76 FR 54188 - Television Broadcasting Services; Montgomery, AL

Science.gov (United States)

2011-08-31

... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 11-137, RM-11637; DA 11-1414] Television Broadcasting Services; Montgomery, AL AGENCY: Federal Communications Commission. ACTION: Proposed... 47 CFR Part 73 Television, Television broadcasting. Federal Communications Commission. Barbara A...

76 FR 71909 - Television Broadcasting Services; Montgomery, AL

Science.gov (United States)

2011-11-21

... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 11-137; RM-11637, DA 11-1863] Television Broadcasting Services; Montgomery, AL AGENCY: Federal Communications Commission. ACTION: Final... CFR Part 73 Television. Federal Communications Commission. Barbara A. Kreisman, Chief, Video Division...

Replication infidelity via a mismatch with Watson-Crick geometry.

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

On Montgomery's pair correlation conjecture to the zeros of Riedmann zeta function

OpenAIRE

Li, Pei

2005-01-01

In this thesis, we are interested in Montgomery's pair correlation conjecture which is about the distribution of.the spacings between consecutive zeros of the Riemann Zeta function. Our goal is to explain and study Montgomery's pair correlation conjecture and discuss its connection with the random matrix theory. In Chapter One, we will explain how to define the Ftiemann Zeta function by using the analytic continuation. After this, several classical properties of the Ftiemann Zeta function wil...

Mad Colonial Narrators in Anglo-Irish Literature: Lemuel Gulliver and Freddie Montgomery

Directory of Open Access Journals (Sweden)

Patricia Jones

2018-03-01

Full Text Available The following discussion highlights parallels between the narrators, Lemuel Gulliver of Jonathan Swift’s Gulliver’s Travels (1726 and Freddie Montgomery of John Banville’s The Book of Evidence (1989. The argument calls on post-colonialism, Foucaultian theory of “will to truth” and the narrative theory of Shlomith Rimmon-Kenan to emphasize similarities in the rendering of mental degeneration in Gulliver and Montgomery. The colonial-induced mental breakdown of both narrators can be said to unravel, not so much in the tale these narrators think they are relating, but instead between the lines of their stories in narratives which continually focus attention back onto themselves. Despite the 260 years separating these works, the madness of both Gulliver and Montgomery can be interpreted as a reluctance on their respective parts to shed established colonial identities once the colonial stage has receded.

A Challenge to Watson

Science.gov (United States)

Detterman, Douglas K.

2011-01-01

Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

Ed Watson - 1940-2006

CERN Multimedia

2006-01-01

Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

Science.gov (United States)

Kidd, Gary R.

2004-05-01

Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

Science.gov (United States)

2013-03-20

... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

Science.gov (United States)

2013-10-25

... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

Buying Renewable Electric Power in Montgomery County, Maryland

Science.gov (United States)

Cember, Richard P.

2008-08-01

From mid-August 2007 until mid-August 2008, my home electricity supply was 100% wind-generated. My experience in switching to wind-generated electric power may be of interest to fellow AGU members for three reasons. First, Montgomery County, Md., where I live, is one of the few jurisdictions in the United States that has both an electric power tax and a renewable energy credit. The county is therefore a case study in price-based public policy for greenhouse gas emissions control. Second, I was surprised by the comparatively small price difference (or ``price premium'') between wind-generated and conventionally generated power in the county, and I believe that Eos readers will be similarly surprised. Third, because so many U.S. federal agencies concerned with Earth science are based in the Washington, D. C., area, a high concentration of AGU members live in Montgomery County and may be personally interested in evaluating the price of reducing carbon dioxide emissions from the generation of their own residential electricity.

Montgomery Point Lock and Dam, White River, Arkansas

Science.gov (United States)

2016-01-01

the time of this study was James E. Walker, Chief, Navigation Branch, HQUSACE. W. Jeff Lillycrop, CHL, was the ERDC Technical Director for... Fischer , and J. Mewes. 2011. Montgomery Point Lock and Dam HSR model, White River miles 4.0 – 0.0; Hydraulic sediment response model investigation

Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

International Nuclear Information System (INIS)

Geltman, S.

1996-01-01

Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

On the scaling limits of Galton Watson processes in varying environment

NARCIS (Netherlands)

Bansaye, V.; Simatos, F.

2011-01-01

Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

School Progress Report 2013. Montgomery County Public Schools

Science.gov (United States)

Montgomery County Public Schools, 2014

2014-01-01

The 2013 School Progress Report for Montgomery County Public Schools (MCPS) provides state, county, and individual school performance data, as well as information on student attendance, high school graduation rates, and the professional qualifications of teachers at the state, district, and school levels for the 2012-2013 school year. Montgomery…

Sommerfeld-Watson transformation for nuclear fission

International Nuclear Information System (INIS)

Alexandru, G.

1978-01-01

It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

Elbow Room for Best Practice? Montgomery, Patients' values, and Balanced Decision-Making in Person-Centred Clinical Care.

Science.gov (United States)

Herring, Jonathan; Fulford, Kmw; Dunn, Michael; Handa, Ashoki

2017-11-01

The UK Supreme Court Montgomery judgment marks a decisive shift in the legal test of duty of care in the context of consent to treatment, from the perspective of the clinician (as represented by Bolam rules) to that of the patient. A majority of commentators on Montgomery have focused on the implications of the judgment for disclosure of risk. In this article, we set risk disclosure in context with three further elements of the judgment: benefits, options, and dialogue. These elements, we argue, taken together with risk disclosure, reflect the origins of the Montgomery ruling in a model of consent based on autonomy of patient choice through shared decision-making with their doctor. This model reflects recent developments in both law and medicine and is widely regarded (by the General Medical Council and others) as representing best practice in contemporary person-centred medicine. So understood, we suggest, the shift marked by Montgomery in the basis of duty of care is a shift in underpinning values: it is a shift from the clinician's interpretation about what would be best for patients to the values of (to what is significant or matters from the perspective of) the particular patient concerned in the decision in question. But the values of the particular patient do not thereby become paramount. The Montgomery test of duty of care requires the values of the particular patient to be balanced alongside the values of a reasonable person in the patient's position. We illustrate some of the practical challenges arising from the balance of considerations required by Montgomery with examples from surgical care. These examples show the extent to which Montgomery, in mirroring the realities of clinical decision-making, provides elbowroom for best practice in person-centred clinical care. © The Author 2017. Published by Oxford University Press; all rights reserved. For Permissions, please email: journals.permissions@oup.com.

Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

Science.gov (United States)

Digdon, Nancy; Powell, Russell A; Harris, Ben

2014-11-01

In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

OpenAIRE

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2005-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

Science.gov (United States)

Rilling, M

2000-01-01

Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

Graham Watson: Eesti vajab enam riigi sekkumist majandusse

Index Scriptorium Estoniae

Watson, Graham

2009-01-01

18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

From theory to practice: caring science according to Watson and Brewer.

Science.gov (United States)

Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

2009-10-01

Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

Oncologists partner with Watson on genomics.

Science.gov (United States)

2015-08-01

A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

Did John B. Watson Really "Found" Behaviorism?

Science.gov (United States)

Malone, John C

2014-05-01

Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

Science.gov (United States)

Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

2007-01-01

In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

[From humanism to nihilism: dialectics on Jean Watson's caring theory].

Science.gov (United States)

Krol, Pawel J; Lavoie, Mireille

2015-09-01

nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2012-11-13

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2013-06-04

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

A history of the term radical behaviorism: From Watson to Skinner

Science.gov (United States)

Schneider, Susan M.; Morris, Edward K.

1987-01-01

This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

Watson's theorem and resonant pion photoproduction amplitude in the delta channel

International Nuclear Information System (INIS)

Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

1984-01-01

The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

Watson's behaviorism: a comparison of the two editions (1925 and 1930).

Science.gov (United States)

Carpintero, Helio

2004-05-01

J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

Science.gov (United States)

Doyle-Lindrud, Susan

2015-02-01

IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

A conversation with Geoff Watson

OpenAIRE

Beran, R. J.; Fisher, N. I.

1998-01-01

Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

Indian Academy of Sciences (India)

IAS Admin

One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

Relativistic generalisation of the Kroll-Watson formula

International Nuclear Information System (INIS)

Kaminski, J.Z.

1985-01-01

The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

International Nuclear Information System (INIS)

Fargher, H.E.; Roberts, M.J.

1983-01-01

Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

Online Opportunist: Mary Ellen Icaza--Montgomery County Public Libraries, Rockville, MD

Science.gov (United States)

Library Journal, 2004

2004-01-01

When Mary Ellen Icaza became Electronic Services Librarian at Montgomery County Public Libraries, she noticed that the readers' services information on the library web site was invisible, even to librarians. "And if staff can't find it," she says, "customers can't." She set out to help people find that material-and to turn a…

Montgomery Blair Science, Mathematics and Computer Science Magnet Program: A Successful Model for Meeting the Needs of Highly Able STEM Learners

Science.gov (United States)

Stein, David; Ostrander, Peter; Lee, G. Maie

2016-01-01

The Magnet Program at Montgomery Blair High School is an application-based magnet program utilizing a curriculum focused on science, mathematics, and computer science catering to interested, talented, and eager to learn students in Montgomery County, Maryland. This article identifies and discusses some of the unique aspects of the Magnet Program…

Role of Montgomery T-tube stent for laryngotracheal stenosis.

Science.gov (United States)

Prasanna Kumar, Saravanam; Ravikumar, Arunachalam; Senthil, Kannan; Somu, Lakshman; Nazrin, Mohd Ismail

2014-04-01

To identify the indications, complications and outcome of patients of LTS managed with Montgomery T-tube stenting and review the current literature about the role of stenting in LTS. Retrospective chart reviews of 39 patients of laryngotracheal stenosis managed by T-tube stenting for temporary or definitive treatment during the period 2004-2011 were considered. The data on indications for stenting, type of stent, problems/complications of stenting, duration of stenting, additional intervention and outcome of management were collected, tabulated and analyzed. Of the 51 cases of laryngotracheal stenosis 39 patients were treated by Montgomery T-tube stenting. There was no mortality associated with the procedure or stenting. 82% of the patients were successfully decannulated. The problems and complications encountered were crusting within the tube in 44% and granulation at the subglottis in 33%. Two patients had complication due to T-tube itself: One patient developed tracheomalacia and the other had stenosis at both ends of the T-tube. Stenting still has a role in management of inoperable or in some deadlock situations where resection anastomosis is not feasible. It is easier to introduce the stent and to maintain it. Complications are minor and can be managed easily. It is safe for long term use. We emphasize that the treating surgeon needs to use prudence while treating stenosis using stents. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

La Materia. Nivel II. Basado en el curso de estudios de Ciencia de Montgomery County Public Schools. (Matter. Level II. Based on the Montgomery County Public Schools Science Studies Program).

Science.gov (United States)

Gerstman, M. Linda

This curriculum unit is for use in an elementary school foreign language immersion program in Montgomery County, Maryland. The unit is geared toward the second grade science classroom. It includes instructional and performance objectives, vocabulary lists, optional language structure sections, illustrations, activities, evaluation suggestions, and…

First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

Changes to the law on consent following Montgomery vs Lanarkshire Health Board.

Science.gov (United States)

Clearkin, Louis

2016-06-01

The Supreme Court's determination on Montgomery (AP) (Appellant) v Lanarkshire Health Board (Respondent) (Scotland) [2015] clarified UK law on consent. It is for the informed patient to determine which intervention, if any, they will undergo. All doctors must meet this standard and may need to reassess their practice to do so.

The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

International Nuclear Information System (INIS)

Catalan, G.; Roberts, M.J.

1979-01-01

A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

Directory of Open Access Journals (Sweden)

Cláudio Ivan de Oliveira

Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

International Nuclear Information System (INIS)

Roberts, M.J.

1988-01-01

Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

The Game is aFoot, Watson: DeepQA systems and the future of HCI

OpenAIRE

Keates, Simeon; Varker, Philip

2012-01-01

In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

NARCIS (Netherlands)

Meijer, Rob R.

I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

Seres Vivos. Nivel I. Basado en el curso de estudios de Ciencia de Montgomery County Public Schools. (Living Beings. Level 1. Based on the Montgomery County Public Schools Science Studies Program).

Science.gov (United States)

Senger, Graciela

This curriculum unit, developed by the Montgomery County Public Schools, Maryland, was designed for use in the elementary level foreign language immersion program. It is geared toward the first grade science classroom. The unit includes instructional and performance objectives, necessary vocabulary lists, optional language structure sections,…

ACT Participation and Performance for Montgomery County Public Schools Students [2014]. Memorandum

Science.gov (United States)

Sanderson, Geoffrey T.

2014-01-01

The Montgomery County (Maryland) Public Schools (MCPS) Class of 2014 consistently outperformed graduates across Maryland and the nation on all sections of the ACT, according to the ACT, Inc. annual report that was released Wednesday, August 20, 2014. Thirty percent of the graduates in the MCPS Class of 2014 took the ACT exam. According to the ACT,…

Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

Science.gov (United States)

Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

2017-07-01

The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

Watson-Crick hydrogen bonding of unlocked nucleic acids

DEFF Research Database (Denmark)

Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

2015-01-01

We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

Watson, Skinner y Algunas Disputas dentro del Conductismo

Directory of Open Access Journals (Sweden)

RICARDO PELLÓN SUÁREZ DE PUGA

2013-01-01

Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

Science.gov (United States)

Chen, Ying; Elenee Argentinis, J D; Weber, Griff

2016-04-01

Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-01-01

Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

Science.gov (United States)

26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

Interview with Mark Watson

Directory of Open Access Journals (Sweden)

Katy Shaw

2016-04-01

Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

An Evaluation of the Employee Assistance Program in the Montgomery County Public School System.

Science.gov (United States)

Goldberg, Jo Ann

The Montgomery County public school system presently provides assistance through the Employee Assistance Program (EAP) to troubled employees with problems which affect work performance. EAP's mandate is to provide crisis intervention, prereferral evaluation, information, referral, and follow-up services. From its inception to March, 1981, EAP…

Watson: A new link in the IIE iron chain

Science.gov (United States)

Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

1994-01-01

Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

Official Reports of Enrollment as of September 30, 2013. Montgomery County Public Schools

Science.gov (United States)

Erickson, Marianne

2013-01-01

This document is a combination of two reports produced for Montgomery County Public Schools (MCPS) by the Department of Policy, Records, and Reporting: (1) Official Race/Ethnic Membership of Students as of September 30, 2013; and (2) Official Report of Enrollment by Grade and School as of September 30, 2013. Both reports provide student data for…

WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

Science.gov (United States)

Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

2017-12-01

Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

Science.gov (United States)

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

Science.gov (United States)

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

DEFF Research Database (Denmark)

Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

2013-01-01

For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

Science.gov (United States)

Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

2016-10-11

We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

The Politics of Children's Literature: The Story of Rosa Parks and the Montgomery Bus Boycott.

Science.gov (United States)

Kohl, Herbert

1991-01-01

As commonly told to and read by children, the story of Rosa Parks and the Montgomery bus boycott fails to indicate Mrs. Parks' activist role or the degree of community organization and participation in the boycott. Telling what actually occurred allows children identify with people who make justice happen. (SLD)

Impact parameter representation from the Watson-Sommerfeld transform

International Nuclear Information System (INIS)

Islam, M.M.

1976-01-01

Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

Some Econometric Results for the Blanchard-Watson Bubble Model

DEFF Research Database (Denmark)

Johansen, Soren; Lange, Theis

The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

Science.gov (United States)

Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

2018-01-01

Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

Inference-Based Similarity Search in Randomized Montgomery Domains for Privacy-Preserving Biometric Identification.

Science.gov (United States)

Wang, Yi; Wan, Jianwu; Guo, Jun; Cheung, Yiu-Ming; C Yuen, Pong

2017-07-14

Similarity search is essential to many important applications and often involves searching at scale on high-dimensional data based on their similarity to a query. In biometric applications, recent vulnerability studies have shown that adversarial machine learning can compromise biometric recognition systems by exploiting the biometric similarity information. Existing methods for biometric privacy protection are in general based on pairwise matching of secured biometric templates and have inherent limitations in search efficiency and scalability. In this paper, we propose an inference-based framework for privacy-preserving similarity search in Hamming space. Our approach builds on an obfuscated distance measure that can conceal Hamming distance in a dynamic interval. Such a mechanism enables us to systematically design statistically reliable methods for retrieving most likely candidates without knowing the exact distance values. We further propose to apply Montgomery multiplication for generating search indexes that can withstand adversarial similarity analysis, and show that information leakage in randomized Montgomery domains can be made negligibly small. Our experiments on public biometric datasets demonstrate that the inference-based approach can achieve a search accuracy close to the best performance possible with secure computation methods, but the associated cost is reduced by orders of magnitude compared to cryptographic primitives.

de Jean Watson

Directory of Open Access Journals (Sweden)

Thaís Schossler

2008-01-01

Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

OpenAIRE

Rao, B J; Radding, C M

1994-01-01

Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Geology of the Birmingham, Gadsden, and Montgomery 10 x 20 NTMS Quadrangles, Alabama

International Nuclear Information System (INIS)

Copeland, C.W.; Beg, M.A.

1979-04-01

This document is a facsimile edition (with accompanying maps) of geologic reports on the Birmingham, Gadsden, and Montgomery 1 0 x 2 0 NTMS quadrangles prepared for SRL by the Geological Survey of Alabama. The purpose of these reports is to provide background geologic information to aid in the interpretation of NURE geochemical reconnaissance data. Each report includes descriptions of economic mineral localities as well as a mineral locality map and a geologic map

Geology of the Birmingham, Gadsden, and Montgomery 10 x 20 NTMS quadrangles, Alabama

International Nuclear Information System (INIS)

Copeland, C.W.; Beg, M.A.

