronomy, their features remain unexplained totally up to now. Generally, the DPs are observed during the solar storms of type III bursts, but not every storm of type III bursts is linked with DPs. Detected by ground-based instruments at decameter and meter wavelengths, the DP bursts are limited in frequency bandwidth. They can drift from high frequencies to low ones and vice versa. Their frequency drift rate may be both lower and higher than typical rates of type III bursts at the same frequency range. The development of low-frequency radio telescopes and data processing provide additional possibilities in the research. In this context the fresh analysis of DPs, made from recent observations in the summer campaign of 2015, are just considered. Their study was implemented by updated tools of the UTR-2 radio telescope at 9-33 MHz. During 10-12 July of 2015, DPs forming the longest patterns on dynamic spectra are about 7% of the total number of recorded DPs. Their marvelous resemblance in frequency drift rates with the solar S-bursts is discussed.

  5. Production of magnetic monopole pairs

    International Nuclear Information System (INIS)

    Maher, R.L.

    1980-01-01

    Using a covariant photon propagator (developed by W.B. Campbell) to represent a photon exchange between a magnetic monopole and an electric charge, the first order production amplitudes in a Feynman-Dyson perturbation expansion and the resulting differential cross-sections are calculated for monopole pair creation from: (i) electron positron annihilation, (ii) photon scattering in the presence of a nucleus, and (iii) electron scattering in the presence of a nucleus. This theory does not specify the spin character of magnetic monopoles, so all processes are calculated twice: for spin zero monopoles and for spin one-half monopoles. In the first and last processes the differential cross-sections have sufficiently different dependences on the production angles (associated with the monopoles momenta), so that near threshold experiments could distinguish between whether monopoles are either spin one-half or spin zero entities. For the t'Hooft monopole mass estimate (5-8 x 10 3 GeV) very high energy particle and photon beam sources would be required to achieve threshold for these production processes

  6. Transmission issues in Alberta

    International Nuclear Information System (INIS)

    Levson, D.

    2002-01-01

    This paper outlined the major issues and concerns facing users of the transmission system in Alberta. They include congestion management issues that make investors uncertain about power generation. It is necessary to know the difference between which transmission price signals will be faced by low cost cogeneration at Fort McMurray and Cold Lake coal-fired generation near Edmonton compared to combined cycle gas generation near Calgary. Import and export policy tariffs are another concern. Most new generation opportunities in Alberta require access to export markets, but transmission facilities for export need policy support and appropriate tariffs. It was noted that the past actions of Alberta's Transmission Administrator and balancing pool may be distorting market signals for ancillary service markets, and that loss studies and calculations need upgrading

  7. Kansas Electric Transmission Lines

    Data.gov (United States)

    Kansas Data Access and Support Center — This data set is a digital representation of the EletcircTransmission lines for the State of Kansas as maintained by the Kansas Corporation Commission. Data is...

  8. ECRH transmission system

    International Nuclear Information System (INIS)

    Tancredi, J.

    1983-01-01

    Hughes, Electron Dynamics Division is developing gyrotrons for ECRH requirements. In the development program, techniques have been evolved for transmission system components. These techniques include over-moded waveguide tapers, high average power windows, and rf water loads for testing

  9. Electric Power Transmission Lines

    Data.gov (United States)

    Department of Homeland Security — Transmission Lines are the system of structures, wires, insulators and associated hardware that carry electric energy from one point to another in an electric power...

  10. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  11. Airspace: Antarctic Sound Transmission

    OpenAIRE

    Polli, Andrea

    2009-01-01

    This paper investigates how sound transmission can contribute to the public understanding of climate change within the context of the Poles. How have such transmission-based projects developed specifically in the Arctic and Antarctic, and how do these works create alternative pathways in order to help audiences better understand climate change? The author has created the media project Sonic Antarctica from a personal experience of the Antarctic. The work combines soundscape recordings and son...

  12. Offshore Transmission Technology

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-10-15

    The purpose of this document is to give an overview of offshore electricity transmission technologies. In particular this document is concerned with the use of High Voltage Direct Current (HVDC) systems and more specifically with the development of Voltage Source Converter (VSC) technology. This report outlines the current state of the main technology groups required for offshore HVDC transmission as well as giving examples of offshore projects (both current and future). Finally some indications of likely unit costs for HV assets are given.

  13. Eliminating Perinatal HIV Transmission

    Centers for Disease Control (CDC) Podcasts

    2012-11-26

    In this podcast, CDC’s Dr. Steve Nesheim discusses perinatal HIV transmission, including the importance of preventing HIV among women, preconception care, and timely HIV testing of the mother. Dr. Nesheim also introduces the revised curriculum Eliminating Perinatal HIV Transmission intended for faculty of OB/GYN and pediatric residents and nurse midwifery students.  Created: 11/26/2012 by Division of HIV/AIDS Prevention.   Date Released: 11/26/2012.

  14. Optical analog transmission device

    International Nuclear Information System (INIS)

    Ikawa, Shinji.

    1994-01-01

    The present invention concerns a device such as electro-optical conversion elements, optoelectric-electric elements and optical transmission channel, not undergoing deleterious effects on the efficiency of conversion and transmission due to temperature, and aging change. That is, a sine wave superposing means superposes, on a detector signal to be transmitted, a sine-wave signal having a predetermined amplitude and at a frequency lower than that of the detector signal. An optoelectric conversion means converts the electric signal as the signal of the sine-wave signal superposing means into an optical signal and outputs the same to an optical transmitting channel. The optoelectric conversion means converts the transmitted signal to an electric signal. A discriminating means discriminates the electric signal into a detector signal and a sine-wave signal. A calculating means calculates an optical transmitting efficiency of the transmitting channel based on the amplitude of the discriminated sine-wave signal. A processing means compensates an amplitude value of the detector signals discriminated by the discriminating means based on the optical transmission efficiency. As a result, an optical analog transmission device can be attained, which conducts optical transmission at a high accuracy without undergoing the defective effects of the optical transmission efficiency. (I.S.)

  15. National transmission grid study

    Energy Technology Data Exchange (ETDEWEB)

    Abraham, Spencer [USDOE Office of the Secretary of Energy, Washington, DC (United States)

    2003-05-31

    The National Energy Policy Plan directed the U.S. Department of Energy (DOE) to conduct a study to examine the benefits of establishing a national electricity transmission grid and to identify transmission bottlenecks and measures to address them. DOE began by conducting an independent analysis of U.S. electricity markets and identifying transmission system bottlenecks using DOE’s Policy Office Electricity Modeling System (POEMS). DOE’s analysis, presented in Section 2, confirms the central role of the nation’s transmission system in lowering costs to consumers through increased trade. More importantly, DOE’s analysis also confirms the results of previous studies, which show that transmission bottlenecks and related transmission system market practices are adding hundreds of millions of dollars to consumers’ electricity bills each year. A more detailed technical overview of the use of POEMS is provided in Appendix A. DOE led an extensive, open, public input process and heard a wide range of comments and recommendations that have all been considered.1 More than 150 participants registered for three public workshops held in Detroit, MI (September 24, 2001); Atlanta, GA (September 26, 2001); and Phoenix, AZ (September 28, 2001).

  16. Lisianthus cultivation using differentiated light transmission nets

    Directory of Open Access Journals (Sweden)

    Paulo Hercilio Viegas Rodrigues

    2016-08-01

    Full Text Available The Lisianthus stands out as one of the ten most cut flowers sold in the world. The use of meshes in a different light transmission is gaining more space in horticulture with promising results in greenhouse. The aim of this study was to evaluate the development of lisianthus grown in different light transmission meshes in blue, black, red and control treatments, which were transplanted 20 seedlings to cultivate Snow white with three replications, and therefore, 60 plants 240 plants per treatment in total. Agronomic characteristics such as plant height and length of the top pair of leaves were evaluated at 15, 38, 59, 82 and 105 days after transplanting. Other features such as early flowering, thick stem, distance between us and weight of the harvested stems were obtained at harvest stage. At the end of the evaluations, the treatment of red net was the most consistent with a significant difference in stem height and earliness in flowering.

  17. Wireless data signal transmission system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method for providing a radio frequency signal for transmission, a system for providing a radio frequency signal for transmission and a method for wireless data transmission between a transmitter and a receiver.......The present invention relates to a method for providing a radio frequency signal for transmission, a system for providing a radio frequency signal for transmission and a method for wireless data transmission between a transmitter and a receiver....

  18. An Entropic Approach for Pair Trading

    Directory of Open Access Journals (Sweden)

    Daisuke Yoshikawa

    2017-06-01

    Full Text Available In this paper, we derive the optimal boundary for pair trading. This boundary defines the points of entry into or exit from the market for a given stock pair. However, if the assumed model contains uncertainty, the resulting boundary could result in large losses. To avoid this, we develop a more robust strategy by accounting for the model uncertainty. To incorporate the model uncertainty, we use the relative entropy as a penalty function in the expected profit from pair trading.

  19. Magnetized pair Bose gas: relativistic superconductor

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.

    1993-01-01

    The magnetized Bose gas at temperatures above pair threshold is investigated. New magnetization laws are obtained for a wide range of field strengths, and the gas is shown to exhibit the Meissner effect. Some related results for the Fermi gas, a relativistic paramagnet, are also discussed. It is concluded that the pair gases, through the interplay between pair creation, temperature, field strength, statistics and/in the case of fermions/spin, have remarkable magnetic properties. 14 refs

  20. Embodied intersubjective engagement in mother-infant tactile communication: a cross-cultural study of Japanese and Scottish mother-infant behaviors during infant pick-up.

    Science.gov (United States)

    Negayama, Koichi; Delafield-Butt, Jonathan T; Momose, Keiko; Ishijima, Konomi; Kawahara, Noriko; Lux, Erin J; Murphy, Andrew; Kaliarntas, Konstantinos

    2015-01-01

    This study examines the early development of cultural differences in a simple, embodied, and intersubjective engagement between mothers putting down, picking up, and carrying their infants between Japan and Scotland. Eleven Japanese and ten Scottish mothers with their 6- and then 9-month-old infants participated. Video and motion analyses were employed to measure motor patterns of the mothers' approach to their infants, as well as their infants' collaborative responses during put-down, pick-up, and carry phases. Japanese and Scottish mothers approached their infants with different styles and their infants responded differently to the short duration of separation during the trial. A greeting-like behavior of the arms and hands was prevalent in the Scottish mothers' approach, but not in the Japanese mothers' approach. Japanese mothers typically kneeled before making the final reach to pick-up their children, giving a closer, apparently gentler final approach of the torso than Scottish mothers, who bent at the waist with larger movements of the torso. Measures of the gap closure between the mothers' hands to their infants' heads revealed variably longer duration and distance gap closures with greater velocity by the Scottish mothers than by the Japanese mothers. Further, the sequence of Japanese mothers' body actions on approach, contact, pick-up, and hold was more coordinated at 6 months than at 9 months. Scottish mothers were generally more variable on approach. Measures of infant participation and expressivity indicate more active participation in the negotiation during the separation and pick-up phases by Scottish infants. Thus, this paper demonstrates a culturally different onset of development of joint attention in pick-up. These differences reflect cultures of everyday interaction.

  1. Variational study of the pair hopping model

    International Nuclear Information System (INIS)

    Fazekas, P.

    1990-01-01

    We study the ground state of a Hamiltonian introduced by Kolb and Penson for modelling situations in which small electron pairs are formed. The Hamiltonian consists of a tight binding band term, and a term describing the nearest neighbour hopping of electron pairs. We give a Gutzwiller-type variational treatment, first with a single-parameter Ansatz treated in the single site Gutzwiller approximation, and then with more complicated trial wave functions, and an improved Gutzwiller approximation. The calculation yields a transition from a partially paired normal state, in which the spin susceptibility has a diminished value, into a fully paired state. (author). 16 refs, 2 figs

  2. Dual origin of pairing in nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Idini, A. [University of Jyvaskyla, Department of Physics (Finland); Potel, G. [Michigan State University, National Superconducting Cyclotron Laboratory (United States); Barranco, F. [Escuela Superior de Ingenieros, Universidad de Sevilla, Departamento de Fìsica Aplicada III (Spain); Vigezzi, E., E-mail: enrico.vigezzi@mi.infn.it [INFN Sezione di Milano (Italy); Broglia, R. A. [Università di Milano, Dipartimento di Fisica (Italy)

    2016-11-15

    The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  3. Pair production in small angle Bhabha scattering

    International Nuclear Information System (INIS)

    Arbuzov, A.B.; Kuraev, Eh.A.; Merenkov, N.P.; Trentadue, L.

    1995-01-01

    The radiative corrections due to a pair production in the small angle high energy e + e - Bhabha scattering are considered. The corrections due to the production of virtual pairs as well as real soft and hard ones are calculated analytically. The collinear and semi-collinear kinematical regions of the hard pair production are taken into account. The results in the leading and next-to-leading logarithmic approximations provide the accuracy of Ο (0.1%). The results of numerical calculations show that the effects of pairs production are to be taken into account in the precise luminosity determination at LEP. 9 refs., 3 figs., 2 tabs

  4. Heteroditopic receptors for ion-pair recognition.

    Science.gov (United States)

    McConnell, Anna J; Beer, Paul D

    2012-05-21

    Ion-pair recognition is a new field of research emerging from cation and anion coordination chemistry. Specific types of heteroditopic receptor designs for ion pairs and the complexity of ion-pair binding are discussed to illustrate key concepts such as cooperativity. The importance of this area of research is reflected by the wide variety of potential applications of ion-pair receptors, including applications as membrane transport and salt solubilization agents and sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Dual origin of pairing in nuclei

    Science.gov (United States)

    Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

    2016-11-01

    The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  6. Finding Maximal Pairs with Bounded Gap

    DEFF Research Database (Denmark)

    Brodal, Gerth Stølting; Lyngsø, Rune B.; Pedersen, Christian N. S.

    1999-01-01

    . In this paper we present methods for finding all maximal pairs under various constraints on the gap. In a string of length n we can find all maximal pairs with gap in an upper and lower bounded interval in time O(n log n+z) where z is the number of reported pairs. If the upper bound is removed the time reduces...... to O(n+z). Since a tandem repeat is a pair where the gap is zero, our methods can be seen as a generalization of finding tandem repeats. The running time of our methods equals the running time of well known methods for finding tandem repeats....

  7. Pair plasma in pulsar magnetospheres

    International Nuclear Information System (INIS)

    Asseo, Estelle

    2003-01-01

    The main features of radiation received from pulsars imply that they are neutron stars which contain an extremely intense magnetic field and emit coherently in the radio domain. Most recent studies attribute the origin of the coherence to plasma instabilities arising in pulsar magnetospheres; they mainly concern the linear, or the nonlinear, character of the involved unstable waves. We briefly introduce radio pulsars and specify physical conditions in pulsar emission regions: geometrical properties, magnetic field, pair creation processes and repartition of relativistic charged particles. We point to the main ingredients of the linear theory, extensively explored since the 1970s: (i) a dispersion relation specific to the pulsar case; (ii) the characteristics of the waves able to propagate in relativistic pulsar plasmas; (iii) the different ways in which a two-humped distribution of particles may arise in a pulsar magnetosphere and favour the development of a two-stream instability. We sum up recent improvements of the linear theory: (i) the determination of a 'coupling function' responsible for high values of the wave field components and electromagnetic energy available; (ii) the obtention of new dispersion relations for actually anisotropic pulsar plasmas with relativistic motions and temperatures; (iii) the interaction between a plasma and a beam, both with relativistic motions and temperatures; (iv) the interpretation of observed 'coral' and 'conal' features, associated with the presence of boundaries and curved magnetic field lines in the emission region; (v) the detailed topology of the magnetic field in the different parts of the emission region and its relation to models recently proposed to interpret drifting subpulses observed from PSR 0943+10, showing 20 sub-beams of emission. We relate the nonlinear evolution of the two-stream instability and development of strong turbulence in relativistic pulsar plasmas to the emergence of relativistic solitons, able

  8. Transmission line capital costs

    International Nuclear Information System (INIS)

    Hughes, K.R.; Brown, D.R.

    1995-05-01

    The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs

  9. Transmission positron microscopes

    International Nuclear Information System (INIS)

    Doyama, Masao; Kogure, Yoshiaki; Inoue, Miyoshi; Kurihara, Toshikazu; Yoshiie, Toshimasa; Oshima, Ryuichiro; Matsuya, Miyuki

    2006-01-01

    Immediate and near-future plans for transmission positron microscopes being built at KEK, Tsukuba, Japan, are described. The characteristic feature of this project is remolding a commercial electron microscope to a positron microscope. A point source of electrons kept at a negative high voltage is changed to a point source of positrons kept at a high positive voltage. Positional resolution of transmission microscopes should be theoretically the same as electron microscopes. Positron microscopes utilizing trapping of positrons have always positional ambiguity due to the diffusion of positrons

  10. ETR transmission systems

    International Nuclear Information System (INIS)

    Metzler, D.

    1983-01-01

    The presentation concentrates on factors associated with transmission systems for reactors and/or reactor relevant devices. For present day mirrors and their upgrades where power levels are in the few hundred kW range, waveguide systems with mode control are preferred. Beyond the early 1990's time frame are the ETR DEMO and reactor devices. These require injected power levels of about 75 MW. If only power oscillators are available at that time, then a MARS like transmission system may be appropriate or possibly a guided wave waveguide

  11. Transmission grid security

    CERN Document Server

    Haarla, Liisa; Hirvonen, Ritva; Labeau, Pierre-Etienne

    2011-01-01

    In response to the growing importance of power system security and reliability, ""Transmission Grid Security"" proposes a systematic and probabilistic approach for transmission grid security analysis. The analysis presented uses probabilistic safety assessment (PSA) and takes into account the power system dynamics after severe faults. In the method shown in this book the power system states (stable, not stable, system breakdown, etc.) are connected with the substation reliability model. In this way it is possible to: estimate the system-wide consequences of grid faults; identify a chain of eve

  12. Stereo Pair: Wellington, New Zealand

    Science.gov (United States)

    2000-01-01

    Wellington, the capital city of New Zealand, is located on the shores of Port Nicholson, a natural harbor at the south end of North Island. The city was founded in 1840 by British emigrants and now has a regional population of more than 400,000 residents. As seen here, the natural terrain imposes strong control over the urban growth pattern (urban features generally appear gray or white in this view). Rugged hills generally rising to 300 meters (1,000 feet) help protect the city and harbor from strong winter windsNew Zealand is seismically active and faults are readily seen in the topography. The Wellington Fault forms the straight northwestern (left) shoreline of the harbor. Toward the southwest (down) the fault crosses through the city, then forms linear canyons in the hills before continuing offshore at the bottom. Toward the northeast (upper right) the fault forms the sharp mountain front along the northern edge of the heavily populated Hutt Valley.This stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced true color Landsat7 satellite image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30 meter (99 foot) spatial resolution of most Landsat images and will provide a valuable complement for studying the historic and growing Landsat data archive. The Landsat 7 Thematic Mapper image used here was provided to the SRTM project by the United States Geological Survey, Earth Resources Observation Systems (EROS) data Center, Sioux Falls, South Dakota.Elevation data used in this image

  13. SRTM Stereo Pair: Fiji Islands

    Science.gov (United States)

    2000-01-01

    image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.This image was acquired by SRTM aboard the Space Shuttle Endeavour, launched on February 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. SRTM was designed to collect three-dimensional measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter-long (about 200 feet) mast, installed additional C-band and X-band antennas, and improved tracking and navigation devices. The mission is a cooperative project between the National Aeronautics and Space Administration (NASA), the National Imagery and Mapping Agency (NIMA) of the U.S. Department of Defense (DoD), and the German and Italian space agencies. It is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Earth Science Enterprise, Washington, DC.Size: 192 km (119 miles) x 142 km (88 miles) Location: 17.8 deg. South lat., 178.0 deg. East lon. Orientation: North at top Date Acquired: February 19, 2000 Image: NASA/JPL/NIMA

  14. Hole pairing induced by antiferromagnetic spin fluctuations

    International Nuclear Information System (INIS)

    Su, Z.B.; Yu Lu; Dong, J.M.; Tosatti, E.

