WorldWideScience

Sample records for montgomery watson harza

  1. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  2. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  3. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  4. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  5. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  6. Weighted Watson-Crick automata

    International Nuclear Information System (INIS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-01-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power

  7. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  8. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  9. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  10. Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

    Science.gov (United States)

    Sternod, Latisha; French, Brian

    2016-01-01

    The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

  11. A conversation with Geoff Watson

    OpenAIRE

    Beran, R. J.; Fisher, N. I.

    1998-01-01

    Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

  12. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  13. School Progress Report 2012. Montgomery County Public Schools

    Science.gov (United States)

    Montgomery County Public Schools, 2013

    2013-01-01

    The 2012 School Progress Report for Montgomery County Public Schools (MCPS) provides state, county, and individual school performance data, as well as information on student attendance, high school graduation rates, and the professional qualifications of teachers at the state, district, and school levels. Montgomery County primary schools are…

  14. Multi-head Watson-Crick automata

    OpenAIRE

    Chatterjee, Kingshuk; Ray, Kumar Sankar

    2015-01-01

    Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...

  15. Sommerfeld-Watson transformation for nuclear fission

    International Nuclear Information System (INIS)

    Alexandru, G.

    1978-01-01

    It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

  16. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  17. Ed Watson 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  18. Faster Double-Size Bipartite Multiplication out of Montgomery Multipliers

    Science.gov (United States)

    Yoshino, Masayuki; Okeya, Katsuyuki; Vuillaume, Camille

    This paper proposes novel algorithms for computing double-size modular multiplications with few modulus-dependent precomputations. Low-end devices such as smartcards are usually equipped with hardware Montgomery multipliers. However, due to progresses of mathematical attacks, security institutions such as NIST have steadily demanded longer bit-lengths for public-key cryptography, making the multipliers quickly obsolete. In an attempt to extend the lifespan of such multipliers, double-size techniques compute modular multiplications with twice the bit-length of the multipliers. Techniques are known for extending the bit-length of classical Euclidean multipliers, of Montgomery multipliers and the combination thereof, namely bipartite multipliers. However, unlike classical and bipartite multiplications, Montgomery multiplications involve modulus-dependent precomputations, which amount to a large part of an RSA encryption or signature verification. The proposed double-size technique simulates double-size multiplications based on single-size Montgomery multipliers, and yet precomputations are essentially free: in an 2048-bit RSA encryption or signature verification with public exponent e=216+1, the proposal with a 1024-bit Montgomery multiplier is at least 1.5 times faster than previous double-size Montgomery multiplications.

  19. 78 FR 43198 - Watson Cogeneration Company; Notice of Filing

    Science.gov (United States)

    2013-07-19

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

  20. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  1. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  2. Montgomery Point Lock and Dam, White River, Arkansas

    Science.gov (United States)

    2016-01-01

    the time of this study was James E. Walker, Chief, Navigation Branch, HQUSACE. W. Jeff Lillycrop, CHL, was the ERDC Technical Director for... Fischer , and J. Mewes. 2011. Montgomery Point Lock and Dam HSR model, White River miles 4.0 – 0.0; Hydraulic sediment response model investigation

  3. A High-Speed Design of Montgomery Multiplier

    Science.gov (United States)

    Fan, Yibo; Ikenaga, Takeshi; Goto, Satoshi

    With the increase of key length used in public cryptographic algorithms such as RSA and ECC, the speed of Montgomery multiplication becomes a bottleneck. This paper proposes a high speed design of Montgomery multiplier. Firstly, a modified scalable high-radix Montgomery algorithm is proposed to reduce critical path. Secondly, a high-radix clock-saving dataflow is proposed to support high-radix operation and one clock cycle delay in dataflow. Finally, a hardware-reused architecture is proposed to reduce the hardware cost and a parallel radix-16 design of data path is proposed to accelerate the speed. By using HHNEC 0.25μm standard cell library, the implementation results show that the total cost of Montgomery multiplier is 130 KGates, the clock frequency is 180MHz and the throughput of 1024-bit RSA encryption is 352kbps. This design is suitable to be used in high speed RSA or ECC encryption/decryption. As a scalable design, it supports any key-length encryption/decryption up to the size of on-chip memory.

  4. School Progress Report 2013. Montgomery County Public Schools

    Science.gov (United States)

    Montgomery County Public Schools, 2014

    2014-01-01

    The 2013 School Progress Report for Montgomery County Public Schools (MCPS) provides state, county, and individual school performance data, as well as information on student attendance, high school graduation rates, and the professional qualifications of teachers at the state, district, and school levels for the 2012-2013 school year. Montgomery…

  5. 76 FR 54188 - Television Broadcasting Services; Montgomery, AL

    Science.gov (United States)

    2011-08-31

    ... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 11-137, RM-11637; DA 11-1414] Television Broadcasting Services; Montgomery, AL AGENCY: Federal Communications Commission. ACTION: Proposed... 47 CFR Part 73 Television, Television broadcasting. Federal Communications Commission. Barbara A...

  6. 76 FR 71909 - Television Broadcasting Services; Montgomery, AL

    Science.gov (United States)

    2011-11-21

    ... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [MB Docket No. 11-137; RM-11637, DA 11-1863] Television Broadcasting Services; Montgomery, AL AGENCY: Federal Communications Commission. ACTION: Final... CFR Part 73 Television. Federal Communications Commission. Barbara A. Kreisman, Chief, Video Division...

  7. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  8. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  9. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  10. Buying Renewable Electric Power in Montgomery County, Maryland

    Science.gov (United States)

    Cember, Richard P.

    2008-08-01

    From mid-August 2007 until mid-August 2008, my home electricity supply was 100% wind-generated. My experience in switching to wind-generated electric power may be of interest to fellow AGU members for three reasons. First, Montgomery County, Md., where I live, is one of the few jurisdictions in the United States that has both an electric power tax and a renewable energy credit. The county is therefore a case study in price-based public policy for greenhouse gas emissions control. Second, I was surprised by the comparatively small price difference (or ``price premium'') between wind-generated and conventionally generated power in the county, and I believe that Eos readers will be similarly surprised. Third, because so many U.S. federal agencies concerned with Earth science are based in the Washington, D. C., area, a high concentration of AGU members live in Montgomery County and may be personally interested in evaluating the price of reducing carbon dioxide emissions from the generation of their own residential electricity.

  11. Role of Montgomery T-tube stent for laryngotracheal stenosis.

    Science.gov (United States)

    Prasanna Kumar, Saravanam; Ravikumar, Arunachalam; Senthil, Kannan; Somu, Lakshman; Nazrin, Mohd Ismail

    2014-04-01

    To identify the indications, complications and outcome of patients of LTS managed with Montgomery T-tube stenting and review the current literature about the role of stenting in LTS. Retrospective chart reviews of 39 patients of laryngotracheal stenosis managed by T-tube stenting for temporary or definitive treatment during the period 2004-2011 were considered. The data on indications for stenting, type of stent, problems/complications of stenting, duration of stenting, additional intervention and outcome of management were collected, tabulated and analyzed. Of the 51 cases of laryngotracheal stenosis 39 patients were treated by Montgomery T-tube stenting. There was no mortality associated with the procedure or stenting. 82% of the patients were successfully decannulated. The problems and complications encountered were crusting within the tube in 44% and granulation at the subglottis in 33%. Two patients had complication due to T-tube itself: One patient developed tracheomalacia and the other had stenosis at both ends of the T-tube. Stenting still has a role in management of inoperable or in some deadlock situations where resection anastomosis is not feasible. It is easier to introduce the stent and to maintain it. Complications are minor and can be managed easily. It is safe for long term use. We emphasize that the treating surgeon needs to use prudence while treating stenosis using stents. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. The multiple personalities of Watson and Crick strands.

    Science.gov (United States)

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  13. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  14. Replication infidelity via a mismatch with Watson-Crick geometry.

    Science.gov (United States)

    Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

    2011-02-01

    In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

  15. On Montgomery's pair correlation conjecture to the zeros of Riedmann zeta function

    OpenAIRE

    Li, Pei

    2005-01-01

    In this thesis, we are interested in Montgomery's pair correlation conjecture which is about the distribution of.the spacings between consecutive zeros of the Riemann Zeta function. Our goal is to explain and study Montgomery's pair correlation conjecture and discuss its connection with the random matrix theory. In Chapter One, we will explain how to define the Ftiemann Zeta function by using the analytic continuation. After this, several classical properties of the Ftiemann Zeta function wil...

  16. 78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

    Science.gov (United States)

    2013-10-25

    ... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

  17. 78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

    Science.gov (United States)

    2013-03-20

    ... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

  18. [From humanism to nihilism: dialectics on Jean Watson's caring theory].

    Science.gov (United States)

    Krol, Pawel J; Lavoie, Mireille

    2015-09-01

    nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

  19. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  20. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  1. Relativistic generalisation of the Kroll-Watson formula

    International Nuclear Information System (INIS)

    Kaminski, J.Z.

    1985-01-01

    The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

  2. Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

    Science.gov (United States)

    Digdon, Nancy; Powell, Russell A; Harris, Ben

    2014-11-01

    In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

  3. Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

    Science.gov (United States)

    Kidd, Gary R.

    2004-05-01

    Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

  4. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

  5. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    Science.gov (United States)

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  6. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  7. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  8. Mad Colonial Narrators in Anglo-Irish Literature: Lemuel Gulliver and Freddie Montgomery

    Directory of Open Access Journals (Sweden)

    Patricia Jones

    2018-03-01

    Full Text Available The following discussion highlights parallels between the narrators, Lemuel Gulliver of Jonathan Swift’s Gulliver’s Travels (1726 and Freddie Montgomery of John Banville’s The Book of Evidence (1989. The argument calls on post-colonialism, Foucaultian theory of “will to truth” and the narrative theory of Shlomith Rimmon-Kenan to emphasize similarities in the rendering of mental degeneration in Gulliver and Montgomery. The colonial-induced mental breakdown of both narrators can be said to unravel, not so much in the tale these narrators think they are relating, but instead between the lines of their stories in narratives which continually focus attention back onto themselves. Despite the 260 years separating these works, the madness of both Gulliver and Montgomery can be interpreted as a reluctance on their respective parts to shed established colonial identities once the colonial stage has receded.

  9. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  10. Watson: A new link in the IIE iron chain

    Science.gov (United States)

    Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

    1994-01-01

    Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

  11. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  12. ACT Participation and Performance for Montgomery County Public Schools Students [2014]. Memorandum

    Science.gov (United States)

    Sanderson, Geoffrey T.

    2014-01-01

    The Montgomery County (Maryland) Public Schools (MCPS) Class of 2014 consistently outperformed graduates across Maryland and the nation on all sections of the ACT, according to the ACT, Inc. annual report that was released Wednesday, August 20, 2014. Thirty percent of the graduates in the MCPS Class of 2014 took the ACT exam. According to the ACT,…

  13. Online Opportunist: Mary Ellen Icaza--Montgomery County Public Libraries, Rockville, MD

    Science.gov (United States)

    Library Journal, 2004

    2004-01-01

    When Mary Ellen Icaza became Electronic Services Librarian at Montgomery County Public Libraries, she noticed that the readers' services information on the library web site was invisible, even to librarians. "And if staff can't find it," she says, "customers can't." She set out to help people find that material-and to turn a…

  14. Changes to the law on consent following Montgomery vs Lanarkshire Health Board.

    Science.gov (United States)

    Clearkin, Louis

    2016-06-01

    The Supreme Court's determination on Montgomery (AP) (Appellant) v Lanarkshire Health Board (Respondent) (Scotland) [2015] clarified UK law on consent. It is for the informed patient to determine which intervention, if any, they will undergo. All doctors must meet this standard and may need to reassess their practice to do so.

  15. Conceptualizing an Agenda for Social Responsibility and Public Policy at Montgomery College. A Briefing Paper. Revised

    Science.gov (United States)

    Scott, Michelle T.

    2007-01-01

    The purpose of this briefing paper is to conceptualize a social responsibility and public policy agenda for Montgomery College. The briefing paper provides (a) a well researched perspective to embed a College culture to actualize social responsibility and public policy as institutional practices; (b) examines some of the opportunities and…

  16. Official Reports of Enrollment as of September 30, 2013. Montgomery County Public Schools

    Science.gov (United States)

    Erickson, Marianne

    2013-01-01

    This document is a combination of two reports produced for Montgomery County Public Schools (MCPS) by the Department of Policy, Records, and Reporting: (1) Official Race/Ethnic Membership of Students as of September 30, 2013; and (2) Official Report of Enrollment by Grade and School as of September 30, 2013. Both reports provide student data for…

  17. 77 FR 28471 - Prevailing Rate Systems; Abolishment of Montgomery, PA, as a Nonappropriated Fund Federal Wage...

    Science.gov (United States)

    2012-05-15

    ... minimum of 26 NAF wage employees in the survey area, the local activity has the capability to host annual... County from the wage area definition. There are no longer NAF FWS employees working in Bucks County... Montgomery, PA, as a Nonappropriated Fund Federal Wage System Wage Area AGENCY: U.S. Office of Personnel...

  18. An Evaluation of the Employee Assistance Program in the Montgomery County Public School System.

    Science.gov (United States)

    Goldberg, Jo Ann

    The Montgomery County public school system presently provides assistance through the Employee Assistance Program (EAP) to troubled employees with problems which affect work performance. EAP's mandate is to provide crisis intervention, prereferral evaluation, information, referral, and follow-up services. From its inception to March, 1981, EAP…

  19. The Myth of "Rosa Parks the Tired." Teaching about Rosa Parks and the Montgomery Bus Boycott.

    Science.gov (United States)

    Kohl, Herbert

    1993-01-01

    Retells the story of Rosa Parks and the Montgomery (Alabama) bus boycott to reflect more accurately the cultural and historical background of the boycott and the conscious decision made by Mrs. Parks. Accurate examination of the story actually enhances a child's ability to identify with the issues and the protagonists. (SLD)

  20. The Politics of Children's Literature: The Story of Rosa Parks and the Montgomery Bus Boycott.

    Science.gov (United States)

    Kohl, Herbert

    1991-01-01

    As commonly told to and read by children, the story of Rosa Parks and the Montgomery bus boycott fails to indicate Mrs. Parks' activist role or the degree of community organization and participation in the boycott. Telling what actually occurred allows children identify with people who make justice happen. (SLD)

  1. Building Watson: An Overview of the DeepQA Project

    OpenAIRE

    Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

    2010-01-01

    IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

  2. Impact parameter representation from the Watson-Sommerfeld transform

    International Nuclear Information System (INIS)

    Islam, M.M.

    1976-01-01

    Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

  3. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  4. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  5. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  6. 77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2012-11-13

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  7. 78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

    Science.gov (United States)

    2013-06-04

    ... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

  8. On the scaling limits of Galton Watson processes in varying environment

    NARCIS (Netherlands)

    Bansaye, V.; Simatos, F.

    2011-01-01

    Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

  9. John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

    Science.gov (United States)

    Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

    2007-01-01

    In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

  10. From theory to practice: caring science according to Watson and Brewer.

    Science.gov (United States)

    Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

    2009-10-01

    Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

  11. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  12. An Appalachian portrait : black and white in Montgomery County, Virginia, before the Civil War

    OpenAIRE

    Grant, Charles L.

    1987-01-01

    Montgomery County, Virginia, is a southern Appalachian county founded in 1776. Throughout the county's antebellum history, as with most other regions of the South, four major population groups were visibly present. There were slaves, free blacks, white slaveowners, and white non-slaveowners. Little research has previously been conducted on the antebellum people of the Appalachian South. This work is a social history consisting of cross tabulations of data found in the county...

  13. Geology of the Birmingham, Gadsden, and Montgomery 10 x 20 NTMS Quadrangles, Alabama

    International Nuclear Information System (INIS)

    Copeland, C.W.; Beg, M.A.

    1979-04-01

    This document is a facsimile edition (with accompanying maps) of geologic reports on the Birmingham, Gadsden, and Montgomery 1 0 x 2 0 NTMS quadrangles prepared for SRL by the Geological Survey of Alabama. The purpose of these reports is to provide background geologic information to aid in the interpretation of NURE geochemical reconnaissance data. Each report includes descriptions of economic mineral localities as well as a mineral locality map and a geologic map

  14. Geology of the Birmingham, Gadsden, and Montgomery 10 x 20 NTMS quadrangles, Alabama

    International Nuclear Information System (INIS)

    Copeland, C.W.; Beg, M.A.

    1979-04-01

    This document is a facsimile edition (with accompanying maps) of geologic reports on the Birmingham, Gadsden, and Montgomery 1 0 x 2 0 NTMS quadrangles prepared for SRL by the Geological Survey of Alabama. Purpose of these reports is to provide background geologic information to aid in the interpretation of NURE geochemical reconnaissance data. Each report includes descriptions of economic mineral localities as well as a mineral locality map and a geologic map

  15. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  16. Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

    Science.gov (United States)

    26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

  17. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  18. Elbow Room for Best Practice? Montgomery, Patients' values, and Balanced Decision-Making in Person-Centred Clinical Care.

    Science.gov (United States)

    Herring, Jonathan; Fulford, Kmw; Dunn, Michael; Handa, Ashoki

    2017-11-01

    The UK Supreme Court Montgomery judgment marks a decisive shift in the legal test of duty of care in the context of consent to treatment, from the perspective of the clinician (as represented by Bolam rules) to that of the patient. A majority of commentators on Montgomery have focused on the implications of the judgment for disclosure of risk. In this article, we set risk disclosure in context with three further elements of the judgment: benefits, options, and dialogue. These elements, we argue, taken together with risk disclosure, reflect the origins of the Montgomery ruling in a model of consent based on autonomy of patient choice through shared decision-making with their doctor. This model reflects recent developments in both law and medicine and is widely regarded (by the General Medical Council and others) as representing best practice in contemporary person-centred medicine. So understood, we suggest, the shift marked by Montgomery in the basis of duty of care is a shift in underpinning values: it is a shift from the clinician's interpretation about what would be best for patients to the values of (to what is significant or matters from the perspective of) the particular patient concerned in the decision in question. But the values of the particular patient do not thereby become paramount. The Montgomery test of duty of care requires the values of the particular patient to be balanced alongside the values of a reasonable person in the patient's position. We illustrate some of the practical challenges arising from the balance of considerations required by Montgomery with examples from surgical care. These examples show the extent to which Montgomery, in mirroring the realities of clinical decision-making, provides elbowroom for best practice in person-centred clinical care. © The Author 2017. Published by Oxford University Press; all rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. The Game is aFoot, Watson: DeepQA systems and the future of HCI

    OpenAIRE

    Keates, Simeon; Varker, Philip

    2012-01-01

    In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

  20. Watson's theorem and resonant pion photoproduction amplitude in the delta channel

    International Nuclear Information System (INIS)

    Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

    1984-01-01

    The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

  1. A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

    International Nuclear Information System (INIS)

    Roberts, M.J.