1979-04-01

This document is a facsimile edition (with accompanying maps) of geologic reports on the Birmingham, Gadsden, and Montgomery 1 0 x 2 0 NTMS quadrangles prepared for SRL by the Geological Survey of Alabama. Purpose of these reports is to provide background geologic information to aid in the interpretation of NURE geochemical reconnaissance data. Each report includes descriptions of economic mineral localities as well as a mineral locality map and a geologic map

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

Science.gov (United States)

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

Ed Watson 1940-2006

CERN Multimedia

2006-01-01

Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

Science.gov (United States)

Malone, John C; García-Penagos, Andrés

2014-07-25

Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-12-01

Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

On the extension of the Fermi-Watson Theorem to high energy diffraction

International Nuclear Information System (INIS)

Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

1995-12-01

The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

Science.gov (United States)

Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

2010-01-01

The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

"Elementary, my dear Watson". Per una falsa citazione

Directory of Open Access Journals (Sweden)

Irene Minella

2014-12-01

Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

Conceptualizing an Agenda for Social Responsibility and Public Policy at Montgomery College. A Briefing Paper. Revised

Science.gov (United States)

Scott, Michelle T.

2007-01-01

The purpose of this briefing paper is to conceptualize a social responsibility and public policy agenda for Montgomery College. The briefing paper provides (a) a well researched perspective to embed a College culture to actualize social responsibility and public policy as institutional practices; (b) examines some of the opportunities and…

The Myth of "Rosa Parks the Tired." Teaching about Rosa Parks and the Montgomery Bus Boycott.

Science.gov (United States)

Kohl, Herbert

1993-01-01

Retells the story of Rosa Parks and the Montgomery (Alabama) bus boycott to reflect more accurately the cultural and historical background of the boycott and the conscious decision made by Mrs. Parks. Accurate examination of the story actually enhances a child's ability to identify with the issues and the protagonists. (SLD)

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

Science.gov (United States)

Beck, Hall P.; Levinson, Sharman; Irons, Gary

2009-01-01

In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

77 FR 28471 - Prevailing Rate Systems; Abolishment of Montgomery, PA, as a Nonappropriated Fund Federal Wage...

Science.gov (United States)

2012-05-15

... minimum of 26 NAF wage employees in the survey area, the local activity has the capability to host annual... County from the wage area definition. There are no longer NAF FWS employees working in Bucks County... Montgomery, PA, as a Nonappropriated Fund Federal Wage System Wage Area AGENCY: U.S. Office of Personnel...

Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

Science.gov (United States)

Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

2018-04-24

A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

From Bolam-Bolitho to Modified-Montgomery - A Paradigm Shift in the Legal Standard of Determining Medical Negligence in Singapore.

Science.gov (United States)

Neo, Han Yee

2017-09-01

In a recent landmark litigation, the Singapore Court of Appeal introduced a new legal standard for determining medical negligence with regards to information disclosure - the Modified-Montgomery test. This new test fundamentally shifts the legal position concerning the standard of care expected of a doctor when he dispenses medical advice. Previously, a doctor is expected to disclose what a "reasonable physician" would tell his patient. Now, a doctor must disclose "all material risks" that a "reasonable patient" would want to know under his unique circumstances. Patient-centred communication is no longer an aspirational ideal but has become a legal mandate. Manpower, administrative, logistic and medical educational reforms should start now, so as to support the average physician transit from the era of the Bolam-Bolitho, to that of the Modified-Montgomery.

A chat with James Watson

CERN Multimedia

2011-01-01

On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

An Appalachian portrait : black and white in Montgomery County, Virginia, before the Civil War

OpenAIRE

Grant, Charles L.

1987-01-01

Montgomery County, Virginia, is a southern Appalachian county founded in 1776. Throughout the county's antebellum history, as with most other regions of the South, four major population groups were visibly present. There were slaves, free blacks, white slaveowners, and white non-slaveowners. Little research has previously been conducted on the antebellum people of the Appalachian South. This work is a social history consisting of cross tabulations of data found in the county...

Building Watson: An Overview of the DeepQA Project

OpenAIRE

Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

2010-01-01

IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

DEFF Research Database (Denmark)

Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

2014-01-01

–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Concrete quality assurance

Energy Technology Data Exchange (ETDEWEB)

Holz, N. [Harza Engineering Company, Chicago, IL (United States)

2000-08-01

This short article reports on progress at the world's largest civil construction project, namely China's Three Gorges hydro project. Work goes on around the clock to put in place nearly 28 M m{sup 3} of concrete. At every stage of the work there is strong emphasis on quality assurance (QA) and concrete is no exception. The US company Harza Engineering has been providing QA since the mid-1980s and concrete QA has been based on international standards. Harza personnel work in the field with supervisors developing educational tools for supervising concrete construction and quality, as well as providing training courses in concrete technology. Some details on flood control, capacity, water quality and environmental aspects are given..

Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

Science.gov (United States)

Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

2018-02-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

Final work plan : phase I investigation of potential contamination at the former CCC/USDA grain storage facility in Montgomery City, Missouri.

Energy Technology Data Exchange (ETDEWEB)

LaFreniere, L. M.; Environmental Science Division

2010-08-16

From September 1949 until September 1966, the Commodity Credit Corporation of the U.S. Department of Agriculture (CCC/USDA) leased property at the southeastern end of Montgomery City, Missouri, for the operation of a grain storage facility. During this time, commercial grain fumigants containing carbon tetrachloride were commonly used by the CCC/USDA and the private grain storage industry to preserve grain in their facilities. In January 2000, carbon tetrachloride was detected in a soil sample (220 {micro}g/kg) and two soil gas samples (58 {micro}g/m{sup 3} and 550 {micro}g/m{sup 3}) collected at the former CCC/USDA facility, as a result of a pre-CERCLIS site screening investigation (SSI) performed by TN & Associates, Inc., on behalf of the U.S. Environmental Protection Agency (EPA), Region VII (MoDNR 2001). In June 2001, the Missouri Department of Natural Resources (MoDNR) conducted further sampling of the soils and groundwater at the former CCC/USDA facility as part of a preliminary assessment/site inspection (PA/SI). The MoDNR confirmed the presence of carbon tetrachloride (at a maximum identified concentration of 2,810 {micro}g/kg) and chloroform (maximum 82 {micro}g/kg) in the soils and also detected carbon tetrachloride and chloroform (42.2 {micro}g/L and 58.4 {micro}g/L, respectively) in a groundwater sample collected at the former facility (MoDNR 2001). The carbon tetrachloride levels identified in the soils and groundwater are above the default target level (DTL) values established by the MoDNR for this contaminant in soils of all types (79.6 {micro}g/kg) and in groundwater (5.0 {micro}g/L), as outlined in Missouri Risk-Based Corrective Action (MRBCA): Departmental Technical Guidance (MoDNR 2006a). The corresponding MRBCA DTL values for chloroform are 76.6 {micro}g/kg in soils of all types and 80 {micro}g/L in groundwater. Because the observed contamination at Montgomery City might be linked to the past use of carbon tetrachloride-based fumigants at its

Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

Science.gov (United States)

IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

Estimated rates of groundwater recharge to the Chicot, Evangeline and Jasper aquifers by using environmental tracers in Montgomery and adjacent counties, Texas, 2008 and 2011

Science.gov (United States)

Oden, Timothy D.; Truini, Margot

2013-01-01

Montgomery County is in the northern part of the Houston, Texas, metropolitan area, the fourth most populous metropolitan area in the United States. As populations have increased since the 1980s, groundwater has become an important resource for public-water supply and industry in the rapidly growing area of Montgomery County. Groundwater availability from the Gulf Coast aquifer system is a primary concern for water managers and community planners in Montgomery County and requires a better understanding of the rate of recharge to the system. The Gulf Coast aquifer system in Montgomery County consists of the Chicot, Evangeline, and Jasper aquifers, the Burkeville confining unit, and underlying Catahoula confining system. The individual sand and clay sequences of the aquifers composing the Gulf Coast aquifer system are not laterally or vertically continuous on a regional scale; however, on a local scale, individual sand and clay lenses can extend over several miles. The U.S. Geological Survey, in cooperation with the Lone Star Groundwater Conservation District, collected groundwater-quality samples from selected wells within or near Montgomery County in 2008 and analyzed these samples for concentrations of chlorofluorocarbons (CFCs), sulfur hexafluoride (SF6), tritium (3H), helium-3/tritium (3He/3H), helium-4 (4He), and dissolved gases (DG) that include argon, carbon dioxide, methane, nitrogen and oxygen. Groundwater ages, or apparent age, representing residence times since time of recharge, were determined by using the assumption of a piston-flow transport model. Most of the environmental tracer data indicated the groundwater was recharged prior to the 1950s, limiting the usefulness of CFCs, SF6, and 3H concentrations as tracers. In many cases, no tracer was usable at a well for the purpose of estimating an apparent age. Wells not usable for estimating an apparent age were resampled in 2011 and analyzed for concentrations of major ions and carbon-14 (14C). At six of

The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

Science.gov (United States)

Caplan, R M

1982-06-01

The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

Quality assurance for radon exposure chambers at the National Air and Radiation Environmental Laboratory, Montgomery, Alabama

Energy Technology Data Exchange (ETDEWEB)

Semler, M.O.; Sensintaffar, E.L. [National Air and Radiation Environmental Laboratory, Montgomery, AL (United States)

1993-12-31

The Office of Radiation and Indoor Air, U.S. Environmental Protection Agency (EPA), operates six radon exposure chambers in its two laboratories, the National Air and Radiation Environmental Laboratory (NAREL) in Montgomery, Alabama, and the Las Vegas Facility, Las Vegas, Nevada. These radon exposure chambers are used to calibrate and test portable radon measuring instruments, test commercial suppliers of radon measurement services through the Radon Measurement Proficiency Program, and expose passive measurement devices to known radon concentrations as part of a quality assurance plan for federal and state studies measuring indoor radon concentrations. Both laboratories participate in national and international intercomparisons for the measurement of radon and are presently working with the National Institute of Standards and Technology (NIST) to receive a certificate of traceability for radon measurements. NAREL has developed an estimate of the total error in its calibration of each chamber`s continuous monitors as part of an internal quality assurance program. This paper discusses the continuous monitors and their calibration for the three chambers located in Montgomery, Alabama, as well as the results of the authors intercomparisons and total error analysis.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

Science.gov (United States)

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

Science.gov (United States)

Hicks, R. E.; Southey, G. N.

1990-01-01

The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

Just the Right Mix: Identifying Potential Dropouts in Montgomery County Public Schools Using an Early Warning Indicators Approach

Science.gov (United States)

West, Thomas C.

2013-01-01

Each school year, roughly a thousand students drop out of Montgomery County (Maryland) Public Schools (MCPS). However, unlike other large, urban school districts where students who drop out skip school and are suspended often (Balfanz & Byrnes, 2010), students who drop out of MCPS are present in school; they just are not doing well…

Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

Science.gov (United States)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2017-06-01

The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

Directory of Open Access Journals (Sweden)

Mei-Yu LEE

2014-11-01

Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

The McLean-Watson line strength formula and its implementation

International Nuclear Information System (INIS)

Hey, J D

2009-01-01

We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

Science.gov (United States)

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

Directory of Open Access Journals (Sweden)

Lina Affifatusholihah

2017-04-01

In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

Work Plan: Phase II Investigation at the Former CCC/USDA Grain Storage Facility in Montgomery City, Missouri

Energy Technology Data Exchange (ETDEWEB)

LaFreniere, Lorraine M [Argonne National Lab. (ANL), Argonne, IL (United States)

2012-05-01

From September 1949 until September 1966, the Commodity Credit Corporation of the U.S. Department of Agriculture (CCC/USDA) leased property at the southeastern end of Montgomery City, Missouri, for the operation of a grain storage facility. During this time, commercial grain fumigants containing carbon tetrachloride were commonly used by the CCC/USDA and the private grain storage industry to preserve grain in their facilities.

James Watson's most inconvenient truth: race realism and the moralistic fallacy.

Science.gov (United States)

Rushton, J Philippe; Jensen, Arthur R

2008-11-01

Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

Science.gov (United States)

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

Science.gov (United States)

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

U.S. History and Modern World History Courses for English Speakers of Other Languages in Montgomery County Public Schools

Science.gov (United States)

Zhao, Huafang; Wade, Julie

2014-01-01

The Office of Shared Accountability (OSA) in Montgomery County (Maryland) Public Schools (MCPS) examined academic performance of English for Speakers of Other Languages (ESOL) students in U.S. History and Modern World History courses, as well as the course sequence in ESOL U.S. History and Modern World History. In MCPS, students who are not ESOL…

A Portrait of School District Crisis Management: Leadership Choices in Montgomery County during the Sniper Shootings of October 2002

Science.gov (United States)

Porter, Brian Joseph

2010-01-01

The actions of two assailants who shot and killed 10 people and wounded three others, including a student, in the region around Washington, D.C., in October 2002, provides the backdrop for a qualitative study of the emergency response by school district leaders in Montgomery County, Maryland. The study explores and describes the experiences of the…

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

Directory of Open Access Journals (Sweden)

Luciane Favero

2009-01-01

Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

Effects of automated speed enforcement in Montgomery County, Maryland, on vehicle speeds, public opinion, and crashes.

Science.gov (United States)

Hu, Wen; McCartt, Anne T

2016-09-01

In May 2007, Montgomery County, Maryland, implemented an automated speed enforcement program, with cameras allowed on residential streets with speed limits of 35 mph or lower and in school zones. In 2009, the state speed camera law increased the enforcement threshold from 11 to 12 mph over the speed limit and restricted school zone enforcement hours. In 2012, the county began using a corridor approach, in which cameras were periodically moved along the length of a roadway segment. The long-term effects of the speed camera program on travel speeds, public attitudes, and crashes were evaluated. Changes in travel speeds at camera sites from 6 months before the program began to 7½ years after were compared with changes in speeds at control sites in the nearby Virginia counties of Fairfax and Arlington. A telephone survey of Montgomery County drivers was conducted in Fall 2014 to examine attitudes and experiences related to automated speed enforcement. Using data on crashes during 2004-2013, logistic regression models examined the program's effects on the likelihood that a crash involved an incapacitating or fatal injury on camera-eligible roads and on potential spillover roads in Montgomery County, using crashes in Fairfax County on similar roads as controls. About 7½ years after the program began, speed cameras were associated with a 10% reduction in mean speeds and a 62% reduction in the likelihood that a vehicle was traveling more than 10 mph above the speed limit at camera sites. When interviewed in Fall 2014, 95% of drivers were aware of the camera program, 62% favored it, and most had received a camera ticket or knew someone else who had. The overall effect of the camera program in its modified form, including both the law change and the corridor approach, was a 39% reduction in the likelihood that a crash resulted in an incapacitating or fatal injury. Speed cameras alone were associated with a 19% reduction in the likelihood that a crash resulted in an

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

Science.gov (United States)

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

Science.gov (United States)

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

Comparative validation of proxy-based montgomery-asberg depression rating scale and cornell scale for depression in dementia in nursing home residents with dementia

NARCIS (Netherlands)

Leontjevas, R.; Gerritsen, D.L.; Vernooij-Dassen, M.F.J.; Smalbrugge, M.; Koopmans, R.T.C.M.

2012-01-01

Objective: To 1) compare the accuracy of the Montgomery-̊Asberg Depression Rating Scale (MADRS) and the Cornell Scale for Depression in Dementia (CSDD) in nursing home residents with dementia when professional caregivers are the only available source of information and 2) explore different methods

Characterization of phenolics by LC-UV/vis, LC-MS/MS and sugars by GC in Melicoccus bijugatus Jacq. 'Montgomery' fruits.

Science.gov (United States)

Bystrom, Laura M; Lewis, Betty A; Brown, Dan L; Rodriguez, Eloy; Obendorf, Ralph L

2008-12-15

Fruits of the native South American tree Melicoccus bijugatus Jacq. (Sapindaceae) are consumed for both dietary and medicinal purposes, but limited information is available about the phytochemistry and health value of M. bijugatus fruits. Fruit tissues of the Florida Montgomery cultivar were assessed for sugars, using gas chromatography, and for total phenolics, using UV spectroscopy. Reverse phase high performance liquid chromatography (HPLC) fingerprints of crude methanolic pulp, embryo and seed coat extracts were obtained at 280 nm. Phenolics were characterised by both HPLC UV/vis analysis and HPLC electrospray ionization tandem mass spectrometry. Major sugars detected in the pulp and embryo extracts were sucrose, followed by glucose and fructose. The glucose:fructose ratio was 1:1 in the pulp and 0.1:1 in the embryo. Total phenolic concentrations of the fruit tissues were in the order: seed coat > embryo > pulp. Phenolic acids were identified mostly in pulp tissues. Phenolic acids, flavonoids, procyanidins and catechins were identified in embryo tissues, and higher molecular weight procyanidins were identified in seed coat tissues. This study provides new information about the phytochemistry and the potential health value of the Montgomery cultivar M. bijugatus fruit tissues.

Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

Directory of Open Access Journals (Sweden)

Roberta Maria Savieto

2016-03-01

Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

Land use mapping and change detection using ERTS imagery in Montgomery County, Alabama

Science.gov (United States)

Wilms, R. P.

1973-01-01

The feasibility of using remotely sensed data from ERTS-1 for mapping land use and detecting land use change was investigated. Land use information was gathered from 1964 air photo mosaics and from 1972 ERTS data. The 1964 data provided the basis for comparison with ERTS-1 imagery. From this comparison, urban sprawl was quite evident for the city of Montgomery. A significant trend from forestland to agricultural was also discovered. The development of main traffic arteries between 1964 and 1972 was a vital factor in the development of some of the urban centers. Even though certain problems in interpreting and correlating land use data from ERTS imagery were encountered, it has been demonstrated that remotely sensed data from ERTS is useful for inventorying land use and detecting land use change.

Map showing radon potential of rocks and soils in Montgomery County, Maryland

Science.gov (United States)

Gundersen, L.C.; Reimer, G.M.; Wiggs, C.R.; Rice, C.A.