    1987-08-01

    The effective interaction induced by antiferromagnetic spin fluctuations is considered in the random phase approximation in the context of the recently discovered high T c oxide superconductors. This effective attraction favours a triplet pairing of holes. The implications of such pairing mechanism are discussed in connection with the current experimental observations. (author). 30 refs, 2 figs

  15. Exploring Pair Programming Benefits for MIS Majors

    Science.gov (United States)

    Dongo, Tendai; Reed, April H.; O'Hara, Margaret

    2016-01-01

    Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS) and Software Engineering (SE) majors have identified benefits such as technical productivity, program/design quality, academic…

  16. Exclusive production of W pairs in CMS

    CERN Document Server

    INSPIRE-00002838

    2014-01-01

    We report the results on the search for exclusive production of $W$ pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at $\\sqrt{s}$~=~7~TeV. The analysis comprises the two-photon production of a $W$ pairs, ${pp\\to p\\,W^{+}W^{-}\\,p\\to p\\,\

  17. Exclusive production of $W$ pairs in CMS

    OpenAIRE

    Da Silveira, Gustavo Gil; CMS

    2014-01-01

    We report the results on the search for exclusive production of $W$ pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at $\\sqrt{s}$~=~7~TeV. The analysis comprises the two-photon production of a $W$ pairs, ${pp\\to p\\,W^{+}W^{-}\\,p\\to p\\,\

  18. Becoming independent through au pair migration

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    . This article argues that, despite this critique, au pairing does play an important formative role for young Filipinas because it opens up for experiences abroad that enable them to be recognised as independent adults in Philippine society. Rather than autonomy, however, au pairs define their independence...

  19. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    ion plasma are discussed. It is shown that the temperature and/or mass difference of both species could produce drift wave in a pair-ion plasma. The results are discussed in the context of the fullerene pair-ion plasma experiment.

  20. A New Secure Pairing Protocol using Biometrics

    NARCIS (Netherlands)

    Buhan, I.R.

    2008-01-01

    Secure Pairing enables two devices, which share no prior context with each other, to agree upon a security association that they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping or to a

  1. Pair creation at large inherent angles

    International Nuclear Information System (INIS)

    Chen, P.; Tauchi, T.; Schroeder, D.V.

    1992-01-01

    In the next-generation linear colliders, the low-energy e + e - pairs created during the collision of high-energy e + e - beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al. At energies where the beamstrahlung parameter Υ lies approximately in the range 0.6 approx-lt Υ approx-lt 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. Since the central issue is the transverse momentum for particles with large angles, the authors notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. In this paper they reinvestigate the problem, following essentially the same equivalent photon approach, but with changes in specific details including the virtual photon spectrum. In addition, various assumptions are made more explicit. The formulas derived are then applied to the collider parameters designed by Palmer

  2. Comparability of results from pair and classical model formulations for different sexually transmitted infections.

    Directory of Open Access Journals (Sweden)

    Jimmy Boon Som Ong

    Full Text Available The "classical model" for sexually transmitted infections treats partnerships as instantaneous events summarized by partner change rates, while individual-based and pair models explicitly account for time within partnerships and gaps between partnerships. We compared predictions from the classical and pair models over a range of partnership and gap combinations. While the former predicted similar or marginally higher prevalence at the shortest partnership lengths, the latter predicted self-sustaining transmission for gonorrhoea (GC and Chlamydia (CT over much broader partnership and gap combinations. Predictions on the critical level of condom use (C(c required to prevent transmission also differed substantially when using the same parameters. When calibrated to give the same disease prevalence as the pair model by adjusting the infectious duration for GC and CT, and by adjusting transmission probabilities for HIV, the classical model then predicted much higher C(c values for GC and CT, while C(c predictions for HIV were fairly close. In conclusion, the two approaches give different predictions over potentially important combinations of partnership and gap lengths. Assuming that it is more correct to explicitly model partnerships and gaps, then pair or individual-based models may be needed for GC and CT since model calibration does not resolve the differences.

  3. Increased clinical anticipation with maternal transmission in benign adult familial myoclonus epilepsy in Japan.

    Science.gov (United States)

    Hitomi, Takefumi; Kobayashi, Katsuya; Jingami, Naoto; Nakagawa, Tomokazu; Imamura, Hisaji; Matsumoto, Riki; Kondo, Takayuki; Chin, Kazuo; Takahashi, Ryosuke; Ikeda, Akio

    2013-12-01

    We recently reported clinical anticipation in Japanese families with benign adult familial myoclonus epilepsy (BAFME). However, it remains unknown whether clinical anticipation is predominantly associated with paternal or maternal transmission. We investigated the relationship between gender of the transmitting parent and clinical anticipation in nine BAFME families. Clinical anticipation regarding either cortical tremor or generalised seizures was observed in all 12 parent/child pairs (8 mother/child pairs and 4 father/child pairs). Moreover, a higher degree of clinical anticipation was associated with maternal transmission than with paternal transmission (p=0.03). Although a causative gene for BAFME still remains unknown, our finding suggests that BAFME and diseases with unstable expanding repeats, including those in non-coding regions, might share a similar molecular mechanism because such diseases often show clinical anticipation with maternal transmission.

  4. Towards an optimal transmission system

    International Nuclear Information System (INIS)

    Calviou, M.

    2005-01-01

    This presentation provided background on National Grid USA and discussed transmission investment in the United States (US) and United Kingdom. It also discussed barriers to transmission investments and improvements, thoughts on solutions and a long-term vision. The presentation identified that transmission investment should follow from clear reliability rules designed to promote better operation and management; investment does not necessarily mean new rights-of-way; and transmission investment should target benefits to customers. It was stated that US transmission investment levels have decreased. A comparison between US and UK transmission investment was presented along with a chart of increasing US congestion costs. Barriers to investment in US transmission include vertical integration; misperception of transmission as a market product; federal and state jurisdiction issues; fragmentation in transmission ownership and operation; rate cap based plans that impact transmission; lack of clarity in cost allocation; and the site selection process. Possible solutions include policy and incentives, promoting independence and resolving structural issues. tabs., figs

  5. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  6. Watching Handball Transmissions

    DEFF Research Database (Denmark)

    Frandsen, Kirsten

    2010-01-01

    and competent when mastering the game and in relation to others. The study shows that entertainment concerns both affective involvement and identity formation, as social and cultural meaning seem to be at the root of involvement. Even though both men and women find great joy in the transmissions, their viewing...

  7. Intergenerational Transmission of Volunteering

    NARCIS (Netherlands)

    Bekkers, René

    2007-01-01

    In this article, I investigate the strength of intergenerational transmission of volunteering for non-profit associations in The Netherlands. Data from the Family Survey of the Dutch Population 2000 reveal that there are significant relations between current volunteering and parental volunteering in

  8. Open access to transmission

    International Nuclear Information System (INIS)

    Keith, D.M.

    1996-01-01

    For the past 12 to 15 years, the US electric power and energy industry and its federal regulators have been going through a prolonged exercise leading to opening up the national interconnected transmission grid for all qualified wholesale users to have open and equal access. The debates have been painful in a sense that not all parties - especially some of the transmission system owning utilities - believe that the concept of Open Access is achievable, due to technical constraints on the systems. The present Open Access activity is limited to wholesales transaction under the federal jurisdiction, but several states are either experimenting with or considering retail wheeling. In fact, the FERC - Federal Energy Regulatory Commission - has already expanded its view to embrace retail transmission, if the retail transaction involves the use of the interstate transmission systems which are under FERC's jurisdiction. This paper delves into some of the results of the technical cost and pricing analysis for open access. The statutes and resulting regulations are not addressed herein. (author). 1 fig

  9. Intergenerational transmission of volunteerism

    NARCIS (Netherlands)

    Bekkers, R.H.F.P.

    2007-01-01

    In this article, I investigate the strength of intergenerational transmission of volunteering for non-profit associations in The Netherlands. Data from the Family Survey of the Dutch Population 2000 reveal that there are significant relations between current volunteering and parental volunteering in

  10. Rumor propagation with heterogeneous transmission in social networks

    Science.gov (United States)

    Vega-Oliveros, Didier A.; Costa, Luciano da F.; Rodrigues, Francisco A.

    2017-02-01

    Rumor models consider that information transmission occurs with the same probability between each pair of nodes. However, this assumption is not observed in social networks, which contain influential spreaders. To overcome this limitation, we assume that central individuals have a higher capacity to convince their neighbors than peripheral subjects. From extensive numerical simulations we find that spreading is improved in scale-free networks when the transmission probability is proportional to the PageRank, degree, and betweenness centrality. In addition, the results suggest that spreading can be controlled by adjusting the transmission probabilities of the most central nodes. Our results provide a conceptual framework for understanding the interplay between rumor propagation and heterogeneous transmission in social networks.

  11. Transmission Reinforcements in the Central American Regional Power System

    Energy Technology Data Exchange (ETDEWEB)

    Elizondo, Marcelo A.; Vallem, Mallikarjuna R.; Samaan, Nader A.; Makarov, Yuri V.; Vyakaranam, Bharat; Nguyen, Tony B.; Munoz, Christian; Herrera, Ricardo; Midence, Diego; Shpitsberg, Anna

    2016-07-25

    The Central American regional interconnected power system (SER) connects the countries members of the Central American regional electricity market (MER): Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, and Panama. The SER was a result of a long term regional effort, and was initially conceived to transfer 300 MW between countries. However, the current transfer limits between countries range from 70 MW to 300 MW. Regional entities, like CRIE (Regional Commission of Electrical Interconnection), EOR (Central American Regional System Operator), and CDMER (Board of Directors of the Central American Market) are working on coordinating the national transmission expansion plans with regional transmission planning efforts. This paper presents experience in Central America region to recommend transmission reinforcements to achieve 300 MW transfer capacity between any pair of member countries of the Central American regional electricity market (MER). This paper also provides a methodology for technical analysis and for coordination among the regional and national entities. This methodology is unique for transmission systems of these characteristics.

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. String pair production in non homogeneous backgrounds

    Energy Technology Data Exchange (ETDEWEB)

    Bolognesi, S. [Department of Physics “E. Fermi” University of Pisa, and INFN - Sezione di Pisa,Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Rabinovici, E. [Racah Institute of Physics, The Hebrew University of Jerusalem,91904 Jerusalem (Israel); Tallarita, G. [Departamento de Ciencias, Facultad de Artes Liberales,Universidad Adolfo Ibáñez, Santiago 7941169 (Chile)

    2016-04-28

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  14. Thermodynamics of pairing phase transition in nuclei

    International Nuclear Information System (INIS)

    Karim, Afaque; Ahmad, Shakeb

    2014-01-01

    The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied

  15. Exploring Pair Programming Benefits for MIS Majors

    Directory of Open Access Journals (Sweden)

    April H. Reed

    2016-12-01

    Full Text Available Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS and Software Engineering (SE majors have identified benefits such as technical productivity, program/design quality, academic performance, and increased satisfaction for their participants. In this paper, pair programming is studied with Management Information Systems (MIS majors, who (unlike CS and SE majors taking several programming courses typically take only one programming course and often struggle to develop advanced programming skills within that single course. The researchers conducted two pair programming experiments in an introductory software development course for MIS majors over three semesters to determine if pair programming could enhance learning for MIS students. The program results, researchers’ direct observations, and participants’ responses to a survey questionnaire were analyzed after each experiment. The results indicate that pair programming appears to be beneficial to MIS students’ technical productivity and program design quality, specifically the ability to create programs using high-level concepts. Additionally, results confirmed increased student satisfaction and reduced frustration, as the pairs worked collaboratively to produce a program while actively communicating and enjoying the process.

  16. Effect of pairing on nuclear dynamics

    International Nuclear Information System (INIS)

    Scamps, Guillaume

    2014-01-01

    Pairing correlations is an essential component for the description of the atomic nuclei. The effects of pairing on static property of nuclei are now well known. In this thesis, the effect of pairing on nuclear dynamics is investigated. Theories that includes pairing are benchmarked in a model case. The TDHF+BCS theory turns out to be a good compromise between the physics taken into account and the numerical cost. This TDHF+BCS theory was retained for realistic calculations. Nevertheless, the application of pairing in the BCS approximation may induce new problems due to (1) the particle number symmetry breaking, (2) the non-conservation of the continuity equation. These difficulties are analysed in detail and solutions are proposed. In this thesis, a 3 dimensional TDHF+BCS code is developed to simulate the nuclear dynamic. Applications to giant resonances show that pairing modify only the low lying peaks. The high lying collective components are only affected by the initial conditions. An exhaustive study of the giant quadrupole resonances with the TDHF+BCS theory is performed on more than 700 spherical or deformed nuclei. Is is shown that the TDHF+BCS theory reproduces well the collective energy of the resonance. After validation on the small amplitude limit problem, the approach was applied to study nucleon transfer in heavy ion reactions. A new method to extract transfer probabilities is introduced. It is demonstrated that pairing significantly increases the two-nucleon transfer probability. (author) [fr

  17. String pair production in non homogeneous backgrounds

    International Nuclear Information System (INIS)

    Bolognesi, S.; Rabinovici, E.; Tallarita, G.

    2016-01-01

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  18. Low mother-to-child HIV transmission rate but high loss-to-follow-up among mothers and babies in Mandalay, Myanmar; a cohort study.

    Directory of Open Access Journals (Sweden)

    Khine Wut Yee Kyaw

    Full Text Available Loss-to-follow-up (LTFU throughout the Prevention of Mother-To-Child Transmission (PMTCT cascade remains one of the major threats to the success of PMTCT programs. In this study, we aimed to determine the mother-to-child transmission rate in a programmatic setting and to determine factors associated with LTFU among enrolled mothers and unfavorable outcomes among HIV-exposed babies which includes being HIV positive, death and LTFU.A retrospective cohort study reviewing routinely collected data in an Integrated HIV care program, Mandalay, Myanmar in June 2016.LTFU means mother/infant missing appointed visit for more than three months.Of 678 pregnant women enrolled in PMTCT program between March 2011 and June 2014, one stillbirth and 607 live births were recorded in this cohort. Of 457 HIV-exposed babies with HIV-test recorded at the end of the intervention, nine (2% were HIV-positive. Pregnant women's and exposed-babies' LTFU rate was 7 per 1000 person-years, and 10 per 1000 person-years respectively. PMTCT option B protocol was found to be significantly associate with maternal LTFU [adjusted Hazard Ratio (aHR 95% CI: 3.52 (1.38-8.96] when compare to mothers receiving option B+/lifelong antiretroviral therapy (ART. Weight <2.5 Kg at enrolment, receiving mixed-feeding, vaginal delivery and option B PMTCT protocol were significantly associated with unfavorable outcomes among exposed babies [aHR(95% CI: 5.40 (1.66-17.53, 5.91(1.68-20.84, 2.27 (1.22-4.22 and 2.33 (1.16-4.69 respectively].Mother-to-child HIV transmission rate in this public hospital-based program was lower than the 5% national target, which indicates a successful PMTCT intervention. However, a high proportion of HIV-infected mothers and exposed babies LTFU was recorded. Lifelong ART provision to HIV-positive pregnant women was shown to reduce exposed babies' LTFU, death and transmission rate (unfavorable outcomes in this setting. Lessons learned from this program could be used to

  19. Nonrandom network connectivity comes in pairs

    Directory of Open Access Journals (Sweden)

    Felix Z. Hoffmann

    2017-02-01

    Full Text Available Overrepresentation of bidirectional connections in local cortical networks has been repeatedly reported and is a focus of the ongoing discussion of nonrandom connectivity. Here we show in a brief mathematical analysis that in a network in which connection probabilities are symmetric in pairs, Pij = Pji, the occurrences of bidirectional connections and nonrandom structures are inherently linked; an overabundance of reciprocally connected pairs emerges necessarily when some pairs of neurons are more likely to be connected than others. Our numerical results imply that such overrepresentation can also be sustained when connection probabilities are only approximately symmetric.

  20. Soliton pair creation at finite temperatures

    International Nuclear Information System (INIS)

    Grigoriev, D.Yu.; Rubakov, V.A.

    1988-01-01

    Creation of soliton-antisoliton pairs at finite temperature is considered within a (1+1)-dimensional model of a real scalar field. It is argued that at certain temperatures, the soliton pair creation in quantum theory can be investigated by studying classical field evolution in real time. The classical field equations are solved numerically, and the pair creation rate and average number of solitons are evaluated. No peculiar suppression of the rate is observed. Some results on the sphaleron transitions in (1+1)-dimensional abelian Higgs model are also presented. (orig.)

  1. Pairing fluctuations in trapped Fermi gases

    International Nuclear Information System (INIS)

    Viverit, Luciano; Bruun, Georg M.; Minguzzi, Anna; Fazio, Rosario

    2004-01-01

    We examine the contribution of pairing fluctuations to the superfluid order parameter for harmonically trapped atomic Fermi gases in the BCS regime. In the limit of small systems we consider, both analytically and numerically, their space and temperature dependence. We predict a parity effect, i.e., that pairing fluctuations show a maximum or a minimum at the center of the trap, depending on the value of the last occupied shell being even or odd. We propose to detect pairing fluctuations by measuring the density-density correlation function after a ballistic expansion of the gas

  2. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  3. English for au pairs the au pair's guide to learning English

    CERN Document Server

    Curtis, Lucy

    2014-01-01

    English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

  4. Electron transmission through a periodically driven graphene magnetic barrier

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)

    2017-05-10

    Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.

  5. Mechanisms, Transmissions and Applications

    CERN Document Server

    Corves, Burkhard

    2012-01-01

    The first Workshop on Mechanisms, Transmissions and Applications -- MeTrApp-2011 was organized by the Mechatronics Department at the Mechanical Engineering Faculty, “Politehnica” University of Timisoara, Romania, under the patronage of the IFToMM Technical Committees Linkages and Mechanical Controls and Micromachines. The workshop brought together researchers and students who work in disciplines associated with mechanisms science and offered a great opportunity for scientists from all over the world to present their achievements, exchange innovative ideas and create solid international links, setting the trend for future developments in this important and creative field. The topics treated in this volume are mechanisms and machine design, mechanical transmissions, mechatronic and biomechanic applications, computational and experimental methods, history of mechanism and machine science and teaching methods.

  6. Wireless transmission of power

    International Nuclear Information System (INIS)

    Grotz, T.

    1991-01-01

    This paper reports that it has been proven by researchers that electrical energy can be propagated around the world between the surface of the Earth and the ionosphere at extremely low frequencies in what is known as the Schumann Cavity. Experiments to data have shown that electromagnetic waves with frequencies in the range of 8 Hz, the fundamental Schumann Resonance frequency, propagate with litter attenuation around the planet within the Schumann Cavity. It is the intent of this research to determine if the Schumann Cavity can be resonated, if the power that is delivered to the cavity propagated with very low losses, and if power can be extracted at other locations within the cavity. Experimental data collected and calculations made in recent years support the hypothesis that wireless power transmission is a viable and practical alternative to the present systems of power transmission

  7. Regional transmission subsystem planning

    Energy Technology Data Exchange (ETDEWEB)

    Costa Bortoni, Edson da [Quadrante Softwares Especializados Ltda., Itajuba, MG (Brazil); Bajay, Sergio Valdir; Barros Correia, Paulo de [Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia Mecanica; Santos, Afonso Henriques Moreira; Haddad, Jamil [Escola Federal de Engenharia de Itajuba, MG (Brazil)

    1994-12-31

    This work presents an approach for the planning of transmission systems by employing mixed--integer linear programming to obtain a cost and operating characteristics optimized system. The voltage loop equations are written in a modified form, so that, at the end of the analysis, the model behaves as a DC power flow, with the help of the two Kirchhoff`s laws, exempting the need of interaction with an external power flow program for analysis of the line loading. The model considers the occurrence of contingencies, so that the final result is a network robust to the most severe contingencies. This whole technique is adapted to the regional electric power transmission subsystems. (author) 9 refs., 4 figs.

  8. Effects of disorder on the electron pairing

    International Nuclear Information System (INIS)

    Oviedo-Roa, R.; Wang, C.; Navarro, O.

    1996-01-01

    The electron pairing in randomly disordered lattices is studied by using an attractive Hubbard model, and by mapping the many-body problem onto a tight-binding one in a higher dimensional space, where a diagonal disorder is considered within the coherent-potential approximation. The results show an enhancement of the pair-binding energy as the self-energy difference increases in a binary alloy A x B 1-x . This fact suggests that the pairing process is highly sensitive to the one-particle localization condition. A ground-state phase diagram for on-site interaction disorder shows regions where pairing is avoided for ordered diatomic systems but not for disordered case

  9. Pairing properties of realistic effective interactions

    Directory of Open Access Journals (Sweden)

    Gargano A.