    1988-01-01

    Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

  2. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    OpenAIRE

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2005-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

  3. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  4. The case of the missing fingerprints or Dr Watson's cosmology

    International Nuclear Information System (INIS)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

  5. Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

    Science.gov (United States)

    Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

    2018-01-01

    Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

  6. The Towers Watson Approach to Improving Corporate Wellness.

    Science.gov (United States)

    Wootton, Adam

    2012-06-01

    Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

  7. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  8. Quality assurance for radon exposure chambers at the National Air and Radiation Environmental Laboratory, Montgomery, Alabama

    Energy Technology Data Exchange (ETDEWEB)

    Semler, M.O.; Sensintaffar, E.L. [National Air and Radiation Environmental Laboratory, Montgomery, AL (United States)

    1993-12-31

    The Office of Radiation and Indoor Air, U.S. Environmental Protection Agency (EPA), operates six radon exposure chambers in its two laboratories, the National Air and Radiation Environmental Laboratory (NAREL) in Montgomery, Alabama, and the Las Vegas Facility, Las Vegas, Nevada. These radon exposure chambers are used to calibrate and test portable radon measuring instruments, test commercial suppliers of radon measurement services through the Radon Measurement Proficiency Program, and expose passive measurement devices to known radon concentrations as part of a quality assurance plan for federal and state studies measuring indoor radon concentrations. Both laboratories participate in national and international intercomparisons for the measurement of radon and are presently working with the National Institute of Standards and Technology (NIST) to receive a certificate of traceability for radon measurements. NAREL has developed an estimate of the total error in its calibration of each chamber`s continuous monitors as part of an internal quality assurance program. This paper discusses the continuous monitors and their calibration for the three chambers located in Montgomery, Alabama, as well as the results of the authors intercomparisons and total error analysis.

  9. Inference-Based Similarity Search in Randomized Montgomery Domains for Privacy-Preserving Biometric Identification.

    Science.gov (United States)

    Wang, Yi; Wan, Jianwu; Guo, Jun; Cheung, Yiu-Ming; C Yuen, Pong

    2017-07-14

    Similarity search is essential to many important applications and often involves searching at scale on high-dimensional data based on their similarity to a query. In biometric applications, recent vulnerability studies have shown that adversarial machine learning can compromise biometric recognition systems by exploiting the biometric similarity information. Existing methods for biometric privacy protection are in general based on pairwise matching of secured biometric templates and have inherent limitations in search efficiency and scalability. In this paper, we propose an inference-based framework for privacy-preserving similarity search in Hamming space. Our approach builds on an obfuscated distance measure that can conceal Hamming distance in a dynamic interval. Such a mechanism enables us to systematically design statistically reliable methods for retrieving most likely candidates without knowing the exact distance values. We further propose to apply Montgomery multiplication for generating search indexes that can withstand adversarial similarity analysis, and show that information leakage in randomized Montgomery domains can be made negligibly small. Our experiments on public biometric datasets demonstrate that the inference-based approach can achieve a search accuracy close to the best performance possible with secure computation methods, but the associated cost is reduced by orders of magnitude compared to cryptographic primitives.

  10. Montgomery Blair Science, Mathematics and Computer Science Magnet Program: A Successful Model for Meeting the Needs of Highly Able STEM Learners

    Science.gov (United States)

    Stein, David; Ostrander, Peter; Lee, G. Maie

    2016-01-01

    The Magnet Program at Montgomery Blair High School is an application-based magnet program utilizing a curriculum focused on science, mathematics, and computer science catering to interested, talented, and eager to learn students in Montgomery County, Maryland. This article identifies and discusses some of the unique aspects of the Magnet Program…

  11. Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

    Science.gov (United States)

    Cubero, Elena; Luque, F Javier; Orozco, Modesto

    2006-02-01

    A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

  12. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  13. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Seres Vivos. Nivel I. Basado en el curso de estudios de Ciencia de Montgomery County Public Schools. (Living Beings. Level 1. Based on the Montgomery County Public Schools Science Studies Program).

    Science.gov (United States)

    Senger, Graciela

    This curriculum unit, developed by the Montgomery County Public Schools, Maryland, was designed for use in the elementary level foreign language immersion program. It is geared toward the first grade science classroom. The unit includes instructional and performance objectives, necessary vocabulary lists, optional language structure sections,…

  15. La Materia. Nivel II. Basado en el curso de estudios de Ciencia de Montgomery County Public Schools. (Matter. Level II. Based on the Montgomery County Public Schools Science Studies Program).

    Science.gov (United States)

    Gerstman, M. Linda

    This curriculum unit is for use in an elementary school foreign language immersion program in Montgomery County, Maryland. The unit is geared toward the second grade science classroom. It includes instructional and performance objectives, vocabulary lists, optional language structure sections, illustrations, activities, evaluation suggestions, and…

  16. Effects of automated speed enforcement in Montgomery County, Maryland, on vehicle speeds, public opinion, and crashes.

    Science.gov (United States)

    Hu, Wen; McCartt, Anne T

    2016-09-01

    In May 2007, Montgomery County, Maryland, implemented an automated speed enforcement program, with cameras allowed on residential streets with speed limits of 35 mph or lower and in school zones. In 2009, the state speed camera law increased the enforcement threshold from 11 to 12 mph over the speed limit and restricted school zone enforcement hours. In 2012, the county began using a corridor approach, in which cameras were periodically moved along the length of a roadway segment. The long-term effects of the speed camera program on travel speeds, public attitudes, and crashes were evaluated. Changes in travel speeds at camera sites from 6 months before the program began to 7½ years after were compared with changes in speeds at control sites in the nearby Virginia counties of Fairfax and Arlington. A telephone survey of Montgomery County drivers was conducted in Fall 2014 to examine attitudes and experiences related to automated speed enforcement. Using data on crashes during 2004-2013, logistic regression models examined the program's effects on the likelihood that a crash involved an incapacitating or fatal injury on camera-eligible roads and on potential spillover roads in Montgomery County, using crashes in Fairfax County on similar roads as controls. About 7½ years after the program began, speed cameras were associated with a 10% reduction in mean speeds and a 62% reduction in the likelihood that a vehicle was traveling more than 10 mph above the speed limit at camera sites. When interviewed in Fall 2014, 95% of drivers were aware of the camera program, 62% favored it, and most had received a camera ticket or knew someone else who had. The overall effect of the camera program in its modified form, including both the law change and the corridor approach, was a 39% reduction in the likelihood that a crash resulted in an incapacitating or fatal injury. Speed cameras alone were associated with a 19% reduction in the likelihood that a crash resulted in an

  17. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  18. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  19. U.S. History and Modern World History Courses for English Speakers of Other Languages in Montgomery County Public Schools

    Science.gov (United States)

    Zhao, Huafang; Wade, Julie

    2014-01-01

    The Office of Shared Accountability (OSA) in Montgomery County (Maryland) Public Schools (MCPS) examined academic performance of English for Speakers of Other Languages (ESOL) students in U.S. History and Modern World History courses, as well as the course sequence in ESOL U.S. History and Modern World History. In MCPS, students who are not ESOL…

  20. A Portrait of School District Crisis Management: Leadership Choices in Montgomery County during the Sniper Shootings of October 2002

    Science.gov (United States)

    Porter, Brian Joseph

    2010-01-01

    The actions of two assailants who shot and killed 10 people and wounded three others, including a student, in the region around Washington, D.C., in October 2002, provides the backdrop for a qualitative study of the emergency response by school district leaders in Montgomery County, Maryland. The study explores and describes the experiences of the…

  1. Just the Right Mix: Identifying Potential Dropouts in Montgomery County Public Schools Using an Early Warning Indicators Approach

    Science.gov (United States)

    West, Thomas C.

    2013-01-01

    Each school year, roughly a thousand students drop out of Montgomery County (Maryland) Public Schools (MCPS). However, unlike other large, urban school districts where students who drop out skip school and are suspended often (Balfanz & Byrnes, 2010), students who drop out of MCPS are present in school; they just are not doing well…

  2. Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

    Science.gov (United States)

    Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

    2017-07-01

    The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

  3. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  4. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  5. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  6. Land use mapping and change detection using ERTS imagery in Montgomery County, Alabama

    Science.gov (United States)

    Wilms, R. P.

    1973-01-01

    The feasibility of using remotely sensed data from ERTS-1 for mapping land use and detecting land use change was investigated. Land use information was gathered from 1964 air photo mosaics and from 1972 ERTS data. The 1964 data provided the basis for comparison with ERTS-1 imagery. From this comparison, urban sprawl was quite evident for the city of Montgomery. A significant trend from forestland to agricultural was also discovered. The development of main traffic arteries between 1964 and 1972 was a vital factor in the development of some of the urban centers. Even though certain problems in interpreting and correlating land use data from ERTS imagery were encountered, it has been demonstrated that remotely sensed data from ERTS is useful for inventorying land use and detecting land use change.

  7. Development and reliability of a structured interview guide for the Montgomery Asberg Depression Rating Scale (SIGMA).

    Science.gov (United States)

    Williams, Janet B W; Kobak, Kenneth A

    2008-01-01

    The Montgomery-Asberg Depression Rating Scale (MADRS) is often used in clinical trials to select patients and to assess treatment efficacy. The scale was originally published without suggested questions for clinicians to use in gathering the information necessary to rate the items. Structured and semi-structured interview guides have been found to improve reliability with other scales. To describe the development and test-retest reliability of a structured interview guide for the MADRS (SIGMA). A total of 162 test-retest interviews were conducted by 81 rater pairs. Each patient was interviewed twice, once by each rater conducting an independent interview. The intraclass correlation for total score between raters using the SIGMA was r=0.93, Preliability. Use of the SIGMA can result in high reliability of MADRS scores in evaluating patients with depression.

  8. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  9. Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

    International Nuclear Information System (INIS)

    Geltman, S.

    1996-01-01

    Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

  10. On the extension of the Fermi-Watson Theorem to high energy diffraction

    International Nuclear Information System (INIS)

    Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

    1995-12-01

    The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

  11. AVE bond index in the H-bond of the Watson-Crick pairs

    International Nuclear Information System (INIS)

    Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

    1981-01-01

    The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

  12. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  13. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  14. Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

    Science.gov (United States)

    Beck, Hall P.; Levinson, Sharman; Irons, Gary

    2009-01-01

    In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

  15. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  16. Ground-water quality beneath an urban residential and commercial area, Montgomery, Alabama, 1999-2000

    Science.gov (United States)

    Robinson, James L.

    2002-01-01

    The Black Warrior River aquifer, which is composed of the Coker, Gordo, and Eutaw Formations, supplies more than 50 percent of the ground water used for public water supply in the Mobile River Basin. The city of Montgomery, Alabama, is partially built upon a recharge area for the Black Warrior River aquifer, and is one of many major population centers that depend on the Black Warrior River aquifer for public water supply. To represent the baseline ground-water quality in the Black Warrior River aquifer, water samples were collected from 30 wells located in a low-density residential or rural setting; 9 wells were completed in the Coker Formation, 9 wells in the Gordo Formation, and 12 wells in the Eutaw Formation. To describe the ground-water quality beneath Montgomery, Alabama, water samples also were collected from 30 wells located in residential and commercial areas of Montgomery, Alabama; 16 wells were completed in the Eutaw Formation, 8 wells in alluvial deposits, and 6 wells in terrace deposits. The alluvial and terrace deposits directly overlie the Eutaw Formation with little or no hydraulic separation. Ground-water samples collected from both the rural and urban wells were analyzed for physical properties, major ions, nutrients, metals, volatile organic compounds, and pesticides. Samples from the urban wells also were analyzed for bacteria, chlorofluorocarbons, dissolved gases, and sulfur hexafluoride. Ground-water quality beneath the urban area was compared to baseline water quality in the Black Warrior River aquifer.Compared to the rural wells, ground-water samples from urban wells contained greater concentrations or more frequent detections of chloride and nitrate, and the trace metals aluminium, chromium, cobalt, copper, nickel, and zinc. Pesticides and volatile organic compounds were detected more frequently and in greater concentrations in ground-water samples collected from urban wells than in ground-water samples from rural wells.The Spearman rho

  17. Map showing radon potential of rocks and soils in Montgomery County, Maryland

    Science.gov (United States)

    Gundersen, L.C.; Reimer, G.M.; Wiggs, C.R.; Rice, C.A.

    1988-01-01

    This report summarizes the radon potential of Montgomery County in the context of its geology. Radon is a naturally occurring gas produced by the radioactive decay of uranium. Radon produced by uraniferous rocks and soils may enter a house through porous building materials and through openings in walls and floors. Radon gases has a tendency to move from the higher pressure commonly existing in the soil to the lower pressure commonly existing in the house. The U.S. Environmental Protection Agency (U.S. EPA, 1986a) estimates that elevated levels of indoor radon may be associated with 5,000 to 20,000 of the 130,000 lung cancer deaths per year. They also estimate that 8 to 12 percent of the homes in the United States will have annual average indoor radon levels exceeding 4 picoCuries per liter of air (pCi/L). Above this level, the U.S. EPA recommends homeowners take remedial action. May factors control the amount of radon which may enter a home from the geologic environment. Soil drainage, permeability, and moisture content effect the amount of radon that can be released from rocks and soils (known as the emmanation) and may limit or increase how far it can migrate. Well drained, highly permeable soils facilitate the movement of radon. Soils with water content in the 8 to 15 percent range enhance the emmanation of radon (Lindmark, 1985). Daily and seasonal variations in soil and indoor radon can be caused by meteorologic factors such as barometric pressure, temperature, and wind (Clements and Wilkening, 1974; Schery and other, 1984). Construction practices also inhibit or promote entry of radon into the home (U.S. EPA, 1986b). In general, however, geology controls the source and distribution of radon (Akerblom and Wilson, 1982; Gundersen and others, 1987, 1988; Sextro and others, 1987; U.S. EPA, 1983; Peake, 1988; Peake and Hess, 1988). The following sections describe: 1) the methods used to measure radon and equivalent uranium (eU) in soil; 2) the radon potential

  18. A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

    International Nuclear Information System (INIS)

    Fargher, H.E.; Roberts, M.J.

    1983-01-01

    Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

  19. Work Plan: Phase II Investigation at the Former CCC/USDA Grain Storage Facility in Montgomery City, Missouri

    Energy Technology Data Exchange (ETDEWEB)

    LaFreniere, Lorraine M [Argonne National Lab. (ANL), Argonne, IL (United States)

    2012-05-01

    From September 1949 until September 1966, the Commodity Credit Corporation of the U.S. Department of Agriculture (CCC/USDA) leased property at the southeastern end of Montgomery City, Missouri, for the operation of a grain storage facility. During this time, commercial grain fumigants containing carbon tetrachloride were commonly used by the CCC/USDA and the private grain storage industry to preserve grain in their facilities.

  20. The secretion of areolar (Montgomery's glands from lactating women elicits selective, unconditional responses in neonates.

    Directory of Open Access Journals (Sweden)

    Sébastien Doucet

    2009-10-01

    Full Text Available The communicative meaning of human areolae for newborn infants was examined here in directly exposing 3-day old neonates to the secretion from the areolar glands of Montgomery donated by non related, non familiar lactating women.The effect of the areolar stimulus on the infants' behavior and autonomic nervous system was compared to that of seven reference stimuli originating either from human or non human mammalian sources, or from an arbitrarily-chosen artificial odorant. The odor of the native areolar secretion intensified more than all other stimuli the infants' inspiratory activity and appetitive oral responses. These responses appeared to develop independently from direct experience with the breast or milk.Areolar secretions from lactating women are especially salient to human newborns. Volatile compounds carried in these substrates are thus in a position to play a key role in establishing behavioral and physiological processes pertaining to milk transfer and production, and, hence, to survival and to the early engagement of attachment and bonding.

  1. Shape of Thyroid Cartilage Influences Outcome of Montgomery Medialization Thyroplasty: A Gender Issue.

    Science.gov (United States)

    Desuter, Gauthier; Henrard, Sylvie; Van Lith-Bijl, Julie T; Amory, Avigaëlle; Duprez, Thierry; van Benthem, Peter Paul; Sjögren, Elisabeth

    2017-03-01

    This study aimed to determine whether the shape of the thyroid cartilage and gender influence voice outcomes after a Montgomery thyroplasty implant system (MTIS). A retrospective cohort study was performed on 20 consecutive patients who underwent MTIS. Voice outcome variables were the relative decrease in Voice Handicap Index (%) and the absolute increase in maximum phonation time (MPT) (in seconds). Material variables were the angle between the thyroid cartilage laminae (α-angle), the size of the prosthesis, and a combination of both (the α-ratio). Continuous variables were analyzed using medians and were compared between groups using the Mann-Whitney U test. Factors associated with the outcome variables were assessed by multivariable linear regression. A Pearson coefficient was calculated between material variables. The absolute increase in MPT between the pre- and postoperative period was significantly different between men and women, with a median absolute increase of 11.0 seconds for men and of 1.3 seconds for women (P gender issue that needs to be further studied and eventually tackled. Copyright © 2017 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

  2. Corporate preparedness for pandemic influenza: a survey of pharmaceutical and biotechnology companies in Montgomery County, Maryland.

    Science.gov (United States)

    Watkins, Rissah J; Barnett, Daniel J; Links, Jonathan M

    2008-09-01

    We conducted a survey of corporate preparedness for pandemic influenza among biotechnology and pharmaceutical companies in Montgomery County, Maryland, to determine the level of preparedness for this industry and geographic region. The survey, based on the HHS Business Pandemic Influenza Planning Checklist, established whether a company had a preparedness plan specific to pandemic influenza, the contents of its plan, or its reasons for a lack of a plan. A total of 50 companies participated in the survey. Of these, 40 did not have any type of preparedness plan, 3 were drafting plans, 6 had general preparedness plans that could be applied to an influenza pandemic, and only 1 company had a preparedness plan specifically designed to address pandemic influenza. Biotechnology and pharmaceutical companies in this geographic region are currently not well prepared for pandemic influenza. Public health officials should offer more help, possibly in the form of a model small business preparedness plan, and collaboration between companies should be encouraged to foster sharing of preparedness plans.

  3. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  4. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  5. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

    Science.gov (United States)

    Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

    2015-01-01

    Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

  7. Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

    Science.gov (United States)

    Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

    2015-03-19

    Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

  8. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  9. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  10. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  11. WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

    Science.gov (United States)

    Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

    2017-12-01

    Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

  12. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  13. Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

    Science.gov (United States)

    Kottemann, Molly C; Smogorzewska, Agata

    2013-01-17

    The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

  14. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  15. Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

    Directory of Open Access Journals (Sweden)

    Ingrid Meireles Gomes

    2013-09-01

    Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

  16. Richard Watson.

    Science.gov (United States)

    Wright, Ian; Bevin, William

    2017-11-25

    An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

  17. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  18. The McLean-Watson line strength formula and its implementation

    International Nuclear Information System (INIS)

    Hey, J D

    2009-01-01

    We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

  19. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  20. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  3. Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

    OpenAIRE

    Rao, B J; Radding, C M

    1994-01-01

    Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

  4. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  5. The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

    Science.gov (United States)

    Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

    2010-01-01

    The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

  6. Comparative validation of proxy-based montgomery-asberg depression rating scale and cornell scale for depression in dementia in nursing home residents with dementia

    NARCIS (Netherlands)

    Leontjevas, R.; Gerritsen, D.L.; Vernooij-Dassen, M.F.J.; Smalbrugge, M.; Koopmans, R.T.C.M.

