WorldWideScience

Sample records for monoterpene synthetic enzymes

  1. Antisense technologies targeting fatty acid synthetic enzymes.

    Science.gov (United States)

    Lin, Jinshun; Liu, Feng; Jiang, Yuyang

    2012-05-01

    Fatty acid synthesis is a coordinated process involving multiple enzymes. Overexpression of some of these enzymes plays important roles in tumor growth and development. Therefore, these enzymes are attractive targets for cancer therapies. Antisense agents provide highly specific inhibition of the expression of target genes and thus have served as powerful tools for gene functional studies and potential therapeutic agents for cancers. This article reviews different types of antisense agents and their applications in the modulation of fatty acid synthesis. Patents of antisense agents targeting fatty acid synthetic enzymes are introduced. In addition, miR-122 has been shown to regulate the expression of fatty acid synthetic enzymes, and thus antisense agent patents that inhibit miR-122 expression are also discussed.

  2. Enzymes go big: surface hydrolysis and functionalization of synthetic polymers.

    Science.gov (United States)

    Guebitz, Georg M; Cavaco-Paulo, Artur

    2008-01-01

    Enzyme technology has progressed from the biotransformation of small substrates to biotransformation of synthetic polymers. Important breakthroughs have been the isolation and design of novel enzymes with enhanced activity on synthetic polymer substrates. These were made possible by efficient screening procedures and genetic engineering approaches based on an in-depth understanding of the mechanisms of enzymes on synthetic polymers. Enhancement of the hydrophilicity of synthetic polymers is a key requirement for many applications, ranging from electronics to functional textile production. This review focuses on enzymes that hydrolyse polyalkyleneterephthalates, polyamides or polyacrylonitriles, specifically on the polymer surface thereby replacing harsh chemical processes currently used for hydrophilisation.

  3. Metabolism of Monoterpenes: Acetylation of (-)-Menthol by a Soluble Enzyme Preparation from Peppermint (Mentha piperita) Leaves.

    Science.gov (United States)

    Croteau, R; Hooper, C L

    1978-05-01

    The essential oil from mature leaves of flowering peppermint (Mentha piperita L.) contains up to 15% (-)-menthyl acetate, and leaf discs converted exogenous (-)-[G-(3)H]menthol into this ester in approximately 15% yield of the incorporated precursor. Leaf extracts catalyzed the acetyl coenzyme A-dependent acetylation of (-)-[G-(3)H]menthol and the product of this transacetylase reaction was identified by radiochromatographic techniques. Transacetylase activity was located mainly in the 100,000g supernatant fraction, and the preparation was partially purified by combination of Sephadex G-100 gel filtration and chromatography on O-diethylaminoethyl-cellulose. The transacetylase had a molecular weight of about 37,000 as judged by Sephadex G-150 gel filtration, and a pH optimum near 9. The apparent K(m) and velocity for (-)-menthol were 0.3 mm and 16 nmol/hr. mg of protein, respectively. The saturation curve for acetyl coenzyme A was sigmoidal, showing apparent saturation near 0.1 mm. Dithioerythritol was required for maximum activity and stability of the enzyme, and the enzyme was inhibited by thiol directed reagents such as p-hydroxymercuribenzoate. Diisopropylfluorophosphate also inhibited transacylation suggesting the involvement of a serine residue in catalysis. The transacylase was highly specific for acetyl coenzyme A; propionyl coenzyme A and butyryl coenzyme A were not nearly as efficient as acyl donors (11% and 2%, respectively). However, the enzyme was much less selective with regard to the alcohol substrate, suggesting that the nature of the acetate ester synthesized in mint is more dependent on the type of alcohol available than on the specificity of the transacetylase. This is the first report on an enzyme involved in monoterpenol acetylation in plants. A very similar enzyme, catalyzing this key reaction in the metabolism of menthol, was also isolated from the flowers of peppermint.

  4. Limonene Synthase, the Enzyme Responsible for Monoterpene Biosynthesis in Peppermint, Is Localized to Leucoplasts of Oil Gland Secretory Cells

    National Research Council Canada - National Science Library

    Glenn Turner; Jonathan Gershenzon; Erik E. Nielson; John E. Froehlich; Rodney Croteau

    1999-01-01

    ...)-Limonene synthase, which is responsible for the first dedicated step of monoterpene biosynthesis in mint species, appears to be translated as a preprotein bearing a long plastidial transit peptide...

  5. CO2 Capture with Enzyme Synthetic Analogue

    Energy Technology Data Exchange (ETDEWEB)

    Cordatos, Harry

    2010-11-08

    Overview of an ongoing, 2 year research project partially funded by APRA-E to create a novel, synthetic analogue of carbonic anhydrase and incorporate it into a membrane for removal of CO2 from flue gas in coal power plants. Mechanism background, preliminary feasibility study results, molecular modeling of analogue-CO2 interaction, and program timeline are provided.

  6. Metabolism of monoterpenes in cell cultures of common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Falk, K.L.; Gershenzon, J.; Croteau, R. (Washington State Univ., Pullman (USA))

    1990-08-01

    Leaves of common sage (Salvia officinalis) accumulate monoterpenes in glandular trichomes at levels exceeding 15 milligrams per gram fresh weight at maturity, whereas sage cells in suspension culture did not accumulate detectable levels of monoterpenes (<0.3 nanograms per gram fresh weight) at any stage of the growth cycle, even in the presence of a polystyrene resin trap. Monoterpene biosynthesis from (U-{sup 14}C)sucrose was also virtually undetectable in this cell culture system. In vitro assay of each of the enzymes required for the sequential conversion of the ubiquitous isoprenoid precursor geranyl pyrophosphate to (+){minus}camphor (a major monoterpene product of sage) in soluble extracts of the cells revealed the presence of activity sufficient to produce (+){minus}camphor at a readily detectable level (>0.3 micrograms per gram fresh weight) at the late log phase of growth. Other monoterpene synthetic enzymes were present as well. In vivo measurement of the ability to catabolize (+){minus}camphor in these cells indicated that degradative capability exceeded biosynthetic capacity by at least 1,000-fold. Therefore, the lack of monoterpene accumulation in undifferentiated sage cultures could be attributed to a low level of biosynthetic activity (relative to the intact plant) coupled to a pronounced capacity for monoterpene catabolism.