    2016-01-01

    Full Text Available We investigate the pairing properties of an effective shell-model interaction defined within a model space outside 132Sn and derived by means of perturbation theory from the CD-Bonn free nucleon-nucleon potential. It turns out that the neutron pairing component of the effective interaction is significantly weaker than the proton one, which accounts for the large pairing gap difference observed in the two-valence identical particle nuclei 134Sn and 134Te. The role of the contribution arising from one particle-one hole excitations in determining the pairing force is discussed and its microscopic structure is also analyzed in terms of the multipole decomposition.

  10. Statistical mechanics of magnetized pair Fermi gas

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.

    1993-01-01

    Following previous work on the magnetized pair Bose gas this contribution presents the statistical mechanics of the charged relativistic Fermi gas with pair creation in d spatial dimensions. Initially, the gas in no external fields is studied. As a result, expansions for the various thermodynamic functions are obtained in both the μ/m→0 (neutrino) limit, and about the point μ/m =1, where μ is the chemical potential. The thermodynamics of a gas of quantum-number conserving massless fermions is also discussed. Then a complete study of the pair Fermi gas in a homogeneous magnetic field, is presented investigating the behavior of the magnetization over a wide range of field strengths. The inclusion of pairs leads to new results for the net magnetization due to the paramagnetic moment of the spins and the diamagnetic Landau orbits. 20 refs

  11. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram

    1998-01-01

    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are

  12. Projected entangled pair states: status and prospects

    Energy Technology Data Exchange (ETDEWEB)

    Verstraete, Frank [Universitaet Wien (Austria)

    2008-07-01

    We report on the progress made to extend the density matrix renormalization group to higher dimensions, discuss the underlying theory of projected entangled pair states (PEPS) and illustrate its potential on the hand of a few examples.

  13. Isovectorial pairing in solvable and algebraic models

    International Nuclear Information System (INIS)

    Lerma, Sergio; Vargas, Carlos E; Hirsch, Jorge G

    2011-01-01

    Schematic interactions are useful to gain some insight in the behavior of very complicated systems such as the atomic nuclei. Prototypical examples are, in this context, the pairing interaction and the quadrupole interaction of the Elliot model. In this contribution the interplay between isovectorial pairing, spin-orbit, and quadrupole terms in a harmonic oscillator shell (the so-called pairing-plus-quadrupole model) is studied by algebraic methods. The ability of this model to provide a realistic description of N = Z even-even nuclei in the fp-shell is illustrated with 44 Ti. Our calculations which derive from schematic and simple terms confirm earlier conclusions obtained by using realistic interactions: the SU(3) symmetry of the quadrupole term is broken mainly by the spin-orbit term, but the energies depends strongly on pairing.

  14. Three mirror pairs of fermion families

    International Nuclear Information System (INIS)

    Montvay, I.

    1988-01-01

    A simple model with three mirror pairs of fermion families is considered which allows for a substantial mixing between the mirror fermion partners without conflicting with known phenomenology. (orig.)

  15. Dynamic Strategic Information Transmission

    OpenAIRE

    Mikhail Golosov; Vasiliki Skreta; Aleh Tsyvinski; Andrea Wilson

    2011-01-01

    This paper studies strategic information transmission in a dynamic environment where, each period, a privately informed expert sends a message and a decision maker takes an action. Our main result is that, in contrast to a static environment, full information revelation is possible. The gradual revelation of information and the eventual full revelation is supported by the dynamic rewards and punishments. The construction of a fully revealing equilibrium relies on two key features. The first f...

  16. Operational electricity transmission rates

    International Nuclear Information System (INIS)

    Roggen, M.

    1997-01-01

    In a liberalized electricity market both the consumers and the producers of electricity must pay for the use of the power transmission network. Thus, the net manager has unlimited options to realize efficiency improvements. A neutral and transparent management of the power grid is necessary to avoid disturbance of the market. KEMA Consulting translated abstract ideas and strategic advices to operational concepts in its report 'A framework for the determination of tariffs of the transport in the Dutch electricity sector'

  17. [Mumps vaccine virus transmission].

    Science.gov (United States)

    Otrashevskaia, E V; Kulak, M V; Otrashevskaia, A V; Karpov, I A; Fisenko, E G; Ignat'ev, G M

    2013-01-01

    In this work we report the mumps vaccine virus shedding based on the laboratory confirmed cases of the mumps virus (MuV) infection. The likely epidemiological sources of the transmitted mumps virus were children who were recently vaccinated with the mumps vaccine containing Leningrad-Zagreb or Leningrad-3 MuV. The etiology of the described cases of the horizontal transmission of both mumps vaccine viruses was confirmed by PCR with the sequential restriction analysis.

  18. Experimental realization of extraordinary acoustic transmission using Helmholtz resonators

    Directory of Open Access Journals (Sweden)

    Brian C. Crow

    2015-02-01

    Full Text Available The phenomenon of extraordinary acoustic transmission through a solid barrier with an embedded Helmholtz resonator (HR is demonstrated. The Helmholtz resonator consists of an embedded cavity and two necks that protrude, one on each side of the barrier. Extraordinary transmission occurs for a narrow spectral range encompassing the resonant frequency of the Helmholtz resonator. We show that an amplitude transmission of 97.5% is achieved through a resonator whose neck creates an open area of 6.25% of the total barrier area. In addition to the enhanced transmission, we show that there is a smooth, continuous phase transition in the transmitted sound as a function of frequency. The frequency dependent phase transition is used to experimentally realize slow wave propagation for a narrow-band Gaussian wave packet centered at the maximum transmission frequency. The use of parallel pairs of Helmholtz resonators tuned to different resonant frequencies is experimentally explored as a means of increasing the transmission bandwidth. These experiments show that because of the phase transition, there is always a frequency between the two Helmholtz resonant frequencies at which destructive interference occurs whether the resonances are close or far apart. Finally, we explain how the phase transition associated with Helmholtz-resonator-mediated extraordinary acoustic transmission can be exploited to produce diffractive acoustic components including sub-wavelength thickness acoustic lenses.

  19. Comparison of First Gear Performance for Manual and Automatic Transmissions

    Directory of Open Access Journals (Sweden)

    Kyle Stottlemyer

    2011-01-01

    Full Text Available The purpose of this project is to compare the first gear performance of an automobile for both its manual and automatic transmission options. Each transmission type has a different gear ratio, which yields a different acceleration curve for each transmission throughout the torque-rpm curve of the engine. The method of integral calculus was used to find an equation which could be used to solve for time at any point in the car's acceleration. The automobile velocity versus time was then graphed to compare each transmissions acceleration trend. This process is similar to that which automotive companies may use when determining what type of transmission to pair with a particular vehicle. By observing the trends in the acceleration graphs, it was determined that there are specific advantages and disadvantages to each type of transmission. Which transmission is the “better” choice is dependent on what application the automobile will be used for (e.g. racing, day-to-day driving, towing/hauling.

  20. Small passenger car transmission test; Chevrolet LUV transmission

    Science.gov (United States)

    Bujold, M. P.

    1980-01-01

    A 1978 Chevrolet LUV manual transmission tested per the applicable portions of a passenger car automatic transmission test code (SAE J65lb) which required drive performance, coast performance, and no load test conditions. Under these test conditions, the transmission attained maximum efficiencies in the upper ninety percent range for both drive performance tests and coast performance tests. The major results of this test (torque, speed, and efficiency curves) are presented. Graphs map the complete performance characteristics for the Chevrolet LUV transmission.

  1. QCD angular correlations for muon pair production

    International Nuclear Information System (INIS)

    Kajantie, K.; Raitio, R.; Lindfors, J.

    1978-01-01

    Angular distributions of muons are discussed in the framework of a QCD treatment of muon pair production in hadron-hadron collisions. The predicted angular effects are independent of the infrared behavior of QCD. Measuring them will permit one to determine whether the origin of the large transverse momentum of the pair is in the quark transverse momenta or in a constituent-constituent subprocess. (author)

  2. Pairing interaction method in crystal field theory

    International Nuclear Information System (INIS)

    Dushin, R.B.

    1989-01-01

    Expressions, permitting to describe matrix elements of secular equation for metal-ligand pairs via parameters of the method of pairing interactions, genealogical coefficients and Clebsch-Gordan coefficients, are given. The expressions are applicable to any level or term of f n and d n configurations matrix elements for the terms of the maximum multiplicity of f n and d n configurations and also for the main levels of f n configurations are tabulated

  3. Influence of quadrupole pairing on backbending

    International Nuclear Information System (INIS)

    Faessler, A.; Wakai, M.

    1978-01-01

    The backbending phenomenon is attributed to the Coriolis antipairing and the rotational alignment effects. We can consider both effects simultaneously by applying the cranked Hartree-Fock-Bogoliubov theory to the description of the rotational motion of nuclei. In usual treatments of the backbending, however, only the monopole pairing force is considered and pairing forces of other types are neglected. This may be the main reason for starting of the backbending at too small total angular momentum in theoretical results. (orig.) [de

  4. Transverse Momentum Distributions for Heavy Quark Pairs

    OpenAIRE

    Berger, Edmond L.; Meng, Ruibin

    1993-01-01

    We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

  5. Benefits of transmission interconnections

    International Nuclear Information System (INIS)

    Lyons, D.

    2006-01-01

    The benefits of new power transmission interconnections from Alberta were discussed with reference to the challenges and measures needed to move forward. Alberta's electricity system has had a long period of sustained growth in generation and demand and this trend is expected to continue. However, no new interconnections have been built since 1985 because the transmission network has not expanded in consequence with the growth in demand. As such, Alberta remains weakly interconnected with the rest of the western region. The benefits of stronger transmission interconnections include improved reliability, long-term generation capability, hydrothermal synergies, a more competitive market, system efficiencies and fuel diversity. It was noted that the more difficult challenges are not technical. Rather, the difficult challenges lie in finding an appropriate business model that recognizes different market structures. It was emphasized that additional interconnections are worthwhile and will require significant collaboration among market participants and governments. It was concluded that interties enable resource optimization between systems and their benefits far exceed their costs. tabs., figs

  6. Seniority zero pair coupled cluster doubles theory

    International Nuclear Information System (INIS)

    Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

    2014-01-01

    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

  7. Prevention of mother-to-child transmission of HIV in Haiti Prevención de la transmisión del VIH de madre a hijo en Haití

    Directory of Open Access Journals (Sweden)

    Marie-Marcelle Deschamps

    2009-01-01

    Full Text Available OBJECTIVES: To describe the effectiveness of a program designed to reduce the rate of mother-to-child transmission (MTCT of HIV at the primary HIV testing and treatment center in Haiti between 1999 and 2004. METHODS: All pregnant, HIV-positive women who attended the major HIV testing and treatment clinic in Port-au-Prince, Haiti, between March 1999 and December 2004 were asked to participate in an MTCT prevention program. Of the 650 women who participated, 73.3% received zidovudine (AZT, 2.9% received nevirapine (NVP, and 10.1% received triple-drug therapy when it became available in 2003 and if clinical/laboratory indications were met. Approximately 13.8% received no antiretroviral medication. All participants received cotrimoxazole prophylaxis and infant formula for their children. Kaplan-Meier survival analysis and the log rank test were used to evaluate program impact on child survival. RESULTS: Complete data were available for 348 mother-infant pairs who completed the program to prevent MTCT of HIV. The rate of MTCT in the study was 9.2% (95% CI: 6.14-12.24, in contrast to the historical mother-to-child transmission rate of 27% in Haiti. HIV-positive infants were less likely to survive than HIV-negative infants at 18 months of follow-up (χ2 = 19.06, P OBJETIVOS: Describir la eficacia de un programa diseñado para reducir la tasa de transmisión del VIH de madre a hijo (TMH en el principal centro de diagnóstico y tratamiento de esa infección en Haití entre 1999 y 2004. MÉTODOS: Se invitó a participar en un programa para la prevención de la TMH a todas las embarazadas positivas al VIH que asistían a la clínica principal de diagnóstico y tratamiento de la infección por el VIH en Puerto Príncipe, Haití, entre marzo de 1999 y diciembre de 2004. De las 650 mujeres que participaron, 73,3% recibieron zidovudina (AZT, 2,9% nervirapine (NVP y 10,1% tripleterapia cuando esta se hizo disponible en 2003 y cumplían los indicadores cl

  8. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  9. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  10. Alternative approaches to transmission investment

    Energy Technology Data Exchange (ETDEWEB)

    Welch, J.L. [International Transmission Co., Detroit, MI (United States)

    2004-07-01

    The International Transmission Company (ITC) is an independent power transmission company that owns, operates and maintains the high voltage transmission system in southeastern Michigan. The company's current focus is on investing in the transmission infrastructure to improve reliability, relieve congestion, improve access to generation and reduce energy costs for consumers. There is a need for investment in power transmission. Trends indicate that power transactions are on the rise while transmission investment is lagging because pricing protocols are inadequate and there is no regional tariff mechanism to allocate the benefits of new investment. The presentation reviewed the applicability of FTRs to transmission owners and the pitfalls of participant funding pricing. It also outlined the regional benefit allocation mechanism (RBAM) with an illustrative example. It was concluded that existing pricing policies must be improved to address the growing need for transmission investment. RBAM is needed to help investors recover costs from project beneficiaries. figs.

  11. Our views on transmission policy

    International Nuclear Information System (INIS)

    Wellford, W.H.; Sutley, N.H.

    1990-01-01

    In this article the authors discuss the need for predictable and fair access to transmission facilities in order to ensure competitive generation of power. They propose that the Federal Energy Regulatory Commission should regulate transmission to prevent a utility from gaining a competitive advantage in electricity generation markets, the incorporation of transmission access into every bidding program under state jurisdiction, and requirement of transmission rates, terms and conditions for all in-state utilities be included in the request for proposal

  12. Two-color ghost interference with photon pairs generated in hot atoms

    Directory of Open Access Journals (Sweden)

    Dong-Sheng Ding

    2012-09-01

    Full Text Available We report on an experimental observation of a two-photon ghost interference experiment. A distinguishing feature of our experiment is that the photons are generated via a non-degenerated spontaneous four-wave mixing process in a hot atomic ensemble; therefore the photon has narrow bandwidth. Besides, there is a large difference in frequency between two photons in a pair. Our works may be important to achieve more secure, large transmission capacity long-distance quantum communication.

  13. Parallel plate transmission line transformer

    NARCIS (Netherlands)

    Voeten, S.J.; Brussaard, G.J.H.; Pemen, A.J.M.

    2011-01-01

    A Transmission Line Transformer (TLT) can be used to transform high-voltage nanosecond pulses. These transformers rely on the fact that the length of the pulse is shorter than the transmission lines used. This allows connecting the transmission lines in parallel at the input and in series at the

  14. Generalized pairing strategies-a bridge from pairing strategies to colorings

    Directory of Open Access Journals (Sweden)

    Győrffy Lajos

    2016-12-01

    Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

  15. Planetary Transmission Diagnostics

    Science.gov (United States)

    Lewicki, David G. (Technical Monitor); Samuel, Paul D.; Conroy, Joseph K.; Pines, Darryll J.

    2004-01-01

    This report presents a methodology for detecting and diagnosing gear faults in the planetary stage of a helicopter transmission. This diagnostic technique is based on the constrained adaptive lifting algorithm. The lifting scheme, developed by Wim Sweldens of Bell Labs, is a time domain, prediction-error realization of the wavelet transform that allows for greater flexibility in the construction of wavelet bases. Classic lifting analyzes a given signal using wavelets derived from a single fundamental basis function. A number of researchers have proposed techniques for adding adaptivity to the lifting scheme, allowing the transform to choose from a set of fundamental bases the basis that best fits the signal. This characteristic is desirable for gear diagnostics as it allows the technique to tailor itself to a specific transmission by selecting a set of wavelets that best represent vibration signals obtained while the gearbox is operating under healthy-state conditions. However, constraints on certain basis characteristics are necessary to enhance the detection of local wave-form changes caused by certain types of gear damage. The proposed methodology analyzes individual tooth-mesh waveforms from a healthy-state gearbox vibration signal that was generated using the vibration separation (synchronous signal-averaging) algorithm. Each waveform is separated into analysis domains using zeros of its slope and curvature. The bases selected in each analysis domain are chosen to minimize the prediction error, and constrained to have the same-sign local slope and curvature as the original signal. The resulting set of bases is used to analyze future-state vibration signals and the lifting prediction error is inspected. The constraints allow the transform to effectively adapt to global amplitude changes, yielding small prediction errors. However, local wave-form changes associated with certain types of gear damage are poorly adapted, causing a significant change in the

  16. Coaxial transmission line - Equalization

    International Nuclear Information System (INIS)

    Bonnerue, J.L.; Fremont, Jacques; Haubtmann, Jack; Pillon, Gerard.

    1981-09-01

    The transmission of electrical signal through a coaxial line is not perfect and signal distortions are increased as much as the frequency spectrum is extended. We have designed and achieved passive filters (named equalizers) with transfer functions which are inverse of coaxial transfer functions. Doing so our attempt is to avoid definitive loss of information in the recorded data. The main feature of our equalization method lies in the fact it could be either an electrical or a numerical correction or both of them. Some examples in the use of this technique are also proposed [fr

  17. Dynamically prioritized progressive transmission

    Science.gov (United States)

    Blanford, Ronald

    1992-04-01

    Retrieval of image data from a centralized database may be subject to bandwidth limitations, whether due to a low-bandwidth communications link or to contention from simultaneous accesses over a high-bandwidth link. Progressive transmission can alleviate this problem by encoding image data so that any prefix of the data stream approximates the complete image at a coarse level of resolution. The longer the prefix, the finer the resolution. In many cases, as little at 1 percent of the image data may be sufficient to decide whether to discard the image, to permit the retrieval to continue, or to restrict retrieval to a subsection of the image. Our approach treats resolution not as a fixed attribute of the image, but rather as a resource which may be allocated to portions of the image at the direction of a user-specified priority function. The default priority function minimizes error by allocating more resolution to regions of high variance. The user may also point to regions of interest requesting priority transmission. More advanced target recognition strategies may be incorporated at the user's discretion. Multispectral imagery is supported. The user engineering implications are profounded. There is immediate response to a query that might otherwise take minutes to complete. The data is transmitted in small increments so that no single user dominates the communications bandwidth. The user-directed improvement means that bandwidth is focused on interesting information. The user may continue working with the first coarse approximations while further image data is still arriving. The algorithm has been implemented in C on Sun, Silicon Graphics, and NeXT workstations, and in Lisp on a Symbolics. Transmission speeds reach as high as 60,000 baud using a Sparc or 68040 processor when storing data to memory; somewhat less if also updating a graphical display. The memory requirements are roughly five bytes per image pixel. Both computational and memory costs may be reduced

  18. Research and Transmission

    Directory of Open Access Journals (Sweden)

    Denise Pumain

    2001-01-01

    Full Text Available The present situation provides a challenge for us to reconsider the necessary link between science and pedagogy, between research and the transmission of knowledge. The Ministry of National education has just inaugurated a broad consultation of teachers on every level with a view to modernising and giving coherence to the programs of secondary education. Armand Frémont will head the group of experts responsible for history and geography. Is this a coincidence? The changeover in the jury for t...

  19. a descriptive study of outcomes of interventions to prevent mother

    African Journals Online (AJOL)

    Esem

    ABSTRACT. Objective: To determine the effectiveness of the ... of 372(67.7%) of 534 mother-infant pairs took single ... education attained, employment status, PMTCT regimen and duration ... feeding and duration, sex and final HIV status.

  20. Adherence to infant-feeding choices by HIV-infected mothers at a ...

    African Journals Online (AJOL)

    countries, and the benefits of antiretroviral (ART) interventions in ... Subjects and settings: The study was conducted on mother-infant pairs recruited from the prevention of ... should be counselled to exclusively breastfeed their infants for the.

  1. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  2. Economy of electric power transmission

    International Nuclear Information System (INIS)

    Manzoni, G.; Delfanti, M.