1988-01-01

This report summarizes the radon potential of Montgomery County in the context of its geology. Radon is a naturally occurring gas produced by the radioactive decay of uranium. Radon produced by uraniferous rocks and soils may enter a house through porous building materials and through openings in walls and floors. Radon gases has a tendency to move from the higher pressure commonly existing in the soil to the lower pressure commonly existing in the house. The U.S. Environmental Protection Agency (U.S. EPA, 1986a) estimates that elevated levels of indoor radon may be associated with 5,000 to 20,000 of the 130,000 lung cancer deaths per year. They also estimate that 8 to 12 percent of the homes in the United States will have annual average indoor radon levels exceeding 4 picoCuries per liter of air (pCi/L). Above this level, the U.S. EPA recommends homeowners take remedial action. May factors control the amount of radon which may enter a home from the geologic environment. Soil drainage, permeability, and moisture content effect the amount of radon that can be released from rocks and soils (known as the emmanation) and may limit or increase how far it can migrate. Well drained, highly permeable soils facilitate the movement of radon. Soils with water content in the 8 to 15 percent range enhance the emmanation of radon (Lindmark, 1985). Daily and seasonal variations in soil and indoor radon can be caused by meteorologic factors such as barometric pressure, temperature, and wind (Clements and Wilkening, 1974; Schery and other, 1984). Construction practices also inhibit or promote entry of radon into the home (U.S. EPA, 1986b). In general, however, geology controls the source and distribution of radon (Akerblom and Wilson, 1982; Gundersen and others, 1987, 1988; Sextro and others, 1987; U.S. EPA, 1983; Peake, 1988; Peake and Hess, 1988). The following sections describe: 1) the methods used to measure radon and equivalent uranium (eU) in soil; 2) the radon potential

"Cancer-Related Fatigue: A Systematic and Meta-Analytic Review of Nonpharmacological Therapies for Cancer Patients:" Correction to Kangas, Bovbjerg, and Montgomery (2008)

Science.gov (United States)

Kangas, Maria; Bovbjerg, Dana H.; Montgomery, Guy H.

2009-01-01

Reports an error in "Cancer-related fatigue: A systematic and meta-analytic review of non-pharmacological therapies for cancer patients" by Maria Kangas, Dana H. Bovbjerg and Guy H. Montgomery (Psychological Bulletin, 2008[Sep], Vol 134[5], 700-741). The URL to the Supplemental Materials for the article is listed incorrectly in two places in the…

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Knowledge of General Nutrition, Soy Nutrition, and Consumption of Soy Products: Assessment of a Sample Adult Population in Montgomery County, Virginia

OpenAIRE

Johnson, Lida Catherine

1999-01-01

KNOWLEDGE OF GENERAL NUTRITION, SOY NUTRITION, AND CONSUMPTION OF SOY PRODUCTS: ASSESSMENT OF A SAMPLE ADULT POPULATION IN MONTGOMERY COUNTY, VIRGINIA Lida Catherine Johnson (ABSTRACT) Nutrition education programs in the prevention of chronic diseases has flourished over the last 15 years. Investigators continue to demonstrate that soy consumption plays a role in decreasing chronic diseases such as cardiovascular disease, cancer, osteoporosis and problems regarding menopause....

Ground-water quality beneath an urban residential and commercial area, Montgomery, Alabama, 1999-2000

Science.gov (United States)

Robinson, James L.

2002-01-01

The Black Warrior River aquifer, which is composed of the Coker, Gordo, and Eutaw Formations, supplies more than 50 percent of the ground water used for public water supply in the Mobile River Basin. The city of Montgomery, Alabama, is partially built upon a recharge area for the Black Warrior River aquifer, and is one of many major population centers that depend on the Black Warrior River aquifer for public water supply. To represent the baseline ground-water quality in the Black Warrior River aquifer, water samples were collected from 30 wells located in a low-density residential or rural setting; 9 wells were completed in the Coker Formation, 9 wells in the Gordo Formation, and 12 wells in the Eutaw Formation. To describe the ground-water quality beneath Montgomery, Alabama, water samples also were collected from 30 wells located in residential and commercial areas of Montgomery, Alabama; 16 wells were completed in the Eutaw Formation, 8 wells in alluvial deposits, and 6 wells in terrace deposits. The alluvial and terrace deposits directly overlie the Eutaw Formation with little or no hydraulic separation. Ground-water samples collected from both the rural and urban wells were analyzed for physical properties, major ions, nutrients, metals, volatile organic compounds, and pesticides. Samples from the urban wells also were analyzed for bacteria, chlorofluorocarbons, dissolved gases, and sulfur hexafluoride. Ground-water quality beneath the urban area was compared to baseline water quality in the Black Warrior River aquifer.Compared to the rural wells, ground-water samples from urban wells contained greater concentrations or more frequent detections of chloride and nitrate, and the trace metals aluminium, chromium, cobalt, copper, nickel, and zinc. Pesticides and volatile organic compounds were detected more frequently and in greater concentrations in ground-water samples collected from urban wells than in ground-water samples from rural wells.The Spearman rho

Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

International Nuclear Information System (INIS)

Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

2010-01-01

By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

Science.gov (United States)

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comments on 'Origin of British and Irish mammals: disparate post-glacial colonisation and species introductions' by W.I. Montgomery, J. Provan, A.M. McCabe, and D.W. Yalden

Science.gov (United States)

Edwards, Ceiridwen J.

2014-12-01

Montgomery et al.'s recent paper in QSR (2014; vol. 98: 144-165) is a most welcome addition to the ongoing research into the origins of Irish mammals. In their Table 1, the authors have used "calibrated carbon dating, comparable stratigraphy and historical records … to establish the earliest known time of arrival of a species in […] Ireland […] where relevant, the latest record of a mammal species [was] used to establish the earliest date after which it was extinct". It is assumed that the dates mentioned in this table are, therefore, calibrated. However, this is very unclear - when dates generated by the Irish Quaternary Fauna project (Woodman et al., 1997) are compared with those used by Montgomery et al. (2014), the earliest recorded dates of Mountain/Irish hare, Irish stoat, lynx and pine marten seem to be direct uncalibrated dates. It is also unclear whether the earliest and latest records of each species relate to all published data available at the time of writing. Even if only consulting those dates generated by Woodman et al. (1997), there are older earliest records for Arctic Fox, Collared lemming and grey wolf. In addition, Montgomery et al. (2014) do not seem to have included early radiocarbon dates for giant deer, reindeer and red deer (Woodman et al., 1997; Carden et al., 2012), or any of the recent radiocarbon dates for brown bear (Edwards et al., 2011), despite reference to these papers.

Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

Science.gov (United States)

Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

2014-01-01

The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

Science.gov (United States)

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Phase I Investigations at the Former CCC/USDA Grain Storage Facility in Montgomery City, Missouri, in 2010-2011

Energy Technology Data Exchange (ETDEWEB)

LaFreniere, Lorraine M. [Argonne National Lab. (ANL), Argonne, IL (United States). Environmental Science Division. Applied Geoscience and Environmental Restoration Program

2012-11-01

This report presents the technical findings of Phase I of Argonne’s studies. The Phase I field investigation was initiated on October 18, 2010. The work was conducted in accord with (1) the final site-specific Phase I Work Plan for Montgomery City (Argonne 2010; approved by the MDNR [2010]); (2) applicable Missouri regulations; and (3) the standard operating procedures, quality assurance/quality control (QA/QC) measures, and general health and safety policies outlined in the Master Work Plan (Argonne 2002) for operations in Kansas, which was reviewed by the MDNR and accepted for current use. A draft master plan specific to work in Missouri and a set of draft standard operating procedures are in review with the MDNR. The site-specific Work Plan for Montgomery City (Argonne 2010) (1) summarizes the pre-existing knowledge base for the Montgomery City investigation site compiled by Argonne and (2) describes the site-specific technical objectives and the intended scope of work developed for the first phase of the investigation. Three primary technical objectives were identified for the Phase I studies, as follows: 1. Update the presently identified inventory and status of private and public drinking water wells in the immediate vicinity of the former CCC/USDA grain storage facility, and sample the identified wells for volatile organic compounds (VOCs) and geochemical analyses. In conjunction with this effort, determine the present sources(s) of drinking water for all residents in an approximate 0.5-mi radius of the former CCC/USDA facility. 2. Investigate for possible evidence of a soil source of carbon tetrachloride contamination in the unconsolidated sediments beneath the former CCC/USDA facility that might affect the underlying bedrock aquifer units. 3. Obtain preliminary information on the site-specific lithologic and hydrologic characteristics of the unconsolidated sediments overlying bedrock at the former CCC/USDA grain storage location. Section 2 of this report

Development and reliability of a structured interview guide for the Montgomery Asberg Depression Rating Scale (SIGMA).

Science.gov (United States)

Williams, Janet B W; Kobak, Kenneth A

2008-01-01

The Montgomery-Asberg Depression Rating Scale (MADRS) is often used in clinical trials to select patients and to assess treatment efficacy. The scale was originally published without suggested questions for clinicians to use in gathering the information necessary to rate the items. Structured and semi-structured interview guides have been found to improve reliability with other scales. To describe the development and test-retest reliability of a structured interview guide for the MADRS (SIGMA). A total of 162 test-retest interviews were conducted by 81 rater pairs. Each patient was interviewed twice, once by each rater conducting an independent interview. The intraclass correlation for total score between raters using the SIGMA was r=0.93, Preliability. Use of the SIGMA can result in high reliability of MADRS scores in evaluating patients with depression.

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Shape of Thyroid Cartilage Influences Outcome of Montgomery Medialization Thyroplasty: A Gender Issue.

Science.gov (United States)

Desuter, Gauthier; Henrard, Sylvie; Van Lith-Bijl, Julie T; Amory, Avigaëlle; Duprez, Thierry; van Benthem, Peter Paul; Sjögren, Elisabeth

2017-03-01

This study aimed to determine whether the shape of the thyroid cartilage and gender influence voice outcomes after a Montgomery thyroplasty implant system (MTIS). A retrospective cohort study was performed on 20 consecutive patients who underwent MTIS. Voice outcome variables were the relative decrease in Voice Handicap Index (%) and the absolute increase in maximum phonation time (MPT) (in seconds). Material variables were the angle between the thyroid cartilage laminae (α-angle), the size of the prosthesis, and a combination of both (the α-ratio). Continuous variables were analyzed using medians and were compared between groups using the Mann-Whitney U test. Factors associated with the outcome variables were assessed by multivariable linear regression. A Pearson coefficient was calculated between material variables. The absolute increase in MPT between the pre- and postoperative period was significantly different between men and women, with a median absolute increase of 11.0 seconds for men and of 1.3 seconds for women (P gender issue that needs to be further studied and eventually tackled. Copyright © 2017 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

Science.gov (United States)

Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

2014-01-01

In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

2013 Advanced Placement Exam Participation and Performance for Students in Montgomery County Public Schools and Public School Students in the State of Maryland and the Nation. Memorandum

Science.gov (United States)

Sanderson, Geoffrey T.

2013-01-01

This memorandum provides data on the participation and performance of Advanced Placement (AP) exams taken by students in the Montgomery County (Maryland) Public Schools (MCPS) in the 2012-2013 school year as compared with those by public school students in Maryland and the nation. Generally, the number of AP exams taken by MCPS students in 2013…

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

Science.gov (United States)

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

Directory of Open Access Journals (Sweden)

Carme Ferré-Grau

2008-03-01

Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

The Towers Watson Approach to Improving Corporate Wellness.

Science.gov (United States)

Wootton, Adam

2012-06-01

Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

OpenAIRE

Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

2016-01-01

In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

The secretion of areolar (Montgomery's glands from lactating women elicits selective, unconditional responses in neonates.

Directory of Open Access Journals (Sweden)

Sébastien Doucet

2009-10-01

Full Text Available The communicative meaning of human areolae for newborn infants was examined here in directly exposing 3-day old neonates to the secretion from the areolar glands of Montgomery donated by non related, non familiar lactating women.The effect of the areolar stimulus on the infants' behavior and autonomic nervous system was compared to that of seven reference stimuli originating either from human or non human mammalian sources, or from an arbitrarily-chosen artificial odorant. The odor of the native areolar secretion intensified more than all other stimuli the infants' inspiratory activity and appetitive oral responses. These responses appeared to develop independently from direct experience with the breast or milk.Areolar secretions from lactating women are especially salient to human newborns. Volatile compounds carried in these substrates are thus in a position to play a key role in establishing behavioral and physiological processes pertaining to milk transfer and production, and, hence, to survival and to the early engagement of attachment and bonding.

Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

Directory of Open Access Journals (Sweden)

Ingrid Meireles Gomes

2013-09-01

Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

Science.gov (United States)

Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

2018-01-01

Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

Science.gov (United States)

Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

2018-04-01

Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

Corporate preparedness for pandemic influenza: a survey of pharmaceutical and biotechnology companies in Montgomery County, Maryland.

Science.gov (United States)

Watkins, Rissah J; Barnett, Daniel J; Links, Jonathan M

2008-09-01

We conducted a survey of corporate preparedness for pandemic influenza among biotechnology and pharmaceutical companies in Montgomery County, Maryland, to determine the level of preparedness for this industry and geographic region. The survey, based on the HHS Business Pandemic Influenza Planning Checklist, established whether a company had a preparedness plan specific to pandemic influenza, the contents of its plan, or its reasons for a lack of a plan. A total of 50 companies participated in the survey. Of these, 40 did not have any type of preparedness plan, 3 were drafting plans, 6 had general preparedness plans that could be applied to an influenza pandemic, and only 1 company had a preparedness plan specifically designed to address pandemic influenza. Biotechnology and pharmaceutical companies in this geographic region are currently not well prepared for pandemic influenza. Public health officials should offer more help, possibly in the form of a model small business preparedness plan, and collaboration between companies should be encouraged to foster sharing of preparedness plans.

Applications of the Galton-Watson process to human DNA evolution and demography

CERN Document Server

Neves, A G M

2005-01-01

We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

Science.gov (United States)

Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

2013-11-01

William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

Science.gov (United States)

Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

Directory of Open Access Journals (Sweden)

Kevin Possin

2014-12-01

Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

Directory of Open Access Journals (Sweden)

Susilawati Susilawati

2016-06-01

Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

Directory of Open Access Journals (Sweden)

Gerry Joseph Nagtzaam

2014-03-01

Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

Energy Technology Data Exchange (ETDEWEB)

Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

1994-09-01

The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

Science.gov (United States)

Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

2018-04-01

This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

Science.gov (United States)

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

International Nuclear Information System (INIS)

Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

1988-01-01

The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

Energy Technology Data Exchange (ETDEWEB)

Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

2016-03-15

Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

The case of the missing fingerprints or Dr Watson's cosmology

International Nuclear Information System (INIS)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

Science.gov (United States)

Durgun Ozan, Yeter; Okumuş, Hülya

2017-06-01

Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

Directory of Open Access Journals (Sweden)

Gonzalo Martínez Fernández

2016-01-01

Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

The self-reported Montgomery-Åsberg depression rating scale is a useful evaluative tool in major depressive disorder

Directory of Open Access Journals (Sweden)

Fantino Bruno

2009-05-01

Full Text Available Abstract Background The use of Patient-reported Outcomes (PROs as secondary endpoints in the development of new antidepressants has grown in recent years. The objective of this study was to assess the psychometric properties of the 9-item, patient-administered version of the Montgomery-Åsberg Depression Rating Scale (MADRS-S. Methods Data from a multicentre, double-blind, 8-week, randomised controlled trial of 278 outpatients diagnosed with Major Depressive Disorder were used to evaluate the validity, reliability and sensitivity to change of the MADRS-S using psychometric methods. A Receiver Operating Characteristic (ROC curve was plotted to identify the most appropriate threshold to define perceived remission. Results No missing values were found at the item level, indicating good acceptability of the scale. The construct validity was satisfactory: all items contributed to a common underlying concept, as expected. The correlation between MADRS-S and physicians' MADRS was moderate (r = 0.54, p Conclusion Taking account of patient's perceptions of the severity of their own symptoms along with the psychometric properties of the MADRS-S enable its use for evaluative purposes in the development of new antidepressant drugs.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Case of the missing fingerprints or Dr. Watson's cosmology

Energy Technology Data Exchange (ETDEWEB)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

Directory of Open Access Journals (Sweden)

Gabriele Guidi

2016-07-01

Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

International Nuclear Information System (INIS)

Hey, J D

2014-01-01

As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

CERN Multimedia

Patrice Loiez

1999-01-01

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

2003-01-01

Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

Occurrence of Selected Pharmaceuticals, Personal-Care Products, Organic Wastewater Compounds, and Pesticides in the Lower Tallapoosa River Watershed near Montgomery, Alabama, 2005

Science.gov (United States)

Oblinger, Carolyn J.; Gill, Amy C.; McPherson, Ann K.; Meyer, Michael T.; Furlong, Edward T.

2007-01-01

Synthetic and natural organic compounds derived from agricultural operations, residential development, and treated and untreated sanitary and industrial wastewater discharges can contribute contaminants to surface and ground waters. To determine the occurrence of these compounds in the lower Tallapoosa River watershed, Alabama, new laboratory methods were used that can detect human and veterinary antibiotics; pharmaceuticals; and compounds found in personal-care products, food additives, detergents and their metabolites, plasticizers, and other industrial and household products in the environment. Well-established methods for detecting 47 pesticides and 19 pesticide degradates also were used. In all, 186 different compounds were analyzed by using four analytical methods. The lower Tallapoosa River serves as the water-supply source for more than 100,000 customers of the Montgomery Water Works and Sanitary Sewer Board. Source-water protection is a high priority for the Board, which is responsible for providing safe drinking water. The U.S. Geological Survey, in cooperation with the Montgomery Water Works and Sanitary Sewer Board, conducted this study to provide baseline data that could be used to assess the effects of agriculture and residential development on the occurrence of selected organic compounds in the lower Tallapoosa River watershed. Twenty samples were collected at 10 sites on the Tallapoosa River and its tributaries. Ten samples were collected in April 2005 during high base streamflow, and 10 samples were collected in October 2005 when base streamflow was low. Thirty-two of 186 compounds were detected in the lower Tallapoosa River watershed. Thirteen compounds, including atrazine, 2-chloro-4-isopropylamino-6-amino-s-triazine (CIAT), hexazinone, metalaxyl, metolachlor, prometryn, prometon, simazine, azithromycin, oxytetracycline, sulfamethoxazole, trimethoprim, and tylosin, had measurable concentrations above their laboratory reporting levels

Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

Science.gov (United States)

Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

2016-03-16

We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

International Nuclear Information System (INIS)

Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

2000-01-01

This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

CERN Multimedia

Brice, Maximilien

2014-01-01

Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

International Nuclear Information System (INIS)

de Prunele, E.