  7. Enzyme screening with synthetic multifunctional pores: Focus on biopolymers

    Science.gov (United States)

    Sordé, Nathalie; Das, Gopal; Matile, Stefan

    2003-01-01

    This report demonstrates that a single set of identical synthetic multifunctional pores can detect the activity of many different enzymes. Enzymes catalyzing either synthesis or degradation of DNA (exonuclease III or polymerase I), RNA (RNase A), polysaccharides (heparinase I, hyaluronidase, and galactosyltransferase), and proteins (papain, ficin, elastase, subtilisin, and pronase) are selected to exemplify this key characteristic of synthetic multifunctional pore sensors. Because anionic, cationic, and neutral substrates can gain access to the interior of complementarily functionalized pores, such pores can be the basis for very user-friendly screening of a broad range of enzymes. PMID:14530413

  8. Diversity screening for novel enzymes degrading synthetic polymers

    DEFF Research Database (Denmark)

    Lezyk, Mateusz Jakub

    The objective of this PhD study was to evaluate the feasibility of enzymatic degradation of synthetic polymers used as binder materials in marine coatings. Enzymatic modification of synthetic polymers like epoxy resin, polyurethanes and various acrylics is desirable in several industrial processes...... is reported. First, a collection of fungal strains was screened for the capability to degrade several compounds of synthetic origin. Strains with the ability to modify colloidal polyester polyurethane, as well as various commercial emulsions of acrylates were identified. Secondly, we have used metagenomic...... and the choice of proper substrates for identification of promising enzyme candidates. Several genes coding for enzymes with the capability to oxidize various natural and synthetic substrates were identified, expressed heterologously and characterized. Three multicopper oxidases (MCOs) were identified encoded...

  9. Synthetic polyester-hydrolyzing enzymes from thermophilic actinomycetes.

    Science.gov (United States)

    Wei, Ren; Oeser, Thorsten; Zimmermann, Wolfgang

    2014-01-01

    Thermophilic actinomycetes produce enzymes capable of hydrolyzing synthetic polyesters such as polyethylene terephthalate (PET). In addition to carboxylesterases, which have hydrolytic activity predominantly against PET oligomers, esterases related to cutinases also hydrolyze synthetic polymers. The production of these enzymes by actinomycetes as well as their recombinant expression in heterologous hosts is described and their catalytic activity against polyester substrates is compared. Assays to analyze the enzymatic hydrolysis of synthetic polyesters are evaluated, and a kinetic model describing the enzymatic heterogeneous hydrolysis process is discussed. Structure-function and structure-stability relationships of actinomycete polyester hydrolases are compared based on molecular dynamics simulations and recently solved protein structures. In addition, recent progress in enhancing their activity and thermal stability by random or site-directed mutagenesis is presented.

  10. A novel synthetic pathway for tropolone ring formation via the olefin monoterpene intermediate terpinolene in cultured Cupressus lusitanica cells.

    Science.gov (United States)

    Fujita, Koki; Bunyu, Yasufumi; Kuroda, Ken'ich; Ashitani, Tatsuya; Shigeto, Jun; Tsutsumi, Yuji

    2014-05-01

    β-Thujaplicin is a wood monoterpene and tropolone compound with a unique conjugated 7-membered ring. Because of its strong antifungal and antitumor activities, β-thujaplicin is used in several fields. The biosynthesis pathway of β-thujaplicin has not yet been elucidated. Using Cupressus lusitanica cell cultures in a radioisotope feeding experiment, our group previously demonstrated that geranyl pyrophosphate (GPP) is the starting material of β-thujaplicin biosynthesis. The results of our previous terpene synthase assay suggested that terpinolene is the first olefin terpenoid intermediate from GPP to β-thujaplicin, although there was no experimental evidence of this at that time. In the present study, we fed deuterium-labeled terpinolene to cultured C. lusitanica cells to determine whether terpinolene is an intermediate metabolite of β-thujaplicin biosynthesis. A gas chromatography-mass spectroscopy analysis of the cell extracts from labeled terpinolene cultures revealed a peak of labeled β-thujaplicin that was not observed after treatment with non-labeled terpinolene. The identification of labeled β-thujaplicin was also performed by mass spectrum assignment. The outcome indicated that terpinolene is indeed an intermediate metabolite of β-thujaplicin biosynthesis. To the best of our knowledge, there has been no prior report that tropolone compounds are biosynthesized via a terpene biosynthesis system, and our results thus suggest the existence of a novel biosynthetic pathway that produces the conjugated 7-membered ring.

  11. Inhibition of phosphatidylinositol-specific phospholipase C: studies on synthetic substrates, inhibitors and a synthetic enzyme.

    Science.gov (United States)

    Vizitiu, D; Kriste, A G; Campbell, A S; Thatcher, G R

    1996-01-01

    Enzyme inhibition studies on phosphatidylinositol-specific phospholipase C (PI-PLC) from B. Cereus were performed in order to gain an understanding of the mechanism of the PI-PLC family of enzymes and to aid inhibitor design. Inhibition studies on two synthetic cyclic phosphonate analogues (1,2) of inositol cyclic-1:2-monophosphate (cIP), glycerol-2-phosphate and vanadate were performed using natural phosphatidylinositol (PI) substrate in Triton X100 co-micelles and an NMR assay. Further inhibition studies on PI-PLC from B. Cereus were performed using a chromogenic, synthetic PI analogue (DPG-PI), an HPLC assay and Aerosol-OT (AOT), phytic acid and vanadate as inhibitors. For purposes of comparison, a model PI-PLC enzyme system was developed employing a synthetic Cu(II)-metallomicelle and a further synthetic PI analogue (IPP-PI). The studies employing natural PI substrate in Triton X100 co-micelles and synthetic DPG-PI in the absence of surfactant indicate three classes of PI-PLC inhibitors: (1) active-site directed inhibitors (e.g. 1,2); (2) water-soluble polyanions (e.g. tetravanadate, phytic acid); (3) surfactant anions (e.g. AOT). Three modes of molecular recognition are indicated to be important: (1) active site molecular recognition; (2) recognition at an anion-recognition site which may be the active site, and; (3) interfacial (or hydrophobic) recognition which may be exploited to increase affinity for the anion-recognition site in anionic surfactants such as AOT. The most potent inhibition of PI-PLC was observed by tetravanadate and AOT. The metallomicelle model system was observed to mimic PI-PLC in reproducing transesterification of the PI analogue substrate to yield cIP as product and in showing inhibition by phytic acid and AOT.

  12. Domain swapping of Citrus limon monoterpene synthases: impact on enzymatic activity and product specifity.

    NARCIS (Netherlands)

    Tamer, el M.K.; Lucker, J.; Bosch, D.; Verhoeven, H.A.; Verstappen, F.W.A.; Schwab, W.; Tunen, van A.J.; Voragen, A.G.J.; Maagd, de R.A.; Bouwmeester, H.J.