    2008-01-01

    An analysis is presented of the impact of H V and Ehv transmission costs on the final value of the kWh supplied, with reference both to transmission systems of the European type and to long distance point-to-point transmission links. The analysis is extended to A C transmission by underground cables and to Hvdc submarine and aerial links. In the European power system, the impact of transmission costs results to be usually modest, but it may become important in the case of network congestions [it

  3. Nonlinear Vibroimpact Characteristics of a Planetary Gear Transmission System

    Directory of Open Access Journals (Sweden)

    Jianxing Zhou

    2016-01-01

    Full Text Available In order to research the vibroimpact characteristics of a planetary gear transmission system under high speed and lightly loaded conditions, a new modeling method is proposed. In the modeling process, linear spring was used to simulate gear mesh elasticity under heavy load cases, and Hertz contact theory was used to calculate the contact force of gear pair under light load cases. Then, effects of the working conditions on the system vibroimpact characteristics are analyzed. The results show that, with input speed growing, the mesh force produced obvious fluctuations on the resonance frequencies of the sun gear and carrier torsion vibration, ring gear’s transverse vibration under the heavy load. Under light load condition, the collision vibration occurs in the gear pair; the changing trend of the contact force shows strongly nonlinear characteristics. The time of mesh-apart in gears pair decreases gradually as the load is increased; until it reaches collision vibration threshold value, the gear pair is no longer mesh-apart. With increasing of the input speed, the time of mesh-apart is decreased gradually; the fluctuation amplitude of contact force shows a linearly increasing trend. The study provides useful theoretical guideline for planetary gear transmission low-noise design.

  4. Isominkowskian theory of Cooper Pairs in superconductors

    International Nuclear Information System (INIS)

    Animalu, A.O.E.

    1993-01-01

    Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs

  5. On pair-absorption in intrinsic vapours

    International Nuclear Information System (INIS)

    Hotop, R.; Niemax, K.; Schlueter, D.

    1982-01-01

    The bound-state pair-absorption bands Cs(6 2 S 1 sub(/) 2 ) + Cs(6 2 S 1 sub(/) 2 ) + hν → Cs(5 2 D 5 sub(/) 2 sub(,) 3 sub(/) 2 ) + Cs(6 2 P 1 sub(/) 2 ) and the K-K continuum-state pair-absorptions in the wavelength region 2.350 <= lambda <= 2.850 Angstroem have been investigated experimentally. In the case of the bound-state pair-absorption bands a theoretical approach for the absorption cross section at the band centre is given which is in good agreement with the experimental observation. Differences between our and the theoretical formulas given by the Stanford group are discussed. (orig.)

  6. Pair production by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.

    1987-01-01

    Solutions are obtained for the Dirac and Klein-Gordon equations with a one-dimensional symmetric potential well, having a flat bottom and arbitrary depth, width and field strengths at the walls. Quasi-stationary solutions describing a pair production by the well and the inverse process are obtained. It is shown that if the pair production probability is small, it is expressed in terms of the pair production probability on one wall and the particle oscillation frequency in the well. If the well has a supercritical depth, the lower continuum contains positron resonance scattering states at energies close to the real part of the quasi-stationary level energy (Zeldovich's effect). The qualitative dependence of the positron penetration coefficient through the wall on its energy and the well depth is an evidence that the solution of the so called one-particle Dirac equation describes in fact a many-particle system with a charge of 0 or 1

  7. The inverse problem for Schwinger pair production

    Directory of Open Access Journals (Sweden)

    F. Hebenstreit

    2016-02-01

    Full Text Available The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  8. Hadronic production of massive lepton pairs

    International Nuclear Information System (INIS)

    Berger, E.L.

    1982-12-01

    A review is presented of recent experimental and theoretical progress in studies of the production of massive lepton pairs in hadronic collisions. I begin with the classical Drell-Yan annihilation model and its predictions. Subsequently, I discuss deviations from scaling, the status of the proofs of factorization in the parton model, higher-order terms in the perturbative QCD expansion, the discrepancy between measured and predicted yields (K factor), high-twist terms, soft gluon effects, transverse-momentum distributions, implications for weak vector boson (W +- and Z 0 ) yields and production properties, nuclear A dependence effects, correlations of the lepton pair with hadrons in the final state, and angular distributions in the lepton-pair rest frame

  9. Charged topological black hole pair creation

    International Nuclear Information System (INIS)

    Mann, R.B.

    1998-01-01

    I examine the pair creation of black holes in space-times with a cosmological constant of either sign. I consider cosmological C-metrics and show that the conical singularities in this metric vanish only for three distinct classes of black hole metric, two of which have compact event horizons on each spatial slice. One class is a generalization of the Reissner-Nordstroem (anti-)de Sitter black holes in which the event horizons are the direct product of a null line with a 2-surface with topology of genus g. The other class consists of neutral black holes whose event horizons are the direct product of a null conoid with a circle. In the presence of a domain wall, black hole pairs of all possible types will be pair created for a wide range of mass and charge, including even negative mass black holes. I determine the relevant instantons and Euclidean actions for each case. (orig.)

  10. Theory of antiferromagnetic pairing in cuprate superconductors

    International Nuclear Information System (INIS)

    Plakida, N.M.

    2006-01-01

    A review of the antiferromagnetic exchange and spin-fluctuation pairing theory in the cuprate superconductors is given. We briefly discuss a phenomenological approach and a theory in the limit of weak Coulomb correlations. A microscopic theory in the strong correlation limit is presented in more detail. In particular, results of our recently developed theory for the effective p-d Hubbard model and the reduced t-J model are given. We have proved that retardation effects for the antiferromagnetic exchange interaction are unimportant that results in pairing of all charge carriers in the conduction band and high Tc proportional to the Fermi energy. The spin-fluctuation interaction caused by kinematic interaction gives an additional contribution to the d-wave pairing. Dependence of Tc on the hole concentration and the lattice constant (or pressure) and an oxygen isotope shift are discussed

  11. Holographic EPR pairs, wormholes and radiation

    Science.gov (United States)

    Chernicoff, Mariano; Güijosa, Alberto; Pedraza, Juan F.

    2013-10-01

    As evidence for the ER = EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determines whether the causal structure of the string worldsheet is trivial or not turns out to be the emission of gluonic radiation by the dual quark and antiquark. In the strongly-coupled gauge theory, it is only when radiation is emitted that one obtains an unambiguous separation of the pair into entangled subsystems, and this is what is reflected on the gravity side by the existence of the worldsheet horizon.

  12. Drell-Yan lepton pair photoproduction

    International Nuclear Information System (INIS)

    Badalyan, R.G.; Grabskij, V.O.; Matinyan, S.G.

    1989-01-01

    The study of photon structure functions by spectra of massive lepton pairs (M l + l - ≥ 2 GeV) in photon fragmentation region in γp-interactions at high energies is suggested. In calculations of Drell-Yan lepton pair inclusive spectra in γp-interactions for photon structure functions there are used results obtained within QCD, data on γγ-interactions in e + e - → e + e - X on colliders as well as results from the analysis of vector meson non-diffractive photoproduction at high energies. It is shown that there exists a sufficienly wide kinematic region over variables X l + l - and M l + l - , wherein photon structure functions can be studied by spectra of Grell-Yan lepton pairs in the processes of their photoproduction. 31 refs.; 6 figs.; 1 tab

  13. Lax pairs: a novel type of separability

    International Nuclear Information System (INIS)

    Fokas, A S

    2009-01-01

    An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)

  14. Top quark pair production in ATLAS

    CERN Document Server

    Moreno Llacer, M; The ATLAS collaboration

    2010-01-01

    Top-quark pairs are expected to be produced at the LHC, even at the lower beam energy and luminosity in the first years of running. Establishing the top-pair signal and measuring the production cross-section are important benchmarks for ATLAS, and will help understand the detector performance for events with high-pT leptons, high jet multiplicity, missing transverse energy. The prospects for early top physics measurements will be shown, with a particular emphasis on the progress achieved with data so far.

  15. Mass resolution for lepton pairs at Isabelle

    International Nuclear Information System (INIS)

    Baltay, C.; Paige, F.E.

    1978-01-01

    Experiments measuring e + e - and μ + μ-pairs will be the principal way of searching at ISABELLE for the Z 0 and for vector mesons made from new heavy quark-antiquark (Q anti Q ) pairs. Although the best possible mass resolution is clearly of benefit in such experiments, excessive resolution would lead to an unnecessarily large detector. It is believed that a mass resolution of a few percent is appropriate in searching both for the Z 0 and for new Q anti Q states. However, there are some interesting experiments which would require much better mass resolution, of order 1/4% FWHM. 9 references

  16. Ponderomotive effects in multiphoton pair production

    Science.gov (United States)

    Kohlfürst, Christian; Alkofer, Reinhard

    2018-02-01

    The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

  17. Holographic EPR Pairs, Wormholes and Radiation

    OpenAIRE

    Chernicoff, Mariano; Güijosa, Alberto; Pedraza, Juan F.

    2013-01-01

    As evidence for the ER=EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determi...

  18. Gluino-pair production at the Tevatron

    International Nuclear Information System (INIS)

    Beenakker, W.; Spira, M.; Zerwas, P.M.

    1995-05-01

    The next-to-leading order QCD corrections to the production of gluino pairs at the Tevatron are presented in this paper. Similar to the production of squark-antisquark pairs, the dependence of the cross section on the renormalization/factorization scale is reduced considerably by including the higher-order corrections. The cross section increases with respect to the lowest-order calculation which, in previous experimental analyses, had been evaluated at the scale of the invariant energy of the partonic subprocesses. (orig.)

  19. Facial expressions and pair bonds in hylobatids.

    Science.gov (United States)

    Florkiewicz, Brittany; Skollar, Gabriella; Reichard, Ulrich H

    2018-06-06

    Facial expressions are an important component of primate communication that functions to transmit social information and modulate intentions and motivations. Chimpanzees and macaques, for example, produce a variety of facial expressions when communicating with conspecifics. Hylobatids also produce various facial expressions; however, the origin and function of these facial expressions are still largely unclear. It has been suggested that larger facial expression repertoires may have evolved in the context of social complexity, but this link has yet to be tested at a broader empirical basis. The social complexity hypothesis offers a possible explanation for the evolution of complex communicative signals such as facial expressions, because as the complexity of an individual's social environment increases so does the need for communicative signals. We used an intraspecies, pair-focused study design to test the link between facial expressions and sociality within hylobatids, specifically the strength of pair-bonds. The current study compared 206 hr of video and 103 hr of focal animal data for ten hylobatid pairs from three genera (Nomascus, Hoolock, and Hylobates) living at the Gibbon Conservation Center. Using video footage, we explored 5,969 facial expressions along three dimensions: repertoire use, repertoire breadth, and facial expression synchrony [FES]. We then used focal animal data to compare dimensions of facial expressiveness to pair bond strength and behavioral synchrony. Hylobatids in our study overlapped in only half of their facial expressions (50%) with the only other detailed, quantitative study of hylobatid facial expressions, while 27 facial expressions were uniquely observed in our study animals. Taken together, hylobatids have a large facial expression repertoire of at least 80 unique facial expressions. Contrary to our prediction, facial repertoire composition was not significantly correlated with pair bond strength, rates of territorial synchrony

  20. Individual Differences in Visual Self-Recognition as a Function of Mother-Infant Attachment Relationship.

    Science.gov (United States)

    Lewis, Michael; And Others

    1985-01-01

    Compares attachment relationships of infants at 12 months to their visual self-recognition at both 18 and 24 months. Individual differences in early attachment relations were related to later self-recognition. In particular, insecurely attached infants showed a trend toward earlier self-recognition than did securely attached infants. (Author/NH)

  1. A focused ethnographic assessment of Middle Eastern mothers' infant feeding practices in Canada.

    Science.gov (United States)

    Jessri, Mahsa; Farmer, Anna P; Olson, Karin

    2015-10-01

    The aim of this study was to examine the barriers to following complementary feeding guidelines among Middle Eastern mothers and the cultural considerations of practitioners from an emic perspective. This is a two-phase focused ethnographic assessment of infant feeding among 22 Middle Eastern mothers in Western Canada who had healthy infants aged foods was whether or not foods were Halal, while food allergens were not causes for concern. Vitamin D supplements were not fed to 18/22 of infants, and mashed dates (Halawi), rice pudding (Muhallabia/Ferni) and sugared water/tea were the first complementary foods commonly consumed. Through constant comparison of qualitative data, three layers of influence emerged, which described mothers' process of infant feeding: socio-cultural, health care system and personal factors. Culture was an umbrella theme influencing all aspects of infant feeding decisions. Mothers cited health care professionals' lack of cultural considerations and lack of relevance and practicality of infant feeding guidelines as the main reasons for ignoring infant feeding recommendations. Early introduction of pre-lacteal feeds and inappropriate types of foods fed to infants among immigrant/refugee Middle Eastern mothers in Canada is cause of concern. Involving trained language interpreters in health teams and educating health care staff on cultural competency may potentially increase maternal trust in the health care system and eventually lead to increased awareness of and adherence to best practices with infant feeding recommendations. © 2013 John Wiley & Sons Ltd.

  2. Developmental Changes in Mother-Infant Face-to-Face Communication: Birth to 3 Months.

    Science.gov (United States)

    Lavelli, Manuela; Fogel, Alan

    2002-01-01

    Investigated development of face-to-face communication in infants between 1 and 14 weeks old and their mothers. Found a curvilinear development of early face-to-face communication, with increases occurring between weeks 4 and 9. When placed on a sofa, infants' face-to-face communication was longer than when they were held. Girls spent a longer…

  3. Very extensive nonmaternal care predicts mother-infant attachment disorganization: Convergent evidence from two samples.

    Science.gov (United States)

    Hazen, Nancy L; Allen, Sydnye D; Christopher, Caroline Heaton; Umemura, Tomotaka; Jacobvitz, Deborah B

    2015-08-01

    We examined whether a maximum threshold of time spent in nonmaternal care exists, beyond which infants have an increased risk of forming a disorganized infant-mother attachment. The hours per week infants spent in nonmaternal care at 7-8 months were examined as a continuous measure and as a dichotomous threshold (over 40, 50 and 60 hr/week) to predict infant disorganization at 12-15 months. Two different samples (Austin and NICHD) were used to replicate findings and control for critical covariates: mothers' unresolved status and frightening behavior (assessed in the Austin sample, N = 125), quality of nonmaternal caregiving (assessed in the NICHD sample, N = 1,135), and family income and infant temperament (assessed in both samples). Only very extensive hours of nonmaternal care (over 60 hr/week) and mothers' frightening behavior independently predicted attachment disorganization. A polynomial logistic regression performed on the larger NICHD sample indicated that the risk of disorganized attachment exponentially increased after exceeding 60 hr/week. In addition, very extensive hours of nonmaternal care only predicted attachment disorganization after age 6 months (not prior). Findings suggest that during a sensitive period of attachment formation, infants who spend more than 60 hr/week in nonmaternal care may be at an increased risk of forming a disorganized attachment.

  4. Mother-Infant Attachment Style as a Predictor of Depression among Female Students

    Directory of Open Access Journals (Sweden)

    Rozita Amani

    2017-01-01

    Full Text Available Background and aim: There are an increasing number of studies showing an association of adult attachment styles to psychopathology. Therefore, the purpose of the present study was to investigate the relation between attachment style and depression among students of Bu-Ali Sina University in Iran. Methods: This descriptive correlational study was conducted on 157 girl students who were randomly selected. They were evaluated by demographic questionnaire, Adult Attachment Inventory (AAI (Hazan and Shaver, and theBeck Depression Inventory (BDI-II. The data was analysis by using Pearson correlation coefficient and regression analysis in SPSS 16 statistical package. Results: Findings indicated that secure attachment style had no significant correlation with depression and insecure attachment styles had a significant positive correlation with depression (p

  5. Holding the baby: early mother-infant contact after childbirth and outcomes.

    Science.gov (United States)

    Redshaw, Maggie; Hennegan, Julie; Kruske, Sue

    2014-05-01

    to describe the timing, type and duration of initial infant contact and associated demographic and clinical factors in addition to investigating the impact of early contact on breastfeeding and maternal health and well being after birth. data from a recent population survey of women birthing in Queensland, Australia were used to describe the nature of the first hold and associated demographic characteristics. Initial comparisons, with subsequent adjustment for type of birthing facility and mode of childbirth, were used to assess associations between timing, type and duration of initial contact and outcomes. Further analyses were conducted to investigate a dose-response relationship between duration of first contact and outcomes. women who had an unassisted vaginal birth held their infant sooner, and for longer than women who had an assisted vaginal birth or caesarean and were more satisfied with their early contact. Multivariate models showed a number of demographic and clinical interventions contributing to timing, duration and type of first contact with type of birthing facility (public/private), area of residence, and assisted birth as prominent factors. For women who had a vaginal birth; early, skin-to-skin, and longer duration of initial contact were associated with high rates of breastfeeding initiation and breastfeeding at discharge, but not breastfeeding at 13 weeks. Some aspects of early contact were associated with improved maternal well being. However, these associations were not found for women who had a caesarean birth. With longer durations of first contact, a dose-response effect was found for breastfeeding. results of the study provide a description of current practice in Queensland, Australia and factors impacting on early contact. For vaginal births, findings add to the evidence in support of early skin-to-skin contact for an extended period. It is suggested that all research in this area should consider the effects of early contact separately for women having vaginal and caesarean births. care providers should consider extending the period of early contact in routine care following vaginal birth and explore the way in which women having a caesarean birth might be better supported in benefitting from early contact with their infant. Copyright © 2014. Published by Elsevier Ltd.

  6. Breast functions perceived by Korean mothers: infant nutrition and female sexuality.

    Science.gov (United States)

    Ahn, Youngmee; Sohn, Min; Yoo, Eunkwang

    2010-04-01

    The descriptive cross-sectional study of 2,235 Korean postpartum women was conducted to explore (a) feeding types with related factors, (b) the perceived benefits of each feeding type, (c) the perceived sexuality-related barriers to breast-feeding, and (d) the perceived relative significance of breast functions. The most frequently utilized feeding type was breast-feeding only. The gender of infants, vaginal delivery, not being employed, having a nuclear family, previous breast-feeding experience, and previously receiving breast-feeding education were statistically significant factors of breast-feeding. Breast-feeding and mixed feeding mothers indicated that their feeding choices were based on nutritional benefits, convenience, and improving family relationships. Only breast-feeding mothers reported changes in breast shape as a perceived sexuality-related barrier to breast-feeding. All mothers reported that infant feeding was a more significant concern than female sexual functioning, but post hoc Schéffe revealed that the breast-feeding mothers appreciated infant feeding function more than female sexual functioning.

  7. Effects of Mother-Infant Social Interactions on Infants' Subsequent Contingency Task Performance.

    Science.gov (United States)

    Dunham, Philip; Dunham, Frances

    1990-01-01

    Infants participated in a nonsocial contingency task immediately after a social interaction with their mothers. The amount of time mothers and infants spent in a state of vocal turn-taking predicted individual differences in infants' subsequent performance on the contingency task. (PCB)

  8. PATTERNS OF EMOTIONAL AVAILABILITY IN MOTHER-INFANT DYADS: ASSOCIATIONS WITH MULTIPLE LEVELS OF CONTEXT.

    Science.gov (United States)

    Mingo, M Verónica; Easterbrooks, M Ann

    2015-01-01

    This study explored emotional availability (EA)- an individual's emotional responsiveness and attunement to another's needs and goals (R.N. Emde, 1980)- among a high social risk group of 226 adolescent mothers and their infants (average = 12 months old). The aim was to identify dyadic patterns of EA and to examine their association with multiple indicators of the ecological context. Maternal sensitivity, maternal nonhostility, and child responsiveness were assessed with the Emotional Availability Scales, Third Edition (Z. Biringen, J. Robinson, & R.N. Emde, 1998) during free play and teaching observations at home. Four EA patterns were identified using k-means cluster analysis: (a) "low functioning," (b) "high functioning," (c) "low functioning dyads with nonhostile mothers," and (d) "inconsistently sensitive mother and responsive child." These patterns had distinct associations with (a) mothers' parenting attitudes regarding children's power and independence and parent-child role reversal, (b) mothers' strategies in conflict resolution with their partners and their children, and (c) the dyads' living arrangements. This study makes a contribution to the understanding of the mother-child relationship from a systemic and relational perspective and explores the association of EA patterns with the dyads' relational context. Implications for programs and treatment approaches aimed at supporting dyads at social risk are discussed. © 2015 Michigan Association for Infant Mental Health.