    2012-01-01

    Objective: To 1) compare the accuracy of the Montgomery-̊Asberg Depression Rating Scale (MADRS) and the Cornell Scale for Depression in Dementia (CSDD) in nursing home residents with dementia when professional caregivers are the only available source of information and 2) explore different methods

  7. "Cancer-Related Fatigue: A Systematic and Meta-Analytic Review of Nonpharmacological Therapies for Cancer Patients:" Correction to Kangas, Bovbjerg, and Montgomery (2008)

    Science.gov (United States)

    Kangas, Maria; Bovbjerg, Dana H.; Montgomery, Guy H.

    2009-01-01

    Reports an error in "Cancer-related fatigue: A systematic and meta-analytic review of non-pharmacological therapies for cancer patients" by Maria Kangas, Dana H. Bovbjerg and Guy H. Montgomery (Psychological Bulletin, 2008[Sep], Vol 134[5], 700-741). The URL to the Supplemental Materials for the article is listed incorrectly in two places in the…

  8. 2013 Advanced Placement Exam Participation and Performance for Students in Montgomery County Public Schools and Public School Students in the State of Maryland and the Nation. Memorandum

    Science.gov (United States)

    Sanderson, Geoffrey T.

    2013-01-01

    This memorandum provides data on the participation and performance of Advanced Placement (AP) exams taken by students in the Montgomery County (Maryland) Public Schools (MCPS) in the 2012-2013 school year as compared with those by public school students in Maryland and the nation. Generally, the number of AP exams taken by MCPS students in 2013…

  9. The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

    International Nuclear Information System (INIS)

    Catalan, G.; Roberts, M.J.

    1979-01-01

    A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

  10. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  11. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  13. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  14. Estimated rates of groundwater recharge to the Chicot, Evangeline and Jasper aquifers by using environmental tracers in Montgomery and adjacent counties, Texas, 2008 and 2011

    Science.gov (United States)

    Oden, Timothy D.; Truini, Margot

    2013-01-01

    Montgomery County is in the northern part of the Houston, Texas, metropolitan area, the fourth most populous metropolitan area in the United States. As populations have increased since the 1980s, groundwater has become an important resource for public-water supply and industry in the rapidly growing area of Montgomery County. Groundwater availability from the Gulf Coast aquifer system is a primary concern for water managers and community planners in Montgomery County and requires a better understanding of the rate of recharge to the system. The Gulf Coast aquifer system in Montgomery County consists of the Chicot, Evangeline, and Jasper aquifers, the Burkeville confining unit, and underlying Catahoula confining system. The individual sand and clay sequences of the aquifers composing the Gulf Coast aquifer system are not laterally or vertically continuous on a regional scale; however, on a local scale, individual sand and clay lenses can extend over several miles. The U.S. Geological Survey, in cooperation with the Lone Star Groundwater Conservation District, collected groundwater-quality samples from selected wells within or near Montgomery County in 2008 and analyzed these samples for concentrations of chlorofluorocarbons (CFCs), sulfur hexafluoride (SF6), tritium (3H), helium-3/tritium (3He/3H), helium-4 (4He), and dissolved gases (DG) that include argon, carbon dioxide, methane, nitrogen and oxygen. Groundwater ages, or apparent age, representing residence times since time of recharge, were determined by using the assumption of a piston-flow transport model. Most of the environmental tracer data indicated the groundwater was recharged prior to the 1950s, limiting the usefulness of CFCs, SF6, and 3H concentrations as tracers. In many cases, no tracer was usable at a well for the purpose of estimating an apparent age. Wells not usable for estimating an apparent age were resampled in 2011 and analyzed for concentrations of major ions and carbon-14 (14C). At six of

  15. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  16. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  17. Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-04-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

  18. LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

    Energy Technology Data Exchange (ETDEWEB)

    Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

    1994-09-01

    The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

  19. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  20. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  1. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  2. Phase I Investigations at the Former CCC/USDA Grain Storage Facility in Montgomery City, Missouri, in 2010-2011

    Energy Technology Data Exchange (ETDEWEB)

    LaFreniere, Lorraine M. [Argonne National Lab. (ANL), Argonne, IL (United States). Environmental Science Division. Applied Geoscience and Environmental Restoration Program

    2012-11-01

    This report presents the technical findings of Phase I of Argonne’s studies. The Phase I field investigation was initiated on October 18, 2010. The work was conducted in accord with (1) the final site-specific Phase I Work Plan for Montgomery City (Argonne 2010; approved by the MDNR [2010]); (2) applicable Missouri regulations; and (3) the standard operating procedures, quality assurance/quality control (QA/QC) measures, and general health and safety policies outlined in the Master Work Plan (Argonne 2002) for operations in Kansas, which was reviewed by the MDNR and accepted for current use. A draft master plan specific to work in Missouri and a set of draft standard operating procedures are in review with the MDNR. The site-specific Work Plan for Montgomery City (Argonne 2010) (1) summarizes the pre-existing knowledge base for the Montgomery City investigation site compiled by Argonne and (2) describes the site-specific technical objectives and the intended scope of work developed for the first phase of the investigation. Three primary technical objectives were identified for the Phase I studies, as follows: 1. Update the presently identified inventory and status of private and public drinking water wells in the immediate vicinity of the former CCC/USDA grain storage facility, and sample the identified wells for volatile organic compounds (VOCs) and geochemical analyses. In conjunction with this effort, determine the present sources(s) of drinking water for all residents in an approximate 0.5-mi radius of the former CCC/USDA facility. 2. Investigate for possible evidence of a soil source of carbon tetrachloride contamination in the unconsolidated sediments beneath the former CCC/USDA facility that might affect the underlying bedrock aquifer units. 3. Obtain preliminary information on the site-specific lithologic and hydrologic characteristics of the unconsolidated sediments overlying bedrock at the former CCC/USDA grain storage location. Section 2 of this report

  3. From Bolam-Bolitho to Modified-Montgomery - A Paradigm Shift in the Legal Standard of Determining Medical Negligence in Singapore.

    Science.gov (United States)

    Neo, Han Yee

    2017-09-01

    In a recent landmark litigation, the Singapore Court of Appeal introduced a new legal standard for determining medical negligence with regards to information disclosure - the Modified-Montgomery test. This new test fundamentally shifts the legal position concerning the standard of care expected of a doctor when he dispenses medical advice. Previously, a doctor is expected to disclose what a "reasonable physician" would tell his patient. Now, a doctor must disclose "all material risks" that a "reasonable patient" would want to know under his unique circumstances. Patient-centred communication is no longer an aspirational ideal but has become a legal mandate. Manpower, administrative, logistic and medical educational reforms should start now, so as to support the average physician transit from the era of the Bolam-Bolitho, to that of the Modified-Montgomery.

  4. Knowledge of General Nutrition, Soy Nutrition, and Consumption of Soy Products: Assessment of a Sample Adult Population in Montgomery County, Virginia

    OpenAIRE

    Johnson, Lida Catherine

    1999-01-01

    KNOWLEDGE OF GENERAL NUTRITION, SOY NUTRITION, AND CONSUMPTION OF SOY PRODUCTS: ASSESSMENT OF A SAMPLE ADULT POPULATION IN MONTGOMERY COUNTY, VIRGINIA Lida Catherine Johnson (ABSTRACT) Nutrition education programs in the prevention of chronic diseases has flourished over the last 15 years. Investigators continue to demonstrate that soy consumption plays a role in decreasing chronic diseases such as cardiovascular disease, cancer, osteoporosis and problems regarding menopause....

  5. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  6. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  7. Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

    OpenAIRE

    Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

    2016-01-01

    In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

  8. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  9. Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

    Science.gov (United States)

    Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

    2005-06-16

    The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

  10. The self-reported Montgomery-Åsberg depression rating scale is a useful evaluative tool in major depressive disorder

    Directory of Open Access Journals (Sweden)

    Fantino Bruno

    2009-05-01

    Full Text Available Abstract Background The use of Patient-reported Outcomes (PROs as secondary endpoints in the development of new antidepressants has grown in recent years. The objective of this study was to assess the psychometric properties of the 9-item, patient-administered version of the Montgomery-Åsberg Depression Rating Scale (MADRS-S. Methods Data from a multicentre, double-blind, 8-week, randomised controlled trial of 278 outpatients diagnosed with Major Depressive Disorder were used to evaluate the validity, reliability and sensitivity to change of the MADRS-S using psychometric methods. A Receiver Operating Characteristic (ROC curve was plotted to identify the most appropriate threshold to define perceived remission. Results No missing values were found at the item level, indicating good acceptability of the scale. The construct validity was satisfactory: all items contributed to a common underlying concept, as expected. The correlation between MADRS-S and physicians' MADRS was moderate (r = 0.54, p Conclusion Taking account of patient's perceptions of the severity of their own symptoms along with the psychometric properties of the MADRS-S enable its use for evaluative purposes in the development of new antidepressant drugs.

  11. Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

    Science.gov (United States)

    Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

    2004-09-28

    Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

  12. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  14. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  15. Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

    2016-03-15

    Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

  16. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  17. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  18. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  19. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  20. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  1. Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

    International Nuclear Information System (INIS)

    de Prunele, E.

    1983-01-01

    The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

  2. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  3. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

  4. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  5. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    Science.gov (United States)

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

  6. Validation of Montgomery-Åsberg Rating Scale and Cornell Scale for Depression in Dementia in Brazilian elderly patients.

    Science.gov (United States)

    Portugal, Maria da Glória; Coutinho, Evandro Silva Freire; Almeida, Cloyra; Barca, Maria Lage; Knapskog, Anne-Brita; Engedal, Knut; Laks, Jerson

    2012-08-01

    There are few studies on validation of depression scales in the elderly in Latin America. This study aimed to assess the validity of Montgomery-Åsberg. Depression Rating Scale (MADRS) and Cornell Scale for Depression in Dementia (CSDD) in Brazilian elderly outpatients. A convenience sample of 95 outpatients was diagnosed for dementia and depression according to DSM-IV-TR, ICD-10, and PDC-dAD criteria. Receiver Operating Curves (ROC) were used to calculate the area under the curve (AUC) and to assess MADRS and CSDD cut-offs for each diagnostic criterion. Dementia was diagnosed in 71 of 95 patients. Depression was diagnosed in 35, 30, and 51 patients by ICD-10, DSM-IV, and PDC-dAD, respectively. MADRS cut-off score of 10 correctly diagnosed 67.4% and 66.3% patients as depressed according to DSM-IV and ICD-10. A cut-off of 9 correctly identified 74.7% by PDC-dAD criteria; a CSDD cut-off score of 13 best recognized depression according to DSM-IV and ICD-10. A score of 11 diagnosed depression according to PDC-dAD, while MADRS = 9 recognized depression in dementia. CSDD was more efficient in showing depression in mild than in moderate/severe dementia according to DSM-IV/ICD-10. PDC-dAD behaved nicely for any severity stage. MADRS and CSDD cut-offs of 10 and 13 were the optimal ones to diagnose depression in elderly, respectively. CSDD cut-offs are higher than those found in other countries. Other Latin American studies are needed to compare results with our study.

  7. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  8. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  9. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  10. Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

    Science.gov (United States)

    Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

    2018-01-01

    Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

  11. Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

    Science.gov (United States)

    Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

    2018-04-24

    A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

  12. William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

    Science.gov (United States)

    Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

    2013-11-01

    William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

  13. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  14. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  15. HYDROLOGY, MONTGOMERY COUNTY, MISSISSIPPI

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — Hydrology data include spatial datasets and data tables necessary for documenting the hydrologic procedures for estimating flood discharges for a flood insurance...

  16. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  17. Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

    Science.gov (United States)

    Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

    2017-06-01

    The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

  18. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  19. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  1. Characterization of phenolics by LC-UV/vis, LC-MS/MS and sugars by GC in Melicoccus bijugatus Jacq. 'Montgomery' fruits.

    Science.gov (United States)

    Bystrom, Laura M; Lewis, Betty A; Brown, Dan L; Rodriguez, Eloy; Obendorf, Ralph L

    2008-12-15

    Fruits of the native South American tree Melicoccus bijugatus Jacq. (Sapindaceae) are consumed for both dietary and medicinal purposes, but limited information is available about the phytochemistry and health value of M. bijugatus fruits. Fruit tissues of the Florida Montgomery cultivar were assessed for sugars, using gas chromatography, and for total phenolics, using UV spectroscopy. Reverse phase high performance liquid chromatography (HPLC) fingerprints of crude methanolic pulp, embryo and seed coat extracts were obtained at 280 nm. Phenolics were characterised by both HPLC UV/vis analysis and HPLC electrospray ionization tandem mass spectrometry. Major sugars detected in the pulp and embryo extracts were sucrose, followed by glucose and fructose. The glucose:fructose ratio was 1:1 in the pulp and 0.1:1 in the embryo. Total phenolic concentrations of the fruit tissues were in the order: seed coat > embryo > pulp. Phenolic acids were identified mostly in pulp tissues. Phenolic acids, flavonoids, procyanidins and catechins were identified in embryo tissues, and higher molecular weight procyanidins were identified in seed coat tissues. This study provides new information about the phytochemistry and the potential health value of the Montgomery cultivar M. bijugatus fruit tissues.

  2. Final work plan : phase I investigation of potential contamination at the former CCC/USDA grain storage facility in Montgomery City, Missouri.

    Energy Technology Data Exchange (ETDEWEB)

    LaFreniere, L. M.; Environmental Science Division

    2010-08-16

    From September 1949 until September 1966, the Commodity Credit Corporation of the U.S. Department of Agriculture (CCC/USDA) leased property at the southeastern end of Montgomery City, Missouri, for the operation of a grain storage facility. During this time, commercial grain fumigants containing carbon tetrachloride were commonly used by the CCC/USDA and the private grain storage industry to preserve grain in their facilities. In January 2000, carbon tetrachloride was detected in a soil sample (220 {micro}g/kg) and two soil gas samples (58 {micro}g/m{sup 3} and 550 {micro}g/m{sup 3}) collected at the former CCC/USDA facility, as a result of a pre-CERCLIS site screening investigation (SSI) performed by TN & Associates, Inc., on behalf of the U.S. Environmental Protection Agency (EPA), Region VII (MoDNR 2001). In June 2001, the Missouri Department of Natural Resources (MoDNR) conducted further sampling of the soils and groundwater at the former CCC/USDA facility as part of a preliminary assessment/site inspection (PA/SI). The MoDNR confirmed the presence of carbon tetrachloride (at a maximum identified concentration of 2,810 {micro}g/kg) and chloroform (maximum 82 {micro}g/kg) in the soils and also detected carbon tetrachloride and chloroform (42.2 {micro}g/L and 58.4 {micro}g/L, respectively) in a groundwater sample collected at the former facility (MoDNR 2001). The carbon tetrachloride levels identified in the soils and groundwater are above the default target level (DTL) values established by the MoDNR for this contaminant in soils of all types (79.6 {micro}g/kg) and in groundwater (5.0 {micro}g/L), as outlined in Missouri Risk-Based Corrective Action (MRBCA): Departmental Technical Guidance (MoDNR 2006a). The corresponding MRBCA DTL values for chloroform are 76.6 {micro}g/kg in soils of all types and 80 {micro}g/L in groundwater. Because the observed contamination at Montgomery City might be linked to the past use of carbon tetrachloride-based fumigants at its

  3. Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

    Science.gov (United States)

    Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

    2013-12-01

    Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

  4. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2018-04-01

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  5. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  6. Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

    Science.gov (United States)

    Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

    2014-01-01

    In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

  7. Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

  8. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  9. Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

    Science.gov (United States)

    Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

  10. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  12. An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

    Science.gov (United States)

    Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

    2007-05-01

    Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

  13. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  14. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  15. Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

    Directory of Open Access Journals (Sweden)

    Kevin Possin

    2014-12-01

    Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

  16. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  17. How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

  18. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  19. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  20. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  1. Investigations of groundwater system and simulation of regional groundwater flow for North Penn Area 7 Superfund site, Montgomery County, Pennsylvania

    Science.gov (United States)

    Senior, Lisa A.; Goode, Daniel J.

    2013-01-01

    Groundwater in the vicinity of several industrial facilities in Upper Gwynedd Township and vicinity, Montgomery County, in southeast Pennsylvania has been shown to be contaminated with volatile organic compounds (VOCs), the most common of which is the solvent trichloroethylene (TCE). The 2-square-mile area was placed on the National Priorities List as the North Penn Area 7 Superfund site by the U.S. Environmental Protection Agency (USEPA) in 1989. The U.S. Geological Survey (USGS) conducted geophysical logging, aquifer testing, and water-level monitoring, and measured streamflows in and near North Penn Area 7 from fall 2000 through fall 2006 in a technical assistance study for the USEPA to develop an understanding of the hydrogeologic framework in the area as part of the USEPA Remedial Investigation. In addition, the USGS developed a groundwater-flow computer model based on the hydrogeologic framework to simulate regional groundwater flow and to estimate directions of groundwater flow and pathways of groundwater contaminants. The study area is underlain by Triassic- and Jurassic-age sandstones and shales of the Lockatong Formation and Brunswick Group in the Mesozoic Newark Basin. Regionally, these rocks strike northeast and dip to the northwest. The sequence of rocks form a fractured-sedimentary-rock aquifer that acts as a set of confined to partially confined layers of differing permeabilities. Depth to competent bedrock typically is less than 20 ft below land surface. The aquifer layers are recharged locally by precipitation and discharge locally to streams. The general configuration of the potentiometric surface in the aquifer is similar to topography, except in areas affected by pumping. The headwaters of Wissahickon Creek are nearby, and the stream flows southwest, parallel to strike, to bisect North Penn Area 7. Groundwater is pumped in the vicinity of North Penn Area 7 for industrial use, public supply, and residential supply. Results of field investigations

  2. Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

    International Nuclear Information System (INIS)

    Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

    2010-01-01

    By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

  3. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  4. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  5. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  6. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  7. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  8. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  10. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  11. Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

    Science.gov (United States)

    Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

    2014-01-01

    Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

  12. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  13. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  14. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  15. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  16. Occurrence of Selected Pharmaceuticals, Personal-Care Products, Organic Wastewater Compounds, and Pesticides in the Lower Tallapoosa River Watershed near Montgomery, Alabama, 2005

    Science.gov (United States)

    Oblinger, Carolyn J.; Gill, Amy C.; McPherson, Ann K.; Meyer, Michael T.; Furlong, Edward T.