    2003-01-01

    Monoterpene cyclases are the key enzymes in the monoterpene biosynthetic pathway, as they catalyze the cyclization of the ubiquitous geranyl diphosphate (GDP) to the specific monoterpene skeletons. From Citrus limon, four monoterpene synthase-encoding cDNAs for a P-pinene synthase named

  13. Domain swapping of Citrus limon monoterpene synthases: impact on enzymatic activity and product specifity.

    NARCIS (Netherlands)

    Tamer, el M.K.; Lucker, J.; Bosch, D.; Verhoeven, H.A.; Verstappen, F.W.A.; Schwab, W.; Tunen, van A.J.; Voragen, A.G.J.; Maagd, de R.A.; Bouwmeester, H.J.

    2003-01-01

    Monoterpene cyclases are the key enzymes in the monoterpene biosynthetic pathway, as they catalyze the cyclization of the ubiquitous geranyl diphosphate (GDP) to the specific monoterpene skeletons. From Citrus limon, four monoterpene synthase-encoding cDNAs for a P-pinene synthase named Cl(-)betaPIN

  14. Microbial monoterpene transformations – A review

    Directory of Open Access Journals (Sweden)

    Robert eMarmulla

    2014-07-01

    Full Text Available Isoprene and monoterpenes constitute a significant fraction of new plant biomass. Emission rates into the atmosphere alone are estimated to be over 500 Tg per year. These natural hydrocarbons are mineralized annually in similar quantities. In the atmosphere, abiotic photochemical processes cause lifetimes of minutes to hours. Microorganisms encounter isoprene, monoterpenes and other volatiles of plant origin while living in and on plants, in the soil and in aquatic habitats. Below toxic concentrations, the compounds can serve as carbon and energy source for aerobic and anaerobic microorganisms. Besides these catabolic reactions, transformations may occur as part of detoxification processes. Initial transformations of monoterpenes involve the introduction of functional groups, oxidation reactions and molecular rearrangements catalyzed by various enzymes. Pseudomonas and Rhodococcus strains and members of the genera Castellaniella and Thauera have become model organisms for the elucidation of biochemical pathways. We review here the enzymes and their genes together with microorganisms known for a monoterpene metabolism, with a strong focus on microorganisms that are taxonomically validly described and currently available from culture collections. Metagenomes of microbiomes with a monoterpene-rich diet confirmed the ecological relevance of monoterpene metabolism and raised concerns on the quality of our insights based on the limited biochemical knowledge.

  15. What are the Limitations of Enzymes in Synthetic Organic Chemistry?

    Science.gov (United States)

    Reetz, Manfred T

    2016-12-01

    Enzymes have been used in organic chemistry and biotechnology for 100 years, but their widespread application has been prevented by a number of limitations, including the often-observed limited thermostability, narrow substrate scope, and low or wrong stereo- and/or regioselectivity. Directed evolution provides a means to address and generally solve these problems, especially since recent methodology development has made this protein engineering method faster, more efficient, and more reliable than in the past. This Darwinian approach to asymmetric catalysis has led to a number of industrial applications. Metabolic-pathway engineering, mutasynthesis, and fermentation are likewise enzyme-based techniques that enrich chemistry. This account outlines the scope, and particularly, the limitations, of biocatalysis. The complementary nature of enzymes and man-made catalysts is emphasized. © 2016 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Natural and Synthetic Macrocyclic Inhibitors of the Histone Deacetylase Enzymes

    DEFF Research Database (Denmark)

    Maolanon, Alex; Kristensen, Helle; Leman, Luke

    2017-01-01

    Inhibition of histone deacetylase (HDAC) enzymes has emerged as a target for development of cancer chemotherapy. Four compounds have gained approval for clinical use by the Food and Drug Administration (FDA) in the US, and several are currently in clinical trials. However, none of these compounds...... HDAC enzymes may hold an advantage over traditional hydroxamic acid-containing inhibitors, which rely on chelation to the conserved active site zinc ion. Here, we review the literature on macrocyclic HDAC inhibitors obtained from natural sources and structure-activity relationship studies inspired...

  17. Hydrogenase Enzymes and Their Synthetic Models: The Role of Metal Hydrides.

    Science.gov (United States)

    Schilter, David; Camara, James M; Huynh, Mioy T; Hammes-Schiffer, Sharon; Rauchfuss, Thomas B

    2016-08-10

    Hydrogenase enzymes efficiently process H2 and protons at organometallic FeFe, NiFe, or Fe active sites. Synthetic modeling of the many H2ase states has provided insight into H2ase structure and mechanism, as well as afforded catalysts for the H2 energy vector. Particularly important are hydride-bearing states, with synthetic hydride analogues now known for each hydrogenase class. These hydrides are typically prepared by protonation of low-valent cores. Examples of FeFe and NiFe hydrides derived from H2 have also been prepared. Such chemistry is more developed than mimicry of the redox-inactive monoFe enzyme, although functional models of the latter are now emerging. Advances in physical and theoretical characterization of H2ase enzymes and synthetic models have proven key to the study of hydrides in particular, and will guide modeling efforts toward more robust and active species optimized for practical applications.

  18. Chemomimetic biocatalysis: exploiting the synthetic potential of cofactor-dependent enzymes to create new catalysts.

    Science.gov (United States)

    Prier, Christopher K; Arnold, Frances H

    2015-11-11

    Despite the astonishing breadth of enzymes in nature, no enzymes are known for many of the valuable catalytic transformations discovered by chemists. Recent work in enzyme design and evolution, however, gives us good reason to think that this will change. We describe a chemomimetic biocatalysis approach that draws from small-molecule catalysis and synthetic chemistry, enzymology, and molecular evolution to discover or create enzymes with non-natural reactivities. We illustrate how cofactor-dependent enzymes can be exploited to promote reactions first established with related chemical catalysts. The cofactors can be biological, or they can be non-biological to further expand catalytic possibilities. The ability of enzymes to amplify and precisely control the reactivity of their cofactors together with the ability to optimize non-natural reactivity by directed evolution promises to yield exceptional catalysts for challenging transformations that have no biological counterparts.

  19. Signal transduction and metabolic flux of beta-thujaplicin and monoterpene biosynthesis in elicited Cupressus lusitanica cell cultures.