  9. Do different data analytic approaches generate discrepant findings when measuring mother-infant HPA axis attunement?

    Science.gov (United States)

    Bernard, Nicola K; Kashy, Deborah A; Levendosky, Alytia A; Bogat, G Anne; Lonstein, Joseph S

    2017-03-01

    Attunement between mothers and infants in their hypothalamic-pituitary-adrenal (HPA) axis responsiveness to acute stressors is thought to benefit the child's emerging physiological and behavioral self-regulation, as well as their socioemotional development. However, there is no universally accepted definition of attunement in the literature, which appears to have resulted in inconsistent statistical analyses for determining its presence or absence, and contributed to discrepant results. We used a series of data analytic approaches, some previously used in the attunement literature and others not, to evaluate the attunement between 182 women and their 1-year-old infants in their HPA axis responsivity to acute stress. Cortisol was measured in saliva samples taken from mothers and infants before and twice after a naturalistic laboratory stressor (infant arm restraint). The results of the data analytic approaches were mixed, with some analyses suggesting attunement while others did not. The strengths and weaknesses of each statistical approach are discussed, and an analysis using a cross-lagged model that considered both time and interactions between mother and infant appeared the most appropriate. Greater consensus in the field about the conceptualization and analysis of physiological attunement would be valuable in order to advance our understanding of this phenomenon. © 2016 Wiley Periodicals, Inc.

  10. Evoking communication in Rett syndrome: comparisons with conversations and games in mother-infant interaction.

    Science.gov (United States)

    Burford, B; Trevarthen, C

    1997-01-01

    Girls with Rett syndrome retain a responsiveness with care-givers that corresponds in many respects with the preverbal communication observed with normal infants. This has characteristic rhythmic patterns and phrases, mutual imitation, reciprocal emotional phases and rudimentary oral, vocal and gestural expressions. After individuals with Rett syndrome have passed the critical stage in dissolution of their attention, co-ordination and voluntary control, they retain positive orientation to human faces and eyes with smiling. Video analyses show that they can engage with rhythms and phrases of conversation, sometimes showing a sense of humour and sensitivity to playful teasing. They respond to repeated patterns of expression in rhythmic/prosodic play and to certain forms in music. It is suggested that sensitive and appropriately attuned support for the rudimentary motives for human contact that survive in Rett syndrome can help stabilisation of self-regulatory states, alleviate panic and confusion and facilitate learning. The effects of the disorder may be a consequence of a genetic fault in the elaboration of an Intrinsic Motive Formation in the reticular core of the embryo brain, leading to dysregulation of differentiation in higher cognitive systems and learning, but leaving partially intact motive principles for human intersubjective response.

  11. Attachment, Mothering and Mental Illness: Mother-Infant Therapy in an Institutional Context.

    Science.gov (United States)

    Masciantonio, Sonia; Hemer, Susan R; Chur-Hansen, Anna

    2018-03-01

    This paper is an ethnographic exploration of how attachment theory underpins therapeutic practices in an Australian institutional context where mothers of infants have been diagnosed and are undergoing treatment for mental illness. We argue that attachment theory in this particular context rests on a series of principles or assumptions: that attachment theory is universally applicable; that attachment is dyadic and gendered; that there is an attachment template formed which can be transferred across generations and shapes future social interactions; that there is understood to be a mental health risk to the infant when attachment is characterised as problematic; and that this risk can be mitigated through the therapeutic practices advocated by the institution. Through an in-depth case study, this paper demonstrates how these assumptions cohere in practice and are used to assess mothering as deficient, to choose therapeutic options, to shape women's behaviour, and to formulate decisions about child placement.

  12. Mother-infant interaction in schizophrenia: transmitting risk or resilience? A systematic review of the literature.

    Science.gov (United States)

    Davidsen, Kirstine Agnete; Harder, Susanne; MacBeth, Angus; Lundy, Jenna-Marie; Gumley, Andrew

    2015-12-01

    The parent-infant relationship is an important context for identifying very early risk and resilience factors and targets for the development of preventative interventions. The aim of this study was to systematically review studies investigating the early caregiver-infant relationship and attachment in offspring of parents with schizophrenia. We searched computerized databases for relevant articles investigating the relationship between early caregiver-infant relationship and outcomes for offspring of a caregiver with a diagnosis of schizophrenia. Studies were assessed for risk of bias. We identified 27 studies derived from 10 cohorts, comprising 208 women diagnosed with schizophrenia, 71 with other psychoses, 203 women with depression, 59 women with mania/bipolar disorder, 40 with personality disorder, 8 with unspecified mental disorders and 119 non-psychiatric controls. There was some evidence to support disturbances in maternal behaviour amongst those with a diagnosis of schizophrenia and there was more limited evidence of disturbances in infant behaviour and mutuality of interaction. Further research should investigate both sources of resilience and risk in the development of offspring of parents with a diagnosis of schizophrenia and psychosis. Given the lack of specificity observed in this review, these studies should also include maternal affective disorders including depressive and bipolar disorders.

  13. The Effects of Music and Movement on Mother-Infant Interactions

    Science.gov (United States)

    Vlismas, Wendy; Malloch, Stephen; Burnham, Denis

    2013-01-01

    Two experiments investigated the effects of a music and movement (M&M) programme on healthy first-time mothers and their 2-6-month-old infants over a five-week period. Experiment 1 (N?=?96) examined the effects of the M&M activities and the face-to-face (F2F) social contact of a group instruction method on the perception of mothers'…

  14. Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

    International Nuclear Information System (INIS)

    Takeuchi, Shin

    2005-01-01

    A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

  15. Small passenger car transmission test-Chevrolet 200 transmission

    Science.gov (United States)

    Bujold, M. P.

    1980-01-01

    The small passenger car transmission was tested to supply electric vehicle manufacturers with technical information regarding the performance of commerically available transmissions which would enable them to design a more energy efficient vehicle. With this information the manufacturers could estimate vehicle driving range as well as speed and torque requirements for specific road load performance characteristics. A 1979 Chevrolet Model 200 automatic transmission was tested per a passenger car automatic transmission test code (SAE J651b) which required drive performance, coast performance, and no load test conditions. The transmission attained maximum efficiencies in the mid-eighty percent range for both drive performance tests and coast performance tests. Torque, speed and efficiency curves map the complete performance characteristics for Chevrolet Model 200 transmission.

  16. Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.

    Science.gov (United States)

    Hao, Pei-Yi

    This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

  17. Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars

    International Nuclear Information System (INIS)

    Leinson, L.B.

    2001-01-01

    The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating

  18. Transmission rights and market power

    International Nuclear Information System (INIS)

    Bushnell, J.

    1999-01-01

    Most of the concerns about physical transmission rights relate to the ability to implicitly or explicitly remove that transmission capacity from the market-place. Under a very strict form of physical right, owners could simply choose not to sell it if they don't want to use it. Modifications that require the release of spare capacity back into an open market could potentially alleviate this problem but there is concern that such releases would not occur far enough in advance to be of much use to schedulers. Similarly, the transmission capacity that is made available for use by non-rights holders can also be manipulated by the owners of transmission rights. The alternative form, financial transmission rights, provide to their owners congestion payments, but physical control of transmission paths. In electricity markets such as California's, even financial transmission rights could potentially be utilized to effectively withhold transmission capacity from the marketplace. However, methods for withholding transmission capacity are somewhat more convoluted, and probably more difficult, for owners of financial rights than for owners of physical rights. In this article, the author discusses some of the potential concerns over transmission rights and their use for the exercise of various forms of market power

  19. Stress transmission in soil

    DEFF Research Database (Denmark)

    Lamandé, Mathieu; Schjønning, Per

    We urgently need increased quantitative knowledge on stress transmission in real soils loaded with agricultural machinery. 3D measurements of vertical stresses under tracked wheels were performed in situ in a Stagnic Luvisol (clay content 20 %) continuously cropped with small grain cereals......). Seven load cells were inserted horizontally from a pit with minimal disturbance of soil in each of three depths (0.3, 0.6 and 0.9 m), covering the width of the wheeled area. The position of the wheel relative to the transducers was recorded using a laser sensor. Finally, the vertical stresses near...... the soil-tyre interface were measured in separate tests by 17 stress transducers across the width of the tyres. The results showed that the inflation pressure controlled the level of maximum stresses at 0.3 m depth, while the wheel load was correlated to the measured stresses at 0.9 m depth. This supports...

  20. Information transmission strategy

    International Nuclear Information System (INIS)

    Moreau, A.

    1989-01-01

    The four propositions on which our radiation protection information transmission strategy is based are as follows: 1. Emotion exists. It rules our lives at work as well as at home, particularly when radiation safety is involved. Emotion is therefore the terrain for our strategy. 2. The basic emotion is that of fear. This must be recognized and accepted if we want to transmit objective information. The basis of our strategy is therefore listening. 3. A person cannot be divided into parts. The whole person is concerned about safety. We have to deal with that whole person. 4. To follow a strategy we need strategists. We must look at our own emotions and our own motivation before going into the field

  1. Underground transmission tomography

    International Nuclear Information System (INIS)

    Geibka, C.

    1990-01-01

    Several underground tomographic transmission surveys have been carried out. Targets were cavities, ore veins and fault zones. Examples from measurements in a german heavy/fluor spar mine a lead/zinc mine and a rock laboratory of the Swiss National Cooperative for the Storage of Radioactive waste are presented. Measurements were carried out between boreholes and road ways. The recording equipment was the intrinsically safe SEAMEX85 system built and sold by WBK. Receivers were mounted in a chain of 6 two-component probes. Sources were an inhole hammer a sledge hammer a sparker and explosives from a single detonator to 180 g depending on the distance and absorption of the rock material. Cavities showed very distinct velocity reductions between 30 and 50%. Different vein material showed velocity reduction as well as velocity increase relative to the surrounding rock

  2. Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques.

    Science.gov (United States)

    Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda

    2018-05-02

    Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

  3. Pair Negotiation When Developing English Speaking Tasks

    Science.gov (United States)

    Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena

    2011-01-01

    This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

  4. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    of charged particles in electromagnetic fields. The linear and nonlinear collective modes in electron-positron plasma have been investigated theoretically [3–6]. Recently, Oohara and Hatakeyama [7] have developed a novel method for generating a pair plasma con- sisting of only negative and positive ions with equal mass ...

  5. Klein tunneling phenomenon with pair creation process

    Science.gov (United States)

    Wu, G. Z.; Zhou, C. T.; Fu, L. B.

    2018-01-01

    In this paper, we study the Klein tunneling phenomenon with electron-positron pair creation process. Pairs can be created from the vacuum by a supercritical single-well potential (for electrons). In the time region, the time-dependent growth pattern of the created pairs can be characterized by four distinct regimes which can be considered as four different statuses of the single well. We find that if positrons penetrate the single well by Klein tunneling in different statuses, the total number of the tunneling positrons will be different. If Klein tunneling begins at the initial stage of the first status i.e. when the sing well is empty, the tunneling process and the total number of tunneling positrons are similar to the traditional Klein tunneling case without considering the pair creation process. As the tunneling begins later, the total tunneling positron number increases. The number will finally settle to an asymptotic value when the tunneling begins later than the settling-down time t s of the single well which has been defined in this paper.

  6. Effective pair potentials for spherical nanoparticles

    International Nuclear Information System (INIS)

    Van Zon, Ramses

    2009-01-01

    An effective description for rigid spherical nanoparticles in a fluid of point particles is presented. The points inside the nanoparticles and the point particles are assumed to interact via spherically symmetric additive pair potentials, while the distribution of points inside the nanoparticles is taken to be spherically symmetric and smooth. The resulting effective pair interactions between a nanoparticle and a point particle, as well as between two nanoparticles, are then given by spherically symmetric potentials. If overlap between particles is allowed, as can occur for some forms of the pair potentials, the effective potential generally has non-analytic points. It is shown that for each effective potential the expressions for different overlapping cases can be written in terms of one analytic auxiliary potential. Even when only non-overlapping situations are possible, the auxiliary potentials facilitate the formulation of the effective potentials. Effective potentials for hollow nanoparticles (appropriate e.g. for buckyballs) are also considered and shown to be related to those for solid nanoparticles. For hollow nanoparticles overlap is more physical, since this covers the case of a smaller particle embedded in a larger, hollow nanoparticle. Finally, explicit expressions are given for the effective potentials derived from basic pair potentials of power law and exponential form, as well as from the commonly used London–van der Waals, Morse, Buckingham, and Lennard-Jones potentials. The applicability of the latter is demonstrated by comparison with an atomic description of nanoparticles with an internal face centered cubic structure

  7. Odd-frequency pairing in superconducting heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Golubov, A A [Faculty of Science and Technology and MESA Institute for Nanotechnology, University of Twente, 7500 AE Enschede (Netherlands); Tanaka, Y [Department of Applied Physics, Nagoya University, Nagoya, 464-8603 (Japan); Asano, Y [Department of Applied Physics, Hokkaido University, Sapporo 060-8628 (Japan); Tanuma, Y [Institute of Physics, Kanagawa University, 3-7-1, Rokkakubashi, Kanagawa-ku, Yokohama 221-8686 (Japan)], E-mail: a.golubov@utwente.nl

    2009-04-22

    We review the theory of odd-frequency pairing in superconducting heterostructures, where an odd-frequency pairing component is induced near interfaces. A general description of the superconducting proximity effect in a normal metal or a ferromagnet attached to an unconventional superconductor (S) is given within quasiclassical kinetic theory for various types of symmetry state in S. Various possible symmetry classes in a superconductor are considered which are consistent with the Pauli principle: even-frequency spin-singlet even-parity (ESE) state, even-frequency spin-triplet odd-parity (ETO) state, odd-frequency spin-triplet even-parity (OTE) state and odd-frequency spin-singlet odd-parity (OSO) state. As an example, we consider a junction between a diffusive normal metal (DN) and a p-wave superconductor (even-frequency spin-triplet odd-parity symmetry), where the pairing amplitude in DN belongs to an odd-frequency spin-triplet even-parity symmetry class. We also discuss the manifestation of odd-frequency pairing in conventional superconductor/normal (S/N) proximity systems and its relation to the classical McMillan-Rowell oscillations.

  8. Impact of Paired Tutoring and Mentoring.

    Science.gov (United States)

    Bruce, Jennifer E.; Trammell, Jack

    2003-01-01

    Discusses a study that examines the effects of paired tutoring and mentoring on academic achievement of college freshmen in a probationary program. Results show that students with mentoring and tutoring services by the same person show greater academic gains as measured by compliance and academic achievement than do those students who were…

  9. Pair breaking and charge relaxation in superconductors

    International Nuclear Information System (INIS)

    Nielson, J.B.; Pethick, C.J.; Rammer, J.; Smith, H.

    1982-01-01

    We present a general formalism based on the quasiclassical Green's function for calculating charge imbalance in nonequilibrium superconductors. Our discussion is sufficiently general that it applies at arbitrary temperatures, and under conditions when the width of quasiparticle states are appreciable due to pair breaking processes, and when strong coupling effects are significant. As a first application we demonstrate in detail how in the limit of smallpair breaking and for a weak coupling superconductor the collision term in the formalism reduces to the one in the quasiparticle Boltzmann equation. We next treat the case of charge imbalance generated by tunnel injection, with pair breaking by phonons and magnetic impurities. Over the range of temperatures investigated exerimentally to date, the calculated charge imbalance is rather close to that evaluated using the Boltzmann equation, even if pair braeking is so strong as almost to destroy superconductivity. Finally we consider charge imbalance generated by the combined influence of a supercurrent and a temperature gradient. We give calculations for a dirty superconductor with scattering by phonons as the pair breaking mechanism, and the results give a reasonable account of the experimental data of Clarke, Fjordboge, and Lindelof. We carry out calculations for the case of impurity scattering along which are valid not only in the clean and dirty limits, but also for intermediate situations. These enable us to see how the large contribution to the charge imbalance found for energies close to the gap edge in the clean case is reduced with increasing impurity scattering

  10. Pseudopotential transformation of correlated-pair equations

    International Nuclear Information System (INIS)

    Szasz, L.; Brown, L.

    1975-01-01

    A pseudopotential transformation for correlated-pair equations is derived that yields solutions that are pseudowavefunctions, i.e., they do not have to be orthogonal to the core functions. The approximate solutions for the transformation will be much simpler to compute, but they do not involve a loss of accuracy

  11. Predictive labeling with dependency pairs using SAT

    NARCIS (Netherlands)

    Koprowski, A.; Middeldorp, A.; Pfenning, F.

    2007-01-01

    This paper combines predictive labeling with dependency pairs and reports on its implementation. Our starting point is the method of proving termination of rewrite systems using semantic labeling with infinite models in combination with lexicographic path orders. We replace semantic labeling with

  12. Multipole pair vibrations in superfluid 3He

    International Nuclear Information System (INIS)

    Baldo, M.; Giansiracusa, G.; Lombardo, U.; Pucci, R.; Petronio, G.

    1978-01-01

    Starting from a path integral formation of the 3 He superfluidity, the authors study the pair vibrations around the BCS solution. For both the BW and ABM states get a set of possible excitations. In particular it is shown that a new type of excitation is present for pure 1 = 2 spin singlet vibration. (Auth.)

  13. Pion-pair production by two photons

    International Nuclear Information System (INIS)

    Terazawa, Hidezumi.

    1994-07-01

    The cross section for pion-pair production by two photons is calculated approximately by using the low energy theorem previously derived from partially-conserved-axial-vector-current hypothesis and current algebra, and found to agree very well with the experimental data recently obtained by the Mark II, TPC/Two-Gamma and CLEO Collaborations. (author)

  14. Computing Hypercrossed Complex Pairings in Digital Images

    Directory of Open Access Journals (Sweden)

    Simge Öztunç

    2013-01-01

    Full Text Available We consider an additive group structure in digital images and introduce the commutator in digital images. Then we calculate the hypercrossed complex pairings which generates a normal subgroup in dimension 2 and in dimension 3 by using 8-adjacency and 26-adjacency.

  15. Phenomena, dynamics and instabilities of vortex pairs

    International Nuclear Information System (INIS)

    Williamson, C H K; Asselin, D J; Leweke, T; Harris, D M

    2014-01-01

    Our motivation for studying the dynamics of vortex pairs stems initially from an interest in the trailing wake vortices from aircraft and the dynamics of longitudinal vortices close to a vehicle surface. However, our motivation also comes from the fact that vortex–vortex interactions and vortex–wall interactions are fundamental to many turbulent flows. The intent of the paper is to present an overview of some of our recent work concerning the formation and structure of counter-rotating vortex pairs. We are interested in the long-wave and short-wave three-dimensional instabilities that evolve for an isolated vortex pair, but also we would like to know how vortex pairs interact with a wall, including both two-dimensional interactions, and also the influence of the surface on the three-dimensional instabilities. The emphasis of this presentation is on physical mechanisms by which vortices interact with each other and with surfaces, principally from an experimental approach, but also coupled with analytical studies. (paper)

  16. A Novel Approach for Collaborative Pair Programming

    Science.gov (United States)

    Goel, Sanjay; Kathuria, Vanshi

    2010-01-01

    The majority of an engineer's time in the software industry is spent working with other programmers. Agile methods of software development like eXtreme Programming strongly rely upon practices like daily meetings and pair programming. Hence, the need to learn the skill of working collaboratively is of primary importance for software developers.…

  17. Pair production of intermediate vector bosons

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1979-01-01

    The production of intermediate vector boson pairs W + W - , Z 0 Z 0 , W +- Z 0 and W +- γ in pp and p anti p collisions is discussed. The motivation is to detect the self-interactions among the four intermediate vector bosons

  18. Pairing the Adult Learner and Boutique Wineries

    Science.gov (United States)

    Holyoke, Laura; Heath-Simpson, Delta

    2013-01-01

    This study explored connections between adult learners and their experiences in the context of small boutique wineries operating in the start-up phase of the organizational life cycle. The research objective was to gain insight regarding the pairing of adult learners with the entering of a specialty industry. Fourteen individuals from four…

  19. Plasma analog of particle-pair production

    International Nuclear Information System (INIS)

    Tsidulko, Yu.A.; Berk, H.L.