    2007-01-01

    Synthetic and natural organic compounds derived from agricultural operations, residential development, and treated and untreated sanitary and industrial wastewater discharges can contribute contaminants to surface and ground waters. To determine the occurrence of these compounds in the lower Tallapoosa River watershed, Alabama, new laboratory methods were used that can detect human and veterinary antibiotics; pharmaceuticals; and compounds found in personal-care products, food additives, detergents and their metabolites, plasticizers, and other industrial and household products in the environment. Well-established methods for detecting 47 pesticides and 19 pesticide degradates also were used. In all, 186 different compounds were analyzed by using four analytical methods. The lower Tallapoosa River serves as the water-supply source for more than 100,000 customers of the Montgomery Water Works and Sanitary Sewer Board. Source-water protection is a high priority for the Board, which is responsible for providing safe drinking water. The U.S. Geological Survey, in cooperation with the Montgomery Water Works and Sanitary Sewer Board, conducted this study to provide baseline data that could be used to assess the effects of agriculture and residential development on the occurrence of selected organic compounds in the lower Tallapoosa River watershed. Twenty samples were collected at 10 sites on the Tallapoosa River and its tributaries. Ten samples were collected in April 2005 during high base streamflow, and 10 samples were collected in October 2005 when base streamflow was low. Thirty-two of 186 compounds were detected in the lower Tallapoosa River watershed. Thirteen compounds, including atrazine, 2-chloro-4-isopropylamino-6-amino-s-triazine (CIAT), hexazinone, metalaxyl, metolachlor, prometryn, prometon, simazine, azithromycin, oxytetracycline, sulfamethoxazole, trimethoprim, and tylosin, had measurable concentrations above their laboratory reporting levels

  17. Comments on 'Origin of British and Irish mammals: disparate post-glacial colonisation and species introductions' by W.I. Montgomery, J. Provan, A.M. McCabe, and D.W. Yalden

    Science.gov (United States)

    Edwards, Ceiridwen J.

    2014-12-01

    Montgomery et al.'s recent paper in QSR (2014; vol. 98: 144-165) is a most welcome addition to the ongoing research into the origins of Irish mammals. In their Table 1, the authors have used "calibrated carbon dating, comparable stratigraphy and historical records … to establish the earliest known time of arrival of a species in […] Ireland […] where relevant, the latest record of a mammal species [was] used to establish the earliest date after which it was extinct". It is assumed that the dates mentioned in this table are, therefore, calibrated. However, this is very unclear - when dates generated by the Irish Quaternary Fauna project (Woodman et al., 1997) are compared with those used by Montgomery et al. (2014), the earliest recorded dates of Mountain/Irish hare, Irish stoat, lynx and pine marten seem to be direct uncalibrated dates. It is also unclear whether the earliest and latest records of each species relate to all published data available at the time of writing. Even if only consulting those dates generated by Woodman et al. (1997), there are older earliest records for Arctic Fox, Collared lemming and grey wolf. In addition, Montgomery et al. (2014) do not seem to have included early radiocarbon dates for giant deer, reindeer and red deer (Woodman et al., 1997; Carden et al., 2012), or any of the recent radiocarbon dates for brown bear (Edwards et al., 2011), despite reference to these papers.

  18. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  19. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  20. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  1. Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-06-21

    Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

  2. ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

    Directory of Open Access Journals (Sweden)

    Susilawati Susilawati

    2016-06-01

    Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

  3. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  4. BASEMAP, MONTGOMERY COUNTY, VIRGINIA, USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — FEMA Framework Basemap datasets comprise six of the seven FGDC themes of geospatial data that are used by most GIS applications (Note: the seventh framework theme,...

  5. HYDRAULICS, MONTGOMERY COUNTY, ALABAMA, USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — Recent developments in digital terrain and geospatial database management technology make it possible to protect this investment for existing and future projects to...

  6. FLOODPLAIN, Montgomery COUNTY, VIRGINIA, USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classifications used are the...

  7. On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

    International Nuclear Information System (INIS)

    Hey, J D

    2014-01-01

    As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

  8. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  9. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  10. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  11. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  12. Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

    International Nuclear Information System (INIS)

    Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

    1988-01-01

    The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

  13. Progress Report on the ISCR Pilot Test Conducted at the Former CCC/USDA Grain Storage Facility in Montgomery City, Missouri, as of April 2013

    Energy Technology Data Exchange (ETDEWEB)

    LaFreniere, Lorraine M. [Argonne National Lab. (ANL), Argonne, IL (United States). Environmental Science Division. Applied Geoscience and Environmental Restoration Program

    2013-06-01

    The Commodity Credit Corporation of the U.S. Department of Agriculture (CCC/USDA) is conducting an environmental investigation at the former CCC/USDA grain storage facility on the county fairgrounds in Montgomery City, Missouri, to evaluate contamination associated with the former use of grain fumigants containing carbon tetrachloride at the site. The CCC/USDA studies have identified carbon tetrachloride in the soils (primarily unconsolidated glacial tills) at concentrations that exceed the U.S. Environmental Protection Agency (EPA) regional screening level (RSL) values for this compound in residential soils (610 μg/kg) but are below the corresponding RSL for industrial soils (3,000 μg/kg). Concentrations of carbon tetrachloride greater than the EPA maximum contaminant level (MCL; 5.0 μg/L) for this contaminant in drinking water were also identified in the shallow groundwater (Argonne 2012). On the basis of these findings, remedial actions are considered necessary to mitigate the present and potential future impacts of the contamination. In cooperation with the Missouri Department of Natural Resources (MDNR), the CCC/USDA has initiated a field-scale pilot test to evaluate an in situ technology for treatment of the carbon tetrachloride contamination. In this approach, a chemical amendment consisting primarily of slow-release organic matter and zero-valent iron is employed to induce oxygen-depleted, chemically reducing conditions in the subsurface. These conditions foster the in situ chemical reduction (ISCR) of carbon tetrachloride and its degradation products (chloroform, methylene chloride, and chloromethane) via both inorganic and biologically mediated processes. The chemical amendment being used, EHC™, was developed by the Adventus Group, Freeport, Illinois, and is now manufactured and distributed by FMC Environmental Solutions, Philadelphia, Pennsylvania. With the approval of the MDNR (2012), the ISCR technology is being tested in two target areas

  14. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  15. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  16. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  17. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  18. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  19. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

    Science.gov (United States)

    Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-05-19

    In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  4. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    Science.gov (United States)

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

  5. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  6. Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

    Science.gov (United States)

    Panczyk, Tomasz; Wolski, Pawel

    2018-06-01

    This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

  7. Pre-treatment factor structures of the Montgomery and Åsberg Depression Rating scale as predictors of response to escitalopram in Indian patients with non-psychotic major depressive disorder.

    Science.gov (United States)

    Basu, Aniruddha; Chadda, Rakesh; Sood, Mamta; Rizwan, S A

    2017-08-01

    Major Depressive Disorder (MDD) is a broad heterogeneous construct resolving into several symptom-clusters by factor analysis. The aim was to find the factor structures of MDD as per Montgomery and Asberg Depression Rating Scale (MADRS) and whether they predict escitalopram response. In a longitudinal study at a tertiary institute in north India, 116 adult out-patients with non-psychotic unipolar MDD were assessed with MADRS before and after treatment with escitalopram (10-20mg) over 6-8 weeks for drug response. For total 116 patients pre-treatment four factor structures of MADRS extracted by principal component analysis with varimax rotation altogether explained a variance of 57%: first factor 'detachment' (concentration difficulty, lassitude, inability to feel); second factor 'psychic anxiety' (suicidal thoughts and inner tension); third 'mood-pessimism' (apparent sadness, reported sadness, pessimistic thoughts) and fourth 'vegetative' (decreased sleep, appetite). Eighty patients (68.9%) who completed the study had mean age 35.37±10.9 yrs, majority were male (57.5%), with mean pre-treatment MADRS score 28.77±5.18 and majority (65%) having moderate severity (MADRS escitalopram. At the end of the treatment there were significant changes in all the 4 factor structures (pescitalopram treatment. Understanding the factor structure is important as they can be important predictor of escitalopram response. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  9. Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

    Science.gov (United States)

    Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

    2018-01-01

    A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

  10. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  11. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  12. Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

    Directory of Open Access Journals (Sweden)

    Marjan Diayanat

    2018-02-01

    Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

  13. Agreement between hopelessness/helplessness and Montgomery-Asberg Depression Rating Scale in healthy individuals and in patients with benign breast disease and breast cancer: a prospective case-control study in Finland.

    Science.gov (United States)

    Eskelinen, Matti; Korhonen, Riika; Selander, Tuomas; Ollonen, Paula

    2015-04-01

    The relation between scoring for hopelessness/helplessness and the Montgomery-Asberg Depression Rating Scale (MADRS) in healthy study subjects (HSS) and in patients with benign breast disease (BBD) and breast cancer (BC) has not been compared in a prospective study. We, therefore, investigated hopelessness and helplessness scores versus the MADRS in 115 patients. In the Kuopio Breast Cancer Study, 115 women with breast symptoms were evaluated for hopelessness and helplessness, and for the MADRS before any diagnostic procedures were carried out. In the self-rating score (SRS), hopelessness/helplessness versus the MADRS were highly significantly positively correlated in the HSS, BBD and BC groups. In the SRS, the weighted kappa values for hopelessness/helplessness versus the MADRS in the HSS, BBD and BC groups were also statistically significant. There was also a significant positive correlation in the examiner-rating score (ERS) for hopelessness versus the MADRS in the HSS, BBD and BC groups and for helplessness versus the MADRS in the HSS, BBD and BC groups. The unweighted kappa values in the ERS for hopelessness versus the MADRS were statistically highly significant for the HSS, BBD and BC groups and those for helplessness versus the MADRS in the HSS and BBD groups were statistically significant. A new finding with clinical relevance in the present work is the agreement between hopelessness/helplessness scores and MADRS in the SRS and ERS. In the breast cancer diagnostic unit, the identification of hopeless/helpless persons is essential in suicide prevention and it is important to assess and treat hopelessness/helplessness even though an individual may report few depressive symptoms. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  14. An item response theory evaluation of the young mania rating scale and the montgomery-asberg depression rating scale in the systematic treatment enhancement program for bipolar disorder (STEP-BD).

    Science.gov (United States)

    Prisciandaro, James J; Tolliver, Bryan K

    2016-11-15

    The Young Mania Rating Scale (YMRS) and Montgomery-Asberg Depression Rating Scale (MADRS) are among the most widely used outcome measures for clinical trials of medications for Bipolar Disorder (BD). Nonetheless, very few studies have examined the measurement characteristics of the YMRS and MADRS in individuals with BD using modern psychometric methods. The present study evaluated the YMRS and MADRS in the Systematic Treatment Enhancement Program for BD (STEP-BD) study using Item Response Theory (IRT). Baseline data from 3716 STEP-BD participants were available for the present analysis. The Graded Response Model (GRM) was fit separately to YMRS and MADRS item responses. Differential item functioning (DIF) was examined by regressing a variety of clinically relevant covariates (e.g., sex, substance dependence) on all test items and on the latent symptom severity dimension, within each scale. Both scales: 1) contained several items that provided little or no psychometric information, 2) were inefficient, in that the majority of item response categories did not provide incremental psychometric information, 3) poorly measured participants outside of a narrow band of severity, 4) evidenced DIF for nearly all items, suggesting that item responses were, in part, determined by factors other than symptom severity. Limited to outpatients; DIF analysis only sensitive to certain forms of DIF. The present study provides evidence for significant measurement problems involving the YMRS and MADRS. More work is needed to refine these measures and/or develop suitable alternative measures of BD symptomatology for clinical trials research. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  16. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  18. Effects of changes in pumping on regional groundwater-flow paths, 2005 and 2010, and areas contributing recharge to discharging wells, 1990–2010, in the vicinity of North Penn Area 7 Superfund site, Montgomery County, Pennsylvania

    Science.gov (United States)

    Senior, Lisa A.; Goode, Daniel J.

    2017-06-06

    A previously developed regional groundwater flow model was used to simulate the effects of changes in pumping rates on groundwater-flow paths and extent of recharge discharging to wells for a contaminated fractured bedrock aquifer in southeastern Pennsylvania. Groundwater in the vicinity of the North Penn Area 7 Superfund site, Montgomery County, Pennsylvania, was found to be contaminated with organic compounds, such as trichloroethylene (TCE), in 1979. At the time contamination was discovered, groundwater from the underlying fractured bedrock (shale) aquifer was the main source of supply for public drinking water and industrial use. As part of technical support to the U.S. Environmental Protection Agency (EPA) during the Remedial Investigation of the North Penn Area 7 Superfund site from 2000 to 2005, the U.S. Geological Survey (USGS) developed a model of regional groundwater flow to describe changes in groundwater flow and contaminant directions as a result of changes in pumping. Subsequently, large decreases in TCE concentrations (as much as 400 micrograms per liter) were measured in groundwater samples collected by the EPA from selected wells in 2010 compared to 2005‒06 concentrations.To provide insight on the fate of potentially contaminated groundwater during the period of generally decreasing pumping rates from 1990 to 2010, steady-state simulations were run using the previously developed groundwater-flow model for two conditions prior to extensive remediation, 1990 and 2000, two conditions subsequent to some remediation 2005 and 2010, and a No Pumping case, representing pre-development or cessation of pumping conditions. The model was used to (1) quantify the amount of recharge, including potentially contaminated recharge from sources near the land surface, that discharged to wells or streams and (2) delineate the areas contributing recharge that discharged to wells or streams for the five conditions.In all simulations, groundwater divides differed from

  19. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  20. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  1. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  2. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  3. VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

    Directory of Open Access Journals (Sweden)

    M. R. Barrón-Yánez

    2009-01-01

    (Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

  4. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  5. Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

    Directory of Open Access Journals (Sweden)

    Brent Tisserat

    2018-04-01

    Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

  6. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  7. How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-08-14

    The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

  8. "Doktor Watson minu õuel!" / Allar Viivik

    Index Scriptorium Estoniae

    Viivik, Allar

    2002-01-01

    Äsjalahkunud näitlejat Vitali Solominit (1941-2002) meenutab Juuliku villa elanik Leo Orav. Siin filmis režissöör Igor Maslennikov paar episoodi "Baskerville'de koerast" vene Sherlock Holmes'i seriaalist. Vitali Solomin mängis doktor Watsonit. Ka teistest selle seriaali võttepaikadest Eestis

  9. Alternative Watson-Crick Synthetic Genetic Systems.

    Science.gov (United States)

    Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia

    2016-11-01

    In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  10. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  11. Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

    Science.gov (United States)

    Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

    2017-12-20

    This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

  12. The physicochemical essence of the purine·pyrimidine transition mismatches with Watson-Crick geometry in DNA: A·C* versa A*·C. A QM and QTAIM atomistic understanding.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually

  13. A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

    NARCIS (Netherlands)

    Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

    1995-01-01

    In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

  14. OrthoImagery Submission for Montgomery County, GA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — NAIP imagery is available for distribution within 60 days of the end of a flying season and is intended to provide current information of agricultural conditions in...

  15. Durbin-Watson statistic for the least trimmed squares

    Czech Academy of Sciences Publication Activity Database

    Víšek, Jan Ámos

    2001-01-01

    Roč. 8, č. 14 (2001), s. 1-40 ISSN 1212-074X Grant - others:GA UK(CZ) 255/2000/A EK/FSV Institutional research plan: CEZ:AV0Z1075907 Keywords : diagnostics * robustness * regression Subject RIV: BB - Applied Statistics, Operational Research

  16. Garri Potter povzroslel! / Daniel Radcliffe, Emma Watson ; interv. Stass Tõrkin

    Index Scriptorium Estoniae

    Radcliffe, Daniel, 1989-

    2005-01-01

    Peaosatäitja järjekorras neljandas Potteri ekraniseeringus "Harry Potter ja tulepeeker" endast, oma tegelaskuju arengust. Samas ka lühiintervjuu näitlejanna Emma Watsoniga. Režissöör Mike Newell : Suurbritannia-USA 2005

  17. Kate Watson on Reynold Humphries’ Hollywood’s Blacklists

    Directory of Open Access Journals (Sweden)

    2008-12-01

    Full Text Available Reynold Humphries. Hollywood’s Blacklists: A Political and Cultural History. Edinburgh: Edinburgh University Press, 2008. Reynold Humphries’ Hollywood’s Blacklists provides a comprehensive examination of the historical and political ramifications of the blacklisting process and of Communism in the motion picture industry. His section on ‘The Background’ initially sets up just this, making the debate and dispute accessible even to those not au fait with such knowledge. This section is informat...

  18. "Elementar, Meu Caro Watson": Jô Soares Reinvents the Classics

    Science.gov (United States)

    Martin, Sarah

    2016-01-01

    Detective fiction--with its roots primarily in Europe and the United States--was slow to catch on in Brazil, where national authors did not attempt more than small forays into the genre for most of the twentieth century. This was due in large part to the particularities of Brazilian society, in which law enforcement agencies, rife with corruption,…

  19. Discourses of Indiscipline: An Informal Hobbesian Riposte to Cate Watson

    Science.gov (United States)

    McManus, Michael

    2006-01-01

    Classroom battles are real and not a metaphor. Warfare is a historical and present fact of human life. Life really is a battle and conflict inevitable; injuries to the psyche are just as real as those to the body. Schools cannot step outside society. It is not Foucault but Thomas Hobbes who offers the most perceptive insight into human behaviour…

  20. What Would It Be Like to Be IBM's Computer, Watson?

    Science.gov (United States)

    Schlinger, Henry D., Jr.

    2012-01-01

    Rachlin (2012) makes two general assertions: (a) "To be human is to behave as humans behave, and to function in society as humans function," and (b) "essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer'. Although Rachlin's article is an…

  1. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-12-01

    Full Text Available In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913 conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  2. Watson, skinner y algunas disputas dentro del conductismo

    OpenAIRE

    Pellón Suárez de Puga, Ricardo

    2013-01-01

    In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913) conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  3. Agentes virtuales con capacidades cognitivas utilizando IBM Watson

    OpenAIRE

    Carrillo Calderón, Manuel Esteban

    2017-01-01

    Resumen (castellano) En la actualidad, los avances en la tecnología informática y la creciente globalización por medio de Internet y las redes sociales han obligado a que los comercios tradicionales luchen por digitalizarse, a la par que los comercios online traten de ser cada vez más personales y cercanos a los clientes. En esto consiste el comercio electrónico conversacional, una evolución del ecosistema del comercio electrónico. Hoy en día, los chats automáticos con mensajes estándar...

  4. Концепция когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson

    OpenAIRE

    Мазуров Никита Юрьевич; Струков Иван Александрович; Лебедева Марина Юрьевна

    2016-01-01

    в данной статье рассматривается роль концепции когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson. Авторы отмечают, что сфера когнитивных технологий крайне перспективна.

  5. Final Environmental Assessment for Temporary Aircraft Relocation to Maxwell Air Force Base 187th Fighter Wing Montgomery Regional Airport Montgomery, Alabama

    Science.gov (United States)

    2012-06-01

    interior construction at Maxwell AFB, such as employment and materials purchasing, will provide minor short-term economic benefits to the local economy...distribution of children and locations where the number of children in the affected area may be disproportionately high (e.g., schools, childcare centers...with its unique Congressional mandate: OSHA regulations categorize substances in terms of their impacts on employee and workplace health and safety

  6. 75 FR 82463 - Yuri I. Montgomery, Respondent; Final Decision and Order

    Science.gov (United States)

    2010-12-30

    ..., U.S. Department of Commerce, Room HCHB 3839, 14th Street and Constitution Ave., NW., Washington, DC... Commerce, Room H-3839, 14th Street & Constitution Avenue, NW., Washington, DC 20230. On behalf of... prohibited items to Macedonia and Slovenia without applying for and obtaining the required export licenses in...

  7. DCS Hydraulics Submission for Montgomery County GA MapMod08

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — Recent developments in digital terrain and geospatial database management technology make it possible to protect this investment for existing and future projects to...