1983-01-01

The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

75 FR 6613 - Endangered and Threatened Wildlife and Plants; Listing with Designation of Critical Habitat for...

Science.gov (United States)

2010-02-10

... University Montgomery, 7440 East Drive, Montgomery, Alabama, at the Taylor Center in conference room 223... Auburn University Montgomery, Taylor Center-conference room 223, 7440 East Drive, Montgomery, Alabama. We...

Validation of Montgomery-Åsberg Rating Scale and Cornell Scale for Depression in Dementia in Brazilian elderly patients.

Science.gov (United States)

Portugal, Maria da Glória; Coutinho, Evandro Silva Freire; Almeida, Cloyra; Barca, Maria Lage; Knapskog, Anne-Brita; Engedal, Knut; Laks, Jerson

2012-08-01

There are few studies on validation of depression scales in the elderly in Latin America. This study aimed to assess the validity of Montgomery-Åsberg. Depression Rating Scale (MADRS) and Cornell Scale for Depression in Dementia (CSDD) in Brazilian elderly outpatients. A convenience sample of 95 outpatients was diagnosed for dementia and depression according to DSM-IV-TR, ICD-10, and PDC-dAD criteria. Receiver Operating Curves (ROC) were used to calculate the area under the curve (AUC) and to assess MADRS and CSDD cut-offs for each diagnostic criterion. Dementia was diagnosed in 71 of 95 patients. Depression was diagnosed in 35, 30, and 51 patients by ICD-10, DSM-IV, and PDC-dAD, respectively. MADRS cut-off score of 10 correctly diagnosed 67.4% and 66.3% patients as depressed according to DSM-IV and ICD-10. A cut-off of 9 correctly identified 74.7% by PDC-dAD criteria; a CSDD cut-off score of 13 best recognized depression according to DSM-IV and ICD-10. A score of 11 diagnosed depression according to PDC-dAD, while MADRS = 9 recognized depression in dementia. CSDD was more efficient in showing depression in mild than in moderate/severe dementia according to DSM-IV/ICD-10. PDC-dAD behaved nicely for any severity stage. MADRS and CSDD cut-offs of 10 and 13 were the optimal ones to diagnose depression in elderly, respectively. CSDD cut-offs are higher than those found in other countries. Other Latin American studies are needed to compare results with our study.

Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

Science.gov (United States)

Bandyopadhyay, D; Bhattacharyya, D

2006-10-15

It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

Directory of Open Access Journals (Sweden)

Siddharth Jain

Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

Engineering hydro's future

International Nuclear Information System (INIS)

Anderson, J.L.

1992-01-01

In this challenging hydropower market, hydropower engineering services are in high demand. The number of new hydropower projects entering the pipeline may have slowed in recent years but that does not mean work is not being done. Independent developers, utilities and municipalities are carrying out a considerable amount of hydropower activity. Whatever the work involves - preliminary planning, licensing and relicensing, environmental mitigation, plant rehabilitation or new-plant startup - engineering firms are finding a brisk market for their services. The complexity of the regulatory framework makes hydropower facility and other water resource work more important then ever. Executives of three engineering firms - Acres International, Harza Engineering and Black and Veatch - active in these areas discuss their views on the future of the hydropower engineering market

Crime

Data.gov (United States)

Montgomery County of Maryland — Updated daily postings on Montgomery County’s open data website, dataMontgomery, provide the public with direct access to crime statistic databases - including raw...

Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

Directory of Open Access Journals (Sweden)

María L. Román-Miranda

2013-01-01

Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

Science.gov (United States)

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

Science.gov (United States)

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

Science.gov (United States)

Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

2018-01-01

The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

Science.gov (United States)

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

Science.gov (United States)

Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

2017-12-20

This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

Why Was General Richard O’Connor’s Command in Northwest Europe Less Effective Than Expected?

Science.gov (United States)

2011-03-01

Commander of 7 Division and Military Governor of Jerusalem , September 1938- August 1939. ______. Papers of General Sir Richard O’Connor KT, GCB, DSO, MC...Montgomery, Brian. A Field Marshall in the Family: A Personal Biography of Montgomery of Alamein. New York: Taplinger, 1973. Montgomery, Field...Commanders: A Composite Biography . Combat Studies Institute publications, Fort Leavenworth, Kansas: U.S. Army Command and General Staff College, 1989

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

International Nuclear Information System (INIS)

Gao, X.; Patel, D.J.

1988-01-01

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

General Outside Employment

Data.gov (United States)

Montgomery County of Maryland — This dataset contains all outside employment requests held by employees of Montgomery County (excluding uniformed police officer) approved by the Ethics Commission...

Employee Travel Data (Non-Local)

Data.gov (United States)

Montgomery County of Maryland — ‘This dataset provides information regarding the total approved actual expenses incurred by Montgomery County government employees traveling non-locally (over 75...

OMB Recommended vs Approved Operating Budget

Data.gov (United States)

Montgomery County of Maryland — This dataset includes the Fiscal Year 2015 County Executive Recommended and County Council Approved operating budgets for Montgomery County, for comparison purposes....

Crash Reporting - Incidents Data

Data.gov (United States)

Montgomery County of Maryland — This dataset provides general information about each collision and details of all traffic collisions occurring on county and local roadways within Montgomery County,...

County Spending

Data.gov (United States)

Montgomery County of Maryland — This dataset includes County spending data for Montgomery County government. It does not include agency spending. Data considered sensitive or confidential and will...

Pre-treatment factor structures of the Montgomery and Åsberg Depression Rating scale as predictors of response to escitalopram in Indian patients with non-psychotic major depressive disorder.

Science.gov (United States)

Basu, Aniruddha; Chadda, Rakesh; Sood, Mamta; Rizwan, S A

2017-08-01

Major Depressive Disorder (MDD) is a broad heterogeneous construct resolving into several symptom-clusters by factor analysis. The aim was to find the factor structures of MDD as per Montgomery and Asberg Depression Rating Scale (MADRS) and whether they predict escitalopram response. In a longitudinal study at a tertiary institute in north India, 116 adult out-patients with non-psychotic unipolar MDD were assessed with MADRS before and after treatment with escitalopram (10-20mg) over 6-8 weeks for drug response. For total 116 patients pre-treatment four factor structures of MADRS extracted by principal component analysis with varimax rotation altogether explained a variance of 57%: first factor 'detachment' (concentration difficulty, lassitude, inability to feel); second factor 'psychic anxiety' (suicidal thoughts and inner tension); third 'mood-pessimism' (apparent sadness, reported sadness, pessimistic thoughts) and fourth 'vegetative' (decreased sleep, appetite). Eighty patients (68.9%) who completed the study had mean age 35.37±10.9 yrs, majority were male (57.5%), with mean pre-treatment MADRS score 28.77±5.18 and majority (65%) having moderate severity (MADRS escitalopram. At the end of the treatment there were significant changes in all the 4 factor structures (pescitalopram treatment. Understanding the factor structure is important as they can be important predictor of escitalopram response. Copyright © 2017 Elsevier B.V. All rights reserved.

Daily Arrests

Data.gov (United States)

Montgomery County of Maryland — This dataset provides the public with arrest information from the Montgomery County Central Processing Unit (CPU) systems. The data presented is derived from every...

Fiscal Year 2015 Budget

Data.gov (United States)

Montgomery County of Maryland — This dataset includes the Fiscal Year 2015 Council-approved operating budget for Montgomery County. The dataset does not include revenues and detailed agency budget...

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

Science.gov (United States)

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

Science.gov (United States)

Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

2017-10-01

In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

Facelift for Romanian hydro

Energy Technology Data Exchange (ETDEWEB)

Anon.

2000-09-01

The Siriu-Nehoiasu and the Ciresu-Surduc-Nehoiasu hydroelectric projects in central Romania are described. At both sites, construction work began in 1983 but funding ran out in 1994 before completion; what was achieved up to that point is described. In 1999, Hidroelectrica linked up with Harza Engineering of Romania who did a detailed review and optimization study of both schemes and formulated a plan to make completion attractive for the private sector in the new market-orientated economy. In June 2000, the two companies reached an agreement to complete construction at both sites through a jointly-owned special purpose company. Construction is expected to begin in 2001 with completion in April 2004. The differences between the new optimized schemes and the originals are given. Financing is expected to be an equal split between the state and investors under a BOT structure. The scheme at Ciresu-Surduc-Nehoiasu will provide the added benefit of reducing annual flood damage.

76 FR 54754 - Combined Notice of Filings #1

Science.gov (United States)

2011-09-02

...: Montgomery L'Energia Power Partners LP. Description: Notice of Cancellation of FERC Electric Rate Schedule Tariff of Montgomery L'Energia Power Partners LP. Filed Date: 08/24/2011. Accession Number: 20110824-5095...

76 FR 30934 - Combined Notice of Filings #1

Science.gov (United States)

2011-05-27

... 19, 2011. Docket Numbers: EC11-84-000. Applicants: Montgomery L'Energia Power Partners LP, Tanner... Montgomery L'Energia Power Partners LP, et. al. Filed Date: 05/23/2011. Accession Number: 20110523-5016...

Geographic data: Zip Codes (Shape File)

Data.gov (United States)

Montgomery County of Maryland — This dataset contains all zip codes in Montgomery County. Zip codes are the postal delivery areas defined by USPS. Zip codes with mailboxes only are not included. As...

Road Closures

Data.gov (United States)

Montgomery County of Maryland — This is an up to date map of current road closures in Montgomery County.This dataset is updated every few minutes from the Department of Transportation road closure...

Richard Watson.

Science.gov (United States)

Wright, Ian; Bevin, William

2017-11-25

An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

Sleeping under the stars

Science.gov (United States)

Zirkel, Jack

Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

HYDROLOGY, MONTGOMERY COUNTY, MISSISSIPPI

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — Hydrology data include spatial datasets and data tables necessary for documenting the hydrologic procedures for estimating flood discharges for a flood insurance...

On Fair Lotteries

OpenAIRE

STONE, PETER

2008-01-01

PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

An item response theory evaluation of the young mania rating scale and the montgomery-asberg depression rating scale in the systematic treatment enhancement program for bipolar disorder (STEP-BD).

Science.gov (United States)

Prisciandaro, James J; Tolliver, Bryan K

2016-11-15

The Young Mania Rating Scale (YMRS) and Montgomery-Asberg Depression Rating Scale (MADRS) are among the most widely used outcome measures for clinical trials of medications for Bipolar Disorder (BD). Nonetheless, very few studies have examined the measurement characteristics of the YMRS and MADRS in individuals with BD using modern psychometric methods. The present study evaluated the YMRS and MADRS in the Systematic Treatment Enhancement Program for BD (STEP-BD) study using Item Response Theory (IRT). Baseline data from 3716 STEP-BD participants were available for the present analysis. The Graded Response Model (GRM) was fit separately to YMRS and MADRS item responses. Differential item functioning (DIF) was examined by regressing a variety of clinically relevant covariates (e.g., sex, substance dependence) on all test items and on the latent symptom severity dimension, within each scale. Both scales: 1) contained several items that provided little or no psychometric information, 2) were inefficient, in that the majority of item response categories did not provide incremental psychometric information, 3) poorly measured participants outside of a narrow band of severity, 4) evidenced DIF for nearly all items, suggesting that item responses were, in part, determined by factors other than symptom severity. Limited to outpatients; DIF analysis only sensitive to certain forms of DIF. The present study provides evidence for significant measurement problems involving the YMRS and MADRS. More work is needed to refine these measures and/or develop suitable alternative measures of BD symptomatology for clinical trials research. Copyright © 2016 Elsevier B.V. All rights reserved.

Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

Science.gov (United States)

2010-03-01

that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

Science.gov (United States)

Panczyk, Tomasz; Wolski, Pawel

2018-06-01

This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

Science.gov (United States)

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

76 FR 21232 - Standard Instrument Approach Procedures, and Takeoff Minimums and Obstacle Departure Procedures...

Science.gov (United States)

2011-04-15

..., AL, Jack Edwards, ILS OR LOC RWY 27, Amdt 1 Gulf Shores, AL, Jack Edwards, RNAV (GPS) RWY 9, Amdt 3 Gulf Shores, AL, Jack Edwards, RNAV (GPS) RWY 27, Amdt 2 Montgomery, AL, Montgomery Rgnl (Dannelly... Williams Memorial, RNAV (GPS) RWY 24, Amdt 1 Vineyard Haven, MA, Marthas Vineyard, RNAV (GPS) RWY 6, Amdt 1...

Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

Science.gov (United States)

Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

2013-12-01

Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

Science.gov (United States)

2010-10-01

DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

Science.gov (United States)

2011-10-01

or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

Science.gov (United States)

2012-07-01

like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

Directory of Open Access Journals (Sweden)

M. R. Barrón-Yánez

2009-01-01

(Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

An analysis of the armys formal bureaucracy and the impact on acquisition cycles

Science.gov (United States)

2017-09-01

defense acquisition . This research coincides with “oversight” and bureaucracy language in the FY17 NDAA legislation and by the 114th Congress. While...IMPACT ON ACQUISITION CYCLES September 2017 By: William T. Montgomery Shannon L. Laegeler Advisors: Charles Pickar Robert Mortlock...BUREAUCRACY AND THE IMPACT ON ACQUISITION CYCLES 5. FUNDING NUMBERS 6. AUTHOR(S) William T. Montgomery and Shannon L. Laegeler 7. PERFORMING

The Rough Road to Antwerp: The First Canadian Army’s Operations Along the Channel Coast

Science.gov (United States)

2014-05-22

41Coincidently, September 17, 1944 also was the first day of Operation Market Garden. 42Copp and Vogel, Maple Leaf Route: Antwerp,142. 43Historical...Holland: 21 Army Group, 1944); Bernard Montgomery. The Armoured Division in Battle (Holland: 21 Army Group, December, 1944); Bernard Montgomery, Some...Canadian Armoured Personnel Carrier Squadron was formed. This squadron was further augmented and became First Canadian Armoured Regiment on October 23

A National Security Strategy for Sweden: Balancing Risks and Opportunities in the 21st Century

Science.gov (United States)

2010-04-01

physics and chemistry. The Intergovernmental Panel on Climate Change (IPCC) links a higher concentration of greenhouse gases to an increase in atmospheric...Command and Staff College. International Security Studies: AY10 Coursebook . Montgomery, 2009. Air Command and Staff College. War Studies Course: AY10... Coursebook . Montgomery, 2009. Assadourian, Eric (Project Director at the World Watch Institute). Vital Signs 2007-2008; The Trends that are Shaping Our

HYDRAULICS, MONTGOMERY COUNTY, ALABAMA, USA

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — Recent developments in digital terrain and geospatial database management technology make it possible to protect this investment for existing and future projects to...

BASEMAP, MONTGOMERY COUNTY, VIRGINIA, USA

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — FEMA Framework Basemap datasets comprise six of the seven FGDC themes of geospatial data that are used by most GIS applications (Note: the seventh framework theme,...

FLOODPLAIN, Montgomery COUNTY, VIRGINIA, USA

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classifications used are the...

Fidelity Mechanisms of DNA Polymerase Alpha

Science.gov (United States)

2008-07-23

between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

An Analysis of the Observed Low-level Structure of Rapidly Intensifying and Mature Hurricane Earl (2010)

Science.gov (United States)

2014-01-01

structure. J. Atmos. Sci. 49: 919–942. Marks FD, Black PG, Montgomery MT, Burpee RW. 2008. Structure of the eye and eyewall of hurricane Hugo (1989...structure of rapidly intensifying and mature hurricane Earl (2010) Michael T. Montgomery,a* Jun A. Zhangb and Roger K. Smithc aDepartment of Meteorology...Naval Postgraduate School, Monterey, CA, USA bNOAA Hurricane Research Division, Miami, FL, USA cMeteorological Institute, Ludwig Maximilians, University

How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

Science.gov (United States)

Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

2016-06-01

Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

Agreement between hopelessness/helplessness and Montgomery-Asberg Depression Rating Scale in healthy individuals and in patients with benign breast disease and breast cancer: a prospective case-control study in Finland.

Science.gov (United States)

Eskelinen, Matti; Korhonen, Riika; Selander, Tuomas; Ollonen, Paula

2015-04-01

The relation between scoring for hopelessness/helplessness and the Montgomery-Asberg Depression Rating Scale (MADRS) in healthy study subjects (HSS) and in patients with benign breast disease (BBD) and breast cancer (BC) has not been compared in a prospective study. We, therefore, investigated hopelessness and helplessness scores versus the MADRS in 115 patients. In the Kuopio Breast Cancer Study, 115 women with breast symptoms were evaluated for hopelessness and helplessness, and for the MADRS before any diagnostic procedures were carried out. In the self-rating score (SRS), hopelessness/helplessness versus the MADRS were highly significantly positively correlated in the HSS, BBD and BC groups. In the SRS, the weighted kappa values for hopelessness/helplessness versus the MADRS in the HSS, BBD and BC groups were also statistically significant. There was also a significant positive correlation in the examiner-rating score (ERS) for hopelessness versus the MADRS in the HSS, BBD and BC groups and for helplessness versus the MADRS in the HSS, BBD and BC groups. The unweighted kappa values in the ERS for hopelessness versus the MADRS were statistically highly significant for the HSS, BBD and BC groups and those for helplessness versus the MADRS in the HSS and BBD groups were statistically significant. A new finding with clinical relevance in the present work is the agreement between hopelessness/helplessness scores and MADRS in the SRS and ERS. In the breast cancer diagnostic unit, the identification of hopeless/helpless persons is essential in suicide prevention and it is important to assess and treat hopelessness/helplessness even though an individual may report few depressive symptoms. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Contemporary Danish book art

DEFF Research Database (Denmark)

Larsen, Poul Steen

the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

Science.gov (United States)

2013-01-31

.... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Comparison of approximate methods for multiple scattering in high-energy collisions. II

International Nuclear Information System (INIS)

Nolan, A.M.; Tobocman, W.; Werby, M.F.