    Science.gov (United States)

    Zhao, Jian; Matsunaga, Yoko; Fujita, Koki; Sakai, Kokki

    2006-01-01

    beta-Thujaplicin is an antimicrobial tropolone derived from geranyl pyrophosphate(GPP) and monoterpene intermediate. Yeast elicitor-treated Cupressus lusitanica cell cultures accumulate high levels of beta-thujaplicin at early stages and other monoterpenes at later stages post-elicitation. The different regulation of beta-thujaplicin and monoterpene biosynthesis and signal transduction directing metabolic flux to beta-thujaplicin firstly and then shifting metabolic flow from beta-thujaplicin to other monoterpene biosynthesis were investigated. The earlier rapid induction of beta-thujaplicin accumulation and a later stimulation of monoterpene biosynthesis by yeast elicitor are in well agreement with elicitor-induced changes in activity of three monoterpene biosynthetic enzymes including isopentenyl pyrophosphate isomerase, GPP synthase, and monoterpene synthase. Yeast elicitor induces an earlier and stronger beta-thujaplicin production and monoterpene biosynthetic enzyme activity than methyl jasmonate (MeJA) does. Profiling all monoterpenes produced by C. lusitanica cell cultures under different conditions reveals that beta-thujaplicin biosynthesis parallels with other monoterpenes and competes for common precursor pools. Yet beta-thujaplicin is produced pre-dominantly at early stage of elicitation whereas other monoterpenes are mainly accumulated at late stage while beta-thujaplicin is metabolized. It is suggested that yeast elicitor-treated C. lusitanica cells preferentially accumulate beta-thujaplicin as a primary defense and other monoterpenes as a secondary defense. Inhibitor treatments suggest that immediate production of beta-thujaplicin post-elicitation largely depends on pre-existing enzymes and translation of pre-existing transcripts as well as recruitment of precursor pools from both the cytosol and plastids. The later beta-thujaplicin and other monoterpene accumulation strictly depends on active transcription and translation. Induction of beta

  20. Antioxidant Potential and Inhibition of Key Enzymes Linked to Alzheimer’s Diseases and Diabetes Mellitus by Monoterpene-Rich Essential Oil from Sideritis galatica Bornm. Endemic to Turkey

    Directory of Open Access Journals (Sweden)

    Gökhan Zengin

    2016-03-01

    Full Text Available The present study was designated to (1 characterize the essential oil from S. galatica (SGEOs and (2 evaluate its antioxidant and enzyme inhibitory activities. Antioxidant capacity was tested different methods including free radical scavenging (DPPH, ABTS and NO, reducing power (FRAP and CUPRAC, metal chelating and phosphomolybdenum. Inhibitory activities were analyzed on acetylcholiesterase, butrylcholinesterase, α-amylase and α-glucosidase. SGEOs were chemically analyzed and identified by gas chromatography and gas chromatography/mass spectrophotometry. 23 components, representing 98.1% of SGEOs were identified. Monoterpene hydrocarbons (74.1%, especially α- (23.0% and β-pinene (32.2%, were the main constituents in SGEOs. The main sesquiterpene hydrocarbons were β-caryophyllene (16.9%, germacrene-D (1.2% and caryophyllene oxide (1.2%, respectively. Generally, SGEOs has shown moderate free radical, reducing power, metal chelating and enzyme inhibitory activities. These activities related to chemical profile in SGEOs. Our findings supported that the possible utility of SGEOs is a source of natural agents for food or pharmaceutical industries.

  1. Combining a Nitrogenase Scaffold and a Synthetic Compound into an Artificial Enzyme**

    OpenAIRE

    Tanifuji, Kazuki; Lee, Chi Chung; Ohki, Yasuhiro; Tatsumi, Kazuyuki; Hu, Yilin; Ribbe, Markus W.

    2015-01-01

    Nitrogenase catalyzes substrate reduction at its cofactor center ([(Cit)MoFe7S9C]n−; designated M-cluster). Here, we report the formation of an artificial, nitrogenase-mimicking enzyme upon insertion of a synthetic model complex ([Fe6S9(SEt)2]4−; designated Fe6RHH) into the catalytic component of nitrogenase (designated NifDK). Two Fe6RHH clusters were inserted into NifDK, rendering the resultant protein (designated NifDKFe) in a similar conformation to that upon insertion of native M-cluster...

  2. Combining a Nitrogenase Scaffold and a Synthetic Compound into an Artificial Enzyme**

    OpenAIRE

    Tanifuji, Kazuki; Lee, Chi Chung; Ohki, Yasuhiro; Tatsumi, Kazuyuki; Hu, Yilin; Ribbe, Markus W.

    2015-01-01

    Nitrogenase catalyzes substrate reduction at its cofactor center ([(Cit)MoFe7S9C]n−; designated M-cluster). Here, we report the formation of an artificial, nitrogenase-mimicking enzyme upon insertion of a synthetic model complex ([Fe6S9(SEt)2]4−; designated Fe6RHH) into the catalytic component of nitrogenase (designated NifDK). Two Fe6RHH clusters were inserted into NifDK, rendering the resultant protein (designated NifDKFe) in a similar conformation to that upon insertion of native M-cluster...

  3. An adeno-associated virus vector-mediated multiple gene transfer for dopamine synthetic enzymes

    Institute of Scientific and Technical Information of China (English)

    樊东升; 沈扬

    2000-01-01

    Objective: To explore a multiple gene transfer approach with separate adeno-associated virus vectors. Methods: The genes of dopamine synthetic enzymes, tyrosine hydroxylasc (TH), GTP cyclohydrolase I (GCH, an enzyme critical for tetrahydrobioptcrin synthesis), and aromatic L-amino acid decarboxylase (AADC), were cotransduced into 293 cells with separate AAV vectors. Expressions of TH, GCH, and AADC were detected by Western blot analysis. L-dopa and dopamine levels in the ceils were assayed by HPLC. Results: TH, GCH, and AADC proteins were effectively cocxpressed in the transduced cells with three separate AAV vectors, AAV-TH, AAV-GCH, and AAV-AADC. Furthermore, the coexpression of these three proteins resulted in an effectively spontaneous dopainc production in the cotransduced cells. Conclusion: The triple transduction of TH, GCH, and AADC genes with separate AAV vectors is effective, which might be important to gene therapy for Parkinson's disease.

  4. Evaluation of a homogenous enzyme immunoassay for the detection of synthetic cannabinoids in urine

    Science.gov (United States)

    Barnes, Allan J.; Young, Sheena; Spinelli, Eliani; Martin, Thomas M.; Klette, Kevin L.; Huestis, Marilyn A.