  8. Customizable pre-printed consent forms: a solution in light of the Montgomery ruling.

    Science.gov (United States)

    Owen, Deborah; Aresti, Nick; Mulligan, Alex; Kosuge, Dennis

    2018-02-02

    This article presents an audit cycle supported quality improvement project addressing best practice in the consent process for lower limb arthroplasty which takes into account the new standard in surgical consent and the importance of material risks. 50 consecutive total hip and total knee replacement consent forms over a 3-month period were reviewed for legibility and completeness. Following the introduction of a new, pre-printed but customizable consent form the review process was repeated. The introduction of a customizable, pre-printed consent form that can be adjusted to reflect the individualized material risks of each patient increased legibility, reduced inappropriate human error variation and abolished the use of abbreviations and medical jargon. When used as part of an extended consent process, the authors feel that the use of pre-printed but customizable consent forms improves legibility, completeness and consistency and also provides the ability to highlight those complications that are of particular importance for that patient to satisfy the new accepted standard in surgical consent.

  9. Inventory and Evaluation of Engineering Cultural Resources: Montgomery to Gadsden, Alabama Coosa River, Alabama,

    Science.gov (United States)

    1981-03-01

    to retain some of its aesthetic quality. Important bridges were also being constructed outside of France. The Westminister Bridge (1738-50) was built... Legislative Session. It was eventually to connect the waters of Mobile Bay with the Coosa River at Wetumpka, and eventually with the Tennessee. The project...Bridge Act of 1927 were important legislative aids. The state act resulted in the construction of fifteen major bridges, including the attractive

  10. Final Environmental Assessment For Proposed Family Campground Expansion Maxwell Air Force Base, Montgomery County, Alabama

    Science.gov (United States)

    2013-03-27

    during Final EA preparation. Providing private address information with your comment is voluntary and such personal information will be kept confidential ...commercially available. 4.2 Commercial kitchen appliances shall be either ENERGY STAR®, FEMP designated or qualified for California Utilities Rebate Program... kitchen pre-rinse spray valves (PRSV) with low flow nozzles) i. Install or convert to only ENERGY STAR® Commercial Dishwashers j. Install or convert to

  11. The compleat lawyer - medical law as practical reasoning : doctrine, empiricism, and engagement / Jonathan Montgomery

    Index Scriptorium Estoniae

    Montgomery, Jonathan

    2012-01-01

    Ajakirjanumber on pühendatud briti meditsiiniõiguse professori Margaret Brazieri töödele ja tegevusele erinevatelt teemadel: patsiendi õigused meditsiiniliste otsuste langetamiseks, asendusemadus, biomeditsiin ja loote õiguslikust staatusest, abordist ja vastavast seadusandlusest Hispaanias, patsiendi autonoomiast

  12. Architect of Union Victory? Montgomery Meigs, Jomini, and Union Success in the American Civil War

    Science.gov (United States)

    2012-04-23

    Floyd, ultimately caused Captain Meigs to be “exiled” to the Tortugas in Florida.20 16 Russell F...Washington for the Tortugas late in 1860. There was a great deal of unrest as he travelled through the south to Florida. As he was settling into Fort

  13. Environmental Assessment for Proposed Demolition and Consolidation, Maxwell Air Force Base, Montgomery County, Alabama

    Science.gov (United States)

    2013-09-01

    51 3.11.2.2 SANITARY SEWER ...............................................................51 3.11.2.3 ELECTRICITY...72 4.2.11.2 SANITARY SEWER ...............................................................73 4.2.11.3...loam or sandy clay soils. The majority of the installation consists of the Amite-Cahaba association which is deep, well-drained, fine sandy loam

  14. Maxwell AFB, Montgomery, Alabama. Revised Uniform Summary of Surface Weather Observations (RUSSWO)

    Science.gov (United States)

    1974-09-19

    VISION GAS . MAY 00-02 09 3,8 90 3,8 499 7,7 .1 11.6 3150 ___03.05, 1.1 4,0 1__ __ 4t, 15t6 139, *1 24#7 3188 0o.o13l ,5 397 __ 3t7 10,8 17,6 1__ 1 2497...WINDDIRECTION AND SPEED i (FROM HOURLY OBSERVATIONS) i ( ..1AXWELL AF B A-AA/HMM15C)MIRY 37m,72 sr-P STA TIONl STATIO lolUNK Tgllil "Ol N CLADA NOPAll (IS T

  15. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  16. Computer‐Assisted Library Instruction and Face‐to‐Face Library Instruction Prove Equally Effective for Teaching Basic Library Skills in Academic Libraries. A review of: Zhang, Li, Watson, Erin M. and Banfield, Laura. ʺThe Efficacy of Computer‐Assisted Instruction Versus Face‐to‐Face Instruction in Academic Libraries: A Systematic Review.ʺ The Journal of Academic Librarianship 33.4 (July 2007: 478‐484.

    Directory of Open Access Journals (Sweden)

    Stephanie Walker

    2008-03-01

    , and case studies, with a sample size greater than one and with pre‐ and post‐test measurements;study participants had to be academic library patrons; the study needed to compare CAI and face‐to‐face instruction; and both the students’ information skills and reactions to the instruction had to be measured. This left 40 unique studies, which were then retrieved in full text. Next, studies were selected to meet the inclusion criteria further using the QUOROM format, a reporting structure used for improving the quality of reports of meta‐analyses of randomised trials (Moher et al 1896‐1900. Evaluation of methodological quality was then done using a dual method: authors Watson and Zhang assessed the studies independently, each using the “Checklist for Study Quality” developed by Downs and Black (Downs and Black 377‐384, adapted slightly to remove non‐relevant questions. After analysis, when additional information was needed, original study authors werecontacted. Finally, ten studies were included in the analysis.The instruction sessions covered many topics, such as catalog use, reading citations, awareness of library services and collections, basic searching of bibliographic databases, and more. But all could qualify as basic, rather than advanced, library instruction. All studies did pre‐ and posttests of students’ skills – some immediatelyafter instruction, and others with a time lapse of up to six weeks. Most authors created their own tests, though one adapted an existing scale. Individual performance improvement was not studied in many cases due to privacy concerns.Main Results ‐ Nine of the ten studies found CAI and face‐to‐face instruction equally effective; the tenth study found face to‐face instruction more effective. The students’ reaction to instruction methods varied – some students felt more satisfied with face‐to‐face instruction and felt that they learned better, while other studies found that students receiving CAI

  17. Anger and Approach: Reply to Watson (2009) and to Tomarken and Zald (2009)

    Science.gov (United States)

    Carver, Charles S.; Harmon-Jones, Eddie

    2009-01-01

    C. S. Carver and E. Harmon-Jones reviewed evidence consistent with the idea that anger arises from a behavioral approach system. Commentary on that article by A. J. Tomarken and D. H. Zald raised questions about the many elements involved in acts of approach and limitations on what information can be provided by electroencephalograms. Commentary…

  18. Determining Baseline Emissions at Mississippi Power Company's Watson Electric Generating Station

    Science.gov (United States)

    This document may be of assistance in applying the New Source Review (NSR) air permitting regulations including the Prevention of Significant Deterioration (PSD) requirements. This document is part of the NSR Policy and Guidance Database. Some documents in the database are a scanned or retyped version of a paper photocopy of the original. Although we have taken considerable effort to quality assure the documents, some may contain typographical errors. Contact the office that issued the document if you need a copy of the original.

  19. Finding Superman & Global Competitiveness: A Conversation with Arthur Levine & Watson Scott Swail. Policy Perspectives

    Science.gov (United States)

    Levine, Arthur; Swail, Watson Scott

    2014-01-01

    On March 21 2013, the "Educational Policy Institute" held the first day of the EPI Forum on Education & the Economy in Orlando, Florida. The Forum was designed to discuss critical issues related to the nexus of education and the workforce. This document presents the transcribed session that featured two of the authors of the Teachers…

  20. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  1. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  2. Moving beyond Watson-Crick models of coarse grained DNA dynamics.

    Science.gov (United States)

    Linak, Margaret C; Tourdot, Richard; Dorfman, Kevin D

    2011-11-28

    DNA produces a wide range of structures in addition to the canonical B-form of double-stranded DNA. Some of these structures are stabilized by Hoogsteen bonds. We developed an experimentally parameterized, coarse-grained model that incorporates such bonds. The model reproduces many of the microscopic features of double-stranded DNA and captures the experimental melting curves for a number of short DNA hairpins, even when the open state forms complicated secondary structures. We demonstrate the utility of the model by simulating the folding of a thrombin aptamer, which contains G-quartets, and strand invasion during triplex formation. Our results highlight the importance of including Hoogsteen bonding in coarse-grained models of DNA.

  3. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  4. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  5. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  6. Molecular moment similarity between several nucleoside analogs of thymidine and thymidine. sil@watson.ibm.com.

    Science.gov (United States)

    Silverman, B D; Pitman, M C; Platt, D E

    1999-06-01

    Molecular moment descriptors of the shape and charge distributions of twenty five nucleoside structures have been examined. The structures include thymidine as well as the difluorotoluene nucleoside analog which has been found to pair efficiently with adenine by polymerase catalysis. The remaining twenty three structures have been chosen to be as structurally similar to thymidine and to the difluorotoluene nucleoside analog as possible. The moment descriptors which include a description of the relationship of molecular charge to shape show the difluorotoluene nucleoside to be one of the most proximate molecules to thymidine in the space of the molecular moments. The calculations, therefore, suggest that polymerase specificity might be not only a consequence of molecular steric features alone but also of the molecular electrostatic environment and its registration with molecular shape.

  7. E.L.C. Watson se pionierstog deur Suid-Afrika (1912) | van der ...

    African Journals Online (AJOL)

    In the light of the Victorian era with all its restrictions, this new freedom of movement was very alluring. The motorcycle evolved out of the bicycle. Following the first Isle of Man TT (Tourist Trophy) in 1907, there was no stopping the popularity of the motorcycle. This influence was felt even in South Africa. It was in this zeitgeist ...

  8. [Sherlock Holmes, Watson and cocaine. A literary contribution to the history of drug addiction].

    Science.gov (United States)

    Fouassier, E

    1994-01-01

    From 1887 to 1927, Conan Doyle devoted fifty-six short stories and four novels to the extraordinary investigations of Sherlock Holmes. Special passages from these works, gathered here in the form of long extracts, evoke the passion of the celebrated detective for cocaine and constitute rather generally an original sort of evidence on the emergence of drug addicts in Europe at the end of the 19th century.

  9. The development of a spiritual wellness framework for the work context / Francois Gerald Watson

    OpenAIRE

    Watson, Francois Gerald

    2007-01-01

    Today's organisations are faced with changes such as increased competition and technological changes, not to mention the impact of globalisation on South African organisations. In a sense, the 21" century brought forth a more positive outlook and is described by some as the century of fortegenic living and wellness. Organisations today are searching for programmes that support strengths and wellness, as opposed to the historic employee assistance programmes. Spiritual wellness ...

  10. VizieR Online Data Catalog: AAVSO International Variable Star Index VSX (Watson+, 2006-2014)

    Science.gov (United States)

    Watson, C.; Henden, A. A.; Price, A.

    2018-05-01

    This file contains Galactic stars known or suspected to be variable. It lists all stars that have an entry in the AAVSO International Variable Star Index (VSX; http://www.aavso.org/vsx). The database consisted initially of the General Catalogue of Variable Stars (GCVS) and the New Catalogue of Suspected Variables (NSV) and was then supplemented with a large number of variable star catalogues, as well as individual variable star discoveries or variables found in the literature. Effort has also been invested to update the entries with the latest information regarding position, type and period and to remove duplicates. The VSX database is being continually updated and maintained. For historical reasons some objects outside of the Galaxy have been included. (3 data files).

  11. The practice of nurses caring for families of pediatric inpatients in light of Jean Watson

    Directory of Open Access Journals (Sweden)

    Maiara Rodrigues dos Santos

    2014-08-01

    Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.

  12. Geographic List of Prime Contract Awards. Oct 92-Sep 93. FY 93. (Amos, Kentucky-Montgomery County, Maryland). Part 6

    Science.gov (United States)

    1994-03-01

    r 11 c I0-eJI C1 31 00000P0) 0 (icc C) Cr) M 0 W( D(DE DW D0)o I o0)0 II.’I1)cc jinI 11 ) C\\LC\\m NA NI C111 Mr (’*4 Y MCJMMMMM (nr (YiC ) (ici MCici...0 00 0 0 III0-Ic14򒰌 OW 000 00 00 000 00 00 000> 00 0 00 11 1 l-4N II 1 N N, NN N 4 N NNN > II 10-i- 11 >- z co11111 - I\\ jINI ,-t 0 11 N N 00 Nc 4ɚ...I 0011C U.L 11 c I caoc II 00 11 E I Gao 0r, 1 -- -I .- ---- -- - - - - - - -- ----- 114- I COLD4l II 000000000000000000000000000000000000000000 00 1

  13. 76 FR 71125 - Caddo Valley Railroad Company-Abandonment Exemption-in Clark, Pike, and Montgomery Counties, AR

    Science.gov (United States)

    2011-11-16

    ... Abandonments to abandon the portion of the Norman Branch Line extending between milepost 447, near Antoine, to... feeder line statute at 49 U.S.C. 10907. See Caddo Antoine & Little Mo. R.R.--Feeder Line Acquis.--Ark...

  14. 78 FR 61871 - Grenada Railway, LLC-Rail Line in Grenada, Montgomery, Carroll, Holmes, Yazoo and Madison...

    Science.gov (United States)

    2013-10-04

    ... the Surface Transportation Board will hold a public meeting concerning the rail line embargo at issue... the effects of the embargo. DATES: Date/Location: The public meeting will take place on Friday... lawfulness of an embargo GRYR imposed on a portion of the Line in 2011.\\1\\ In doing so, the Board directed...

  15. Bringing Black History Home: Oral Sketches of the Black Experience from Africa to Montgomery to Bedford-Stuyvesant.

    Science.gov (United States)

    Levine, Richard

    This guide describes how to implement an interdisciplinary black history project designed to explore black experiences through a combination of personal anecdotes and text research. The program was designed by a teacher at Satellite East Junior High School in Brooklyn (New York). An introduction gives an overview of the structure and aims of the…

  16. 75 FR 6613 - Endangered and Threatened Wildlife and Plants; Listing with Designation of Critical Habitat for...

    Science.gov (United States)

    2010-02-10

    ... University Montgomery, 7440 East Drive, Montgomery, Alabama, at the Taylor Center in conference room 223... Auburn University Montgomery, Taylor Center-conference room 223, 7440 East Drive, Montgomery, Alabama. We...

  17. Concrete quality assurance

    Energy Technology Data Exchange (ETDEWEB)

    Holz, N. [Harza Engineering Company, Chicago, IL (United States)

    2000-08-01

    This short article reports on progress at the world's largest civil construction project, namely China's Three Gorges hydro project. Work goes on around the clock to put in place nearly 28 M m{sup 3} of concrete. At every stage of the work there is strong emphasis on quality assurance (QA) and concrete is no exception. The US company Harza Engineering has been providing QA since the mid-1980s and concrete QA has been based on international standards. Harza personnel work in the field with supervisors developing educational tools for supervising concrete construction and quality, as well as providing training courses in concrete technology. Some details on flood control, capacity, water quality and environmental aspects are given..

  18. Capturing Student Mathematical Engagement through Differently Enacted Classroom Practices: Applying a Modification of Watson's Analytical Tool

    Science.gov (United States)

    Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

    2018-01-01

    This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms…

  19. Orbital interactions and charge redistribution in weak hydrogen bonds: The Watson-Crick AT mimic adenine-2,4-difluorotoluene

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.

    2003-01-01

    An overview is given of results that reestablish hydrogen bonding as an essential factor in DNA replication involving natural bases as well as less polar mimics and they also confirm the importance of steric factors, in line with Kool's experimental work. In addition they show that knowledge of the

  20. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    Science.gov (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  1. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  3. DNA before Watson & Crick-The Pioneering Studies of J. M. Gulland and D. O. Jordan at Nottingham

    Science.gov (United States)

    Booth, Harold; Hey, Michael J.

    1996-10-01

    A description placed in a historical context, of the physico-chemical investigations of DNA carried out in the period 1940-1950 by a group at University College, Nottingham led by J.M.Gulland and D.O.Jordan. The isolation of a pure sample of DNA from calf thymus was followed by its analysis by potentiometric titrations and by measurements at variable pH of viscosity and streaming birefringence. Unlike the phosphoric acid groups, the primary amino and enolic hydroxyl groups could only be titrated after prior treatment with strong acid or strong base. The conclusion of Gulland and Jordan, that extremes of pH caused liberation of amino and enolic hydoxyl groups by disruption of hydrogen bonds between neighbouring polynucleotide chains, proved to be of considerable importance. The article includes life histories of Gulland and Jordan, and reference to Linus Pauling's remarkable foresight during his Sir Jesse Boot Foundation Lecture delivered at Nottingham in 1948.

  4. Effective Lagrangians, Watson's theorem and the E2/M1 mixing ratio in the excitation of the Delta resonance

    International Nuclear Information System (INIS)

    Davidson, R.M.

    1992-01-01

    The author investigates theoretical uncertainties and model dependence in the extraction of the nucleon-delta(1232) electromagnetic transition amplitudes from the multipole data base. The starting point is an effective Lagrangian incorporating chiral symmetry, which includes at the tree level the pseudovector Born terms, leading t-channel vector meson exchanges, and s and u channel delta exchanges. The nucleon-delta magnetic dipole (M1) and electric quadrupole (E2) transition amplitudes are expressed in terms of two independent gauge couplings at the γNΔ vertex. After unitarizing the tree level amplitude, the gauge couplings are fitted to various multipole data sets, thus determining E2 and M1. Although there is much sensitivity to the method used to unitarize the amplitude, the author extracts the E2/M1 ratio to be negative, with a magnitude around 1.5%. 11 refs., 3 figs

  5. Elizabeth Shove, Mika Pantzar, Matt Watson, The Dynamics of Social Practice. Everyday Life and how it Changes

    OpenAIRE

    Ortar, Nathalie

    2012-01-01

    The dynamics of social practice s’inscrit dans une filiation qui marque depuis quelques années le paysage de la recherche de la sociologie de la consommation et de l’énergie. Son ambition est à la hauteur de l’importance prise par ces travaux puisque les auteurs souhaitent faire une différence grâce à la théorisation sociale pour influer sur les politiques publiques. L’ouvrage se veut également une critique de la théorie des choix rationnels et s’applique à démontrer pourquoi cette théorie es...

  6. 77 FR 64515 - Watson Pharmaceuticals, Inc., Actavis Inc., Actavis Pharma Holding 4 ehf., and Actavis S.a.r.l...

    Science.gov (United States)

    2012-10-22

    ... resulting from Parkinson's disease. Novartis markets branded Exelon in the United States. Currently, there... Pharma Holding 4 ehf., and Actavis S.a.r.l.; Analysis of Agreement Containing Consent Orders To Aid... agreement in this matter settles alleged violations of federal law prohibiting unfair or deceptive acts or...

  7. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  8. Crime

    Data.gov (United States)

    Montgomery County of Maryland — Updated daily postings on Montgomery County’s open data website, dataMontgomery, provide the public with direct access to crime statistic databases - including raw...