1976-01-01

The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

Comparison of the costs of nonoperative care to minimally invasive surgery for sacroiliac joint disruption and degenerative sacroiliitis in a United States commercial payer population: potential economic implications of a new minimally invasive technology

OpenAIRE

Ackerman, Stacey J; Polly, David W; Knight, Tyler; Schneider, Karen; Holt, Tim; Cummings, John

2014-01-01

Stacey J Ackerman,1 David W Polly Jr,2 Tyler Knight,3 Karen Schneider,4 Tim Holt,5 John Cummings Jr6 1Covance Market Access Services Inc., San Diego, CA, USA; 2University of Minnesota, Orthopaedic Surgery, Minneapolis, MN, USA; 3Covance Market Access Services Inc., Gaithersburg, MD, USA; 4Covance Market Access Services Inc., Sydney, Australia; 5Montgomery Spine Center, Orthopedic Surgery, Montgomery, AL, USA; 6Community Health Network, Neurosurgery, Indianapolis, IN, USA Introduction: Low ba...

Comparison of the costs of nonoperative care to minimally invasive surgery for sacroiliac joint disruption and degenerative sacroiliitis in a United States Medicare population: potential economic implications of a new minimally-invasive technology

OpenAIRE

Ackerman SJ; Polly Jr DW; Knight T; Schneider K; Holt T; Cummings J

2013-01-01

Stacey J Ackerman1, David W Polly Jr2, Tyler Knight3, Karen Schneider4, Tim Holt5, John Cummings61Covance Market Access Services Inc, San Diego, CA, USA; 2University of Minnesota, Orthopaedic Surgery, Minneapolis, MN, USA; 3Covance Market Access Services Inc, Gaithersburg, MD, USA; 4Covance Market Access Services Inc, Sydney, NSW, Australia; 5Montgomery Spine Center, Orthopaedic Surgery, Montgomery, AL, USA; 6Community Health Network, Neurosurgery, Indianapolis, IN, USAIntroduction: The econo...

75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

Science.gov (United States)

2010-09-07

... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

Commentary on Malone: Who Founded Behaviorism?

Science.gov (United States)

Reese, Hayne W

2015-05-01

Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

NARCIS (Netherlands)

Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

1995-01-01

In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

Science.gov (United States)

Fukawa-Connelly, Timothy Patrick; Newton, Charlene

2014-01-01

Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

the use of research in protected area management in Madagascar

African Journals Online (AJOL)

they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

An Observational Study of Tropical Cyclone Spin-Up in Supertyphoon Jangmi and Hurricane Georges

Science.gov (United States)

2011-12-01

Marks et al. (2008) flight level and radar observations from Hurricane Hugo shown in Figure 9 (their Figure 3) and Hurricane Isabel (Montgomery et al...Figure 3c and Figure 6c) and Persing and Montgomery (2003, their Figures 8, 9, and 12). For the case of Hurricane Hugo , a cross-section of the... Hurricane Hugo (1989). Mon. Wea. Rev., 136, 1237–1259. McTaggart-Cowan, R., L. F. Bosart, J. R. Gyakum, and E. H. Atallah, 2007: Hurricane Katrina

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Genetics by the Numbers

Science.gov (United States)

... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

Does Size Matter?

Science.gov (United States)

Watson, David

2014-01-01

In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

Educational Technologists: Leading Change for a New Paradigm of Education

Science.gov (United States)

Aslan, Sinem; Reigeluth, Charles M.

2013-01-01

The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

Music Technology and Musical Creativity: Making Connections

Science.gov (United States)

Thompson, Douglas Earl

2012-01-01

This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

Bringing Precision Medicine to Community Oncologists.

Science.gov (United States)

2017-01-01

Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

Behaviorism

Science.gov (United States)

Moore, J.

2011-01-01

Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

Anti-parallel triplexes

DEFF Research Database (Denmark)

Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.

2015-01-01

about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...

Possible role of double scattering in electron-atom scattering in a laser field

International Nuclear Information System (INIS)

Rabadan, I.; Mendez, L.; Dickinson, A.S.

1996-01-01

By considering observations of double-scattering effects in the excitation of the 2 1 P level of He, gas density values estimated for the laser-assisted elastic scattering experiments of Wallbank and Holmes (1993, 1994a,b) for which the Kroll-Watson approximation appears to fail. Using comparable densities for He and lower densities for Ar, and assuming the Kroll-Watson approximation for single-scattering events, differential cross sections are calculated including double scattering for laser-assisted scattering for a range of energies and scattering angles. Comparison with the observed values shows that double-scattering effects can give a semi-quantitative explanation of the apparent breakdown of the Kroll-Watson approximation in both He and Ar. (author)

Extended low-frequency approximation for laser-modified electron scattering: Coulomb effects

International Nuclear Information System (INIS)

Mittleman, M.H.

1988-01-01

The Kroll-Watson [N.M. Kroll and K. M. Watson, Phys. Rev. A 8, 804 (1973)] theory for electron scattering in the field of a low-frequency laser has been extended by L. Rosenberg [Phys. Rev. A 23, 2283 (1981); 28, 2727 (1983)] to apply to higher intensities. That result is rederived in another way so as to make the correction second order. The correction terms are obtained and shown to be small in the high-intensity low-energy regime in which the original theory is weakest. The special case of a Coulomb potential is analyzed and shown to present special peculiarities in the extended theory just as in the original Kroll-Watson theory

Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

Directory of Open Access Journals (Sweden)

Brent Tisserat

2018-04-01

Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

Early Fourier analysis

CERN Document Server

Montgomery, Hugh L

2015-01-01

Hugh Montgomery has written a book which both students and faculty should appreciate. I wish it had been written 15 years ago so I could have shared it with students. It is a gem. -Richard Askey, University of Wisconsin-Madison Montgomery has written an exquisite text combining basic material, exciting examples, advanced topics, wonderful historical notes, and excellent exercises. It is absolutely compelling and masterful! -John Benedetto, University of Maryland This nice book is likely to be especially successful. l feel that the author has managed admirably to bring to light both the beauty

A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

Science.gov (United States)

Willis, Derek W.

2010-01-01

This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

Progress Report on the ISCR Pilot Test Conducted at the Former CCC/USDA Grain Storage Facility in Montgomery City, Missouri, as of April 2013

Energy Technology Data Exchange (ETDEWEB)

LaFreniere, Lorraine M. [Argonne National Lab. (ANL), Argonne, IL (United States). Environmental Science Division. Applied Geoscience and Environmental Restoration Program

2013-06-01

The Commodity Credit Corporation of the U.S. Department of Agriculture (CCC/USDA) is conducting an environmental investigation at the former CCC/USDA grain storage facility on the county fairgrounds in Montgomery City, Missouri, to evaluate contamination associated with the former use of grain fumigants containing carbon tetrachloride at the site. The CCC/USDA studies have identified carbon tetrachloride in the soils (primarily unconsolidated glacial tills) at concentrations that exceed the U.S. Environmental Protection Agency (EPA) regional screening level (RSL) values for this compound in residential soils (610 μg/kg) but are below the corresponding RSL for industrial soils (3,000 μg/kg). Concentrations of carbon tetrachloride greater than the EPA maximum contaminant level (MCL; 5.0 μg/L) for this contaminant in drinking water were also identified in the shallow groundwater (Argonne 2012). On the basis of these findings, remedial actions are considered necessary to mitigate the present and potential future impacts of the contamination. In cooperation with the Missouri Department of Natural Resources (MDNR), the CCC/USDA has initiated a field-scale pilot test to evaluate an in situ technology for treatment of the carbon tetrachloride contamination. In this approach, a chemical amendment consisting primarily of slow-release organic matter and zero-valent iron is employed to induce oxygen-depleted, chemically reducing conditions in the subsurface. These conditions foster the in situ chemical reduction (ISCR) of carbon tetrachloride and its degradation products (chloroform, methylene chloride, and chloromethane) via both inorganic and biologically mediated processes. The chemical amendment being used, EHC™, was developed by the Adventus Group, Freeport, Illinois, and is now manufactured and distributed by FMC Environmental Solutions, Philadelphia, Pennsylvania. With the approval of the MDNR (2012), the ISCR technology is being tested in two target areas

Examining Current Conceptualizations of Psychopathology With the MMPI-2/MMPI-2-RF Restructured Clinical Scales: Preliminary Findings From a Cross-Cultural Study.

Science.gov (United States)

Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S

2017-01-01

Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.

Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

Science.gov (United States)

2011-07-01

AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

Nonequilibrium Phase Transitions Associated with DNA Replication

Science.gov (United States)

2011-02-11

polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

Automated problem list generation and physicians perspective from a pilot study.

Science.gov (United States)

Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric

2017-09-01

An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017

Improving the Army’s Next Effort in Technology Forecasting

Science.gov (United States)

2010-09-01

DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

OSA Proceedings on Ultrafast Electronics and Optoelectronics Held in San Francisco, California on January 25 -27, 1993. Volume 14,

Science.gov (United States)

1993-01-27

Fetterman , University of California, Los Angeles M. Fischetti, IBM T. J. Watson Research Center D. Grischkowski, IBM T. J. Watson Research Center E. P. Ippen...Spectroscopy System ............................. 112 Jeffrey S. Bostak, Daniel W. Van Der Weide, Ikuro Aoki, Bertram A. Aul" and David M. Bloom Sub-Picosecond...Martin, F. K. Oshita, and H. R. Fetterman ix On-Wafer Optoelectronic Techniques for Millimeter-Wave Generation, Control, and Circuit Characterization

How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-08-14

The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

Symptom predictors of response to electroconvulsive therapy in older patients with treatment-resistant depression

Directory of Open Access Journals (Sweden)

Tominaga K

2011-07-01

Full Text Available Keiichiro Tominaga¹, Mioto Okazaki¹, Hisashi Higuchi¹, Itaru Utagawa¹, Etsuko Nakamura², Noboru Yamaguchi¹¹Department of Neuropsychiatry, St Marianna University School of Medicine, Miyamae-ku, Kawasaki City, Kanagawa, ²Tsurukawa Sanatorium Hospital, Machida City, Tokyo, JapanBackground: Electroconvulsive therapy (ECT has been used for treatment-resistant depression. However, predictors of response to ECT have not been adequately studied using the Montgomery and Åsberg Depression Rating Scale, especially in older patients with treatment-resistant depression.Methods: This study included 18 Japanese patients who fulfilled the Diagnostic and Statistical Manual of Mental Disorders Fourth Edition Text Revision criteria for a diagnosis of major depressive disorder or bipolar disorder with a current major depressive episode, and met the definition of treatment-resistant depression outlined by Thase and Rush, scoring ≥21 on the Montgomery and Åsberg Depression Rating Scale. The three-factor model of the Montgomery and Åsberg Depression Rating Scale was used for analysis. Factor 1 was defined by three items, factor 2 by four items, and factor 3 by three items, representing dysphoria, retardation, and vegetative symptoms, respectively. ECT was performed twice a week for a total of six sessions using a Thymatron System IV device with the brief pulse technique. Clinical responses were defined on the basis of a ≥50% decrease in total pretreatment Montgomery and Åsberg Depression Rating Scale scores.Results: The mean pretreatment factor 2 score for responders (n = 7 was significantly lower than that for nonresponders (n = 11. Furthermore, a significant difference in mean factor 3 score between responders and nonresponders was observed one week after six sessions of ECT, indicating a time lag of response. No significant differences were observed for age, number of previous episodes, and duration of the current episode between responders and

Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

Directory of Open Access Journals (Sweden)

Marjan Diayanat

2018-02-01

Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

Applications of Fast Truncated Multiplication in Cryptography

Directory of Open Access Journals (Sweden)

Laszlo Hars

2006-12-01

Full Text Available Truncated multiplications compute truncated products, contiguous subsequences of the digits of integer products. For an n-digit multiplication algorithm of time complexity O(nα, with 1<α≤2, there is a truncated multiplication algorithm, which is constant times faster when computing a short enough truncated product. Applying these fast truncated multiplications, several cryptographic long integer arithmetic algorithms are improved, including integer reciprocals, divisions, Barrett and Montgomery multiplications, 2n-digit modular multiplication on hardware for n-digit half products. For example, Montgomery multiplication is performed in 2.6 Karatsuba multiplication time.

A Win-Win Collaboration

Directory of Open Access Journals (Sweden)

Mary Beth Parkinson

2013-04-01

Full Text Available This brief article reports on a collaborative book-borrowing policy between The Brendlinger Library of Montgomery County Community College and the Wissahickon Valley Public Library (WVPL, both located in Blue Bell, PA.  Beginning in January 2013, WVPL will donate books periodically to the Brendlinger Library in support of the students enrolled in Reading classes.  Circulation statistics will be reported to WVPL, and the books will be returned to WVPL for sale in the WVPL Friends of the Library book sale. Keywords: academic library; public library,  community college library; collaboration; developmental readers; reading programs; reading instruction; literacy; Montgomery County Community College; Wissahickon Valley Public Library

OrthoImagery Submission for Montgomery County, GA

Data.gov (United States)

Federal Emergency Management Agency, Department of Homeland Security — NAIP imagery is available for distribution within 60 days of the end of a flying season and is intended to provide current information of agricultural conditions in...

Glutamate Receptor Aptamers and ALS

Science.gov (United States)

2009-01-01

considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

Science.gov (United States)

Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

2018-01-01

A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

76 FR 59177 - New York Disaster #NY-00110

Science.gov (United States)

2011-09-23

... York: Chemung, Cortland, Greene, Herkimer, Madison, Montgomery, Oneida, Schoharie, Sullivan, Tompkins... Federal Domestic Assistance Numbers 59002 and 59008) James E. Rivera, Associate Administrator for Disaster...

Automated Information Enrichment for a Better Search

OpenAIRE

José Luis Preza

2016-01-01

The process of adding the Metadata when uploading a digital object onto a repository is usually manual. This means that the user has to have already at hand the keywords and all the other information about the asset. This paper addresses the possibility of enriching the “manual metadata” by generating automated metadata using the cognitive services provided by technologies like IBM Watson platform. The cognitive computing services offered by IBM Watson automatically generate Semantic Data (in...

Healthcare Information Technology (HIT) in an Anti-Access (A2) and Area Denial (AD) Environment

Science.gov (United States)

2014-03-01

point for multiple sites to connect to each other so radiologists can read diagnostic images by managing firewall connections. The idea of multiple...learn from them.41 Although IBM’s Watson isn’t living up to the hype just yet, the artificial intelligent ( AI ) computer system is a precursor for a...on the ground can control a UAV with two passengers in it; one technician and one AI healthcare machine (Medical IBM Watson). Once the UAV lands

Airway Clearance Techniques (ACTs)

Medline Plus

Full Text Available ... Autogenic Drainage Positive Expiratory Pressure High-Frequency Chest Wall Oscillation (the Vest) ... Cystic Fibrosis Foundation 4550 Montgomery Ave. Suite 1100 N Bethesda, MD ...

Recreation Summer Camps

Data.gov (United States)

Montgomery County of Maryland — List of all Camps (Register here:https://apm.activecommunities.com/montgomerycounty/Home) to include Aquatics, Basketball, Soccer, Special Interest, General Sports,...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University of Illinois Chicago, Center of ...

Symptoms of depression and their relation to myocardial infarction and periodontitis.

Science.gov (United States)

Kjellström, Barbro; Gustafsson, Anders; Nordendal, Eva; Norhammar, Anna; Nygren, Åke; Näsman, Per; Rydén, Lars; Åsberg, Marie

2017-08-01

Psychosocial stress and depression are established risk factors for cardiovascular disease and a relationship to periodontitis has been suggested. We studied symptoms of depression and their relation to myocardial infarction and periodontitis. In a Swedish case-control study, 805 patients, stress at home and work, and symptoms of depression (Montgomery Åsberg Depression Scale). A Montgomery Åsberg Depression Scale score ⩾13 was considered clinically relevant. A family history of cardiovascular disease, smoking and divorce was more frequent among patients than controls. Patients had more symptoms of depression than controls (14 vs 7%; pless anti-depressive treatment (16 vs 42%; pless anti-depressive treatment. A relationship between depression and periodontitis could not be confirmed.

Coulomb interaction in multiple scattering theory

International Nuclear Information System (INIS)

Ray, L.; Hoffmann, G.W.; Thaler, R.M.

1980-01-01

The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reaction cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+ 208 Pb elastic scattering and compared with experimental data

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

77 FR 16316 - Kentucky Disaster Number KY-00044

Science.gov (United States)

2012-03-20

... Counties: (Physical Damage and Economic Injury Loans): Bath, Campbell, Carroll, Grant, Martin, Montgomery... Assistance Numbers 59002 and 59008) Joseph P. Loddo, Acting Associate Administrator for Disaster Assistance...

DEP Reported Sanitary Sewer Overflows

Data.gov (United States)

Montgomery County of Maryland — Sanitary sewer overflows reported to the Department of Environmental Protection by the Washington Suburban Sanitary Commission or individuals in the County. Update...

Internal Affairs Allegations

Data.gov (United States)

Montgomery County of Maryland — This dataset contains allegations brought to the attention of the Internal Affairs Division either through external complaints or internal complaint or recognition....

The discovery of the structure of DNA

Science.gov (United States)

Squires, G. L.

2003-04-01

On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

Visual marking and change blindness : moving occluders and transient masks neutralize shape changes to ignored objects

OpenAIRE

Watson, Derrick G.; Kunar, Melina A.

2010-01-01

Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys, 2002). Here we present 5 experiments that examined whether such object changes are still effective in recapturing attention if the changes occur while the pr...

Foreign Broadcast Information Service. History. Part 1: 1941-1947

Science.gov (United States)

1969-04-01

station outside the Punchbowl. Then the·tlold bugaboo ". arose, as Paige put it in a letter on 24 July 1944. Paige said he had asked for clarification...transfer ofFBIS personnel to PWB jurisdiction proved to be a rather poor invest - ment from an FBIS standpoint. PWB, a joint U.S.-British organization...communist front groups, and said Watson belonged to all of them. Fly’~ reply assured Dies that he had been misinformed. Watson had been thoroughly invest

Capital Improvement Program (CIP) Project Status

Data.gov (United States)

Montgomery County of Maryland — This dataset includes pertinent information relating to a capital project’s status administered by the Department of Transportation and the Department of General...

78 FR 25755 - Announcement of Funding Awards; Energy Innovation Fund-Multifamily Pilot Program Fiscal Year 2010

Science.gov (United States)

2013-05-02

... Community Place, 7441. Cecil, Frederick, Crownsville, MD 21032. Hartford, Howard, Montgomery, Prince George... Greater Portland, OR 1020 SW Taylor, Suite 585, Portland, 5680. metropolitan area. Oregon 97205. NRG...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University of Illinois Chicago, Center of Excellence in ...