    2014-01-01

    Introduction The recent emergence and widespread availability of many new synthetic cannabinoids support the need for an accurate and high-throughput urine screen for these new designer drugs. We evaluated performance of the immunalysis homogeneous enzyme immunoassay (HEIA) to sensitively, selectively, and rapidly identify urinary synthetic cannabinoids. Methods 2443 authentic urine samples were analyzed with the HEIA that targets JWH-018 N-pentanoic acid, and a validated LC-MS/MS method for 29 synthetic cannabinoids and metabolites. Semiquantitative HEIA results were obtained, permitting performance evaluation at and around three cutoffs (5, 10 and 20 μg/L), and diagnostic sensitivity, specificity and efficiency determination. Performance challenges at ±25 and ±50% of each cutoff level, cross-reactivity and interferences also were evaluated. Results Sensitivity, specificity, and efficiency of the immunalysis HEIA K2 Spice kit with the manufacturer's recommended 10 μg/L cutoff were 75.6%, 99.6% and 96.8%, respectively, as compared to the reference LC-MS/MS method with limits of detection of 0.1 -10 μg/L. Performance at 5 μg/L was 92.2%, 98.1% and 97.4%, and for the 20 μg/L cutoff were 62.9%, 99.7% and 95.4%. Semi-quantitative results for in-house prepared standards were obtained from 2.5-30 μg/L, and documented acceptable linearity from 5-25 μg/L, with inter-day imprecision <30% (n = 17). Thirteen of 74 synthetic cannabinoids evaluated were classified as highly cross-reactive (≥50% at 10 μg/L); 4 showed moderate cross-reactivity (10–50% at 10 μg/L), 30 low cross-reactivity (<10% at 500 μg/L), and 27 <1% cross-reactivity at 500 μg/L. There was no interference from 102 investigated compounds. Only a mixture containing 1000 μg/L each of buprenorphine/norbuprenorphine produced a positive result above our proposed cutoff (5 μg/L) but below the manufacturer's recommended cutoff concentration (10 μg/L). Conclusion The Immunalysis HEIA K2 Spice kit

  5. SynTec Final Technical Report: Synthetic biology for Tailored Enzyme cocktails

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Janine [Novozymes, Inc., Davis, CA (United States); Teter, Sarah [Novozymes, Inc., Davis, CA (United States)

    2016-06-30

    Using a novel enzyme screening method inspired by synthetic biology, Novozymes developed new technology under SynTec which allows for more rapidly tailoring of enzyme cocktails. The methodology can be applied to specific feedstocks, and or coupled to address a specific hydrolytic conversion process context. Using combinatorial high throughput screening of libraries of enzyme domains, we can quickly assess which combination of catalytic modules delivers the best performance for a specific condition. To demonstrate the effectiveness of the screening process, we measured performance of the output catalytic cocktail compared to CTec3/HTec3. SynTec benchmark cocktail - blend of Cellic® CTec3 and HTec3. The test substrate was - ammonia fiber expansion pretreated corn stover (AFEX™ PCS).CTec3/HTec3 was assayed at the optimal pH and temperature, and also in the absence of any pH adjustment. The new enzyme cocktail discovered under SynTec was assayed in the absence of any pH adjustment and at the optimal temperature. Conversion is delivered by SynTec enzyme at significant dose reduction relative to CTec3/HTec3 at the controlled pH optimum, and without titrant required to maintain pH, which delivers additional cost savings relative to current state of the art process. In this 2.5 year $4M project, the team delivered an experimental cocktail that significantly outperformed CTec3/HTec3 for a specific substrate, and for specific hydrolysis conditions. As a means of comparing performance improvement delivered per research dollar spent, we note that SynTec delivered a similar performance improvement to the previous award, in a shorter time and with fewer resources than for the previously successful DOE project DECREASE, a 3.5 year, $25M project, though this project focused on a different substrate and used different hydrolysis conditions. The newly implemented technology for rapid sourcing of new cellulases and hemicellulases from nature is an example of Novozymes

  6. Genetic and biochemical characterization of a novel monoterpene epsilon-lactone hydrolase from Rhodococcus erythropolis DCL14

    NARCIS (Netherlands)

    Vlugt-Bergmans, van der C.J.B.; Werf, van der M.J.

    2001-01-01

    A monoterpene ε-lactone hydrolase (MLH) from Rhodococcus erythropolis DCL14, catalyzing the ring opening of lactones which are formed during degradation of several monocyclic monoterpenes, including carvone and menthol, was purified to apparent homogeneity. It is a monomeric enzyme of 31 kDa that is

  7. Genetic and biochemical characterization of a novel monoterpene e-lactone hydrolase from Rhodococcus erythropolis DCL14

    NARCIS (Netherlands)

    Vlugt-Bergmans, C.J.B. van der; Werf, M.J. van der

    2001-01-01

    A monoterpene ε-lactone hydrolase (MLH) from Rhodococcus erythropolis DCL14, catalyzing the ring opening of lactones which are formed during degradation of several monocyclic monoterpenes, including carvone and menthol, was purified to apparent homogeneity. It is a monomeric enzyme of 31 kDa that is

  8. Monoterpene emission from ponderosa pine

    Science.gov (United States)

    Lerdau, Manual; Dilts, Stephen B.; Westberg, Hal; Lamb, Brian K.; Allwine, Eugene J.

    1994-01-01

    We explore the variability in monoterpene emissions from ponderosa pine beyond that which can be explained by temperature alone. Specifically, we examine the roles that photosynthesis and needle monoterpene concentrations play in controlling emissions. We measure monoterpene concentrations and emissions, photosynthesis, temperature, and light availability in the late spring and late summer in a ponderosa pine forest in central Oregon. We use a combination of measurements from cuvettes and Teflon bag enclosures to show that photosynthesis is not correlated with emissions in the short term. We also show that needle monoterpene concentrations are highly correlated with emissions for two compounds, alpha-pinene and beta-pinene, but that Delta-carene concentrations are not correlated with emissions. We suggest that direct effects of light and photosynthesis do not need to be included in emission algorithms. Our results indicate that the role of needle concentration bears further investigation; our results for alpha-pinene and beta-pinene are explainable by a Raoult's law relationship, but we cannot yet explain the cause of our results with Delta-carene.