  9. Crash Reporting - Incidents Data

    Data.gov (United States)

    Montgomery County of Maryland — This dataset provides general information about each collision and details of all traffic collisions occurring on county and local roadways within Montgomery County,...

  10. General Outside Employment

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains all outside employment requests held by employees of Montgomery County (excluding uniformed police officer) approved by the Ethics Commission...

  11. County Spending

    Data.gov (United States)

    Montgomery County of Maryland — This dataset includes County spending data for Montgomery County government. It does not include agency spending. Data considered sensitive or confidential and will...

  12. OMB Recommended vs Approved Operating Budget

    Data.gov (United States)

    Montgomery County of Maryland — This dataset includes the Fiscal Year 2015 County Executive Recommended and County Council Approved operating budgets for Montgomery County, for comparison purposes....

  13. On the Pragmatic Functions of English Rhetoric in Public Speech: A Case Study of Emma Watson's "HeForShe"

    Science.gov (United States)

    Yuan, Bin

    2018-01-01

    The current research is mainly conducted to explore the pragmatic functions of English rhetoric in public speech. To do this, methods of close reading and case studies are adopted. The research first reveals that the boom of public speech programs helps reexamine the art of utterance, during the delivery of which English rhetoric plays an…

  14. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  15. Orbital interactions and charge redistribution in weak hydrogen bonds: Watson-Crick GC mimic involving C-H proton donor and F proton acceptor groups

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2006-01-01

    The discovery by Kool and coworkers that 2,4-difluorotoluene (F) mimics thymine (T) in DNA replication has led to controversy regarding the question of whether this mimic has the capability of forming hydrogen bonds with adenine (A). Recently, we have provided evidence for an important role of both

  16. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  17. The Importance of Short- and Long-Range Exchange on Various Excited State Properties of DNA Monomers, Stacked Complexes, and Watson-Crick Pairs.

    Science.gov (United States)

    Raeber, Alexandra E; Wong, Bryan M

    2015-05-12

    We present a detailed analysis of several time-dependent DFT (TD-DFT) methods, including conventional hybrid functionals and two types of nonempirically tuned range-separated functionals, for predicting a diverse set of electronic excitations in DNA nucleobase monomers and dimers. This large and extensive set of excitations comprises a total of 50 different transitions (for each tested DFT functional) that includes several n → π and π → π* valence excitations, long-range charge-transfer excitations, and extended Rydberg transitions (complete with benchmark calculations from high-level EOM-CCSD(T) methods). The presence of localized valence excitations as well as extreme long-range charge-transfer excitations in these systems poses a serious challenge for TD-DFT methods that allows us to assess the importance of both short- and long-range exchange contributions for simultaneously predicting all of these various transitions. In particular, we find that functionals that do not have both short- and full long-range exchange components are unable to predict the different types of nucleobase excitations with the same accuracy. Most importantly, the current study highlights the importance of both short-range exchange and a nonempirically tuned contribution of long-range exchange for accurately predicting the diverse excitations in these challenging nucleobase systems.

  18. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence binding properties in these recognition events. Subunit (1R,3R)-3-aminocyclopentanecarboxylic acid broadens our scope to design novel polyamides. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  20. Validación de dos escalas utilizadas en la medición del cuidado humano transpersonal basadas en la Teoría de Jean Watson

    Directory of Open Access Journals (Sweden)

    Margarita del Carmen Poblete-Troncoso

    2012-01-01

    Full Text Available Objetivo: validar Caring Efficacy Scale y Nyberg's Caring Assessment, elementos basados en la Teoría Transpersonal del Cuidado Humano que se fundamenta en los aspectos humanos y éticos del cuidado. Método: los instrumentos fueron validados en una muestra de 360 enfermeras chilenas. Los coeficientes de alfa de Cronbach fueron de 0,76 para Caring Efficacy Scale, y de 0,82 para el Nyberg's Caring Assessment. En cuanto a la validez de constructo ambos instrumentos se correlacionan positiva y significativamente. Resultados: se pondera divergencia como estrategia de esta validez en ambos instrumentos y se utiliza una subescala que evalúa la falta de empatía con el sufrimiento del otro. Conclusión: la validación de estas escalas es un aporte al cuidado humano transpersonal, para conocer el significado que las enfermeras le otorgan, y cuán eficaces se sienten, así cómo remediar aspectos deficitarios en la enseñanza y práctica del cuidado.

  1. Texture and diet related behavior: a focus on satiation and satiety. Handbook of Behavior, Food and Nutrition, Part 2 Preedy VR, Watson RR, Martin CR 133-142

    NARCIS (Netherlands)

    Stafleu, A.; Zijlstra, N.; Hogenkamp, P.; Mars, M.

    2011-01-01

    In view of the increasing numbers in overweight and obesity, insight in food intake regulation is necessary. Food intake is regulated by sensory, cognitive, post-ingestive, and post-absorptive processes. Food properties, such as energy density, macronutrient composition, volume, and form, influence

  2. Simulation of aquifer tests and ground-water flowpaths at the local scale in fractured shales and sandstones of the Brunswick Group and Lockatong Formation, Lansdale, Montgomery County, Pennsylvania

    Science.gov (United States)

    Goode, Daniel J.; Senior, Lisa A.

    2000-01-01

    The U.S. Geological Survey, as part of technical assistance to the U.S. Environmental Protection Agency, has constructed and calibrated models of local-scale ground-water flow in and near Lansdale, Pa., where numerous sources of industrial contamination have been consolidated into the North Penn Area 6 Superfund Site. The local-scale models incorporate hydrogeologic structure of northwest-dipping beds with uniform hydraulic properties identified in previous studies. Computations associated with mapping the dipping-bed structure into the three-dimensional model grid are handled by a preprocessor using a programmed geographic information system (GIS). Hydraulic properties are identified by calibration of the models using measured water levels during pumping and recovery from aquifer tests at three sites. Reduced flow across low-permeability beds is explicitly simulated. The dipping high-permeability beds are extensive in the strike direction but are of limited extent in the dip direction. This model structure yields ground-water-flow patterns characteristic of anisotropic aquifers; preferred flow is in the strike direction. The transmissivities of high-permeability beds in the local-scale models range from 142 to 1,900 ft2/d (feet squared per day) (13 to 177 m2/d). The hydraulic conductivities of low-permeability parts of the aquifer range from 9.6 x 10-4 to 0.26 ft/d (feet per day) (2.9 x 10-4 to 0.079 m/d). Storage coefficients and specific storage are very low, indicating the confined nature of the aquifer system. The calibrated models are used to simulate contributing areas of wells under alternative, hypothetical ground-water-management practices. Predictive contributing areas indicate the general characteristics of ground-water flow towards wells in the Lansdale area. Recharge to wells in Lansdale generally comes from infiltration near the well and over an area that extends upgradient from the well. The contributing areas for two wells pumping at 10 gal/min (gallons per minute) extend about 1,500 ft (feet) upgradient from the wells. The contributing area is more complex at ground-water divides and can extend in more than one direction to capture recharge from more than 3,300 ft away, for pumping at a rate of 30 gal/min. Locally, all recharge in the area of the pumping well is not captured; recharge in the downgradient direction about 150 ft from the pumping well will flow to other discharge locations.

  3. National Research Council, 2003, Cities Transformed. Demographic Change and its Implications in the Developing World. Panel on Urban Population Dynamics, M. Montgomery, R. Stren, B. Cohen. and H. Reed (eds.), Committee on Population, Division of

    OpenAIRE

    Thomas, Isabelle

    2004-01-01

    Telle est exactement la manière officielle de citer l’ouvrage (p. ii).  Il s’agit en fait d’un support papier très court (un résumé de 6 pages accompagné d’une table de matières et de quelques avant-propos) accompagné d’un CD-rom sur lequel se trouve le livre.  L’ouvrage est composé de 10 chapitres et d’une série d’annexes, chaque chapitre constituant un fichier en format pdf, à consulter indépendamment, sans aucun lien  hypertexte.  Cette forme surprend un peu : pourquoi ne pas avoir envisag...

  4. 76 FR 30934 - Combined Notice of Filings #1

    Science.gov (United States)

    2011-05-27

    ... 19, 2011. Docket Numbers: EC11-84-000. Applicants: Montgomery L'Energia Power Partners LP, Tanner... Montgomery L'Energia Power Partners LP, et. al. Filed Date: 05/23/2011. Accession Number: 20110523-5016...

  5. 76 FR 54754 - Combined Notice of Filings #1

    Science.gov (United States)

    2011-09-02

    ...: Montgomery L'Energia Power Partners LP. Description: Notice of Cancellation of FERC Electric Rate Schedule Tariff of Montgomery L'Energia Power Partners LP. Filed Date: 08/24/2011. Accession Number: 20110824-5095...

  6. Daily Arrests

    Data.gov (United States)

    Montgomery County of Maryland — This dataset provides the public with arrest information from the Montgomery County Central Processing Unit (CPU) systems. The data presented is derived from every...

  7. Geographic data: Zip Codes (Shape File)

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains all zip codes in Montgomery County. Zip codes are the postal delivery areas defined by USPS. Zip codes with mailboxes only are not included. As...

  8. Fiscal Year 2015 Budget

    Data.gov (United States)

    Montgomery County of Maryland — This dataset includes the Fiscal Year 2015 Council-approved operating budget for Montgomery County. The dataset does not include revenues and detailed agency budget...

  9. Road Closures

    Data.gov (United States)

    Montgomery County of Maryland — This is an up to date map of current road closures in Montgomery County.This dataset is updated every few minutes from the Department of Transportation road closure...

  10. Employee Travel Data (Non-Local)

    Data.gov (United States)

    Montgomery County of Maryland — ‘This dataset provides information regarding the total approved actual expenses incurred by Montgomery County government employees traveling non-locally (over 75...

  11. Comment on "Relating side chain organization of PNIPAm with its conformation in aqueous methanol" by D. Mukherji, M. Wagner, M. D. Watson, S. Winzen, T. E. de Oliveira, C. M. Marques and K. Kremer, Soft Matter, 2016, 12, 7995.

    Science.gov (United States)

    Pica, Andrea; Graziano, Giuseppe

    2017-11-01

    In a recent article, Kremer and co-workers have combined NMR measurements and very long, all-atom MD simulations to strengthen their original claim that PNIPAM cononsolvency in water-methanol solutions is driven by the ability of MeOH molecules to bridge different monomers far away along the polymeric chain. In this comment, the results presented by Kremer and co-workers are reviewed, analyzed, and questioned regarding their ability to provide support to the bridging mechanism. Here, some pieces of evidence are provided to show that: (1) the solvent-excluded volume effect plays always a fundamental role in polymer collapse; (2) PNIPAM cononsolvency is caused by the geometric-energetic frustration experienced by the polymer when it can interact with both water and methanol molecules at the same time.

  12. L'évolution des valeurs de soin humain : une analyse dialectique de la proposition d'humanisation de Watson à la lumière d'une perspective nietzschéenne

    OpenAIRE

    Krol, Pawel

    2014-01-01

    La pratique du soin infirmier d’aujourd’hui hérite d’une longue et complexe évolution de valeurs. Outre les valeurs traditionnellement humaines de soigner, la pratique infirmière d’aujourd’hui intègre aussi des valeurs qui façonnent notre monde moderne. Ainsi, nous retraçons d’abord l’évolution de quelques-unes des valeurs traditionnelles rattachées au soin humain conservées dans les pratiques infirmières. Puis, nous montrons que certaines valeurs traditionnelles de soin humain sont progressi...

  13. Is the DPT tautomerization of the long A·G Watson-Crick DNA base mispair a source of the adenine and guanine mutagenic tautomers? A QM and QTAIM response to the biologically important question.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2014-03-05

    Herein, we first address the question posed in the title by establishing the tautomerization trajectory via the double proton transfer of the adenine·guanine (A·G) DNA base mispair formed by the canonical tautomers of the A and G bases into the A*·G* DNA base mispair, involving mutagenic tautomers, with the use of the quantum-mechanical calculations and quantum theory of atoms in molecules (QTAIM). It was detected that the A·G ↔ A*·G* tautomerization proceeds through the asynchronous concerted mechanism. It was revealed that the A·G base mispair is stabilized by the N6H···O6 (5.68) and N1H···N1 (6.51) hydrogen bonds (H-bonds) and the N2H···HC2 dihydrogen bond (DH-bond) (0.68 kcal·mol(-1) ), whereas the A*·G* base mispair-by the O6H···N6 (10.88), N1H···N1 (7.01) and C2H···N2 H-bonds (0.42 kcal·mol(-1) ). The N2H···HC2 DH-bond smoothly and without bifurcation transforms into the C2H···N2 H-bond at the IRC = -10.07 Bohr in the course of the A·G ↔ A*·G* tautomerization. Using the sweeps of the energies of the intermolecular H-bonds, it was observed that the N6H···O6 H-bond is anticooperative to the two others-N1H···N1 and N2H···HC2 in the A·G base mispair, while the latters are significantly cooperative, mutually strengthening each other. In opposite, all three O6H···N6, N1H···N1, and C2H···N2 H-bonds are cooperative in the A*·G* base mispair. All in all, we established the dynamical instability of the А*·G* base mispair with a short lifetime (4.83·10(-14) s), enabling it not to be deemed feasible source of the A* and G* mutagenic tautomers of the DNA bases. The small lifetime of the А*·G* base mispair is predetermined by the negative value of the Gibbs free energy for the A*·G* → A·G transition. Moreover, all of the six low-frequency intermolecular vibrations cannot develop during this lifetime that additionally confirms the aforementioned results. Thus, the A*·G* base mispair cannot be considered as a source of the mutagenic tautomers of the DNA bases, as the A·G base mispair dissociates during DNA replication exceptionally into the A and G monomers in the canonical tautomeric form. Copyright © 2013 Wiley Periodicals, Inc.

  14. An in situ study of growth of Lemongrass Cymbopogon flexuosus (Nees ex Steud.) W. Watson on varying concentration of Chromium (Cr+6) on soil and its bioaccumulation: Perspectives on phytoremediation potential and phytostabilisation of chromium toxicity.

    Science.gov (United States)

    Patra, Deepak Kumar; Pradhan, Chinmay; Patra, Hemanta Kumar

    2018-02-01

    Chromium (Cr) contamination in soil is a growing concern in sustainable agricultural production and food safety. Remediation of Cr from contaminated soils is a challenging task which may not only help in sustaining agriculture but also in minimizing adverse environmental impacts. Pot culture experiments were performed with the application of varied concentration of Cr +6 to assess the Chromium accumulation potential of Lemongrass and to study the impact of toxic concentration of Cr +6 on morphological, physiological and biochemical parameters of the plant. The results showed an increasing accumulation trend of Chromium with increasing Chromium concentrations in both root and shoot of 60 days old Lemongrass plants, while the protein and chlorophyll contents decreased. Similarly, accumulation of Cr increased the levels of proline and antioxidant enzymes indicating the enhanced damage control activity. The potentiality of the plant with the capacity to accumulate and stabilize Cr compound in Cr contaminated soil by phytoremediation process has been explored in the present investigation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Algumas considerações sobre o fazer científico realizadas a partir da análise dos modelos de ciência propostos por Taylor, Wundt e Watson

    Directory of Open Access Journals (Sweden)

    Bruno Alvarenga Ribeiro

    Full Text Available A história das ciências como um todo, incluindo a história das ciências humanas e, particularmente, a história da Psicologia, nos presenteia com exemplos de como às vezes o fazer científico é restringido aos lugares comuns da metodologia. Dessa forma, o objetivo deste artigo é refletir sobre a crença de que a ciência é o próprio método que ela utiliza, demonstrando que metodologias particulares decorrem da adoção de determinados pressupostos filosóficos também particulares, que podem levar o fazer científico a algumas incorreções, nem sempre refutáveis por questões de lógica.

  16. Engineering hydro's future

    International Nuclear Information System (INIS)

    Anderson, J.L.

    1992-01-01

    In this challenging hydropower market, hydropower engineering services are in high demand. The number of new hydropower projects entering the pipeline may have slowed in recent years but that does not mean work is not being done. Independent developers, utilities and municipalities are carrying out a considerable amount of hydropower activity. Whatever the work involves - preliminary planning, licensing and relicensing, environmental mitigation, plant rehabilitation or new-plant startup - engineering firms are finding a brisk market for their services. The complexity of the regulatory framework makes hydropower facility and other water resource work more important then ever. Executives of three engineering firms - Acres International, Harza Engineering and Black and Veatch - active in these areas discuss their views on the future of the hydropower engineering market

  17. Facelift for Romanian hydro

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2000-09-01

    The Siriu-Nehoiasu and the Ciresu-Surduc-Nehoiasu hydroelectric projects in central Romania are described. At both sites, construction work began in 1983 but funding ran out in 1994 before completion; what was achieved up to that point is described. In 1999, Hidroelectrica linked up with Harza Engineering of Romania who did a detailed review and optimization study of both schemes and formulated a plan to make completion attractive for the private sector in the new market-orientated economy. In June 2000, the two companies reached an agreement to complete construction at both sites through a jointly-owned special purpose company. Construction is expected to begin in 2001 with completion in April 2004. The differences between the new optimized schemes and the originals are given. Financing is expected to be an equal split between the state and investors under a BOT structure. The scheme at Ciresu-Surduc-Nehoiasu will provide the added benefit of reducing annual flood damage.

  18. On Fair Lotteries

    OpenAIRE

    STONE, PETER

    2008-01-01

    PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

  19. Sleeping under the stars

    Science.gov (United States)

    Zirkel, Jack

    Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

  20. Why Was General Richard O’Connor’s Command in Northwest Europe Less Effective Than Expected?

    Science.gov (United States)

    2011-03-01

    Commander of 7 Division and Military Governor of Jerusalem , September 1938- August 1939. ______. Papers of General Sir Richard O’Connor KT, GCB, DSO, MC...Montgomery, Brian. A Field Marshall in the Family: A Personal Biography of Montgomery of Alamein. New York: Taplinger, 1973. Montgomery, Field...Commanders: A Composite Biography . Combat Studies Institute publications, Fort Leavenworth, Kansas: U.S. Army Command and General Staff College, 1989

  1. Airway Clearance Techniques (ACTs)

    Medline Plus

    Full Text Available ... Autogenic Drainage Positive Expiratory Pressure High-Frequency Chest Wall Oscillation (the Vest) ... Cystic Fibrosis Foundation 4550 Montgomery Ave. Suite 1100 N Bethesda, MD ...

  2. 78 FR 25755 - Announcement of Funding Awards; Energy Innovation Fund-Multifamily Pilot Program Fiscal Year 2010

    Science.gov (United States)

    2013-05-02

    ... Community Place, 7441. Cecil, Frederick, Crownsville, MD 21032. Hartford, Howard, Montgomery, Prince George... Greater Portland, OR 1020 SW Taylor, Suite 585, Portland, 5680. metropolitan area. Oregon 97205. NRG...

  3. 77 FR 16316 - Kentucky Disaster Number KY-00044

    Science.gov (United States)

    2012-03-20

    ... Counties: (Physical Damage and Economic Injury Loans): Bath, Campbell, Carroll, Grant, Martin, Montgomery... Assistance Numbers 59002 and 59008) Joseph P. Loddo, Acting Associate Administrator for Disaster Assistance...