    1996-09-01

    It is shown that the plasma axial shear flow instability satisfies the Klein-Gordon equation. The plasma instability is then shown to be analogous to spontaneous particle-pair production when a potential energy is present that is greater than twice the particle rest mass energy. Stability criteria can be inferred based on field theoretical conservation laws

  20. Frustrated Lewis pairs: Design and reactivity

    Indian Academy of Sciences (India)

    for FLP systems and their unique reactivity are discussed here. Keywords. Lewis .... we will concentrate on the design principles of such. FLPs and the ... Designs of frustrated Lewis pairs ..... 64 and neutral titanium (III) complex [Cp2TiOC6.

  1. Environmentally benign working pairs for adsorption refrigeration

    International Nuclear Information System (INIS)

    Cui Qun; Tao Gang; Chen Haijun; Guo Xinyue; Yao Huqing

    2005-01-01

    This paper begins from adsorption working pairs: water and ethanol were selected as refrigerants; 13x molecular sieve, silica gel, activated carbon, adsorbent NA and NB, proposed by authors, were selected as adsorbents, and the performance of adsorption working pairs in adsorption refrigeration cycle was studied. The adsorption isotherms of adsorbents (NA and NB) were obtained by high-vacuum gravimetric method. Desorption properties of adsorbents were analyzed and compared by thermal analysis method. The performance of adsorption refrigeration was studied on simulation device of adsorption refrigeration cycle. After presentation of adsorption isotherms, the thermodynamic performance for their use in adsorption refrigeration system was calculated. The results show: (1) the maximum adsorption capacity of water on adsorbent NA reaches 0.7 kg/kg, and the maximum adsorption capacity of ethanol on adsorbent NB is 0.68 kg/kg, which is three times that of ethanol on activated carbon, (2) the refrigeration capacity of NA-water working pair is 922 kJ/kg, the refrigeration capacity of NB-ethanol is 2.4 times that of activated carbon-methanol, (3) as environmental friendly and no public hazard adsorption working pair, NA-H 2 O and NB-ethanol can substitute activated carbon-methanol in adsorption refrigeration system using low-grade heat source

  2. Fermion pair physics at LEP2

    International Nuclear Information System (INIS)

    Georgios, Anagnostou

    2004-01-01

    Combined measurements of the 4 LEP collaborations for the fermion pair processes e + e - →f anti f are presented. The results show no significant deviations when compared with the Standard Model predictions and are used to set limits on contact interactions, Z' gauge bosons and low scale gravity models with large extra dimensions. (orig.)

  3. Frustrated Lewis pairs-assisted tritium labeling

    Czech Academy of Sciences Publication Activity Database

    Marek, Aleš; Široká, Sabina; Elbert, Tomáš

    2016-01-01

    Roč. 14, č. 5 (2016), s. 219 ISSN 2336-7202. [Sjezd českých a slovenských chemických společností /68./. 04.09.2016-07.09.2016, Praha] Institutional support: RVO:61388963 Keywords : frustrated Lewis pairs * one-pot synthesis * tritium -labeling Subject RIV: CC - Organic Chemistry

  4. Angular assymetries in a shielded pair line

    International Nuclear Information System (INIS)

    Fanchiotti, H.; Garcia Canal, C.A.; Vucetich, H.

    1979-01-01

    The capacitance matrix and surface charge density distribution of an unbalanced pair line with both longitudinal and balanced excitations is presented. In particular the case in which the axes of the inner wires are not restricted to lie on a line through the axis of the shield is discussed

  5. The design and analysis of single flank transmission error testor for loaded gears

    Science.gov (United States)

    Houser, D. R.; Bassett, D. E.

    1985-01-01

    Due to geometrical imperfections in gears and finite tooth stiffnesses, the motion transmitted from an input gear shaft to an output gear shaft will not have conjugate action. In order to strengthen the understanding of transmission error and to verify mathematical models of gear transmission error, a test stand that will measure the transmission error of a gear pair at operating loads, but at reduced speeds would be desirable. This document describes the design and development of a loaded transmission error tester. For a gear box with a gear ratio of one, few tooth meshing combinations will occur during a single test. In order to observe the effects of different tooth mesh combinations and to increase the ability to load test gear pairs with higher gear ratios, the system was designed around a gear box with a gear ratio of two.

  6. Binaries and triples among asteroid pairs

    Science.gov (United States)

    Pravec, Petr; Scheirich, Peter; Kušnirák, Peter; Hornoch, Kamil; Galád, Adrián

    2015-08-01

    Despite major achievements obtained during the past two decades, our knowledge of the population and properties of small binary and multiple asteroid systems is still far from advanced. There is a numerous indirect evidence for that most small asteroid systems were formed by rotational fission of cohesionless parent asteroids that were spun up to the critical frequency presumably by YORP, but details of the process are lacking. Furthermore, as we proceed with observations of more and more binary and paired asteroids, we reveal new facts that substantially refine and sometimes change our understanding of the asteroid systems. One significant new finding we have recently obtained is that primaries of many asteroid pairs are actually binary or triple systems. The first such case found is (3749) Balam (Vokrouhlický, ApJL 706, L37, 2009). We have found 9 more binary systems among asteroid pairs within our ongoing NEOSource photometric project since October 2012. They are (6369) 1983 UC, (8306) Shoko, (9783) Tensho-kan, (10123) Fideoja, (21436) Chaoyichi, (43008) 1999 UD31, (44620) 1999 RS43, (46829) 1998 OS14 and (80218) 1999 VO123. We will review their characteristics. These paired binaries as we call them are mostly similar to binaries in the general ("background") population (of unpaired asteroids), but there are a few trends. The paired binaries tend to have larger secondaries with D_2/D_1 = 0.3 to 0.5 and they also tend to be wider systems with 8 of the 10 having orbital periods between 30 and 81 hours, than average among binaries in the general population. There may be also a larger fraction of triples; (3749) Balam is a confirmed triple, having a larger close and a smaller distant satellite, and (8306) Shoko and (10123) Fideoja are suspect triples as they show additional rotational lightcurve components with periods of 61 and 38.8 h that differ from the orbital period of 36.2 and 56.5 h, respectively. The unbound secondaries tend to be of the same size or

  7. Perinatal transmission of human papilomavirus DNA

    Directory of Open Access Journals (Sweden)

    Serafini Eduardo P

    2009-06-01

    Full Text Available Abstract The purpose was to study the perinatal transmission of human papillomavirus DNA (HPV-DNA in 63 mother-newborn pairs, besides looking at the epidemiological factors involved in the viral DNA transmission. The following sampling methods were used: (1 in the pregnant woman, when was recruited, in cervix and clinical lesions of the vagina, vulva and perineal region; (2 in the newborn, (a buccal, axillary and inguinal regions; (b nasopharyngeal aspirate, and (c cord blood; (3 in the children, buccal was repeated in the 4th week and 6th and 12th month of life. HPV-DNA was identified using two methodologies: multiplex PCR (PGMY09 and MY11 primers and nested-PCR (genotypes 6/11, 16, 18, 31, 33, 42, 52 and 58. Perinatal transmission was considered when concordance was found in type-specific HPV between mother/newborn or mother/child. HPV-DNA genital was detected in 49 pregnant women submitted to delivery. Eleven newborns (22.4%, n = 11/49 were HPV-DNA positive. In 8 cases (16.3%, n = 8/49 there was type specific HPV concordance between mother/newborn samples. At the end of the first month of life three children (6.1%, n = 3/49 became HPV-DNA positive, while two remained positive from birth. In 3 cases (100%, n = 3/3 there was type specific HPV concordance between mother/newborn samples. In the 6th month, a child (2%, n = 1/49 had become HPV-DNA positive between the 1st and 6th month of life, and there was type specific HPV concordance of mother/newborn samples. All the HPV-DNA positive children (22.4%, n = 11/49 at birth and at the end first month of life (6.1%, n = 3/49 became HPV-DNA negative at the age of 6 months. The HPV-DNA positive child (2%, n = 1/49 from 1st to the 6th month of life became HPV-DNA negative between the 6th and 12th month of life and one child had anogenital warts. In the twelfth month all (100%, n = 49/49 the children studied were HPV-DNA negative. A positive and significant correlation was observed between perinatal

  8. Boron/nitrogen pairs Co-doping in metallic carbon nanotubes: a first-principle study

    International Nuclear Information System (INIS)

    Ouyang Fang-Ping; Peng Sheng-Lin; Chen Ling-Na; Sun Shu-Yuan; Xu Hui

    2011-01-01

    By using the first-principles calculations, the electronic structure and quantum transport properties of metallic carbon nanotubes with B/N pairs co-doping have been investigated. It is shown that the total energies of metallic carbon nanotubes are sensitive to the doping sites of the B/N pairs. The energy gaps of the doped metallic carbon nanotubes decrease with decreasing the concentration of the B/N pair not only along the tube axis but also around the tube. Moreover, the I—V characteristics and transmissions of the doped tubes are studied. Our results reveal that the conducting ability of the doped tube decreases with increasing the concentrations of the B/N pairs due to symmetry breaking of the system. This fact opens a new way to modulate band structures of metallic carbon nanotubes by doping B/N pair with suitable concentration and the novel characteristics are potentially useful in future applications. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  9. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  10. Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling

    International Nuclear Information System (INIS)

    Friedmann, Tamar; Verlinde, Herman

    2005-01-01

    We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field

  11. Neutron pair and proton pair transfer reactions between identical cores in the sulfur region

    International Nuclear Information System (INIS)

    Mermaz, M.C.

    1995-12-01

    Optical model and exact finite range distorted-wave Born approximation analyses were performed on neutron pair exchange between identical cores for 32 S and 34 S nuclei and on proton pair exchange between identical cores for 30 Si and 32 S. The extracted spectroscopic factors were compared with theoretical ones deduced from Hartree-Fock calculations on these pair of nuclei. The enhancement of the experimental cross sections with respect to the theoretical ones strongly suggests evidence for a nuclear Josephson effect. (author). 15 refs., 5 figs., 3 tabs

  12. Transmission diamond imaging detector

    Energy Technology Data Exchange (ETDEWEB)

    Smedley, John, E-mail: smedley@bnl.gov; Pinelli, Don; Gaoweia, Mengjia [Brookhaven National Laboratory, Upton, NY (United States); Muller, Erik; Ding, Wenxiang; Zhou, Tianyi [Stony Brook University, Stony Brook, NY (United States); Bohon, Jen [Case Center for Synchrotron Biosciences, Center for Proteomics and Bioinformatics, Case Western Reserve University, Cleveland, OH (United States)

    2016-07-27

    Many modern synchrotron techniques are trending toward use of high flux beams and/or beams which require enhanced stability and precise understanding of beam position and intensity from the front end of the beamline all the way to the sample. For high flux beams, major challenges include heat load management in optics (including the vacuum windows) and a mechanism of real-time volumetric measurement of beam properties such as flux, position, and morphology. For beam stability in these environments, feedback from such measurements directly to control systems for optical elements or to sample positioning stages would be invaluable. To address these challenges, we are developing diamond-based instrumented vacuum windows with integrated volumetric x-ray intensity, beam profile and beam-position monitoring capabilities. A 50 µm thick single crystal diamond has been lithographically patterned to produce 60 µm pixels, creating a >1kilopixel free-standing transmission imaging detector. This device, coupled with a custom, FPGA-based readout, has been used to image both white and monochromatic x-ray beams and capture the last x-ray photons at the National Synchrotron Light Source (NSLS). This technology will form the basis for the instrumented end-station window of the x-ray footprinting beamline (XFP) at NSLS-II.

  13. Control of schistosomiasis transmission

    Directory of Open Access Journals (Sweden)

    Luiz C. de S. Dias

    1995-04-01

    Full Text Available Despite the success of control programmes, schistosomiasis is still a serious public health problem in the world. More than 70 countries where 200 million individuals are evaluated to be infected of a total 600 million at risk. Though there have been important local success in the control of transmission, globally the infection has increased. Economic constrains in developing countries, environmental changes associated with migration and water resources development have been blocking the progress. The main objective of schistosomiasis control is to achieve reduction of disease due to schistosomiasis. We discussed the control measures like: health education, diagnosis and chemotherapy, safe water supplies, sanitation and snail control. We emphasized the need to give priority to school-age children and the importance of integrating the measures of control into locally available systems of health care. The control of schistosomiasis is directly related to the capacity of the preventive health services of an endemic country. The strategy of control requires long-term commitment from the international to the local level.

  14. Transmission acoustic microscopy investigation

    Science.gov (United States)

    Maev, Roman; Kolosov, Oleg; Levin, Vadim; Lobkis, Oleg

    The nature of acoustic contrast, i.e. the connection of the amplitude and phase of the output signal of the acoustic microscope with the local values of the acoustic parameters of the sample (density, elasticity, viscosity) is a central problem of acoustic microscopy. A considerable number of studies have been devoted to the formation of the output signal of the reflection scanning acoustic microscope. For the transmission acoustic microscope (TAM) this problem has remained almost unstudied. Experimental investigation of the confocal system of the TAM was carried out on an independently manufactured laboratory mockup of the TAM with the working frequency of the 420 MHz. Acoustic lenses with the radius of curvature of about 500 microns and aperture angle of 45 deg were polished out in the end faces of two cylindrical sound conductors made from Al2O3 single crystals with an axis parallel to the axis C of the crystal (the length of the sound conductor is 20 mm; diameter, 6 mm). At the end faces of the sound conductor, opposite to the lenses, CdS transducers with a diameter of 2 mm were disposed. The electric channel of the TAM provided a possibility for registering the amplitude of the microscope output signal in the case of the dynamic range of the 50 dB.

  15. Model for pairing phase transition in atomic nuclei

    International Nuclear Information System (INIS)

    Schiller, A.; Guttormsen, M.; Hjorth-Jensen, M.; Rekstad, J.; Siem, S.

    2002-01-01

    A model is developed which allows the investigation and classification of the pairing phase transition in atomic nuclei. The regions of the parameter space are discussed for which a pairing phase transition can be observed. The model parameters include number of particles, attenuation of pairing correlations with increasing seniority, single-particle level spacing, and pairing gap parameter

  16. Paired peer learning through engineering education outreach

    Science.gov (United States)

    Fogg-Rogers, Laura; Lewis, Fay; Edmonds, Juliet

    2017-01-01

    Undergraduate education incorporating active learning and vicarious experience through education outreach presents a critical opportunity to influence future engineering teaching and practice capabilities. Engineering education outreach activities have been shown to have multiple benefits; increasing interest and engagement with science and engineering for school children, providing teachers with expert contributions to engineering subject knowledge, and developing professional generic skills for engineers such as communication and teamwork. This pilot intervention paired 10 pre-service teachers and 11 student engineers to enact engineering outreach in primary schools, reaching 269 children. A longitudinal mixed methods design was employed to measure change in attitudes and Education Outreach Self-Efficacy in student engineers; alongside attitudes, Teaching Engineering Self-Efficacy and Engineering Subject Knowledge Confidence in pre-service teachers. Highly significant improvements were noted in the pre-service teachers' confidence and self-efficacy, while both the teachers and engineers qualitatively described benefits arising from the paired peer mentor model.

  17. Top quark pair production beyond NNLO

    Energy Technology Data Exchange (ETDEWEB)

    Muselli, Claudio [TIF Lab, Dipartimento di Fisica, Università di Milano, and INFN - Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Bonvini, Marco [Rudolf Peierls Centre for Theoretical Physics, University of Oxford,1 Keble Road, OX1 3NP, Oxford (United Kingdom); Forte, Stefano [TIF Lab, Dipartimento di Fisica, Università di Milano, and INFN - Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Marzani, Simone [Center for Theoretical Physics, Massachusetts Institute of Technology,77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Ridolfi, Giovanni [Dipartimento di Fisica, Università di Genova and INFN - Sezione di Genova,Via Dodecaneso 33, I-16146 Genova (Italy)

    2015-08-17

    We construct an approximate expression for the total cross section for the production of a heavy quark-antiquark pair in hadronic collisions at next-to-next-to-next-to-leading order (N{sup 3}LO) in α{sub s}. We use a technique which exploits the analyticity of the Mellin space cross section, and the information on its singularity structure coming from large N (soft gluon, Sudakov) and small N (high energy, BFKL) all order resummations, previously introduced and used in the case of Higgs production. We validate our method by comparing to available exact results up to NNLO. We find that N{sup 3}LO corrections increase the predicted top pair cross section at the LHC by about 4% over the NNLO.

  18. Top quark pair production beyond NNLO

    International Nuclear Information System (INIS)

    Muselli, Claudio; Bonvini, Marco; Forte, Stefano; Marzani, Simone; Ridolfi, Giovanni

    2015-01-01

    We construct an approximate expression for the total cross section for the production of a heavy quark-antiquark pair in hadronic collisions at next-to-next-to-next-to-leading order (N 3 LO) in α s . We use a technique which exploits the analyticity of the Mellin space cross section, and the information on its singularity structure coming from large N (soft gluon, Sudakov) and small N (high energy, BFKL) all order resummations, previously introduced and used in the case of Higgs production. We validate our method by comparing to available exact results up to NNLO. We find that N 3 LO corrections increase the predicted top pair cross section at the LHC by about 4% over the NNLO.

  19. Photoproduction of Drell-Yan lepton pairs

    International Nuclear Information System (INIS)

    Jones, L.M.; Sullivan, J.D.; Willen, D.E.; Wyld, H.W.

    1979-01-01

    We investigate the Drell-Yan reaction γp → (μ + μ - ) X with an eye to experimental determination of the photon structure functions. Contributions to the process from both the nonhadronic anomaly and the vector-dominance piece are estimated: we find that the cross section from the anomaly dominates the vector-dominance contribution at large Q 2 . The background from Bethe-Heitler pairs is also calculated; it is somewhat suppressed by going to y=0, and further suppressed relative to the Drell-Yan contribution for fixed Q 2 by looking at high center-of-mass energies and at small Q/sub perpendicular/ for the pair. Overall we find that the absolute Drell-Yan cross sections in the regions of interest are very small; experimental study of the process will be difficult

  20. A search for resonant Z pair production

    Energy Technology Data Exchange (ETDEWEB)

    Boveia, Antonio [Univ. of California, Santa Barbara, CA (United States)

    2008-12-01

    I describe a search for anomalous production of Z pairs through a new massive resonance X in 2.5-2.9 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDFII Detector at the Fermilab Tevatron. I reconstruct Z pairs through their decays to electrons, muons, and quarks. To achieve perhaps the most efficient lepton reconstruction ever used at CDF, I apply a thorough understanding of the detector and new reconstruction software heavily revised for this purpose. In particular, I have designed and employ new general-purpose algorithms for tracking at large η in order to increase muon acceptance. Upon analyzing the unblinded signal samples, I observe no X → ZZ candidates and set upper limits on the production cross section using a Kaluza-Klein graviton-like acceptance.

  1. Magnetically-enhanced open string pair production

    Science.gov (United States)

    Lu, J. X.

    2017-12-01

    We consider the stringy interaction between two parallel stacks of D3 branes placed at a separation. Each stack of D3 branes in a similar fashion carry an electric flux and a magnetic flux with the two sharing no common field strength index. The interaction amplitude has an imaginary part, giving rise to the Schwinger-like pair production of open strings. We find a significantly enhanced rate of this production when the two electric fluxes are almost identical and the brane separation is on the order of string scale. This enhancement will be largest if the two magnetic fluxes are opposite in direction. This novel enhancement results from the interplay of the non-perturbative Schwinger-type pair production due to the electric flux and the stringy tachyon due to the magnetic flux, and may have realistic physical applications.

  2. Radiation- and pair-loaded shocks

    Science.gov (United States)

    Lyutikov, Maxim

    2018-06-01

    We consider the structure of mildly relativistic shocks in dense media, taking into account the radiation and pair loading, and diffusive radiation energy transfer within the flow. For increasing shock velocity (increasing post-shock temperature), the first important effect is the efficient energy redistribution by radiation within the shock that leads to the appearance of an isothermal jump, whereby the flow reaches the final state through a discontinuous isothermal transition. The isothermal jump, on scales much smaller than the photon diffusion length, consists of a weak shock and a quick relaxation to the isothermal conditions. Highly radiation-dominated shocks do not form isothermal jump. Pair production can mildly increase the overall shock compression ratio to ≈10 (4 for matter-dominated shocks and 7 of the radiation-dominated shocks).

  3. Dynamics and Instabilities of Vortex Pairs

    Science.gov (United States)

    Leweke, Thomas; Le Dizès, Stéphane; Williamson, Charles H. K.