Predicting and Modeling RNA Architecture

Science.gov (United States)

Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice

2011-01-01

SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963

How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

Science.gov (United States)

Shanker, Sudhanshu; Bandyopadhyay, Pradipta

2017-08-01

The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

78 FR 44187 - New York Disaster # NY-00136

Science.gov (United States)

2013-07-23

...; Herkimer; Madison; Montgomery; Niagara; Oneida; Otsego; Warren. The Interest Rates are: Percent For... for economic injury is 13668B (Catalog of Federal Domestic Assistance Numbers 59002 and 59008). James...

Lobbying Semi-Annual Activity

Data.gov (United States)

Montgomery County of Maryland — This dataset contains Registration and Activity Reporting information lobbyists have provided. The dollar figures in the far right columns are the total of expenses...

Distance breached or distance transformed? Dilemmas of simulated and banal closeness in humanitarian communication

DEFF Research Database (Denmark)

Bajde, Domen; Knudsen, Gry Høngsmark

Social media have been argued to have transformed humanitarian communication and those involved in it. Networked humanitarian organizations are supposedly more open and transparent (Kanter and Fine 2010) and their “audiences” too are networked and "cause-wired" (Watson 2009), implying an unpreced......Social media have been argued to have transformed humanitarian communication and those involved in it. Networked humanitarian organizations are supposedly more open and transparent (Kanter and Fine 2010) and their “audiences” too are networked and "cause-wired" (Watson 2009), implying...

Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing

Science.gov (United States)

2010-01-01

DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research addresses how the...Acid dsDNA double stranded DNA MOSAIC Mobile Stream Processing Cluster PCR Polymerase Chain Reaction RAM Random Access Memory ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ...are 5′→3′ and strands with strikethrough are 3′→5′. A dsDNA duplex formed between a strand and its reverse complement is called a

Animal welfare in brown trout farming: hematological results

Directory of Open Access Journals (Sweden)

G. Forneris

2010-01-01

Full Text Available The effect of stress resulting from fish farming has received considerable attention in this last period and fish welfare in aquaculture is a relevant topic, very important for the future of aquaculture (Watson et al., 2004; Klinger et al., 1996; Peres et al., 2004; Ron et al., 1995;Wagner et al., 1995;Watson et al., 1998. Brown trout farming is less developed then rainbow trout farming, but this kind of fish farming is increasing, mainly for fish conservation and restocking aquaculture.

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University ...

OCA Code Enforcement

Data.gov (United States)

Montgomery County of Maryland — The Office of the County Attorney (OCA) processes Code Violation Citations issued by County agencies. The citations can be viewed by issued department, issued date...

Agricultural Producer Certificates

Data.gov (United States)

Montgomery County of Maryland — A Certified Agricultural Producer, or representative thereof, is an individual who wishes to sell regionally-grown products in the public right-of-way. A Certified...

40 CFR 52.1683 - Control strategy: Ozone.

Science.gov (United States)

2010-07-01

... not apply to these areas. (i) Albany-Schenectady-Troy (consisting of Albany, Greene, Montgomery... determination shall no longer apply in the area where the violation occurs. (i) Albany-Schenectady-Troy...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

Stormwater Management Concept Information

Data.gov (United States)

Montgomery County of Maryland — A stormwater management concept is a statement or drawing, or both, describing the manner in which stormwater runoff from a proposed development will be controlled...

"Doktor Watson minu õuel!" / Allar Viivik

Index Scriptorium Estoniae

Viivik, Allar

2002-01-01

Äsjalahkunud näitlejat Vitali Solominit (1941-2002) meenutab Juuliku villa elanik Leo Orav. Siin filmis režissöör Igor Maslennikov paar episoodi "Baskerville'de koerast" vene Sherlock Holmes'i seriaalist. Vitali Solomin mängis doktor Watsonit. Ka teistest selle seriaali võttepaikadest Eestis

Alternative Watson-Crick Synthetic Genetic Systems.

Science.gov (United States)

Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

2016-11-01

In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

Science.gov (United States)

Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

2017-07-11

RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

Floodplain District Permit

Data.gov (United States)

Montgomery County of Maryland — The purpose of a Floodplain District Permit (FPDP) is to control floodplain development in order to protect persons and property from danger and destruction and to...

Quantum Groupoids Acting on Semiprime Algebras

Directory of Open Access Journals (Sweden)

Inês Borges

2011-01-01

Full Text Available Following Linchenko and Montgomery's arguments we show that the smash product of an involutive weak Hopf algebra and a semiprime module algebra, satisfying a polynomial identity, is semiprime.

75 FR 4415 - National Register of Historic Places; Notification of Pending Nominations and Related Actions

Science.gov (United States)

2010-01-27

... comments should be submitted by Dated: February 11, 2010. J. Paul Loether, Chief, National Register of... Building, 125 Cherry St., Buffalo, 10000027 Montgomery County Chalmers Knitting Mills, 21-41 Bridge St...

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

1-, 2-, and 4-Ethynylpyrenes in the Structure of Twisted Intercalating Nucleic Acids: Structure, Thermal Stability, and Fluorescence Relationship

DEFF Research Database (Denmark)

Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

2008-01-01

to ortho in homopyrimidine TINAs. Thus, for para-TINAs the bulge insertion of an intercalator led to high thermal stability of Hoogsteen-type parallel triplexes and duplexes, whereas Watson-Cricktype duplexes were destabilized. In the case of ortho-TINA, both Hoogsteen and Watson-Crick-type complexes were......A postsynthetic, on-column Sonogashira reaction was applied on DNA molecules modified by 2- or 4-iodophenylmethylglycerol in the middle of the sequence, to give the corresponding ortho- and para-twisted intercalating nucleic acids (TINA) with 1-, 2-, and 4-ethynylpyrene residues. The convenient...

Pathogenesis of Septic Acute Lung Injury and Strategies for Immuno-Pharmacological Therapy.

Science.gov (United States)

1996-10-01

J Cell Biol 120:1227-1235. 90. Lasky, L. A., M. S. Singer, D. Dowbenko, Y. Imai, W. J. Henzel, C. Grimley, C. Fennie , N. Gillett, S. R. Watson, and...Rats. J. Immunol 152:832-840. 102. Lasky, L. A., M. S. Singer, T. A. Yednock, D. Dowbenko, C. Fennie , H. Rodriguez, T. Nguyen, S. Stachel, and S. D...1132-1135. 105. Foxall, C. R., S. R. Watson, C. Fennie , L. A. Lasky, M. Kiso, A. Hasegawa, D. Asa, and B. Brandley. 1992. The three members of the

Millimetre-wave spectrum of anti-13C1 and 13C2 isotopologues of ethanol

International Nuclear Information System (INIS)

Bouchez, Aurelia; Walters, Adam; Müller, Holger S.P.; Ordu, Matthias; Lewen, Frank; Koerber, Monika; Bottinelli, Sandrine; Endres, Christian P.; Schlemmer, Stephan

2012-01-01

The rotational spectra of the two monosubstituted 13 C isotopologues of the anti conformer of ethanol have been measured between 80-800 GHz using three different spectrometers at the Cologne Laboratory Astrophysics group. The dataset was constrained for fitting with a standard Watson-S reduction Hamiltonian by rejecting transitions from high-lying states showing significant perturbation with the gauche states and by averaging some small methyl torsional splits. This treatment is compatible with the needs for a first astrophysical research for which an appropriate set of predictions is given.

Particle Deposition onto Enclosure Surfaces

Science.gov (United States)

2009-08-20

quantitative descriptions were published by Watson in 193633 and Zernik in 1957.34 Thermophoretic force arises from asymmetrical interactions of an aerosol...N t vq CN II s .— o B *-* 2 ^ 3d - CO > X3 CO o feel s.i = ••§ 5 o 5 Ci- vs CJ O T3 0< _ JH C TJ CO — C ca -a 5...Edinburgh 32,239(1884). 52 33. H. H. Watson, "The Dust-Free Space Surrounding Hot Bodies," Trans. Faraday Soc. 32, 1073 (1936). 34. W. Zernik , "The

Complex integration and Cauchy's theorem

CERN Document Server

Watson, GN

2012-01-01

This brief monograph by one of the great mathematicians of the early twentieth century offers a single-volume compilation of propositions employed in proofs of Cauchy's theorem. Developing an arithmetical basis that avoids geometrical intuitions, Watson also provides a brief account of the various applications of the theorem to the evaluation of definite integrals.Author G. N. Watson begins by reviewing various propositions of Poincaré's Analysis Situs, upon which proof of the theorem's most general form depends. Subsequent chapters examine the calculus of residues, calculus optimization, the

Water Quality Protection Charges

Data.gov (United States)

Montgomery County of Maryland — The Water Quality Protection Charge (WQPC) is a line item on your property tax bill. WQPC funds many of the County's clean water initiatives including: • Restoration...

Softball Complex

Science.gov (United States)

Ellis, Jim

1977-01-01

The Parks and Recreation Department of Montgomery, Alabama, has developed a five-field softball complex as part of a growing community park with facilities for camping, golf, aquatics, tennis, and picnicking. (MJB)

Kaasaegseid maailmavaateid kohtulaua ees / Ants Oras

Index Scriptorium Estoniae

Oras, Ants

2003-01-01

Montgomery Belgioni raamatust "Our present philosophy of life", mis tutvustab Bernard Shaw', André Gide'i, Sigmund Freudi ja Bertrand Russelli filosoofilisi teooriaid. Varem ilmunud: "Looming", 1931, nr. 6, lk. 646-651

Real Property Tax - 2017

Data.gov (United States)

Montgomery County of Maryland — This data represents all of the County’s residential real estate properties and all of the associated tax charges and credits with that property processed at the...

Site Specific Vendor's License

Data.gov (United States)

Montgomery County of Maryland — This dataset contains information of a site-specific vendor's license which is required if an individual sells or offers to sell goods or services from a stationary...

Spending Disclosure - Fiscal Year 2012

Data.gov (United States)

Montgomery County of Maryland — The purpose of this Spending Disclosure Fiscal Year 12 dataset is to allow the public to search and view summary information on payments made to recipients (referred...

Real Property Tax - 2016

Data.gov (United States)

Montgomery County of Maryland — This data represents all of the County’s residential real estate properties and all of the associated tax charges and credits with that property processed at the...

76 FR 70386 - Proposed Flood Elevation Determinations

Science.gov (United States)

2011-11-14

..., Alabama, and Incorporated Areas Audubon Ditch At the upstream side of +185 +184 City of Montgomery. Norman... available for inspection at 36535 Green Street, New Baltimore, MI 48047. Township of Chesterfield Maps are...

Updating ARI Educational Benefits Usage Data Bases for Army Regular, Reserve, and Guard: 2005 - 2006

National Research Council Canada - National Science Library

Young, Winnie

2007-01-01

This report describes the updating of ARI's educational benefits usage database with Montgomery GI Bill and Army College Fund data for Army Regular, Reserve, and Guard components over the 2005 and 2006 period...

Floodplain Study

Data.gov (United States)

Montgomery County of Maryland — The purpose of a floodplain study is to establish the 100-year floodplain limits within or near a development in order to preserve the natural resources within the...

(Mis)understanding Science: The Problem with Scientific Breakthroughs.

Science.gov (United States)

Evans, James P

2016-09-01

On Saturday morning, February 28, 1953, the mystery of heredity appeared secure. Humans hadn't the faintest idea of how genetic information was transmitted-how the uncanny resemblance between mother and daughter, grandfather and grandson was conveyed across generations. Yet, by that Saturday afternoon, two individuals, James Watson and Francis Crick, had glimpsed the solution to these mysteries. The story of Watson and Crick's great triumph has been told and retold and has rightly entered the pantheon of scientific legend. But Watson and Crick's breakthrough was just that: a rupture and dramatic discontinuity in human knowledge that solved a deep mystery, the likes of which occurs, perhaps, a couple of times each century. And that's the problem. The story is just so good and so irresistible that it has misled generations of scientists about what to expect regarding a life in science. And more damaging, the resulting breakthrough mentality misleads the public, the media, and society's decision-makers about how science really works, all to the detriment of scientific progress and our society's well-being. © 2016 The Hastings Center.

After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.

Science.gov (United States)

Creager, Angela N H; Morgan, Gregory J

2008-06-01

Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.

Branching processes and neutral evolution

CERN Document Server

Taïb, Ziad

1992-01-01

The Galton-Watson branching process has its roots in the problem of extinction of family names which was given a precise formulation by F. Galton as problem 4001 in the Educational Times (17, 1873). In 1875, an attempt to solve this problem was made by H. W. Watson but as it turned out, his conclusion was incorrect. Half a century later, R. A. Fisher made use of the Galton-Watson process to determine the extinction probability of the progeny of a mutant gene. However, it was J. B. S. Haldane who finally gave the first sketch of the correct conclusion. J. B. S. Haldane also predicted that mathematical genetics might some day develop into a "respectable branch of applied mathematics" (quoted in M. Kimura & T. Ohta, Theoretical Aspects of Population Genetics. Princeton, 1971). Since the time of Fisher and Haldane, the two fields of branching processes and mathematical genetics have attained a high degree of sophistication but in different directions. This monograph is a first attempt to apply the current sta...

Role modeling excellence in clinical nursing practice.

Science.gov (United States)

Perry, R N Beth

2009-01-01

Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.

Product Purchases by DLC

Data.gov (United States)

Montgomery County of Maryland — This dataset contains a list of items in case units by category and supplier that have been purchased by the Department of Liquor Control in the past month. Update...

Most Recent Sampling Results for Annex III Building

Science.gov (United States)

Contains email from Scott Miller, US EPA to Scott Kramer. Subject: Most Recent Sampling Results for Annex III Building. (2:52 PM) and Gore(TM) Surveys Analytical Results U.S. Geological Survey, Montgomery, AL.

Operation Market-Garden: Ultra Intelligence Ignored

National Research Council Canada - National Science Library

Jeffson, Joel

2002-01-01

.... Is this really the case? Operation Market-Garden, the plan envisioned by Field Marshal Montgomery, would open the gate into Germany and simultaneously force General Eisenhower to abandon his broad-front strategy in favor...

How Loud Is Too Loud? | NIH MedlinePlus the Magazine

Science.gov (United States)

... visit www.noisyplanet.nidcd.nih.gov The High Cost of Noise Exposure Kurt Evers of Montgomery Village, ... too. Doctors, parents, and educators worry about portable music players and other noisy gadgets damaging hearing in ...

Co-Occurring Disorders

Science.gov (United States)

... the mental health field. Alcohol and Drug Abuse, Addiction and Co-occurring Disorders: Co-occurring Disorders and ... 500 Montgomery Street, Suite 820 Alexandria, VA 22314 Phone (703) 684.7722 Toll Free (800) 969.6642 ...

Design and development of sustained-release glyburide-loaded ...

Indian Academy of Sciences (India)

delivery of cancer imaging, i.e., diagnosis. ... hyperglycemic agent of class sulphonylurea having half-life. ∗ ... patients with chronic kidney disease [10] and active ischemic ..... [24] Montgomery D C 2008 Introduction to statistical quality.

Final Environmental Assessment for Temporary Aircraft Relocation to Maxwell Air Force Base 187th Fighter Wing Montgomery Regional Airport Montgomery, Alabama

Science.gov (United States)

2012-06-01

interior construction at Maxwell AFB, such as employment and materials purchasing, will provide minor short-term economic benefits to the local economy...distribution of children and locations where the number of children in the affected area may be disproportionately high (e.g., schools, childcare centers...with its unique Congressional mandate: OSHA regulations categorize substances in terms of their impacts on employee and workplace health and safety

The Development of the Caregiving System among women with severe mental illness

DEFF Research Database (Denmark)

Røhder, Katrine

attachment classification (George & Solomon, 2008). Aims of the Study: As little is known on how the caregiving system develops when the mother suffers from severe mental illness (SMI), this presentation will explore the role of maternal psychopathology for the pre- and postnatal development of caregiving...... representations in the WARM study. The hypothesis is that higher level of psychopathology is associated with higher levels of the caregiving representations: Deactivation, cognitive disconnection and the segregated systems – all dimensions found among mothers with children that show a pattern of insecure......, & Solomon, 2013). The development of psychopathology is assessed in pregnancy and at 4 and 16 weeks with The Positive and Negative Syndrome Scale (PANSS, Kay et al., 1989), The Montgomery Asberg Depression Rating Scale (MADRS, Montgomery and Asberg, 1979) and The Bech-Rafaelsen Mania Rating Scale (BRMRS...

Shape space figure-8 solution of three body problem with two equal masses

Science.gov (United States)

Yu, Guowei

2017-06-01

In a preprint by Montgomery (https://people.ucsc.edu/~rmont/Nbdy.html), the author attempted to prove the existence of a shape space figure-8 solution of the Newtonian three body problem with two equal masses (it looks like a figure 8 in the shape space, which is different from the famous figure-8 solution with three equal masses (Chenciner and Montgomery 2000 Ann. Math. 152 881-901)). Unfortunately there is an error in the proof and the problem is still open. Consider the α-homogeneous Newton-type potential, 1/rα, using action minimization method, we prove the existence of this solution, for α \\in (1, 2) ; for α=1 (the Newtonian potential), an extra condition is required, which unfortunately seems hard to verify at this moment.

Real Property Tax Rates

Data.gov (United States)

Montgomery County of Maryland — The Levy Year 2012 real property tax rate dataset reflects all the rates per $100 set each year by the County Council. These rates are applied to the assessed value...

Linnud teevad järglastel vahet

Index Scriptorium Estoniae

2012-01-01

Ajakirjas Behavioral Ecology and Sociobiology avaldatud Queensi ülikooli teadlase Bob Montgomerie uuringust, mis tõestas, et isa punarinnad toitsid kaks korda innukamalt oma poegi, kes sündisid säravama sinise varjundiga munadest

Two speeches that changed the world: from Fulton to Zurich

Directory of Open Access Journals (Sweden)

Alan John Watson

2016-12-01

Full Text Available In this extract from his new book Churchill’s Legacy: Two Speeches to Save the World (Watson, 2016, Lord Watson of Richmond draws on his own experience of post war British politics, as a television presenter and media commentator and then as a Liberal Peer and Chairman of the English-Speaking Union, to analyse the significance of Churchill’s Zurich speech of 19 September 1946. He argues that, building on Churchill’s earlier speech at Fulton, Missouri, it helped change the perceptions of the West and alter their response to the emerging Cold War and the future of Europe.