  4. Recreation Summer Camps

    Data.gov (United States)

    Montgomery County of Maryland — List of all Camps (Register here:https://apm.activecommunities.com/montgomerycounty/Home) to include Aquatics, Basketball, Soccer, Special Interest, General Sports,...

  5. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University of Illinois Chicago, Center of Excellence in ...

  6. 76 FR 59177 - New York Disaster #NY-00110

    Science.gov (United States)

    2011-09-23

    ... York: Chemung, Cortland, Greene, Herkimer, Madison, Montgomery, Oneida, Schoharie, Sullivan, Tompkins... Federal Domestic Assistance Numbers 59002 and 59008) James E. Rivera, Associate Administrator for Disaster...

  7. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

  8. Internal Affairs Allegations

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains allegations brought to the attention of the Internal Affairs Division either through external complaints or internal complaint or recognition....

  9. DEP Reported Sanitary Sewer Overflows

    Data.gov (United States)

    Montgomery County of Maryland — Sanitary sewer overflows reported to the Department of Environmental Protection by the Washington Suburban Sanitary Commission or individuals in the County. Update...

  10. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University of Illinois Chicago, Center of ...

  11. Commentary on "a matched comparison of perioperative outcomes of a single laparoscopic surgeon versus a multisurgeon robot-assisted cohort for partial nephrectomy." Ellison JS, Montgomery JS, Wolf Jr JS, Hafez KS, Miller DC, Weizer AZ, Department of Urology, University of Michigan, Ann Arbor, MI, USA: J Urol 2012;188(1):45-50.

    Science.gov (United States)

    Kane, Christopher

    2013-02-01

    Minimally invasive nephron sparing surgery is gaining popularity for small renal masses. Few groups have evaluated robot-assisted partial nephrectomy compared to other approaches using comparable patient populations. We present a matched pair analysis of a heterogeneous group of surgeons who performed robot-assisted partial nephrectomy and a single experienced laparoscopic surgeon who performed conventional laparoscopic partial nephrectomy. Perioperative outcomes and complications were compared. All 249 conventional laparoscopic and robot-assisted partial nephrectomy cases from January 2007 to June 2010 were reviewed from our prospectively maintained institutional database. Groups were matched 1:1 (108 matched pairs) by R.E.N.A.L. (radius, exophytic/endophytic properties, nearness of tumor to collecting system or sinus, anterior/posterior, location relative to polar lines) nephrometry score, transperitoneal vs retroperitoneal approach, patient age and hilar nature of the tumor. Statistical analysis was done to compare operative outcomes and complications. Matched analysis revealed that nephrometry score, age, gender, tumor side and American Society of Anesthesia physical status classification were similar. Operative time favored conventional laparoscopic partial nephrectomy. During the study period robot-assisted partial nephrectomy showed significant improvements in estimated blood loss and warm ischemia time compared to those of the experienced conventional laparoscopic group. Postoperative complication rates, and complication distributions by Clavien classification and type were similar for conventional laparoscopic and robot-assisted partial nephrectomy (41.7% and 35.0%, respectively). Robot-assisted partial nephrectomy has a noticeable but rapid learning curve. After it is overcome the robotic procedure results in perioperative outcomes similar to those achieved with conventional laparoscopic partial nephrectomy done by an experienced surgeon. Robot-assisted partial nephrectomy likely improves surgeon and patient accessibility to minimally invasive nephron sparing surgery. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. University Student and Faculty Opinions on Academic Integrity Are Informed by Social Practices or Personal Values, A Review of: Randall, Ken, Denise G. Bender and Diane M. Montgomery. “Determining the Opinions of Health Sciences Students and Faculty Regarding Academic Integrity.” International Journal for Educational Integrity 3.2 (2007): 27‐40.

    OpenAIRE

    Matthew Thomas

    2009-01-01

    Objective – To understand the opinions of students and faculty in physical therapy (PT) and occupational therapy (OT) regarding issues of academic integrity such as plagiarism and cheating.Design – Q method (a mixed method of qualitative data collection with application of quantitative methods to facilitate grouping and interpretation).Setting – An urban university‐affiliated health sciences facility in the mid‐western United States.Subjects – Thirty‐three students and five faculty members of...

  13. University Student and Faculty Opinions on Academic Integrity Are Informed by Social Practices or Personal Values, A Review of: Randall, Ken, Denise G. Bender and Diane M. Montgomery. “Determining the Opinions of Health Sciences Students and Faculty Regarding Academic Integrity.” International Journal for Educational Integrity 3.2 (2007: 27‐40.

    Directory of Open Access Journals (Sweden)

    Matthew Thomas

    2009-09-01

    Full Text Available Objective – To understand the opinions of students and faculty in physical therapy (PT and occupational therapy (OT regarding issues of academic integrity such as plagiarism and cheating.Design – Q method (a mixed method of qualitative data collection with application of quantitative methods to facilitate grouping and interpretation.Setting – An urban university‐affiliated health sciences facility in the mid‐western United States.Subjects – Thirty‐three students and five faculty members of ages 21 to 61 years, 30 associated with the physical therapy program and 8 with occupational therapy, including 6 males and 32 females.Methods – Initially, 300 opinion statements for, against, or neutral on the subject of academic integrity were gathered from journal articles, editorials and commentaries, Internet sites, and personal web logs, 36 of which were selected to represent a full spectrum of perspectives on the topic. Participants in the study performed a “Q‐sort” in which they ranked the 36 statements as more‐like or less‐like their own values. A correlation matrix was developed based on the participantsʹ rankings to create “factors” or groups of individuals with similar views. Two such groups were found and interpreted qualitatively to meaningfully describe the differing views of each group. Three participants could not be sorted into either group, being split between the factors. Main Results – Analysis of the two groups, using software specific to the Q method, revealed a good deal of consensus, particularly in being “most unlike” those statements in support of academic dishonesty. The two groups differed primarily in the motivation for academic honesty. Factor one, with 21 individuals, was labeled “Collective Integrity,” (CI being represented by socially oriented statements such as “I believe in being honest, true, virtuous, and in doing good to all people,” or “My goal is to help create a world where all people are treated with fairness, decency, and respect.” Factor two, with 14 individuals, was described as “Personal Integrity,” (PI, and focused on an internal sense of values and self‐modulation, identifying with statements like “Honour means having the courage to make difficult choices and accepting responsibility for actions and their consequences, even at personal cost.” There were also some demographic patterns in the results. Twenty of the 31 students, 20 of the 29 females, and 17 of the 25 participants aged 30 and under were in the CI group, while 3 of the 4 faculty were in PI. Males, occupational therapists, physical therapists, and those over the age of 30 did not belong clearly to one or the other group, having close to equal numbers in both.Conclusion – Given the two factors, CI and PI, this sample of OT and PT students and faculty can be seen to make academic decisions based on either what they believe society deems correct or what their own internal values tell them. The discovery that more females, students, and those 30 and under were associated with CI resonates with the some key claims in the literature, such as that younger individuals tend to have a more social outlook on academic integrity, or that womenʹs ethic of care is often focused on connections among people. Most importantly, students and faculty appear to share a notable degree of common ground as it relates to their opinions on academic integrity. Additional exploration and the continued use and development of policies promoting academic integrity is called for.

  14. 76 FR 21232 - Standard Instrument Approach Procedures, and Takeoff Minimums and Obstacle Departure Procedures...

    Science.gov (United States)

    2011-04-15

    ..., AL, Jack Edwards, ILS OR LOC RWY 27, Amdt 1 Gulf Shores, AL, Jack Edwards, RNAV (GPS) RWY 9, Amdt 3 Gulf Shores, AL, Jack Edwards, RNAV (GPS) RWY 27, Amdt 2 Montgomery, AL, Montgomery Rgnl (Dannelly... Williams Memorial, RNAV (GPS) RWY 24, Amdt 1 Vineyard Haven, MA, Marthas Vineyard, RNAV (GPS) RWY 6, Amdt 1...

  15. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    Science.gov (United States)

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  16. Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2010-10-01

    DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

  17. Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

    Science.gov (United States)

    2011-10-01

    or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

  18. Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

    Science.gov (United States)

    2010-03-01

    that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

  19. Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

    Science.gov (United States)

    2012-07-01

    like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

  20. Investigation of Nanophase Materials for Thermoelectric Applications

    National Research Council Canada - National Science Library

    Stokes, Kevin

    2004-01-01

    .... Watson Research Center. Our major accomplishments include the chemical synthesis of nanoparticles, nanorods and nanowires of lead chalcogenide, bismuth calcogenide and bismuth antimony materials...

  1. A report on the occurrence of Thraustochytrid species in Indian waters

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, S.; Raghukumar, C.

    Raghukumar Labyrinthuloidus minuta (Watson and Raper) Perkins, L. yorkensis, Perkins, Thraustochytrium aggregatum Ulken, T. motivum Goldstein, T. multirudimentale, Goldstein, T. striatum, Schneider, Schizochytrium mangrovei, Raghukumar and Ulkenia visurgensis...

  2. A Multi-center, Double-blind, Randomized Study, Comparing Clindamycin Phosphate Vaginal Cream 2% (Watson Laboratories, Inc.) to Clindesse® (Ther-Rx™, Clindamyin Phosphate Vaginal Cream 2%) and Both Active Treatments to a Placebo Control in the Treatment of Bacterial Vaginosis in Non-pregnant Women

    Science.gov (United States)

    2015-03-18

    BACTERIAL VAGINOSIS; Signs and Symptoms to be Evaluated and Recorded Include:; Vaginal Discharge: Color, Odor, and Consistency;; Vulvovaginal Itching and Irritation (Subjective): Absent, Mild, Moderate, or Severe; Vulvovaginal Inflammation (Objective): Absent, Mild, Moderate, or Severe.

  3. Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

    Science.gov (United States)

    Fukawa-Connelly, Timothy Patrick; Newton, Charlene

    2014-01-01

    Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

  4. Genetics by the Numbers

    Science.gov (United States)

    ... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

  5. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  6. Does Size Matter?

    Science.gov (United States)

    Watson, David

    2014-01-01

    In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

  7. Bringing Precision Medicine to Community Oncologists.

    Science.gov (United States)

    2017-01-01

    Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

  8. Music Technology and Musical Creativity: Making Connections

    Science.gov (United States)

    Thompson, Douglas Earl

    2012-01-01

    This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

  9. the use of research in protected area management in Madagascar

    African Journals Online (AJOL)

    they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

  10. Contemporary Danish book art

    DEFF Research Database (Denmark)

    Larsen, Poul Steen

    the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

  11. A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

    Science.gov (United States)

    Willis, Derek W.

    2010-01-01

    This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

  12. Educational Technologists: Leading Change for a New Paradigm of Education

    Science.gov (United States)

    Aslan, Sinem; Reigeluth, Charles M.

    2013-01-01

    The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

  13. 75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

    Science.gov (United States)

    2010-09-07

    ... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

  14. 78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

    Science.gov (United States)

    2013-01-31

    .... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

  15. Behaviorism

    Science.gov (United States)

    Moore, J.

    2011-01-01

    Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

  16. Monetary valuation of salinity impacts and microbial pollution in the Olifants Water Management Area, South Africa

    CSIR Research Space (South Africa)

    De Lange, Willem J

    2012-04-01

    Full Text Available , salmonellosis and typhoid fever (Department of Water Affairs and Forestry, 2001). A direct functional relationship exists between dysfunctional water and sanitation systems and a high risk of waterborne disease (Hinrichsen et al., 1997, Montgomery...

  17. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Services The Latino AIDS Agenda National Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

  18. Most Recent Sampling Results for Annex III Building

    Science.gov (United States)

    Contains email from Scott Miller, US EPA to Scott Kramer. Subject: Most Recent Sampling Results for Annex III Building. (2:52 PM) and Gore(TM) Surveys Analytical Results U.S. Geological Survey, Montgomery, AL.

  19. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University ...

  20. Quantum Groupoids Acting on Semiprime Algebras

    Directory of Open Access Journals (Sweden)

    Inês Borges

    2011-01-01

    Full Text Available Following Linchenko and Montgomery's arguments we show that the smash product of an involutive weak Hopf algebra and a semiprime module algebra, satisfying a polynomial identity, is semiprime.

  1. OCA Code Enforcement

    Data.gov (United States)

    Montgomery County of Maryland — The Office of the County Attorney (OCA) processes Code Violation Citations issued by County agencies. The citations can be viewed by issued department, issued date...

  2. Co-Occurring Disorders

    Science.gov (United States)

    ... the mental health field. Alcohol and Drug Abuse, Addiction and Co-occurring Disorders: Co-occurring Disorders and ... 500 Montgomery Street, Suite 820 Alexandria, VA 22314 Phone (703) 684.7722 Toll Free (800) 969.6642 ...

  3. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... groups of young people, guiding the use of technology, the discussion between friends, and the importance of ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

  4. Genetics Home Reference: Potocki-Shaffer syndrome

    Science.gov (United States)

    ... PubMed Central Montgomery ND, Turcott CM, Tepperberg JH, McDonald MT, Aylsworth AS. A 137-kb deletion within ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  5. 76 FR 70386 - Proposed Flood Elevation Determinations

    Science.gov (United States)

    2011-11-14

    ..., Alabama, and Incorporated Areas Audubon Ditch At the upstream side of +185 +184 City of Montgomery. Norman... available for inspection at 36535 Green Street, New Baltimore, MI 48047. Township of Chesterfield Maps are...

  6. Product Purchases by DLC

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains a list of items in case units by category and supplier that have been purchased by the Department of Liquor Control in the past month. Update...

  7. Airway Clearance Techniques (ACTs)

    Medline Plus

    Full Text Available ... Dr. William Skach Paul di Sant’Agnese Distinguished Scientific Achievement Award Quality Care Awards Richard C Talamo ... clinical trial that may be right for you. Search Trials CFF Homepage Cystic Fibrosis Foundation 4550 Montgomery ...

  8. Floodplain District Permit

    Data.gov (United States)

    Montgomery County of Maryland — The purpose of a Floodplain District Permit (FPDP) is to control floodplain development in order to protect persons and property from danger and destruction and to...

  9. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

  10. Water Quality Protection Charges

    Data.gov (United States)

    Montgomery County of Maryland — The Water Quality Protection Charge (WQPC) is a line item on your property tax bill. WQPC funds many of the County's clean water initiatives including: • Restoration...

  11. Real Property Tax Rates

    Data.gov (United States)

    Montgomery County of Maryland — The Levy Year 2012 real property tax rate dataset reflects all the rates per $100 set each year by the County Council. These rates are applied to the assessed value...

  12. Agricultural Producer Certificates

    Data.gov (United States)

    Montgomery County of Maryland — A Certified Agricultural Producer, or representative thereof, is an individual who wishes to sell regionally-grown products in the public right-of-way. A Certified...

  13. Capital Improvement Program (CIP) Project Status

    Data.gov (United States)

    Montgomery County of Maryland — This dataset includes pertinent information relating to a capital project’s status administered by the Department of Transportation and the Department of General...

  14. Building Homes, Building Careers.

    Science.gov (United States)

    Cohn, Meredith

    1987-01-01

    The Construction Trades Foundation, a nonprofit corporation of business, industry, and school leaders, provides high school students in Montgomery County, Maryland, with unique hands-on experiences in construction, home design, marketing, public relations, and other fields. (SK)

  15. Site Specific Vendor's License

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains information of a site-specific vendor's license which is required if an individual sells or offers to sell goods or services from a stationary...

  16. Stormwater Management Concept Information

    Data.gov (United States)

    Montgomery County of Maryland — A stormwater management concept is a statement or drawing, or both, describing the manner in which stormwater runoff from a proposed development will be controlled...

  17. 77 FR 65044 - Pennsylvania Disaster #PA-00054

    Science.gov (United States)

    2012-10-24

    ... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 13346 and 13347] Pennsylvania Disaster PA... Administrative declaration of a disaster for the Commonwealth of Pennsylvania dated 10/18/2012. Incident... adversely affected by the disaster: Primary Counties: Montgomery. Contiguous Counties: Pennsylvania: Berks...

  18. 75 FR 71486 - Pennsylvania Disaster # PA-00035

    Science.gov (United States)

    2010-11-23

    ... SMALL BUSINESS ADMINISTRATION [Disaster Declaration 12389 and 12390] Pennsylvania Disaster PA... Administrative declaration of a disaster for the Commonwealth of Pennsylvania dated 11/15/2010. Incident: Severe... the disaster: Primary Counties: Delaware. Contiguous Counties: Pennsylvania: Chester, Montgomery...

  19. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Advocates Against AIDS The Women’s Collective K.I. Services The Latino AIDS Agenda National Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of Distance ...

  20. Softball Complex

    Science.gov (United States)

    Ellis, Jim

    1977-01-01

    The Parks and Recreation Department of Montgomery, Alabama, has developed a five-field softball complex as part of a growing community park with facilities for camping, golf, aquatics, tennis, and picnicking. (MJB)

  1. Operation Market-Garden: Ultra Intelligence Ignored

    National Research Council Canada - National Science Library

    Jeffson, Joel

    2002-01-01

    .... Is this really the case? Operation Market-Garden, the plan envisioned by Field Marshal Montgomery, would open the gate into Germany and simultaneously force General Eisenhower to abandon his broad-front strategy in favor...

  2. Updating ARI Educational Benefits Usage Data Bases for Army Regular, Reserve, and Guard: 2005 - 2006

    National Research Council Canada - National Science Library

    Young, Winnie

    2007-01-01

    This report describes the updating of ARI's educational benefits usage database with Montgomery GI Bill and Army College Fund data for Army Regular, Reserve, and Guard components over the 2005 and 2006 period...

  3. Airway Clearance Techniques (ACTs)

    Medline Plus

    Full Text Available Skip to Main Content Skip to Footer CFF Homepage Menu Search What Is CF? X close ABOUT ... may be right for you. Search Trials CFF Homepage Cystic Fibrosis Foundation 4550 Montgomery Ave. Suite 1100 ...

  4. 78 FR 44187 - New York Disaster # NY-00136

    Science.gov (United States)

    2013-07-23

    ...; Herkimer; Madison; Montgomery; Niagara; Oneida; Otsego; Warren. The Interest Rates are: Percent For... for economic injury is 13668B (Catalog of Federal Domestic Assistance Numbers 59002 and 59008). James...

  5. Alabama Cooperative Extension System - ACES.edu

    Science.gov (United States)

    Marshall Mobile Monroe Montgomery Morgan Perry Pickens Pike Randolph Russell Shelby St. Clair Sumter Marengo Tuscaloosa Greene Pickens Sumter Conecuh Escambia Monroe Clarke Choctaw Washington Baldwin Mobile Office Communications & Marketing Information Technology ACES Publications & Store 4-H &

  6. Kaasaegseid maailmavaateid kohtulaua ees / Ants Oras

    Index Scriptorium Estoniae

    Oras, Ants

    2003-01-01

    Montgomery Belgioni raamatust "Our present philosophy of life", mis tutvustab Bernard Shaw', André Gide'i, Sigmund Freudi ja Bertrand Russelli filosoofilisi teooriaid. Varem ilmunud: "Looming", 1931, nr. 6, lk. 646-651

  7. Real Property Tax - 2017

    Data.gov (United States)

    Montgomery County of Maryland — This data represents all of the County’s residential real estate properties and all of the associated tax charges and credits with that property processed at the...