  9. Monoterpenes in essential oils. Biosynthesis and properties.

    Science.gov (United States)

    Loza-Tavera, H

    1999-01-01

    Monoterpenes are compounds found in the essential oils extracted from many plants, including fruits, vegetables, spices and herbs. These compounds contribute to the flavor and aroma of plant from which they are extracted. Monoterpenes are acyclic, monocyclic, or bicyclic C30 compounds synthesized by monoterpene synthases using geranyl pyrophosphate (GPP) as substrate. GPP is also the precursor in the synthesis of farnesyl pyrophosphate (FPP) and geranyl-geranyl pyrophosphate (GGPP), two important compounds in cell metabolism of animals, plants and yeast. Monoterpene cyclases produce cyclic monoterpenes through a multistep mechanism involving a universal intermediate, a terpinyl cation which can be transformed to several compounds. Experimental studies, using animal cancer models, have demonstrated that some monoterpenes possess anticarcinogenic properties, acting at different cellular and molecular levels. From these discoveries it seems clear that monoterpenes could be considered as effective, nontoxic dietary antitumorigenic agents that hold promise as a novel class of anticancer drugs.

  10. Directed evolution of artificial enzymes (XNAzymes) from diverse repertoires of synthetic genetic polymers.

    Science.gov (United States)

    Taylor, Alexander I; Holliger, Philipp

    2015-10-01

    This protocol describes the directed evolution of artificial endonuclease and ligase enzymes composed of synthetic genetic polymers (XNAzymes), using 'cross-chemistry selective enrichment by exponential amplification' (X-SELEX). The protocol is analogous to (deoxy)ribozyme selections, but it enables the development of fully substituted catalysts. X-SELEX is initiated by the synthesis of diverse repertoires (here 10(14) different sequences), using xeno nucleic acid (XNA) polymerases, on DNA templates primed with DNA, RNA or XNA oligonucleotides that double as substrates, allowing selection for XNA-catalyzed cleavage or ligation. XNAzymes are reverse-transcribed into cDNA using XNA-dependent DNA polymerases, and then PCR-amplified to generate templates for subsequent rounds or deep sequencing. We describe methods developed for four XNA chemistries, arabino nucleic acids (ANAs), 2'-fluoroarabino nucleic acids (FANAs), hexitol nucleic acids (HNAs) and cyclohexene nucleic acids (CeNAs), which require ∼1 week per round, and typically 10-20 rounds; in principle, these methods are scalable and applicable to a wide range of novel XNAzyme chemistries, substrates and reactions.

  11. Monoterpene synthases of loblolly pine (Pinus taeda) produce pinene isomers and enantiomers.

    Science.gov (United States)

    Phillips, M A; Savage, T J; Croteau, R

    1999-12-01

    The turpentine fraction of conifer oleoresin is a complex mixture of monoterpene olefins and plays important roles in defense and in the mediation of chemical communication between conifer hosts and insect predators. The stereochemistry of the turpentine monoterpenes is critical in these interactions, influencing host recognition, toxicity, and potency of derived pheromones, and the stereochemical composition of these compounds lends insight into their biogenetic origin, with implications for the numbers and types of enzymes responsible and their corresponding genes. Analysis of the oleoresin from several tissues of loblolly pine (Pinus taeda) showed the derived turpentine to consist mainly of (+)-(3R:5R)-alpha-pinene and (-)-(3S:5S)-beta-pinene. Cell-free extracts from xylem tissue yielded three monoterpene synthases which together account for the monoterpene isomer and enantiomer content of the turpentine of this tissue. The major products of these enzymes, produced from the universal precursor of monoterpenes, geranyl diphosphate, were shown to be (+)-alpha-pinene, (-)-alpha-pinene, and (-)-beta-pinene, respectively. In most properties (molecular mass of approximately 60 kDa, K(m) for geranyl diphosphate of 3 microM, requirement for monovalent and divalent cations), these enzymes resemble other monoterpene synthases from conifer species.

  12. Synthetic

    Directory of Open Access Journals (Sweden)

    Anna Maria Manferdini

    2010-06-01

    Full Text Available Traditionally materials have been associated with a series of physical properties that can be used as inputs to production and manufacturing. Recently we witnessed an interest in materials considered not only as ‘true matter’, but also as new breeds where geometry, texture, tooling and finish are able to provoke new sensations when they are applied to a substance. These artificial materials can be described as synthetic because they are the outcome of various qualities that are not necessarily true to the original matter, but they are the combination of two or more parts, whether by design or by natural processes. The aim of this paper is to investigate the potential of architectural surfaces to produce effects through the invention of new breeds of artificial matter, using micro-scale details derived from Nature as an inspiration.

  13. Biotransformations of monoterpenes by photoautotrophic micro-organisms.

    Science.gov (United States)

    Balcerzak, L; Lipok, J; Strub, D; Lochyński, S

    2014-12-01

    Monoterpenes are widely used in food technology, cosmetic and pharmaceutical industries and as compounds of agricultural importance. It is known that compounds comprising this class can be transformed by a variety of organisms, namely by: bacteria, fungi, yeasts, plants or isolated enzymes. Biotransformations, as one of the most important tools of green chemistry, allow obtaining new products using whole cells of micro-organisms or isolated enzymes in mild reaction conditions. Therefore, biotransformations of monoterpenes, by different type of reaction such as: epoxidation, oxidation and stereoselective hydroxylation, resulted in the production of so desired, enantiomerically defined compounds that can be advised as natural seem to be interesting. Bearing in mind that such processes are carried out also by easy to maintain, photoautotrophic micro-organisms cultivated at large scale, this paper is focused on biotransformations of acyclic, monocyclic and bicyclic monoterpenes by freshwater or haliphylic cyanobacteria and microalgae on the way of mainly stereoselective hydroxylation. Moreover, aspects of potential industrial application of obtained products in medicine, perfume, cosmetics and food industry are discussed.

  14. Metabolic engineering of monoterpene biosynthesis in plants

    NARCIS (Netherlands)

    Lücker, J.

    2002-01-01

    Monoterpenes are a large group of compounds that belong to the terpenoid family of natural compounds in plants. They are small, volatile, lipophilic substances of which around one thousand different structures have been identified. Monoterpenes are

  15. Production of aromas and fragrances through microbial oxidation of monoterpenes

    Directory of Open Access Journals (Sweden)

    H. F. Rozenbaum

    2006-09-01

    Full Text Available Aromas and fragrances can be obtained through the microbial oxidation of monoterpenes. Many microorganisms can be used to carry out extremely specific conversions using substrates of low commercial value. However, for many species, these substrates are highly toxic, consequently inhibiting their metabolism. In this work, the conversion ability of Aspergillus niger IOC-3913 for terpenic compounds was examined. This species was preselected because of its high resistance to toxic monoterpenic substrates. Though it has been grown in media containing R-limonene (one of the cheapest monoterpenic hydrocarbons, which is widely available on the market, the species has not shown the ability to metabolize it, since biotransformation products were not detected in high resolution gas chromatography analyses. For this reason, other monoterpenes (alpha-pinene, beta-pinene and camphor were used as substrates. These compounds were shown to be metabolized by the selected strain, producing oxidized compounds. Four reaction systems were used: a biotransformation in a liquid medium with cells in growth b with pre-grown cultures c with cells immobilized in a synthetic polymer network and d in a solid medium to which the substrate was added via the gas phase. The main biotransformation products were found in all the reaction systems, although the adoption of previously cultivated cells seemed to favor biotransformation. Cell immobilization seemed to be a feasible strategy for alleviating the toxic effect of the substrate. Through mass spectrometry it was possible to identify verbenone and alpha-terpineol as the biotransformation products of alpha-pinene and beta-pinene, respectively. The structures of the other oxidation products are described.