    2016-01-01

    This article reviews the characteristics and behavior of counter-rotating and corotating vortex pairs, which are seemingly simple flow configurations yet immensely rich in phenomena. Since the reviews in this journal by Widnall (1975) and Spalart (1998) , who studied the fundamental structure and dynamics of vortices and airplane trailing vortices, respectively, there have been many analytical, computational, and experimental studies of vortex pair flows. We discuss two-dimensional dynamics, including the merging of same-sign vortices and the interaction with the mutually induced strain, as well as three-dimensional displacement and core instabilities resulting from this interaction. Flows subject to combined instabilities are also considered, in particular the impingement of opposite-sign vortices on a ground plane. We emphasize the physical mechanisms responsible for the flow phenomena and clearly present the key results that are useful to the reader for predicting the dynamics and instabilities of parallel vortices.

  4. Space-Efficient Re-Pair Compression

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li; Prezza, Nicola

    2017-01-01

    Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...

  5. Glass scintillator pair for compensation neutron logging

    International Nuclear Information System (INIS)

    Ji Changsong; Li Xuezhi; Yiu Guangduo

    1985-01-01

    Glass scintillator pair types ST 1604 and ST 1605 for compensation of neutron logging is developed. The neutron sensitive material used is multistick lithium glass scintillators 3 and 4 mm in diameter respectively. Thermoneutron detection efficiencies are 50-60% and 100% respectively. The detection efficiency for 60 Co γ ray is lower than 0.3%. The type ST 1604 and ST 1605 may also be used as high sensitive neutron detectors in an intensive γ ray field

  6. On $ \\phi $ -amicable pairs (with appendix)

    NARCIS (Netherlands)

    G.L. Cohen; H.J.J. te Riele (Herman)

    1995-01-01

    textabstractLet $\\phi(n)$ denote Euler's totient function, i.e., the number of positive integers~$pairs of positive integers $(a_0,a_1)$ with $a_0\\le a_1$ such that $\\phi(a_0)=\\phi(a_1)=(a_0+a_1)/k$ for some integer $k\\ge1$. We call these numbers $\\phi$--{\\it

  7. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  8. Hadronic production of lepton pairs (experimental)

    International Nuclear Information System (INIS)

    Boucrot, J.

    1980-12-01

    Hadonic production of lepton pairs has become a good testground of Q.C.D. The large effects predicted in cross sections and in Psub(T) distributions are seen and may be one of the good indirect proofs of the existence of gluons. Detailed experimental results are available, and clearly it is necessary that higher order Q.C.D. corrections should be estimated

  9. W+- pairs and neutral currents at ISABELLE

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1975-01-01

    A report is presented on two different types of processes which may form part of the weak interactions program. The first is the production of pairs of charged weak bosons in the process pp → W + W - X; the second involves searching for neutral current effects in the rate for ordinary lepton production, without measuring any charge asymmetry or helicities using the reaction pp → l + l - X

  10. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    Science.gov (United States)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  11. Neutrino signal from pair-instability supernovae

    Science.gov (United States)

    Wright, Warren P.; Gilmer, Matthew S.; Fröhlich, Carla; Kneller, James P.

    2017-11-01

    A very massive star with a carbon-oxygen core in the range of 64M ⊙Earth from two, one-dimensional pair-instability supernova simulations which bracket the mass range of stars which explode by this mechanism taking into account the full time and energy dependence of the neutrino emission and the flavor evolution through the outer layers of the star. We calculate the neutrino signals in five different detectors chosen to represent present or near future designs. We find the more massive progenitors explode as pair-instability supernova which can easily be detected in multiple different neutrino detectors at the "standard" supernova distance of 10 kpc producing several events in DUNE, JUNO, and Super-Kamiokande, while the lightest progenitors produce only a handful of events (if any) in the same detectors. The proposed Hyper-Kamiokande detector would detect neutrinos from a large pair-instability supernova as far as ˜50 kpc allowing it to reach the Megallanic Clouds and the several very high mass stars known to exist there.

  12. Exclusive production of W pairs in CMS

    Directory of Open Access Journals (Sweden)

    Silveira Da

    2014-04-01

    Full Text Available We report the results on the search for exclusive production of W pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at √s = 7 TeV. The analysis comprises the two-photon production of a W pairs, pp → pW+ W− p → p νe± νµ∓ p. Two events are observed in data for pT(ℓ > 4 GeV, |η(ℓ| 20 GeV, in agreement with the standard model prediction of 2.2 ± 0.4 signal events with 0.84 ± 0.15 background events. Moreover, a study of the tail of the lepton pair transverse momentum distribution is performed to search for an evidence of anomalous quartic gauge couplings in the γγ → W+ W− vertex. As no events are observed in data, it results in a model-independent upper limits for the anomalous W quartic gauge couplings aW0,C/Λ2, which are of the order of 10−4.

  13. Galactic Pairs in the Early Universe

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    In the spirit of Valentines Day, today well be exploring apparent pairs of galaxies in the distant, early universe. How can we tell whether these duos are actually paired galaxies, as opposed to disguised singles?Real Pair, or Trick of the Light?In the schematic timeline of the universe, the epoch of reionization is when the first galaxies and quasars began to form and evolve. [NASA]The statistics of merging galaxies throughout the universe reveal not only direct information about how galaxies interact, but also cosmological information about the structure of the universe. While weve observed many merging galaxy pairs at low redshift, however, its much more challenging to identify these duos in the early universe.A merging pair of galaxies at high redshift appears to us as a pair of unresolved blobs that lie close to each other in the sky. But spotting such a set of objects doesnt necessarily mean were looking at a merger! There are three possible scenarios to explain an observed apparent duo:Its a pair of galaxies in a stage of merger.Its a projection coincidence; the two galaxies arent truly near each other.Its a single galaxy being gravitationally lensed by a foreground object. This strong lensing produces the appearance of multiple galaxies.Hubble photometry of one of the three galaxy groups identified at z 8, with the galaxies in the image labeled with their corresponding approximate photometric redshifts. [Adapted from Chaikin et al. 2018]Hunting for Distant DuosIn a recent study led by Evgenii Chaikin (Peter the Great St. Petersburg Polytechnic University, Russia), a team of scientists has explored the Hubble Ultra Deep Field in search ofhigh-redshift galaxies merging during the epoch of reionization, when the first galaxies formed and evolved.Using an approach called the dropout technique, which leverages the visibility of the galaxies in different wavelength filters, Chaikin and collaborators obtain approximate redshifts for an initial sample of 7

  14. Pair creation by dynamic field configurations

    International Nuclear Information System (INIS)

    Aoyama, H.

    1982-01-01

    This thesis deals with the dynamics of the classical configuration of a quantum field unstable due to pair creation. The effective action method is developed first to treat such problems for a simple two-field model. Physical quantities such as pair creation probabilities are related to a complex function called the effective configuration, which is defined to minimize the effective action. Unitarity of the S-matrix is verified at the lowest order of the weak-field approximation. At the same order, the real valued vacuum expectation value of the quantum field, named the real configuration, is constructed in terms of the effective configuration. An integro-differential equation for the real configuration is given and is used to show that the real configuration is causal, while the effective configuration is not. Two practical applications of the effective action method are discussed. The first deals with pair creation in an anisotropic universe, and the real geometry is given in terms of the effective geometry in the samll anisotropy limit. The second deals with expanding vacuum bubbles. Corresponding to three possible situations, three kinds of field equations of each of the effective configuration and the real configuration are obtained. The behavior of the bubble is also studied by a semi-classical method, and one of the three situations is suggested to be plausible

  15. Quantitative evaluation of pairs and RS steganalysis

    Science.gov (United States)

    Ker, Andrew D.

    2004-06-01

    We give initial results from a new project which performs statistically accurate evaluation of the reliability of image steganalysis algorithms. The focus here is on the Pairs and RS methods, for detection of simple LSB steganography in grayscale bitmaps, due to Fridrich et al. Using libraries totalling around 30,000 images we have measured the performance of these methods and suggest changes which lead to significant improvements. Particular results from the project presented here include notes on the distribution of the RS statistic, the relative merits of different "masks" used in the RS algorithm, the effect on reliability when previously compressed cover images are used, and the effect of repeating steganalysis on the transposed image. We also discuss improvements to the Pairs algorithm, restricting it to spatially close pairs of pixels, which leads to a substantial performance improvement, even to the extent of surpassing the RS statistic which was previously thought superior for grayscale images. We also describe some of the questions for a general methodology of evaluation of steganalysis, and potential pitfalls caused by the differences between uncompressed, compressed, and resampled cover images.

  16. Pair-correlations in swimmer suspensions

    Science.gov (United States)

    Nambiar, Sankalp; Subramanian, Ganesh

    2017-11-01

    Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

  17. Estimating Eulerian spectra from pairs of drifters

    Science.gov (United States)

    LaCasce, Joe

    2017-04-01

    GPS-tracked surface drifters offer the possibility of sampling energetic variations at the ocean surface on scales of only 10s of meters, much less than that resolved by satellite. Here we investigate whether velocity differences between pairs of drifters can be used to estimate kinetic energy spectra. Theoretical relations between the spectrum and the second-order longitudinal structure function for 2D non-divergent flow are derived. The structure function is a natural statistic for particle pairs and is easily calculated. However it integrates contributions across wavenumber, and this tends to obscure the spectral dependencies when turbulent inertial ranges are of finite extent. Nevertheless, the transform from spectrum to structure function is robust, as illustrated with Eulerian data collected from aircraft. The inverse transform, from structure function to spectrum, is much less robust, yielding poor results in particular at large wavenumbers. This occurs because the transform involves a filter function which magnifies contributions from large pair separations, which tend to be noisy. Fitting the structure function to a polynomial improves the spectral estimate, but not sufficiently to distinguish correct inertial range dependencies. Thus with Lagrangian data, it is appears preferable to focus on structure functions, despite their shortcomings.

  18. Magnetic Pair Creation Transparency in Pulsars

    Science.gov (United States)

    Story, Sarah; Baring, M. G.

    2013-04-01

    The Fermi gamma-ray pulsar database now exceeds 115 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency below the turnover energy. We adopt a semi-analytic approach, spanning both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. Our work clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths. The altitude bounds, typically in the range of 2-6 neutron star radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. For the Crab pulsar, which emits pulsed radiation up to energies of 120 GeV, we obtain a lower bound of around 15 neutron star radii to its emission altitude.

  19. Paired and interacting galaxies: Conference summary

    International Nuclear Information System (INIS)

    Norman, C.A.

    1990-01-01

    The author gives a summary of the conference proceedings. The conference began with the presentation of the basic data sets on pairs, groups, and interacting galaxies with the latter being further discussed with respect to both global properties and properties of the galactic nuclei. Then followed the theory, modelling and interpretation using analytic techniques, simulations and general modelling for spirals and ellipticals, starbursts and active galactic nuclei. Before the conference the author wrote down the three questions concerning pairs, groups and interacting galaxies that he hoped would be answered at the meeting: (1) How do they form, including the role of initial conditions, the importance of subclustering, the evolution of groups to compact groups, and the fate of compact groups; (2) How do they evolve, including issues such as relevant timescales, the role of halos and the problem of overmerging, the triggering and enhancement of star formation and activity in the galactic nuclei, and the relative importance of dwarf versus giant encounters; and (3) Are they important, including the frequency of pairs and interactions, whether merging and interactions are very important aspects of the life of a normal galaxy at formation, during its evolution, in forming bars, shells, rings, bulges, etc., and in the formation and evolution of active galaxies? Where possible he focuses on these three central issues in the summary

  20. Orthogonal expansions related to compact Gelfand pairs

    DEFF Research Database (Denmark)

    Berg, Christian; Peron, Ana P.; Porcu, Emilio

    2017-01-01

    . The functions of this class are the functions having a uniformly convergent expansion ∑ϕεZB(ϕ)(u)ϕ(x) for xεG,uεL, where the sum is over the space Z of positive definite spherical functions ϕ:G→C for the Gelfand pair, and (B(ϕ))ϕεZ is a family of continuous positive definite functions on L such that ∑ϕε......For a locally compact group G, let P(G) denote the set of continuous positive definite functions f:G→C. Given a compact Gelfand pair (G,K) and a locally compact group L, we characterize the class PK#(G,L) of functions fεP(G×L) which are bi-invariant in the G-variable with respect to K......(d)) and (U(q),U(q-1)) as well as for the product of these Gelfand pairs.The result generalizes recent theorems of Berg-Porcu (2016) and Guella-Menegatto (2016)....

  1. HVDC power transmission technology assessment

    Energy Technology Data Exchange (ETDEWEB)

    Hauth, R.L.; Tatro, P.J.; Railing, B.D. [New England Power Service Co., Westborough, MA (United States); Johnson, B.K.; Stewart, J.R. [Power Technologies, Inc., Schenectady, NY (United States); Fink, J.L.

    1997-04-01

    The purpose of this study was to develop an assessment of the national utility system`s needs for electric transmission during the period 1995-2020 that could be met by future reduced-cost HVDC systems. The assessment was to include an economic evaluation of HVDC as a means for meeting those needs as well as a comparison with competing technologies such as ac transmission with and without Flexible AC Transmission System (FACTS) controllers. The role of force commutated dc converters was to be assumed where appropriate. The assessment begins by identifying the general needs for transmission in the U.S. in the context of a future deregulated power industry. The possible roles for direct current transmission are then postulated in terms of representative scenarios. A few of the scenarios are illustrated with the help of actual U.S. system examples. non-traditional applications as well as traditional applications such as long lines and asynchronous interconnections are discussed. The classical ``break-even distance`` concept for comparing HVDC and ac lines is used to assess the selected scenarios. The impact of reduced-cost converters is reflected in terms of the break-even distance. This report presents a comprehensive review of the functional benefits of HVDC transmission and updated cost data for both ac and dc system components. It also provides some provocative thoughts on how direct current transmission might be applied to better utilize and expand our nation`s increasingly stressed transmission assets.

  2. Endoscopic transmission of Helicobacter pylori

    NARCIS (Netherlands)

    Tytgat, G. N.

    1995-01-01

    The contamination of endoscopes and biopsy forceps with Helicobacter pylori occurs readily after endoscopic examination of H. pylori-positive patients. Unequivocal proof of iatrogenic transmission of the organism has been provided. Estimates for transmission frequency approximate to 4 per 1000

  3. Transmission reliability faces future challenges

    International Nuclear Information System (INIS)

    Beaty, W.

    1993-01-01

    The recently published Washington International Energy Group's 1993 Electric Utility Outlook states that nearly one-third (31 percent) of U.S. utility executives expect reliability to decrease in the near future. Electric power system stability is crucial to reliability. Stability analysis determines whether a system will stay intact under normal operating conditions, during minor disturbances such as load fluctuations, and during major disturbances when one or more parts of the system fails. All system elements contribute to reliability or the lack of it. However, this report centers on the transmission segment of the electric system. The North American Electric Reliability Council (NERC) says the transmission systems as planned will be adequate over the next 10 years. However, delays in building new lines and increasing demands for transmission services are serious concerns. Reliability concerns exist in the Mid-Continent Area Power Pool and the Mid-America Interconnected Network regions where transmission facilities have not been allowed to be constructed as planned. Portions of the transmission systems in other regions are loaded at or near their limits. NERC further states that utilities must be allowed to complete planned generation and transmission as scheduled. A reliable supply of electricity also depends on adhering to established operating criteria. Factors that could complicate operations include: More interchange schedules resulting from increased transmission services. Increased line loadings in portions of the transmission systems. Proliferation of non-utility generators

  4. Strong pairing approximation in comparison with the exact solutions to the pairing Hamiltonian

    Directory of Open Access Journals (Sweden)

    Lunyov A.V.

    2016-01-01

    Full Text Available Results of the Strong Pairing Approximation (SPA as a method with the exact particle number conservation are compared with those of the quasiparticle method (QM. It is shown that SPA comes to the same equations as QM for the gap parameter, chemical potential and one- and two-quasiparticle states. Calculations are performed for 14864Gd84 as an example, and compared with the exact solutions to the pairing Hamiltonian.

  5. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    OpenAIRE

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2014-01-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

  6. The paired-domination and the upper paired-domination numbers of graphs

    Directory of Open Access Journals (Sweden)

    Włodzimierz Ulatowski

    2015-01-01

    Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

  7. Energy Transmission and Infrastructure

    Energy Technology Data Exchange (ETDEWEB)

    Mathison, Jane

    2012-12-31

    The objective of Energy Transmission and Infrastructure Northern Ohio (OH) was to lay the conceptual and analytical foundation for an energy economy in northern Ohio that will: • improve the efficiency with which energy is used in the residential, commercial, industrial, agricultural, and transportation sectors for Oberlin, Ohio as a district-wide model for Congressional District OH-09; • identify the potential to deploy wind and solar technologies and the most effective configuration for the regional energy system (i.e., the ratio of distributed or centralized power generation); • analyze the potential within the district to utilize farm wastes to produce biofuels; • enhance long-term energy security by identifying ways to deploy local resources and building Ohio-based enterprises; • identify the policy, regulatory, and financial barriers impeding development of a new energy system; and • improve energy infrastructure within Congressional District OH-09. This objective of laying the foundation for a renewable energy system in Ohio was achieved through four primary areas of activity: 1. district-wide energy infrastructure assessments and alternative-energy transmission studies; 2. energy infrastructure improvement projects undertaken by American Municipal Power (AMP) affiliates in the northern Ohio communities of Elmore, Oak Harbor, and Wellington; 3. Oberlin, OH-area energy assessment initiatives; and 4. a district-wide conference held in September 2011 to disseminate year-one findings. The grant supported 17 research studies by leading energy, policy, and financial specialists, including studies on: current energy use in the district and the Oberlin area; regional potential for energy generation from renewable sources such as solar power, wind, and farm-waste; energy and transportation strategies for transitioning the City of Oberlin entirely to renewable resources and considering pedestrians, bicyclists, and public transportation as well as drivers

  8. Regional Transmission Projects: Finding Solutions

    Energy Technology Data Exchange (ETDEWEB)

    The Keystone Center

    2005-06-15

    The Keystone Center convened and facilitated a year-long Dialogue on "Regional Transmission Projects: Finding Solutions" to develop recommendations that will help address the difficult and contentious issues related to expansions of regional electric transmission systems that are needed for reliable and economic transmission of power within and across regions. This effort brought together a cross-section of affected stakeholders and thought leaders to address the problem with the collective wisdom of their experience and interests. Transmission owners sat at the table with consumer advocates and environmental organizations. Representatives from regional transmission organizations exchanged ideas with state and federal regulators. Generation developers explored common interests with public power suppliers. Together, the Dialogue participants developed consensus solutions about how to begin unraveling some of the more intractable issues surrounding identification of need, allocation of costs, and reaching consensus on siting issues that can frustrate the development of regional transmission infrastructure. The recommendations fall into three broad categories: 1. Recommendations on appropriate institutional arrangements and processes for achieving regional consensus on the need for new or expanded transmission infrastructure 2. Recommendations on the process for siting of transmission lines 3. Recommendations on the tools needed to support regional planning, cost allocation, and siting efforts. List of Dialogue participants: List of Dialogue Participants: American Electric Power American Transmission Company American Wind Energy Association California ISO Calpine Corporation Cinergy Edison Electric Institute Environmental Defense Federal Energy Regulatory Commission Great River Energy International Transmission Company ISO-New England Iowa Public Utility Board Kanner & Associates Midwest ISO National Association of Regulatory Utility Commissioners National Association

  9. Information transmission via fiber optics in the shiva laser control system

    International Nuclear Information System (INIS)

    Parker, J.

    1978-01-01

    The Fiber Optic Serial Link package performs the functions of transmission and reception of signals over a pair of fiber optic cables and the I/O of serial data to a local device in EIA format. Present sysems requirements include fiber cable transmission length of up to 150 m and baud rates up to 9600, although the design criterium of transmission at 19.2 KB has been met. Fiber optic links are used between the central control area and each of the alignment control subsystems, in addition to sending timing signals over long distances between subsystems

  10. The evolution of transmission mode

    Science.gov (United States)

    Forbes, Mark R.; Hauffe, Heidi C.; Kallio, Eva R.; Okamura, Beth; Sait, Steven M.