  8. How Loud Is Too Loud? | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... visit www.noisyplanet.nidcd.nih.gov The High Cost of Noise Exposure Kurt Evers of Montgomery Village, ... too. Doctors, parents, and educators worry about portable music players and other noisy gadgets damaging hearing in ...

  9. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Adolescent Psychiatry (AACAP) The United Negro College Fund, Special Programs Latino Commission on AIDS Azteca America Foundation/ ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program ...

  10. 75 FR 4415 - National Register of Historic Places; Notification of Pending Nominations and Related Actions

    Science.gov (United States)

    2010-01-27

    ... comments should be submitted by Dated: February 11, 2010. J. Paul Loether, Chief, National Register of... Building, 125 Cherry St., Buffalo, 10000027 Montgomery County Chalmers Knitting Mills, 21-41 Bridge St...

  11. 40 CFR 52.1683 - Control strategy: Ozone.

    Science.gov (United States)

    2010-07-01

    ... not apply to these areas. (i) Albany-Schenectady-Troy (consisting of Albany, Greene, Montgomery... determination shall no longer apply in the area where the violation occurs. (i) Albany-Schenectady-Troy...

  12. Floodplain Study

    Data.gov (United States)

    Montgomery County of Maryland — The purpose of a floodplain study is to establish the 100-year floodplain limits within or near a development in order to preserve the natural resources within the...

  13. An easy and low cost option for economic statistical process control ...

    African Journals Online (AJOL)

    a large number of nonconforming products are manufactured. ... size, n, sampling interval, h, and control limit parameter, k, that minimize the ...... [11] Montgomery DC, 2001, Introduction to statistical quality control, 4th Edition, John Wiley, New.

  14. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Foundation for Women Legislators (NFWL) Educational Institutions: Florida International University Montgomery College Center for the Advancement of ... NY Metropolitan Transportation Authority (MTA) Titan Worldwide Hestia International Panasonic Times Square Astrovision Avalon Theatre Events: Daytona ...

  15. Robustness studies on coal gasification process variables

    African Journals Online (AJOL)

    coal before feeding to the gasification process [1]. .... to-control variables will make up the terms in the response surface model for the ... Montgomery (1999) explained that all the Taguchi engineering objectives for a robust ..... software [3].

  16. Spending Disclosure - Fiscal Year 2012

    Data.gov (United States)

    Montgomery County of Maryland — The purpose of this Spending Disclosure Fiscal Year 12 dataset is to allow the public to search and view summary information on payments made to recipients (referred...

  17. Real Property Tax - 2016

    Data.gov (United States)

    Montgomery County of Maryland — This data represents all of the County’s residential real estate properties and all of the associated tax charges and credits with that property processed at the...

  18. Design and development of sustained-release glyburide-loaded ...

    Indian Academy of Sciences (India)

    delivery of cancer imaging, i.e., diagnosis. ... hyperglycemic agent of class sulphonylurea having half-life. ∗ ... patients with chronic kidney disease [10] and active ischemic ..... [24] Montgomery D C 2008 Introduction to statistical quality.

  19. Lobbying Semi-Annual Activity

    Data.gov (United States)

    Montgomery County of Maryland — This dataset contains Registration and Activity Reporting information lobbyists have provided. The dollar figures in the far right columns are the total of expenses...

  20. Linnud teevad järglastel vahet

    Index Scriptorium Estoniae

    2012-01-01

    Ajakirjas Behavioral Ecology and Sociobiology avaldatud Queensi ülikooli teadlase Bob Montgomerie uuringust, mis tõestas, et isa punarinnad toitsid kaks korda innukamalt oma poegi, kes sündisid säravama sinise varjundiga munadest

  1. Drugs + HIV, Learn the Link

    Medline Plus

    Full Text Available ... Montgomery College Center for the Advancement of Distance Education University of Southern California, Maternal Child & Adolescent Program University of Illinois Chicago, Center of Excellence in Women’s Health Duke Ellington School of the Arts Howard ...

  2. The Rough Road to Antwerp: The First Canadian Army’s Operations Along the Channel Coast

    Science.gov (United States)

    2014-05-22

    41Coincidently, September 17, 1944 also was the first day of Operation Market Garden. 42Copp and Vogel, Maple Leaf Route: Antwerp,142. 43Historical...Holland: 21 Army Group, 1944); Bernard Montgomery. The Armoured Division in Battle (Holland: 21 Army Group, December, 1944); Bernard Montgomery, Some...Canadian Armoured Personnel Carrier Squadron was formed. This squadron was further augmented and became First Canadian Armoured Regiment on October 23

  3. A National Security Strategy for Sweden: Balancing Risks and Opportunities in the 21st Century

    Science.gov (United States)

    2010-04-01

    physics and chemistry. The Intergovernmental Panel on Climate Change (IPCC) links a higher concentration of greenhouse gases to an increase in atmospheric...Command and Staff College. International Security Studies: AY10 Coursebook . Montgomery, 2009. Air Command and Staff College. War Studies Course: AY10... Coursebook . Montgomery, 2009. Assadourian, Eric (Project Director at the World Watch Institute). Vital Signs 2007-2008; The Trends that are Shaping Our

  4. Comparison of the costs of nonoperative care to minimally invasive surgery for sacroiliac joint disruption and degenerative sacroiliitis in a United States commercial payer population: potential economic implications of a new minimally invasive technology

    OpenAIRE

    Ackerman, Stacey J; Polly, David W; Knight, Tyler; Schneider, Karen; Holt, Tim; Cummings, John

    2014-01-01

    Stacey J Ackerman,1 David W Polly Jr,2 Tyler Knight,3 Karen Schneider,4 Tim Holt,5 John Cummings Jr6 1Covance Market Access Services Inc., San Diego, CA, USA; 2University of Minnesota, Orthopaedic Surgery, Minneapolis, MN, USA; 3Covance Market Access Services Inc., Gaithersburg, MD, USA; 4Covance Market Access Services Inc., Sydney, Australia; 5Montgomery Spine Center, Orthopedic Surgery, Montgomery, AL, USA; 6Community Health Network, Neurosurgery, Indianapolis, IN, USA Introduction: Low ba...

  5. Comparison of the costs of nonoperative care to minimally invasive surgery for sacroiliac joint disruption and degenerative sacroiliitis in a United States Medicare population: potential economic implications of a new minimally-invasive technology

    OpenAIRE

    Ackerman SJ; Polly Jr DW; Knight T; Schneider K; Holt T; Cummings J

    2013-01-01

    Stacey J Ackerman1, David W Polly Jr2, Tyler Knight3, Karen Schneider4, Tim Holt5, John Cummings61Covance Market Access Services Inc, San Diego, CA, USA; 2University of Minnesota, Orthopaedic Surgery, Minneapolis, MN, USA; 3Covance Market Access Services Inc, Gaithersburg, MD, USA; 4Covance Market Access Services Inc, Sydney, NSW, Australia; 5Montgomery Spine Center, Orthopaedic Surgery, Montgomery, AL, USA; 6Community Health Network, Neurosurgery, Indianapolis, IN, USAIntroduction: The econo...

  6. An Analysis of the Observed Low-level Structure of Rapidly Intensifying and Mature Hurricane Earl (2010)

    Science.gov (United States)

    2014-01-01

    structure. J. Atmos. Sci. 49: 919–942. Marks FD, Black PG, Montgomery MT, Burpee RW. 2008. Structure of the eye and eyewall of hurricane Hugo (1989...structure of rapidly intensifying and mature hurricane Earl (2010) Michael T. Montgomery,a* Jun A. Zhangb and Roger K. Smithc aDepartment of Meteorology...Naval Postgraduate School, Monterey, CA, USA bNOAA Hurricane Research Division, Miami, FL, USA cMeteorological Institute, Ludwig Maximilians, University

  7. An analysis of the armys formal bureaucracy and the impact on acquisition cycles

    Science.gov (United States)

    2017-09-01

    defense acquisition . This research coincides with “oversight” and bureaucracy language in the FY17 NDAA legislation and by the 114th Congress. While...IMPACT ON ACQUISITION CYCLES September 2017 By: William T. Montgomery Shannon L. Laegeler Advisors: Charles Pickar Robert Mortlock...BUREAUCRACY AND THE IMPACT ON ACQUISITION CYCLES 5. FUNDING NUMBERS 6. AUTHOR(S) William T. Montgomery and Shannon L. Laegeler 7. PERFORMING

  8. Comparison of approximate methods for multiple scattering in high-energy collisions. II

    International Nuclear Information System (INIS)

    Nolan, A.M.; Tobocman, W.; Werby, M.F.

    1976-01-01

    The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

  9. Fidelity Mechanisms of DNA Polymerase Alpha

    Science.gov (United States)

    2008-07-23

    between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

  10. Interaction of the Adenine-Thymine Watson-Crick and Adenine-Adenine Reverse-Hoogsteen DNA Base Pairs with Hydrated Group IIa (Mg .sup.2+./sup., Ca .sup.2+./sup., Sr .sup.2+./sup., Ba .sup.2+./sup.) and IIb (Zn .sup.2+./sup., Cd .sup.2+./sup., Hg .sup.2+./sup.) Metal Cations: Absence of the Base Pair Stabilization by Metal-Induced Polarization Effects

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Sabat, M.; Burda, J. V.; Leszczynski, J.; Hobza, Pavel

    1999-01-01

    Roč. 103, č. 13 (1999), s. 2528-2534 ISSN 1089-5647 R&D Projects: GA ČR GA203/97/0029 Grant - others:NSF(US) EHR108767; NIH(US) GM08047 Subject RIV: BO - Biophysics Impact factor: 3.265, year: 1999

  11. Genetics Home Reference: hereditary paraganglioma-pheochromocytoma

    Science.gov (United States)

    ... 295(6):628. Citation on PubMed Selak MA, Armour SM, MacKenzie ED, Boulahbel H, Watson DG, Mansfield ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

  12. Journal of Humanities - Vol 13, No 1 (1999)

    African Journals Online (AJOL)

    From cultural aesthetic to performance technique: Continuities and contrasts in improvisational milieux of Vimbuza and Jazz* · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Watson Msosa, 47-58 ...

  13. Nucleic acid nanomaterials: Silver-wired DNA

    Science.gov (United States)

    Auffinger, Pascal; Ennifar, Eric

    2017-10-01

    DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

  14. Uus raamatusari õpetajatele / Inga Kukk

    Index Scriptorium Estoniae

    Kukk, Inga

    2003-01-01

    Haridus- ja teadusministeerium hakkas välja andma tänapäeva pedagoogika raamatusarja "XXI sajandi kool". Ilmumas on esimene raamat: George Watson. Koolikäitumise käsiraamat. Kommenteerivad Jaan Kõrgesaar, Krista Sillar

  15. The role of the yeast as probiotic in the protection against liver fibrosis

    African Journals Online (AJOL)

    khairy

    treatment groups have been fed by yeast from the first 35 to 60 days, respectively. The results show ... medicinal and pharmaceutical applications (Kumura et al., 2004 ..... sclerosis and rheumatoid arthritis (Nicklin et al., 1994;. Watson and ...

  16. RESEARCH REPORTS

    African Journals Online (AJOL)

    This study is concerned with the productivity of nurses working within the. Primary ..... rience more work-related stress and report this as overall poor health, than ... performance, and reduces the possibility of staff loss through burnout (Watson,.

  17. Effects of National Fadama III Programme on the Scope and Scale of ...

    African Journals Online (AJOL)

    User

    Agriculture is the backbone of Nigeria's economy, despite being a leading producer of oil in the ... financing for the diverse livelihood activities which the beneficiaries themselves ..... McIntyre B. D., Herren H. R., Wakhungu J., Watson R. T.),.

  18. Commentary on Malone: Who Founded Behaviorism?

    Science.gov (United States)

    Reese, Hayne W

    2015-05-01

    Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

  19. Human genes and genomes: science, health, society

    National Research Council Canada - National Science Library

    Rosenberg, Leon E; Rosenberg, Diane Drobnis

    2012-01-01

    "In the nearly 60 years since Watson and Crick proposed the double helical structure of DNA, the molecule of heredity, waves of discoveries have made genetics the most thrilling field in the sciences...

  20. 76 FR 7625 - Qualification of Drivers; Exemption Applications; Diabetes Mellitus

    Science.gov (United States)

    2011-02-10

    ... exempts, Thomas H. Adams, Jr., Charlie A. Barner, Charles G. Beasley, Philp M. Carr, Timothy D. Cochran..., Darwin D. Roberts, Robert A. Roskamp, David N. Studebaker, Danny J. Watson, Robert L. Wenzel, David A...

  1. 75 FR 9478 - Qualification of Drivers; Exemption Applications; Vision

    Science.gov (United States)

    2010-03-02

    ... and devices showing standard red, green, and amber (49 CFR 391.41(b)(10)). FMCSA recognizes that some..., Donald D. Overton, Willie L. Parks, Derrick A. Robinson, Clarence Robinshaw, Jr., Norman J. Watson and...

  2. Mahlburg's Work on Crank Functions

    Indian Academy of Sciences (India)

    IAS Admin

    640–651, 2006. [8]. G N Watson, Ramanujan's Vermutung uber zerfallungsanzahlen, J. Reine Angew Math., Vol.179, pp.97–128, 1938. [9]. J Lehner, Ramanujan identities involving the partition function for the moduli 11α, Amer. J. Math.

  3. Spectral density regression for bivariate extremes

    KAUST Repository

    Castro Camilo, Daniela; de Carvalho, Miguel

    2016-01-01

    can be seen as an extension of the Nadaraya–Watson estimator where the usual scalar responses are replaced by mean constrained densities on the unit interval. Numerical experiments with the methods illustrate their resilience in a variety of contexts

  4. Zeeman and orbital limiting magnetic fields in cuprates: The ...

    Indian Academy of Sciences (India)

    1IBM T. J. Watson Research Center, Yorktown Heights, New York 10598, ... In cuprates, in a view where pairing correlations set in at the pseudogap ... the field Hc2 bounding the superconducting response and the pseudogap closing field.

  5. trawl bycatch in the fishing grounds of Bus

    African Journals Online (AJOL)

    ajl yemi

    2011-11-30

    . Biol. 86: 1455-1462. Watson RA, Dredge MLC, Mayer DG (1990). Spatial and seasonal variation in demersal trawl fauna associated with a prawn fishery on the CentralGreat Barrier Reef, Australia. Aust. J. Mar. Freshw. Res.

  6. The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.

    Science.gov (United States)

    Waddell, Thomas G.; Rybolt, Thomas R.

    2003-01-01

    Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)

  7. Teatripeegel : Milliseid elamusi on hooaeg pakkunud Mihkel Mutile / Mihkel Mutt

    Index Scriptorium Estoniae

    Mutt, Mihkel, 1953-

    1998-01-01

    Arthur Conan Doyle'i "Sherlock Holmes ja doktor Watson", lav. Ago-Endrik Kerge ja Bertold Brechti "Kolmekrossiooper", lav. Adolf Shapiro Tallinna Linnateatris. Humanitaarinstituudi teatrifakulteedi õpilaste esituses Jean Anouilh' "Antigone", lav. Lembit Peterson

  8. A preliminary geochemical study of zircons and monazites from ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    equation of Watson and Harrison (1983) predicts that zircon with Zr-contents ... tion equation of Montel (1993) predicts that the .... and geochemistry of the basalts of Gujarat state (western ... solution kinetics: implications for the thorium and light.

  9. R2 Cognitive Computing

    Data.gov (United States)

    National Aeronautics and Space Administration — Robonaut 2, a crew assistant robotic prototype, will be integrated with IBM’s Watson. R2 will embody the artificial intelligence to enable new levels of robotic...

  10. The Egg with Two Yellows

    Indian Academy of Sciences (India)

    Srimath

    James Watson, Seymour Benzer's work and his place in the .... A graduate student, Ronald J Konopka from. Dayton, joined him, hoping .... genetics of Thomas Hunt Morgan and his student Alfred ... the findings of Franz Boas, Frank A Brown Jr,.

  11. Use of the FAO AquaCrop model in developing sowing guidelines ...

    African Journals Online (AJOL)

    2014-03-03

    Mar 3, 2014 ... Thomas (1961) with indication of the meteorological stations (stars) used ...... FYLSTRA D, LASDON L, WATSON J and WARREN A (1998) Design ... JONES CA, KINIRY JR and DYKE PT (1987) CERES-Maize: A Simu-.

  12. Ainooson et al., Afr J Tradit Complement Altern Med. (2012) 9(1):8 ...

    African Journals Online (AJOL)

    AJTCAM

    Ainooson et al., Afr J Tradit Complement Altern Med. (2012) ..... The authors are grateful for the technical assistance offered by Messrs Thomas Ansah, Gordon Darku and George Ofei of ... Miller, J. R. (2003). ... R. Watson and V. R. Preedy.

  13. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  14. Coal fire mapping of East Basuria Colliery, Jharia coalfield using ...

    Indian Academy of Sciences (India)

    detect coal fire regions based on surface tem- perature ..... and non-coal fire regions have been delineated well in the ..... System Development Notes; Paterson Grant and Watson .... Schloemer S 2006 Innovative technologies for exploration,.

  15. Behaviorism and Neuroscience.

    Science.gov (United States)

    Thompson, Richard F.

    1994-01-01

    The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)

  16. 76 FR 59141 - Determination That LOXITANE (Loxapine Succinate) Capsules and Three Other Drug Products Were Not...

    Science.gov (United States)

    2011-09-23

    ... Applicant NDA 017525 LOXITANE (loxapine Watson Laboratories succinate) Inc., 417 Wakara Capsules, Way, Suite.../milliliter. NDA 020828 FORTOVASE Hoffmann La Roche (saquinavir) Inc., 340 Kingsland Capsule, 200 mg. St...

  17. Publications | Page 272 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Fighting the violet vampire. In the fields of sub-Saharan Africa, Alan Watson and McGill University's Weed Research Group are battling devastating parasites — naturally. Something big was happening in these agricultural fields of.

  18. Fulltext PDF

    Indian Academy of Sciences (India)

    Unknown

    and Watson clearly showed how, in fact, a gene could work. ... fifties Crick suggested that RNA acts as an adaptor that enables amino acids to associate ... tions, segmentation and complementation in development and origin of life on earth.

  19. The discovery of the structure of DNA

    Science.gov (United States)

    Squires, G. L.

    2003-04-01

    On 25 April 1953, Nature published a letter by Francis Crick and James Watson, at the Cavendish Laboratory, Cambridge, proposing a structure for DNA. This letter marked the beginning of a revolution in biology. Besides Crick and Watson, two other scientists, Rosalind Franklin and Maurice Wilkins, played key roles in the discovery. After sketching the early careers of the four scientists, the present article gives an account of the physics and chemistry involved in the discovery, and the events leading up to it.

  20. Improving the Army’s Next Effort in Technology Forecasting

    Science.gov (United States)

    2010-09-01

    DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the