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Services The Latino AIDS Agenda National Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Advocates Against AIDS The Women’s Collective K.I. Services The Latino AIDS Agenda National Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance ...

Genetics Home Reference: Potocki-Shaffer syndrome

Science.gov (United States)

... PubMed Central Montgomery ND, Turcott CM, Tepperberg JH, McDonald MT, Aylsworth AS. A 137-kb deletion within ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

An easy and low cost option for economic statistical process control ...

African Journals Online (AJOL)

a large number of nonconforming products are manufactured. ... size, n, sampling interval, h, and control limit parameter, k, that minimize the ...... [11] Montgomery DC, 2001, Introduction to statistical quality control, 4th Edition, John Wiley, New.

Monetary valuation of salinity impacts and microbial pollution in the Olifants Water Management Area, South Africa

CSIR Research Space (South Africa)

De Lange, Willem J

2012-04-01

Full Text Available , salmonellosis and typhoid fever (Department of Water Affairs and Forestry, 2001). A direct functional relationship exists between dysfunctional water and sanitation systems and a high risk of waterborne disease (Hinrichsen et al., 1997, Montgomery...

Airway Clearance Techniques (ACTs)

Medline Plus

Full Text Available ... Dr. William Skach Paul di Sant’Agnese Distinguished Scientific Achievement Award Quality Care Awards Richard C Talamo ... clinical trial that may be right for you. Search Trials CFF Homepage Cystic Fibrosis Foundation 4550 Montgomery ...

75 FR 71486 - Pennsylvania Disaster # PA-00035

Science.gov (United States)

2010-11-23

... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 12389 and 12390] Pennsylvania Disaster PA... Administrative declaration of a disaster for the Commonwealth of Pennsylvania dated 11/15/2010. Incident: Severe... the disaster: Primary Counties: Delaware. Contiguous Counties: Pennsylvania: Chester, Montgomery...

Airway Clearance Techniques (ACTs)

Medline Plus

Full Text Available Skip to Main Content Skip to Footer CFF Homepage Menu Search What Is CF? X close ABOUT ... may be right for you. Search Trials CFF Homepage Cystic Fibrosis Foundation 4550 Montgomery Ave. Suite 1100 ...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Adolescent Psychiatry (AACAP) The United Negro College Fund, Special Programs Latino Commission on AIDS Azteca America Foundation/ ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... groups of young people, guiding the use of technology, the discussion between friends, and the importance of ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

Building Homes, Building Careers.

Science.gov (United States)

Cohn, Meredith

1987-01-01

The Construction Trades Foundation, a nonprofit corporation of business, industry, and school leaders, provides high school students in Montgomery County, Maryland, with unique hands-on experiences in construction, home design, marketing, public relations, and other fields. (SK)

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of ... NY Metropolitan Transportation Authority (MTA) Titan Worldwide Hestia International Panasonic Times Square Astrovision Avalon Theatre Events: Daytona ...

Robustness studies on coal gasification process variables

African Journals Online (AJOL)

coal before feeding to the gasification process [1]. .... to-control variables will make up the terms in the response surface model for the ... Montgomery (1999) explained that all the Taguchi engineering objectives for a robust ..... software [3].

77 FR 65044 - Pennsylvania Disaster #PA-00054

Science.gov (United States)

2012-10-24

... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 13346 and 13347] Pennsylvania Disaster PA... Administrative declaration of a disaster for the Commonwealth of Pennsylvania dated 10/18/2012. Incident... adversely affected by the disaster: Primary Counties: Montgomery. Contiguous Counties: Pennsylvania: Berks...

Alabama Cooperative Extension System - ACES.edu

Science.gov (United States)

Marshall Mobile Monroe Montgomery Morgan Perry Pickens Pike Randolph Russell Shelby St. Clair Sumter Marengo Tuscaloosa Greene Pickens Sumter Conecuh Escambia Monroe Clarke Choctaw Washington Baldwin Mobile Office Communications & Marketing Information Technology ACES Publications & Store 4-H &

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... HIV/AIDS, and the general public. U.S. National Library of Medicine HIV/AIDS Information : Specialized Information Services. ... for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance ...

Drugs + HIV, Learn the Link

Medline Plus

Full Text Available ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University of Illinois Chicago, Center of Excellence in Women’s Health Duke Ellington School of the Arts Howard ...

A Danish cost-effectiveness model of escitalopram in comparison with citalopram and venlafaxine as first-line treatments for major depressive disorder in primary care

DEFF Research Database (Denmark)

Sørensen, Jan; Stage, Kurt B; Damsbo, Niels

2007-01-01

The objective of this study was to model the cost-effectiveness of escitalopram in comparison with generic citalopram and venlafaxine in primary care treatment of major depressive disorder (baseline scores 22-40 on the Montgomery-Asberg Depression Rating Scale, MADRS) in Denmark. A three-path dec...... clinical benefit and cost-savings, and similar in cost-effectiveness to venlafaxine.......The objective of this study was to model the cost-effectiveness of escitalopram in comparison with generic citalopram and venlafaxine in primary care treatment of major depressive disorder (baseline scores 22-40 on the Montgomery-Asberg Depression Rating Scale, MADRS) in Denmark. A three......, ad-hoc survey and expert opinion. Main outcome measures were remission defined as MADRS costs. Analyses were conducted from healthcare system and societal perspectives. The human capital approach was used to estimate societal cost of lost productivity. Costs were reported...

40 CFR Appendix II to Part 280 - List of Agencies Designated To Receive Notifications

Science.gov (United States)

2010-07-01

..., Ground Water Section/Water Division, 1751 Congressman W.L. Dickinson Drive, Montgomery, Alabama 36130... of Environmental Regulation, Solid Waste Section, Twin Towers Office Building, 2600 Blair Stone Road...), Division of Environmental Management, Ground-Water Operations Branch, Department of Natural Resources and...

A new species of Laricobius (Coleoptera: Derodontidae) from Japan with phylogeny and a key for native and introduced congeners in North America

Science.gov (United States)

Montgomery Michael E.; S. Shiyake; Nathan P. Havill

2011-01-01

Laricobius osakensis Montgomery and Shiyake sp. nov., collected from Adelges tsugae Annand on hemlock [Tsuga sieboldii Carr. and Tsuga diversifolia (Maxim.) Mast.] in Japan, is described and illustrated. The new species was collected from several localities on Honshu, Shikokou, and Kyushu...

Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-l-LNA

DEFF Research Database (Denmark)

Kosbar, Tamer R.; Sofan, Mamdouh A.; Abou-Zeid, Laila

2015-01-01

G-rich anti-parallel DNA triplexes were modified with LNA or α-l-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability...... of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-l-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-l-LNA and LNA in the middle of the triplex...

Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

DEFF Research Database (Denmark)

Aagaard, C; Douthwaite, S

1994-01-01

RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

The psyche as behavior

OpenAIRE

Clavijo A., Arturo

2012-01-01

Según el conductismo, el comportamiento constituye la Psique y el tema de estudio de la psicología. Aunque algunos científicos habían realizado trabajos empíricos con métodos objetivos antes de 1913, año en el que John B. Watson publicó su manifiesto, este último fue el primero en intentar la sistematización de la conducta como equivalente a la Psique, esto es, como el objeto de estudio de la psicología. El artículo discute la noción de comportamiento de Watson y la compara con otras dos form...

Investigation of Nanophase Materials for Thermoelectric Applications

National Research Council Canada - National Science Library

Stokes, Kevin

2004-01-01

.... Watson Research Center. Our major accomplishments include the chemical synthesis of nanoparticles, nanorods and nanowires of lead chalcogenide, bismuth calcogenide and bismuth antimony materials...

Adapting Institutional Structure and Culture to Change.

Science.gov (United States)

Parilla, Robert E.

1993-01-01

Highlights the importance of management in a community college's success. Suggests that adaptive institutions, which identify challenges and create programs through cooperation with their staff and faculty, have a mechanism for continuous quality improvement. Describes Montgomery College's (Maryland) transition from a bureaucratic management…

Autonomous Experimentation of Carbon Nanotube Using Response Surface Methods

Science.gov (United States)

2015-03-26

minimizes variance (Myers et al., 2009:286). Orthogonality is a very useful property, because it eliminates multicollinearity in the regressor variables...Montgomery et al., 2012:118). Multicollinearity is a common problem in data that is not collected from an experimental design. Multicollinearity can

Watermass structure and current system in the equatorial western Indian Ocean during August, 1985

Digital Repository Service at National Institute of Oceanography (India)

Suryanarayana, A.; Reddy, G.V.; Pankajakshan, T.

. At the equator, currents were computed using Montgomery's method. Westerly flows near Equator and easterly flows on either side of the equator are deduced. The presence of the Arabian Sea surface water, the Red Sea water, and Pacific low salinity water is noticed...

78 FR 8156 - National Cancer Institute; Notice of Closed Meetings

Science.gov (United States)

2013-02-05

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Cancer Institute... proposals. Place: Bethesda North Marriott Hotel & Conference Center, Montgomery County Conference Center... Institute, NIH, 6116 Executive Blvd., Suite 703, Room 7072, Bethesda, md 20892-8329, 301-594-1408, Stoicaa2...

76 FR 24570 - Proposed Information Collection (Application for VA Education Benefits) Activity; Comment Request

Science.gov (United States)

2011-05-02

... (Application for VA Education Benefits) Activity; Comment Request AGENCY: Veterans Benefits Administration, Department of Veterans Affairs. ACTION: Notice. SUMMARY: The Veterans Benefits Administration (VBA... Under the Montgomery GI Bill, VA Form 22-1990E. c. Application for VA Education Benefits Under the...

38 CFR 21.7170 - Course measurement.

Science.gov (United States)

2010-07-01

...) VOCATIONAL REHABILITATION AND EDUCATION All Volunteer Force Educational Assistance Program (Montgomery GI Bill-Active Duty) Course Assessment § 21.7170 Course measurement. In administering benefits payable...) and (a)(3) and those portions of paragraph (c) and footnotes dealing with farm cooperative training...

Концепция когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson

OpenAIRE

Мазуров Никита Юрьевич; Струков Иван Александрович; Лебедева Марина Юрьевна

2016-01-01

в данной статье рассматривается роль концепции когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson. Авторы отмечают, что сфера когнитивных технологий крайне перспективна.

Constraining convection parameters from the light curve shapes of pulsating white dwarf stars: the cases of EC 14012-1446 and WD 1524-0030

Energy Technology Data Exchange (ETDEWEB)

Handler, G; Lendl, M; Beck, P [Institut fuer Astronomie, Universitaet Wien, Tuerkenschanzstrasse 17, A-1180 Wien (Austria); Provencal, J L; Montgomery, M H [Mt. Cuba Observatory and Department of Physics and Astronomy, University of Delaware, 223 Sharp Laboratory, Newark, DE 19716 (Cuba); Romero-Colmenero, E [South AfricAN Astronomical Observatory, PO Box 9, Observatory 7935 (South Africa); Sanchawala, K; Chen, W-P [Graduate Institute of Astronomy, National Central University, Chung-Li 32054, Taiwan (China); Wood, M A; Silver, I [Department of Physics and Space Sciences and SARA Observatory, Florida Institute of Technology, Melbourne, FL 32901 (United States)], E-mail: handler@astro.univie.ac.at

2008-10-15

Montgomery [1] developed a method to probe convection in pulsating white dwarf stars which allows the recovery of the thermal response time of the convection zone by fitting observed nonsinusoidal light curves. He applied this method to two objects; the Whole Earth Telescope (WET) observed the pulsating DB white dwarf GD 358 for just this purpose. Given this WET run's success, it is time to extend Montgomery's method to pulsating DA white dwarf (ZZ Ceti) stars. We present observations of two ZZ Ceti stars, WD 1524-0030 and EC 14012-1446, both observed from multiple sites. EC 14012-1446 seems better suited thAN WD1524-0030 for a future WET run because it has more pulsation modes excited and because it pulsation spectrum appears to be more stable in time. We call for participation in this effort to take place in April 2008.

Three Mile Island nuclear reactor accident of March 1979. Environmental radiation data: Volume I. A report to the President's Commission on the Accident at Three Mile Island

International Nuclear Information System (INIS)

Bretthauer, E.W.; Grossman, R.F.; Thome, D.J.; Smith, A.E.

1981-03-01

This report contains a listing of environmental radiation monitoring data collected in the vicinity of Three Mile Island (TMI) following the March 28, 1979 accident. These data were collected by the EPA, NRC, DOE, HHS, the Commonwealth of Pennsylvania, or the Bethlehem Steel Corporation. The original report was printed in September 1979 and the update was released in December 1979. Volume 1 consists of the following 5 tables: Table 1-Measurements made by principal participants; Table 2-Cross-check program instituted by US Environmental Protection Agency (EPA) for iodine-131 in milk. Table 3-Comparison of EPA and US Nuclear Regulatory Commission (NRC) air data collected at the Three Mile Island (TMI) Observation Center; Table 4-Summary of EPA Environmental Monitoring Systems Laboratory-Las Vegas (EMSL-LV) and EPA Eastern Environmental Radiation Facility-Montgomery (EERF-Montgomery) sampling and analytical procedures; Table 5-Computer printout of environmental data collected by EPA

The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.

Science.gov (United States)

Waddell, Thomas G.; Rybolt, Thomas R.

2003-01-01

Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)

The National Shipbuilding Research Program. Design for Production Manual 2nd Edition

Science.gov (United States)

1999-07-01

New York, 1979 Montgomery, Douglas C., Introduction to Statistical Quality Control, 3rd Edition, John Wiley & Sons, New York, 1997 Ishikawa , Kaoru ...references: Feigenbaum, A.V., Total Quality Control: Engineering and Management, 3rd edition, New York McGraw Hill, 1983. Ishikawa , Kaouro., Guide to

77 FR 10491 - Progress Energy Carolinas, Inc.; Notice of Application for Amendment of License and Soliciting...

Science.gov (United States)

2012-02-22

... ensuring the continued safe and reliable production of hydroelectric power at the project. Among other... Intervene, and Protests Take notice that the following hydroelectric application has been filed with the.... Name of Project: Yadkin-Pee Dee Hydroelectric Project. f. Location: Lake Tillery in Montgomery and...

A Study of the Need for Cross-Cultural Capability Development in the Members of the United States Military

Science.gov (United States)

2006-06-16

past. According to cultural anthropologist Montgomery McFate, “Our ethnocentrism , biased assumptions and mirror-imagining have had negative outcomes...Center is staffed by experts in the field of culture and has accumulated volumes of culturally relevant information to assist Air Force members in

38 CFR 21.7020 - Definitions.

Science.gov (United States)

2010-07-01

...) VOCATIONAL REHABILITATION AND EDUCATION All Volunteer Force Educational Assistance Program (Montgomery GI... of higher learning. The term institution of higher learning has the same meaning as provided in § 21... higher learning, that provides training required for completion of a State-approved alternative teacher...

The Vibrational Spectra of the Boron Halides and Their Molecular ...

African Journals Online (AJOL)

NICO

a cc refers to the cis-cis conformation with respect to the FBNOH chain. b tc refers to the ..... For the intermolecular interactions the values of these quantities ..... Y. Honda, O. Kitao, H. Nakai, T. Vreven, J.A. Montgomery, Jr., J.E.. Peralta, F.

Evaluation: Processes and Practices. Selected Papers from the Conference for the Evaluation of Instructional Materials (Washington, D.C., April 5-6, 1968).

Science.gov (United States)

Swisher, Ginny, Ed.; And Others

Selected papers from the Conference for the Evaluation of Instructional Materials treat the area of evaluation by describing Richard Dershimer's three-part evaluative schema, the Educational Products Information Exchange approach to evaluating instructional materials, the evaluation procedures in Montgomery county (Maryland), the Consumers Union…

76 FR 63602 - Voting Rights Act Amendments of 2006, Determinations Under Section 203

Science.gov (United States)

2011-10-13

... subdivisions obligated to comply with the requirements are listed in the attachment to this Notice. Section 203..., where a state is covered, those counties or county equivalents not displayed in the attachment are... Hispanic. Maryland: Montgomery County Hispanic. Massachusetts: Boston city Hispanic. Chelsea city Hispanic...

The SHARPn project on secondary use of Electronic Medical Record data: progress, plans, and possibilities.

Science.gov (United States)

Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M

2011-01-01

SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010.

Structure of the DNA duplex d(ATTAAT2 with Hoogsteen hydrogen bonds.

Directory of Open Access Journals (Sweden)

Francisco J Acosta-Reyes

Full Text Available The traditional Watson-Crick base pairs in DNA may occasionally adopt a Hoogsteen conformation, with a different organization of hydrogen bonds. Previous crystal structures have shown that the Hoogsteen conformation is favored in alternating AT sequences of DNA. Here we present new data for a different sequence, d(ATTAAT2, which is also found in the Hoogsteen conformation. Thus we demonstrate that other all-AT sequences of DNA with a different sequence may be found in the Hoogsteen conformation. We conclude that any all-AT sequence might acquire this conformation under appropriate conditions. We also compare the detailed features of DNA in either the Hoogsteen or Watson-Crick conformations.

The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

DEFF Research Database (Denmark)

Vester, B; Hansen, L H; Douthwaite, S

1995-01-01

the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... by introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents...

Calculation of the positronium formation differential cross section for collision of electron with anti-hydrogen atoms

International Nuclear Information System (INIS)

Ghanbari Adivi, E.; Kanjuri, F.; Bolorizadeh, M.

2006-01-01

The positronium formation differential cross sections in collision of the high-energy but non-relativistic electrons with anti-hydrogen atoms are calculated by using the three-body Faddeev-Watson-Lovelace formalism. In a second-order approximation, the inter-nuclear and nuclear-electronic partial amplitudes therein the Faddeev-Watson series are calculated, analytically, in the range of 0-180 degrees of the scattering angles. The presence of the T homas peak a t 45 d egree i s investigated. The results are discussed for 1 and 10 keV impact energies and for electron transition from anti-hydrogen ground state into the different states therein the K-, L- and M- shells of the positronium atoms.