    2017-01-01

    This article reviews research on the evolutionary mechanisms leading to different transmission modes. Such modes are often under genetic control of the host or the pathogen, and often in conflict with each other via trade-offs. Transmission modes may vary among pathogen strains and among host populations. Evolutionary changes in transmission mode have been inferred through experimental and phylogenetic studies, including changes in transmission associated with host shifts and with evolution of the unusually complex life cycles of many parasites. Understanding the forces that determine the evolution of particular transmission modes presents a fascinating medley of problems for which there is a lack of good data and often a lack of conceptual understanding or appropriate methodologies. Our best information comes from studies that have been focused on the vertical versus horizontal transmission dichotomy. With other kinds of transitions, theoretical approaches combining epidemiology and population genetics are providing guidelines for determining when and how rapidly new transmission modes may evolve, but these are still in need of empirical investigation and application to particular cases. Obtaining such knowledge is a matter of urgency in relation to extant disease threats. This article is part of the themed issue ‘Opening the black box: re-examining the ecology and evolution of parasite transmission’. PMID:28289251

  11. Alternative approaches to transmission investment

    Energy Technology Data Exchange (ETDEWEB)

    Thon, S. [AltaLink Management Ltd., Calgary, AB (Canada)

    2004-07-01

    AltaLink is Canada's first stand-alone power transmission company, serving all major centres in Alberta and 85 per cent of Alberta's population. It has more than $1 billion in assets, 11,500 km of transmission lines and 300 substations. It was noted that there has not been any significant investment in power transmission in Alberta for the past 20 years, partly because transmission assets have a very long lifespan. The new role of the power grid is to ensure reliability, safety, efficiency, market effectiveness and supply diversity. The benefits and costs of AltaLink's 500 kV North-South upgrade project were outlined. It was noted that a healthy transmission system is the basis for economic growth throughout the province and for the development of Alberta's resource base. The transmission policy in Alberta endorses that all consumers pay postage stamp tariffs. It also promotes a proactive plan for transmission projects, the time to maximum rate (TMR) in limited cases only, a congestion-free grid under normal conditions, the financial commitment of generators, specific time limits on permitting processes, and regional interconnections to benefit all customers. tabs., figs.

  12. Transmission Line Series Compensation for Wind Energy Transmission

    International Nuclear Information System (INIS)

    Palanichamy, C; Wong, Y C

    2015-01-01

    Wind energy has demonstrated to be a clean, copious and absolutely renewable source of energy, and the large penetration of it into the power grid indicates that wind energy is considered an effective means of power generation, Transmission of wind energy from remote locations to load centers necessitates long transmission lines. Series compensation is a proven and economical transmission solution to address system power transfer strength, grid stability, and voltage profile issues of long transmission lines. In this paper, a programmable approach to determine the capacitive reactance of series capacitor and optimum location for its placement to achieve maximum power transfer gas been presented. The respective program with sample solutions has been provided for real-time applications. (paper)

  13. Top quark pair production at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Baernreuther, Peter

    2012-06-28

    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 ({proportional_to}7.3 pb at the Tevatron to {proportional_to}800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair

  14. Top quark pair production at the LHC

    International Nuclear Information System (INIS)

    Baernreuther, Peter

    2012-01-01

    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 (∝7.3 pb at the Tevatron to ∝800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair production in quark anti

  15. Presumptive horizontal symbiont transmission in the fungus-growing termite Macrotermes natalensis

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Boomsma, Jacobus Jan; Aanen, Duur Kornelis

    2006-01-01

    recombination was found, indicative of frequent sexual horizontal transmission. First, all 31 strains had unique multilocus genotypes. Second, SNP markers (n = 55) were largely in Hardy-Weinberg equilibrium (90.9%) and almost all possible pairs of SNPs between genetically unlinked loci were in linkage...

  16. Older Galaxy Pair Has Surprisingly Youthful Glow

    Science.gov (United States)

    2007-01-01

    [figure removed for brevity, see original site] Poster Version A pair of interacting galaxies might be experiencing the galactic equivalent of a mid-life crisis. For some reason, the pair, called Arp 82, didn't make their stars early on as is typical of most galaxies. Instead, they got a second wind later in life -- about 2 billion years ago -- and started pumping out waves of new stars as if they were young again. Arp 82 is an interacting pair of galaxies with a strong bridge and a long tail. NGC 2535 is the big galaxy and NGC 2536 is its smaller companion. The disk of the main galaxy looks like an eye, with a bright 'pupil' in the center and oval-shaped 'eyelids.' Dramatic 'beads on a string' features are visible as chains of evenly spaced star-formation complexes along the eyelids. These are presumably the result of large-scale gaseous shocks from a grazing encounter. The colors of this galaxy indicate that the observed stars are young to intermediate in age, around 2 million to 2 billion years old, much less than the age of the universe (13.7 billion years). The puzzle is: why didn't Arp 82 form many stars earlier, like most galaxies of that mass range? Scientifically, it is an oddball and provides a relatively nearby lab for studying the age of intermediate-mass galaxies. This picture is a composite captured by Spitzer's infrared array camera with light at wavelength 8 microns shown in red, NASA's Galaxy Evolution Explorer combined 1530 and 2310 Angstroms shown in blue, and the Southeastern Association for Research in Astronomy Observatory light at 6940 Angstroms shown in green.

  17. Augmenting Think-Pair-Share with Simulations

    Science.gov (United States)

    Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS

    2009-01-01

    Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

  18. Midwest Transmission Workshop I Summary

    Energy Technology Data Exchange (ETDEWEB)

    Kevin Bryan

    2001-05-01

    OAK-B135 The meeting was opened with a review of the purposes of the workshop: (1) Present and discuss key studies and assessments of transmission upgrades, additions and related issues for the upper Midwest, including work that addresses the full range of views on these topics; (2) Understand the various transmission issues in the upper Midwest and discuss options for addressing the issues; and (3) Identify the decision makers and entities that need to play an active role if transmission issues are to be resolved, and agree on next steps for engaging these individuals and organizations through education, outreach, and information dissemination.

  19. Markets for financial transmission rights

    International Nuclear Information System (INIS)

    Kristiansen, T.

    2004-01-01

    Results of a survey of markets for financial transmission rights that facilitate competitive, open and non-discriminatory electricity market design are discussed. Specifically, the survey covered Pennsylvania, New Jersey, Maryland (PJM), New York, California, New England, Texas and New Zealand. The main emphasis was on the PJM and the New York markets, since they are the most mature. Interwowen with the results is a thorough discussion of the properties, features and the design of financial transaction rights in the various jurisdictions, the advantages, disadvantages and market performance of financial transmission rights, market performance criteria, and the mechanism for acquiring financial transmission rights. 49 refs., 14 tabs., 6 figs

  20. Paired structures and bipolar knowledge representation

    DEFF Research Database (Denmark)

    Montero, Javier; Bustince, Humberto; Franco, Camilo

    In this strictly positional paper we propose a general approach to bipolar knowledge representation, where the meaning of concepts can be modelled by examining their decomposition into opposite and neutral categories. In particular, it is the semantic relationship between the opposite categories...... and at the same time the type of neutrality rising in between opposites. Based on this first level of bipolar knowledge representation, paired structures in fact offer the means to characterize a specific bipolar valuation scale depending on the meaning of the concept that has to be verified. In this sense...

  1. Z Boson Pair-Production at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Duda, M; Echenard, B; Eline, A; El-Hage, A; El-Mamouni, H; Engler, A; Eppling, F J; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Nisati, A; Novák, T; Nowak, H; Ofierzynski, R A; Organtini, G; Pal, I; Palomares, C; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofev, D; Prokofiev, D O; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, J A; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Schäfer, C; Shchegelskii, V; Schopper, Herwig Franz; Schotanus, D J; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wang, Q; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2003-01-01

    Events stemming from the pair-production of Z bosons in e^+e^- collisions are studied using 217.4 pb^-1 of data collected with the L3 detector at centre-of-mass energies from 200 GeV up to 209 GeV. The special case of events with b quarks is also investigated. Combining these events with those collected at lower centre-of-mass energies, the Standard Model predictions for the production mechanism are verified. In addition, limits are set on anomalous couplings of neutral gauge bosons and on effects of extra space dimensions.

  2. Pair Negotiation When Developing English Speaking Tasks

    Directory of Open Access Journals (Sweden)

    Ingrid Liliana Bohórquez Suárez

    2011-12-01

    Full Text Available This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students’ negotiations: Establishing a connection with a partner to work with, proposing practical alternatives, refusing mates’ propositions, and making practical decisions. Moreover, we found that the constant performance of the process of negotiation provokes students to construct a sociolinguistic identity that allows agreements to emerge.

  3. Production of supersymmetric pairs at antipp colliders

    International Nuclear Information System (INIS)

    Peschanski, R.

    1985-02-01

    Production and decay rates of squarks and gluinos at antipp colliders are shown to depend not only on the mass scale but on the ratio of squark to gluino mass. In the degenerate case which is shown to be natural in a large class of broken Supergravity models with minimal field content the predicted cross-sections are enhanced by a sizeable factor. This gives an improved bound on the squark mass (70 GeV) from the analysis of Cern monojets and indications for the search of squark decay modes of supersymmetric pairs at antipp colliders in the near future

  4. Pairing correlations in a fissioning potential well

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    1999-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler box potential with a δ-function diaphragm to mimic scission

  5. Hadroproduction of massive lepton pairs and QCD

    International Nuclear Information System (INIS)

    Berger, E.L.

    1979-04-01

    A survey is presented of some current issues of interest in attempts to describe the production of massive lepton pairs in hadronic collisions at high energies. I concentrate on the interpretation of data in terms of the parton model and on predictions derived from quantum-chromodynamics (QCD), their reliability and their confrontation with experiment. Among topics treated are the connection with deep-inelastic lepton scattering, universality of structure functions, and the behavior of cross-sections as a function of transverse momentum

  6. Dimer pair correlations on the brick lattice

    International Nuclear Information System (INIS)

    Yokoi, C.S.O.; Nagle, J.F.; Sulinas, S.R.

    1986-01-01

    Using exact methods, pair-correlation functions are studied in the dimer model defined on a brick lattice. At long distances these functions exhibit strongly anisotropic algebraic decay and, near criticality, the length scales diverge differently in the two principal directions. The critical exponents are v /sub x/ =1/2 and v /sub y/ =1. These results are in agreement with deductions drawn from recent exact finite-size scaling calculations. We also interpret our results in the light of domain wall theories of commensurate-incommensurate transitions, and in particular we study the relation of the present model to the discrete version of the Pokrovsky-Talapov model introduced by Villain

  7. The evolution of plant virus transmission pathways

    Science.gov (United States)

    Frédéric M. Hamelin; Linda J.S. Allen; Holly R. Prendeville; M. Reza Hajimorad; Michael J. Jeger

    2016-01-01

    The evolution of plant virus transmission pathways is studied through transmission via seed, pollen, oravector. We address the questions: under what circumstances does vector transmission make pollen transmission redundant? Can evolution lead to the coexistence of multiple virus transmission pathways? We restrict the analysis to an annual plant population in which...

  8. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    Energy Technology Data Exchange (ETDEWEB)

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)

    2015-07-01

    Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

  9. Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

    Science.gov (United States)

    Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

    2015-03-01

    Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

  10. Frequent Pairs in Data Streams: Exploiting Parallelism and Skew

    DEFF Research Database (Denmark)

    Campagna, Andrea; Kutzkow, Konstantin; Pagh, Rasmus

    2011-01-01

    We introduce the Pair Streaming Engine (PairSE) that detects frequent pairs in a data stream of transactions. Our algorithm finds the most frequent pairs with high probability, and gives tight bounds on their frequency. It is particularly space efficient for skewed distribution of pair supports...... items mining in data streams. We show how to efficiently scale these approaches to handle large transactions. We report experimental results showcasing precision and recall of our method. In particular, we find that often our method achieves excellent precision, returning identical upper and lower...... bounds on the supports of the most frequent pairs....

  11. In situ observation of thermal relaxation of interstitial-vacancy pair defects in a graphite gap

    International Nuclear Information System (INIS)

    Urita, Koki; Suenaga, Kazu; Iijima, Sumio; Sugai, Toshiki; Shinohara, Hisanori

    2005-01-01

    Direct observation of individual defects during formation and annihilation in the interlayer gap of double-wall carbon nanotubes (DWNT) is demonstrated by high-resolution transmission electron microscopy. The interlayer defects that bridge two adjacent graphen layers in DWNT are stable for a macroscopic time at the temperature below 450 K. These defects are assigned to a cluster of one or two interstitial-vacancy pairs (I-V pairs) and often disappear just after their formation at higher temperatures due to an instantaneous recombination of the interstitial atom with vacancy. Systematic observations performed at the elevated temperatures find a threshold for the defect annihilation at 450-500 K, which, indeed, corresponds to the known temperature for the Wigner energy release

  12. In situ observation of thermal relaxation of interstitial-vacancy pair defects in a graphite gap.

    Science.gov (United States)

    Urita, Koki; Suenaga, Kazu; Sugai, Toshiki; Shinohara, Hisanori; Iijima, Sumio

    2005-04-22

    Direct observation of individual defects during formation and annihilation in the interlayer gap of double-wall carbon nanotubes (DWNT) is demonstrated by high-resolution transmission electron microscopy. The interlayer defects that bridge two adjacent graphen layers in DWNT are stable for a macroscopic time at the temperature below 450 K. These defects are assigned to a cluster of one or two interstitial-vacancy pairs (I-V pairs) and often disappear just after their formation at higher temperatures due to an instantaneous recombination of the interstitial atom with vacancy. Systematic observations performed at the elevated temperatures find a threshold for the defect annihilation at 450-500 K, which, indeed, corresponds to the known temperature for the Wigner energy release.

  13. Power-efficient production of photon pairs in a tapered chalcogenide microwire

    Energy Technology Data Exchange (ETDEWEB)

    Meyer-Scott, Evan, E-mail: emeyersc@uwaterloo.ca; Dot, Audrey [Institute for Quantum Computing and Department of Physics and Astronomy, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Ahmad, Raja; Li, Lizhu; Rochette, Martin [Department of Electrical and Computer Engineering, McGill University, 3480 University Street, Montréal, Québec H3A 2A7 (Canada); Jennewein, Thomas [Institute for Quantum Computing and Department of Physics and Astronomy, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Quantum Information Science Program, Canadian Institute for Advanced Research, 180 Dundas Street West, Suite 1400, Toronto, Ontario M5G 1Z8 (Canada)

    2015-02-23

    Using tapered fibers of As{sub 2}Se{sub 3} chalcogenide glass, we produce photon pairs at telecommunication wavelengths with low pump powers. We found maximum coincidences-to-accidentals ratios of 2.13 ± 0.07 for degenerate pumping with 3.2 μW average power, and 1.33 ± 0.03 for non-degenerate pumping with 1.0 μW and 1.5 μW average power of the two pumps. Our results show that the ultrahigh nonlinearity in these microwires could allow single-photon pumping to produce photon pairs, enabling the production of large entangled states, heralding of single photons after lossy transmission, and photonic quantum information processing with nonlinear optics.

  14. Digital coherent superposition of optical OFDM subcarrier pairs with Hermitian symmetry for phase noise mitigation.

    Science.gov (United States)

    Yi, Xingwen; Chen, Xuemei; Sharma, Dinesh; Li, Chao; Luo, Ming; Yang, Qi; Li, Zhaohui; Qiu, Kun

    2014-06-02

    Digital coherent superposition (DCS) provides an approach to combat fiber nonlinearities by trading off the spectrum efficiency. In analogy, we extend the concept of DCS to the optical OFDM subcarrier pairs with Hermitian symmetry to combat the linear and nonlinear phase noise. At the transmitter, we simply use a real-valued OFDM signal to drive a Mach-Zehnder (MZ) intensity modulator biased at the null point and the so-generated OFDM signal is Hermitian in the frequency domain. At receiver, after the conventional OFDM signal processing, we conduct DCS of the optical OFDM subcarrier pairs, which requires only conjugation and summation. We show that the inter-carrier-interference (ICI) due to phase noise can be reduced because of the Hermitain symmetry. In a simulation, this method improves the tolerance to the laser phase noise. In a nonlinear WDM transmission experiment, this method also achieves better performance under the influence of cross phase modulation (XPM).

  15. Three-color Sagnac source of polarization-entangled photon pairs.

    Science.gov (United States)

    Hentschel, Michael; Hübel, Hannes; Poppe, Andreas; Zeilinger, Anton

    2009-12-07

    We demonstrate a compact and stable source of polarization-entangled pairs of photons, one at 810 nm wavelength for high detection efficiency and the other at 1550 nm for long-distance fiber communication networks. Due to a novel Sagnac-based design of the interferometer no active stabilization is needed. Using only one 30 mm ppKTP bulk crystal the source produces photons with a spectral brightness of 1.13 x 10(6) pairs/s/mW/THz with an entanglement fidelity of 98.2%. Both photons are single-mode fiber coupled and ready to be used in quantum key distribution (QKD) or transmission of photonic quantum states over large distances.

  16. Echinococcosis : disease, detection and transmission

    NARCIS (Netherlands)

    Craig, P.S.; Rogan, M T; Campos-Ponce, M

    2003-01-01

    Echinococcosis is one of the world's most geographically widespread parasitic zoonoses, with transmission occurring in tropical, temperate and arctic biomes. Most human infections are due to Echinococcus granulosus transmitted between domestic dogs and livestock, but this cosmopolitan species also

  17. Hybrid-Vehicle Transmission System

    Science.gov (United States)

    Lupo, G.; Dotti, G.

    1985-01-01

    Continuously-variable transmission system for hybrid vehicles couples internal-combustion engine and electric motor section, either individually or in parallel, to power vehicle wheels during steering and braking.

  18. Accounting-related transmission issues

    International Nuclear Information System (INIS)

    Niehaus, M.; Bjorn, P.; Pate, G.

    1999-01-01

    Various initiatives have been undertaken by the Federal Energy Regulatory Commission (FERC) to deregulate wholesale electric energy markets. These initiatives have focused on restructuring the transmission systems in the US and recently have culminated in a proposal requiring formation of and participation in regional transmission organizations. The overall form of regulation selected to determine rates for transmission entities as well as underlying regulatory decisions reached on key issues will have profound implications for transmission entities. For example, traditional cost-based regulation would require one set of accounting and reporting rules, while incentive-based regulation may not be subject to those same rules. An overview of some of the major accounting and financial reporting issues that will need to be considered is presented

  19. Transmission of Information: An Overview.

    Science.gov (United States)

    Thoma, George R.

    1981-01-01

    Outlines the basic principles underlying the transmission of information, including analog and digital modulation, limitations to communications, configurations of communications networks, optical fiber cables, and earth satellites. Six references are cited. (FM)

  20. Linking healthcare associated norovirus outbreaks: a molecular epidemiologic method for investigating transmission

    Directory of Open Access Journals (Sweden)

    Andrews Nick

    2006-07-01

    Full Text Available Abstract Background Noroviruses are highly infectious pathogens that cause gastroenteritis in the community and in semi-closed institutions such as hospitals. During outbreaks, multiple units within a hospital are often affected, and a major question for control programs is: are the affected units part of the same outbreak or are they unrelated transmission events? In practice, investigators often assume a transmission link based on epidemiological observations, rather than a systematic approach to tracing transmission. Here, we present a combined molecular and statistical method for assessing: 1 whether observed clusters provide evidence of local transmission and 2 the probability that anecdotally|linked outbreaks truly shared a transmission event. Methods 76 healthcare associated outbreaks were observed in an active and prospective surveillance scheme of 15 hospitals in the county of Avon, England from April 2002 to March 2003. Viral RNA from 64 out of 76 specimens from distinct outbreaks was amplified by reverse transcription-PCR and was sequenced in the polymerase (ORF 1 and capsid (ORF 2 regions. The genetic diversity, at the nucleotide level, was analysed in relation to the epidemiological patterns. Results Two out of four genetic and epidemiological clusters of outbreaks were unlikely to have occurred by chance alone, thus suggesting local transmission. There was anecdotal epidemiological evidence of a transmission link among 5 outbreaks pairs. By combining this epidemiological observation with viral sequence data, the evidence of a link remained convincing in 3 of these pairs. These results are sensitive to prior beliefs of the strength of epidemiological evidence especially when the outbreak strains are common in the background population. Conclusion The evidence suggests that transmission between hospitals units does occur. Using the proposed criteria, certain hypothesized transmission links between outbreaks were supported while