  16. Enzyme-free translation of DNA into sequence-defined synthetic polymers structurally unrelated to nucleic acids.

    Science.gov (United States)

    Niu, Jia; Hili, Ryan; Liu, David R

    2013-04-01

    The translation of DNA sequences into corresponding biopolymers enables the production, function and evolution of the macromolecules of life. In contrast, methods to generate sequence-defined synthetic polymers with similar levels of control have remained elusive. Here, we report the development of a DNA-templated translation system that enables the enzyme-free translation of DNA templates into sequence-defined synthetic polymers that have no necessary structural relationship with nucleic acids. We demonstrate the efficiency, sequence-specificity and generality of this translation system by oligomerizing building blocks including polyethylene glycol, α-(D)-peptides, and β-peptides in a DNA-programmed manner. Sequence-defined synthetic polymers with molecular weights of 26 kDa containing 16 consecutively coupled building blocks and 90 densely functionalized β-amino acid residues were translated from DNA templates using this strategy. We integrated the DNA-templated translation system developed here into a complete cycle of translation, coding sequence replication, template regeneration and re-translation suitable for the iterated in vitro selection of functional sequence-defined synthetic polymers unrelated in structure to nucleic acids.

  17. Isolation and characterization of three new monoterpene synthases from Artemisia annua

    Directory of Open Access Journals (Sweden)

    Ju-Xin eRuan

    2016-05-01

    Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

  18. Synthetic pyrethroid effect on blood plasma biomarker enzymes and histological changes in Catla catla.

    Science.gov (United States)

    Muthuviveganandavel, Veerappan; Hwang, Inho; Anita, Vanattayen; Malarani, Pattabiraman S; Selvam, Chandrasekar; Hemalatha, Moorthy; Pandurangan, Muthuraman

    2013-04-01

    Alpha-cypermethrin is an isoform of cypermethrin; it is an active pyrethroid used extensively to control a wide range of pests in agriculture and animal breeding. In this study four groups of six fish were examined. The first group served as a control in fresh water alone, with no pyrethroid. The second, third and fourth groups were exposed to alpha-cypermethrin for 4, 8 and 96 h respectively. At the end of the each exposure period, the fish were sacrificed, and the required muscle tissues were collected for histological examination. The blood was drawn with heparinized needles and processed for serum enzymatic studies. Serum enzymes such as aspartate transaminase (AST), alanine transaminase (ALT), amylase, acid phosphatase (ACP) and gamma-glutamyl transpeptidase (GGT) were measured at 4, 8 and 96 h. AST enzyme activity was significantly increased at 4 h, whereas ALT and amylase enzyme activities were significantly reduced at all the time points. ACP enzyme activity was significantly reduced at 4 and 8 h, whereas GGT enzyme activity was significantly increased at all the time points. Hepatocyte cytoplasmic vacuolisation and degeneration, rupture of blood vessels, and necrosis was found at all time points. Congestion of blood vessels, bulging, distortion of filaments, erosion and disintegration of blood corpuscles and hyperplasia of epithelium were found in treated gills at 4, 8 and 96 h. Breakdown of muscle fibres, vacuolation and accumulation of lipids and melanin in white muscle were observed in treated fish muscle at 4, 8 and 96 h.

  19. Oxidative bioelectrocatalysis: From natural metabolic pathways to synthetic metabolons and minimal enzyme cascades.

    Science.gov (United States)

    Minteer, Shelley D

    2016-05-01

    Anodic bioelectrodes for biofuel cells are more complex than cathodic bioelectrodes for biofuel cells, because laccase and bilirubin oxidase can individually catalyze four electron reduction of oxygen to water, whereas most anodic enzymes only do a single two electron oxidation of a complex fuel (i.e. glucose oxidase oxidizing glucose to gluconolactone while generating 2 electrons of the total 24 electrons), so enzyme cascades are typically needed for complete oxidation of the fuel. This review article will discuss the lessons learned from natural metabolic pathways about multi-step oxidation and how those lessons have been applied to minimal or artificial enzyme cascades. This article is part of a Special Issue entitled Biodesign for Bioenergetics--the design and engineering of electronic transfer cofactors, proteins and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson.

  20. Monoterpene biosynthesis potential of plant subcellular compartments

    NARCIS (Netherlands)

    Dong, L.; Jongedijk, E.J.; Bouwmeester, H.J.; Krol, van der A.R.

    2016-01-01

    Subcellular monoterpene biosynthesis capacity based on local geranyl diphosphate (GDP) availability or locally boosted GDP production was determined for plastids, cytosol and mitochondria. A geraniol synthase (GES) was targeted to plastids, cytosol, or mitochondria. Transient expression in Nicotiana

  1. Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis FlowersW

    NARCIS (Netherlands)

    Ginglinger, J.F.; Boachon, B.; Hofer, R.; Paetz, C.; Kollner, T.G.; Miesch, L.; Lugan, R.; Baltenweck, R.; Mutterer, J.; Ullman, P.; Verstappen, F.W.A.; Bouwmeester, H.J.

    2013-01-01

    The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus

  2. Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis FlowersW

    NARCIS (Netherlands)

    Ginglinger, J.F.; Boachon, B.; Hofer, R.; Paetz, C.; Kollner, T.G.; Miesch, L.; Lugan, R.; Baltenweck, R.; Mutterer, J.; Ullman, P.; Verstappen, F.W.A.; Bouwmeester, H.J.