Applied Meteorology Unit (AMU) Quarterly Report Fourth Quarter FY-14

Science.gov (United States)

Bauman, William H.; Crawford, Winifred C.; Watson, Leela R.; Shafer, Jaclyn

2014-01-01

Ms. Crawford completed the final report for the dual-Doppler wind field task. Dr. Bauman completed transitioning the 915-MHz and 50-MHz Doppler Radar Wind Profiler (DRWP) splicing algorithm developed at Marshall Space Flight Center (MSFC) into the AMU Upper Winds Tool. Dr. Watson completed work to assimilate data into model configurations for Wallops Flight Facility (WFF) and Kennedy Space Center/Cape Canaveral Air Force Station (KSC/CCAFS). Ms. Shafer began evaluating the a local high-resolution model she had set up previously for its ability to forecast weather elements that affect launches at KSC/CCAFS. Dr. Watson began a task to optimize the data-assimilated model she just developed to run in real time.

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

Science.gov (United States)

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

Trauma-related guilt: conceptual development and relationship with posttraumatic stress and depressive symptoms.

Science.gov (United States)

Browne, Kendall C; Trim, Ryan S; Myers, Ursula S; Norman, Sonya B

2015-04-01

Despite high prevalence and concerning associated problems, little effort has been made to conceptualize the construct of posttraumatic guilt. This investigation examined the theoretical model of trauma-related guilt proposed by Kubany and Watson (2003). This model hypothesizes that emotional and physical distress related to trauma memories partially mediates the relationship between guilt cognitions and posttraumatic guilt. Using path analysis, this investigation (a) empirically evaluated relationships hypothesized in Kubany and Watson's model, and (b) extended this conceptualization by evaluating models whereby guilt cognitions, distress, and posttraumatic guilt were related to posttraumatic stress disorder (PTSD) symptoms depression symptom severity. Participants were male U.S. Iraq and Afghanistan veterans (N = 149). Results yielded a significant indirect effect from guilt cognitions to posttraumatic guilt via distress, providing support for Kubany and Watson's model (β = .14). Findings suggested distress may be the strongest correlate of PTSD symptoms (β = .47) and depression symptoms (β = .40), and that guilt cognitions may serve to intensify the relationship between distress and posttraumatic psychopathology. Research is needed to evaluate whether distress specific to guilt cognitions operates differentially on posttraumatic guilt when compared to distress more broadly related to trauma memories. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

38 CFR 21.7103 - Travel expenses.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Travel expenses. 21.7103...) VOCATIONAL REHABILITATION AND EDUCATION All Volunteer Force Educational Assistance Program (Montgomery GI Bill-Active Duty) Counseling § 21.7103 Travel expenses. (a) Travel for veterans and servicemembers. (1...

Field-cage evaluation of the survival, feeding and reproduction of Laricobius osakensis (Coleoptera: Derodontidae), a predator of Adelges tsugae (Hemiptera: Adelgidae)

Science.gov (United States)

L.C. Viera; S.M. Salom; M.E. Montgomery; L.T. Kok

2013-01-01

The hemlock woolly adelgid, Adelges tsugae Annand, is a serious, non-native pest of hemlock in eastern North America. Laricobius osakensis Montgomery and Shiyake was identified as a key predator in Japan, where A. tsugae is native. Performance of adult and immature stages of L. osakensis was...

36 CFR 7.96 - National Capital Region.

Science.gov (United States)

2010-07-01

... Alexandria in Virginia and Prince Georges, Charles, Anne Arundel, and Montgomery Counties in Maryland and to... provision or will not unreasonably interfere with other demonstrations or special events. (ii... will be waived by the Regional Director if the size and nature of the activity will not reasonably...

Grieving Together and Apart: Bereaved Parents' Contradictions of Marital Interaction

Science.gov (United States)

Toller, Paige W.; Braithwaite, Dawn O.

2009-01-01

The researchers adopted relational dialectics theory (Baxter & Montgomery, 1996) to examine the discourse of 37 bereaved parents. Research questions guiding the study were what dialectical contradictions do bereaved parents experience when communicating with their marital partner after their child's death and how do bereaved parents and their…

38 CFR 21.7076 - Entitlement charges.

Science.gov (United States)

2010-07-01

...) VOCATIONAL REHABILITATION AND EDUCATION All Volunteer Force Educational Assistance Program (Montgomery GI... basic educational assistance otherwise applicable to him or her for full-time institutional training. If... to him or her for full-time institutional training. (Authority: 38 U.S.C. 3031(f)) (10) When a...

38 CFR 21.7220 - Course approval.

Science.gov (United States)

2010-07-01

...) VOCATIONAL REHABILITATION AND EDUCATION All Volunteer Force Educational Assistance Program (Montgomery GI...; Pub. L. 98-525) (b) Course approval criteria. In administering benefits payable under 38 U.S.C...) Section 21.4265—Practical training approved as institutional training or on-job training; (10) Section 21...

A Taste of Cooperativeness within an Elementary School.

Science.gov (United States)

McElroy, Karen B.

1989-01-01

The process of implementing cooperative learning techniques in an elementary school in Montgomery County, Maryland, is described. Discussed are: learning techniques used, such as Student Teams Achievement Divisions, Round Table, Think-Pair-Share, and the Trading Game; student and teacher reactions to cooperative learning; teacher recommendations;…

A report on the occurrence of Thraustochytrid species in Indian waters

Digital Repository Service at National Institute of Oceanography (India)

Raghukumar, S.; Raghukumar, C.

Raghukumar Labyrinthuloidus minuta (Watson and Raper) Perkins, L. yorkensis, Perkins, Thraustochytrium aggregatum Ulken, T. motivum Goldstein, T. multirudimentale, Goldstein, T. striatum, Schneider, Schizochytrium mangrovei, Raghukumar and Ulkenia visurgensis...

76 FR 59141 - Determination That LOXITANE (Loxapine Succinate) Capsules and Three Other Drug Products Were Not...

Science.gov (United States)

2011-09-23

... Applicant NDA 017525 LOXITANE (loxapine Watson Laboratories succinate) Inc., 417 Wakara Capsules, Way, Suite.../milliliter. NDA 020828 FORTOVASE Hoffmann La Roche (saquinavir) Inc., 340 Kingsland Capsule, 200 mg. St...

Burnout and health of primary school educators in the North West ...

African Journals Online (AJOL)

Burnout and health of primary school educators in the North West Province. Amanda Montgomery, Karina Mostert, Leon Jackson. Abstract. No Abstract. South African journal of Education Vol. 25(4) 2005: 266-272. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL ...

Owning the Journey: Using Collaborative Revisions of Little Red Riding Hood in Teaching Introduction to Literature at a Historically Black University

Science.gov (United States)

Scott, Pauline

2012-01-01

Design and implementation of a collaborative course project, using Little Red Riding Hood (LRRH) to teach and discuss the concepts of orality, cultural legacy, archetypes, adaptation/appropriation, and social criticism in an Introduction to Literature course at Historically Black Alabama State University in Montgomery, Alabama. The student groups…

Parent Feedback about Individualized Education Program Team Meetings for Students in Kindergarten through Grade 12

Science.gov (United States)

Cooper-Martin, Elizabeth; Wilson, Heather M.

2014-01-01

This report presents parent feedback from a study that focused on experiences at Individualized Education Program (IEP) team meetings and also explored parent satisfaction with delivery of special education services. The study included all parents of Montgomery County (Maryland) Public Schools (MCPS) students who had educational disabilities, were…

1984 Program Report on the Army-Navy Initiative in the National Capital Area in Support of the Department of Defense Science and Engineering Apprenticeship Program for High School Students

Science.gov (United States)

1985-03-01

Mexico . The other method was by the Faraday Rotation Principle calculated by polarimeter here at the lab. To measure the TEC by either method gives a base...shock in chronic rats. Springbrook High School Montgomery County, Md. Sarah Gaffen Investigated the herpes Varicella Mentor: Dr. John Hay Zoster virus

ECM using Edwards curves

DEFF Research Database (Denmark)

Bernstein, Daniel J.; Birkner, Peter; Lange, Tanja

2013-01-01

-arithmetic level are as follows: (1) use Edwards curves instead of Montgomery curves; (2) use extended Edwards coordinates; (3) use signed-sliding-window addition-subtraction chains; (4) batch primes to increase the window size; (5) choose curves with small parameters and base points; (6) choose curves with large...

40 CFR 80.70 - Covered areas.

Science.gov (United States)

2010-07-01

... following Illinois counties: (i) Cook; (ii) Du Page; (iii) Kane; (iv) Lake; (v) McHenry; (vi) Will; (2... counties: (i) Calvert; (ii) Charles; (iii) Frederick; (iv) Montgomery; (v) Prince Georges; (vi) Queen Anne...) Manassas; (viii) Manassas Park; (ix) Prince William County; (x) Stafford County; (xi) Charles City County...

75 FR 51104 - National Register of Historic Places; Notification of Pending Nominations and Related Actions

Science.gov (United States)

2010-08-18

..., Daglren, Frostown, Mt. Tabor, and Moser Rds, Middletown, 10000575 MINNESOTA Big Stone County St. Pauli... Montgomery County Caspar Getman Farmstead, 1311 Stone Arabia Rd, Stone Arabia, 10000594 New York County Park..., Charlotte, 10000603 Polk County Lynncote, 3318 Lynn Rd, Tryon, 10000604 NORTH DAKOTA Grand Forks County R.S...

Ohio River Navigation: Past-Present-Future

Science.gov (United States)

1979-10-01

navigation structures had been built: the auxillary 56- by 360-foot lock at dam 41 (Louisville), 1930; Montgomery Locks and Dam, 1936; and Gallipolis...Mile 974.2. This project was approved in 1963, but substantial ’ delay is anticipated ina decision concerning its execu- tion. For this reason a

45 CFR 3.1 - Definitions.

Science.gov (United States)

2010-10-01

... area, containing about 318 acres, acquired by the United States in several parcels in the years 1935... DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION CONDUCT OF PERSONS AND TRAFFIC ON THE NATIONAL... Montgomery County, Maryland, over which the United States acquired exclusive jurisdiction under the Act of...

A Comparative Study of the Attitudes, Self-Efficacy, and Readiness of American versus Turkish Language Teachers

Science.gov (United States)

Kaloti, Yesim Ozek

2016-01-01

Contrasting studies of foreign language teacher education have become a growing interest among educationists and researchers in different countries (Yoder, 1992; McKay & Montgomery, 1995; Baker & Giacchino-Baker, 2000; Stachowski & Sparks, 2007; Firmin, M. W., Firmin, R & MacKay, F. M., 2008; LaFond & Dogancay-Aktuna, 2009;…

MCPS School Safety & Security at a Glance 2013-2014

Science.gov (United States)

Montgomery County Public Schools, 2014

2014-01-01

"MCPS School Safety and Security at a Glance" provides, in a single document, information about the reporting of incidents related to school safety and security, school climate, local school safety program descriptions, and serious incidents. Information is presented for each Montgomery County (Maryland) public school. While much of this…

MCPS School Safety & Security at a Glance 2012-2013

Science.gov (United States)

Montgomery County Public Schools, 2013

2013-01-01

"MCPS School Safety and Security at a Glance" provides, in a single document, information about the reporting of incidents related to school safety and security, school climate, local school safety program descriptions, and serious incidents. Information is presented for each Montgomery County (Maryland) public school. While much of this…

MCPS School Safety & Security at a Glance 2011-2012

Science.gov (United States)

Montgomery County Public Schools, 2012

2012-01-01

"MCPS School Safety and Security at a Glance" provides, in a single document, information about the reporting of incidents related to school safety and security, school climate, local school safety program descriptions, and serious incidents. Information is presented for each Montgomery County (Maryland) public school. While much of this…

Program of Studies, Aesthetic Education: Dance, Drama/Theatre, Interrelated Arts.

Science.gov (United States)

Montgomery County Public Schools, Rockville, MD. Dept. of Instructional Planning and Development.

Educational objectives and brief course descriptions are provided for dance, drama/theatre, and interrelated ARTS (Arts Resource Teams in Schools), Montgomery County Public School System, Rockville, Maryland. In grades K-12 dance and movement are part of the physical education department. Instruction emphasizes the potential of body movement for…

A Synchronous Distance Education Course for Non-Scientists Coordinated among Three Universities

Science.gov (United States)

Smith, Tamara Floyd; Baah, David; Bradley, James; Sidler, Michelle; Hall, Rosine; Daughtrey, Terrell; Curtis, Christine

2010-01-01

A Synchronous Distance Education (SDE) course, jointly offered by Auburn University, Tuskegee University and Auburn University at Montgomery, introduced non-science majors to the concepts of nanoscience. Lectures originated from each of the three campuses during the semester, and video conferencing equipment allowed students at all three campuses…

From the Field: Speech Therapy Outcome Measures--Interview with Dr. Pam Enderby

Science.gov (United States)

Montgomery, Judy K.

2015-01-01

This article is an interview with Dr. Pam Enderby--a speech language therapist and professor at the Institute of General Practice and Primary Care at the University of Sheffield, Community Sciences Centre, Northern General Hospital, in the United Kingdom--conducted by Judy Montgomery, Editor in Chief, of "Communication Disorders…

Double-periodic arrays of vortices

NARCIS (Netherlands)

Kuvshinov, B. N.; Schep, T. J.

2000-01-01

Analytical solutions to the sinh-Poisson equation are discussed. This equation plays a role in the theory of vortex dynamics [Mallier and Maslowe, Phys. Fluids A 5, 1074 (1993)] and in the discussion of the most probable states of inviscid two-dimensional flows in fluids and plasmas [Montgomery and

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

An atlas of the (near) future: cognitive computing applications for medical imaging (Conference Presentation)

Science.gov (United States)

LeGrand, Anne

2017-02-01

The role of medical imaging in global health systems is literally fundamental. Like labs, medical images are used at one point or another in almost every high cost, high value episode of care. CT scans, mammograms, and x-rays, for example, "atlas" the body and help chart a course forward for a patient's care team. Imaging precision has improved as a result of technological advancements and breakthroughs in related medical research. Those advancements also bring with them exponential growth in medical imaging data. As IBM trains Watson to "see" medical images, Ms. Le Grand will discuss recent advances made by Watson Health and explore the potential value of "augmented intelligence" to assist healthcare providers like radiologists and cardiologists, as well as the patients they serve.

Hydrogen bond indices and tertiary structure of yeast tRNA sup(Phe)

International Nuclear Information System (INIS)

Giambiagi, M.S. de; Giambiagi, M.; Esquivel, D.M.S.

1982-01-01

The rigidity and stability of the tertiary structure of yeast tRNA sup(Phe) is related to a bond index employed in an IEHT calculation. The index permits a quantitative estimate of the electronic cloud along the hydrogen bond, having thus an appealing physical meaning. The results indicate that Hoogsteen-type bonds have, as expected, greater electronic population than Watson-Crick type ones. Other non-Watson-Crick pairings, the wobble pair and G 15 -C 48 , exhibit high values of the index for the NH...O bond. In the triples, the electronic density of the hydrogen bridges does not weaken, comparing it with the one of the pairs involved. Contour density maps are shown and dipolar moments of pairs and triples are qualitatively discussed. (Author) [pt

Water-level altitudes 2017 and water-level changes in the Chicot, Evangeline, and Jasper Aquifers and compaction 1973–2016 in the Chicot and Evangeline Aquifers, Houston-Galveston region, Texas

Science.gov (United States)

Kasmarek, Mark C.; Ramage, Jason K.

2017-08-16

Most of the land-surface subsidence in the Houston-Galveston region, Texas, has occurred as a direct result of groundwater withdrawals for municipal supply, commercial and industrial use, and irrigation that depressured and dewatered the Chicot and Evangeline aquifers, thereby causing compaction of the aquifer sediments, mostly in the fine-grained silt and clay layers. This report, prepared by the U.S. Geological Survey in cooperation with the Harris-Galveston Subsidence District, City of Houston, Fort Bend Subsidence District, Lone Star Groundwater Conservation District, and Brazoria County Groundwater Conservation District, is one in an annual series of reports depicting water-level altitudes and water-level changes in the Chicot, Evangeline, and Jasper aquifers and measured cumulative compaction of subsurface sediments in the Chicot and Evangeline aquifers in the Houston-Galveston region. This report contains regional-scale maps depicting approximate 2017 water-level altitudes (represented by measurements made during December 2016 through March 2017) and long-term water-level changes for the Chicot, Evangeline, and Jasper aquifers; a map depicting locations of borehole-extensometer (hereinafter referred to as “extensometer”) sites; and graphs depicting measured long-term cumulative compaction of subsurface sediments at the extensometers during 1973–2016.In 2017, water-level-altitude contours for the Chicot aquifer ranged from 200 feet (ft) below the North American Vertical Datum of 1988 (hereinafter referred to as “datum”) in two localized areas in southwestern and northwestern Harris County to 200 ft above datum in west-central Montgomery County. The largest water-level-altitude decline (120 ft) depicted by the 1977–2017 water-level-change contours for the Chicot aquifer was in northwestern Harris County. A broad area where water-level altitudes declined in the Chicot aquifer extends from northwestern, north-central, and southwestern Harris County

Why Do Model Tropical Cyclones Grow Progressively in Size and Decay in Intensity after Reaching Maturity

Science.gov (United States)

2015-08-17

the distribution of azimuthally-averaged diabatic heating rate derived from the MM5 output. The coefficients of this equation are deter- mined by the...contributions to the intensification of Hurricane Opal as diagnosed from a GFDL model forecast. Mon. Wea. Rev., 130, 1866–1881. Montgomery, M. T., M. E

76 FR 1664 - Notice of Final Federal Agency Actions on State Highway 99 (Segment G)

Science.gov (United States)

2011-01-11

... on State Highway 99 (Segment G) AGENCY: Federal Highway Administration (FHWA), DOT. ACTION: Notice of.... 139(l)(1). The actions relate to a proposed highway project, Grand Parkway (State Highway 99) Segment... (State Highway 99) Segment G from I- 45 to US 59 in Harris and Montgomery Counties; FHWA Project...