    2013-01-01

    The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus

  3. Enzyme

    Science.gov (United States)

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  4. Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy

    DEFF Research Database (Denmark)

    Miotke, Laura; Maity, Arindam; Ji, Hanlee

    2015-01-01

    microscopy and nucleic acid analogues have been proposed so far. METHODS AND RESULTS: Here we report a novel enzyme-free approach to efficiently detect cancer mutations. This assay includes gene-specific target enrichment followed by annealing to oligonucleotides containing locked nucleic acids (LNAs...... 1000-fold above the potential detection limit. CONCLUSION: Overall, the novel assay we describe could become a new approach to rapid, reliable and enzyme-free diagnostics of cancer or other associated DNA targets. Importantly, stoichiometry of wild type and mutant targets is conserved in our assay...... of methods since they would allow rapid and relatively inexpensive detection of nucleic acids. Modern fluorescence microscopy is having a huge impact on detection of biomolecules at previously unachievable resolution. However, no straightforward methods to detect DNA in a non-enzymatic way using fluorescence...

  5. A comparison of new measurements of total monoterpene flux with improved measurements of speciated monoterpene flux

    Directory of Open Access Journals (Sweden)

    A. Lee

    2004-12-01

    Full Text Available Many monoterpenes have been identified in forest emissions using gas chromatography (GC. Until now, it has been impossible to determine whether all monoterpenes are appropriately measured using GC techniques. We used a proton transfer reaction mass spectrometer (PTR-MS coupled with the eddy covariance (EC technique to measure mixing ratios and fluxes of total monoterpenes above a ponderosa pine plantation. We compared PTR-MS-EC results with simultaneous measurements of eight speciated monoterpenes, β-pinene, α-pinene, 3-carene, d-limonene, β-phellandrene, α-terpinene, camphene, and terpinolene, made with an automated, in situ gas chromatograph with flame ionization detectors (GC-FID, coupled to a relaxed eddy accumulation system (REA. Monoterpene mixing ratios and fluxes measured by PTR-MS averaged 30±2.3% and 31±9.2% larger than by GC-FID, with larger differences at night than during the day. Four unidentified peaks that correlated with β-pinene were resolved in the chromatograms and completely accounted for the daytime difference and reduced the nighttime difference to 19±3.4%. Measurements of total monoterpenes by PTR-MS-EC indicated that GC-FID-REA measured the common, longer-lived monoterpenes well, but that additional monoterpenes were emitted from the ecosystem that represented an important contribution to the total mixing ratio above the forest at night, and that must have been oxidized during the day before they escaped the forest canopy.

  6. Using synthetic biology to screen for functional diversity of GH1 enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Deutsch, Sam; Datta, Supratim; Hamilton, Matthew; Friedland, Greg; D' Haeseleer, Patrik; Chen, Jan-Fang; Chivian, Dylan; Egan, Rob; Sale, Kenneth; Simmons, Blake; Rubin, Eddy

    2011-05-31

    Advances in next-generation sequencing technologies have enabled single genomes as well as complex environmental samples (metagenomes) to be comprehensively sequenced on a routine basis. Bioinformatics analysis of the resulting sequencing data reveals a continually expanding catalogue of predicted proteins ( 14 million as of April 2011), 75 percent of which are associated with functional annotation (COG, Pfam, Enzyme, Kegg, etc). These predicted proteins cover the full spectrum of known pathways and functional activities, including many novel biocatalysts that are expected to significantly contribute to the development of clean technologies including biomass degradation, lipid transformation for biodiesel generation, intermediates for polymer production, carbon capture, and bioremediation.

  7. Monoterpenes in the glandular trichomes of tomato are synthesized from a neryl diphosphate precursor rather than geranyl diphosphate.

    Science.gov (United States)

    Schilmiller, Anthony L; Schauvinhold, Ines; Larson, Matthew; Xu, Richard; Charbonneau, Amanda L; Schmidt, Adam; Wilkerson, Curtis; Last, Robert L; Pichersky, Eran

    2009-06-30

    We identified a cis-prenyltransferase gene, neryl diphosphate synthase 1 (NDPS1), that is expressed in cultivated tomato (Solanum lycopersicum) cultivar M82 type VI glandular trichomes and encodes an enzyme that catalyzes the formation of neryl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. mRNA for a terpene synthase gene, phellandrene synthase 1 (PHS1), was also identified in these glands. It encodes an enzyme that uses neryl diphosphate to produce beta-phellandrene as the major product as well as a variety of other monoterpenes. The profile of monoterpenes produced by PHS1 is identical with the monoterpenes found in type VI glands. PHS1 and NDPS1 map to chromosome 8, and the presence of a segment of chromosome 8 derived from Solanum pennellii LA0716 causes conversion from the M82 gland monoterpene pattern to that characteristic of LA0716 plants. The data indicate that, contrary to the textbook view of geranyl diphosphate as the "universal" substrate of monoterpene synthases, in tomato glands neryl diphosphate serves as a precursor for the synthesis of monoterpenes.

  8. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch

    Energy Technology Data Exchange (ETDEWEB)

    Say, R. [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Şenay, R. Hilal [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz [Anadolu University, Faculty of Science, Chemistry Department, Yunus Emre Campus, Eskişehir (Turkey); Akgöl, Sinan, E-mail: sinanakgol@yahoo.co.uk [Ege University, Faculty of Science, Biochemistry Department, 35100 Bornova-Izmir (Turkey); Denizli, Adil [Hacettepe University, Faculty of Science, Chemistry Department, 06532 Ankara (Turkey)

    2013-05-01

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. K{sub m} values were 0.26 and 0.87 mM and V{sub max} values were 0.36 IU mg{sup −1} and 22.32 IU mg{sup −1} for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70–80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst. - Highlights: ► Developing to prepare nanoprotein particles carrying α-amylase ► Characterization of nanostructured α-amylase ► Usability of α-amylase nanoparticles in hydrolysis of starch.

  9. Polymeric amylase nanoparticles as a new semi-synthetic enzyme system for hydrolysis of starch.

    Science.gov (United States)

    Say, R; Şenay, R Hilal; Biçen, Özlem; Ersöz, Arzu; Şişman Yılmaz, Filiz; Akgöl, Sinan; Denizli, Adil

    2013-05-01

    α-Amylase (EC 3.2.1.1; α-D-1,4,glucan glucanohydrolase) catalyzes the hydrolysis of α-D-(1,4)-glucosidic linkages in starch, glycogen, and various malto-oligosaccharides, by releasing α-anomeric products. In this study, a novel method has been developed to prepare nanoprotein particles that carry α-amylase as a monomer by using a photosensitive microemulsion polymerization process. The nanostructured α-amylase with photosensitive features have been characterized by fluorescence spectroscopy, transmission electron microscopy (TEM) and Zeta Sizer. The fluorescence intensity of amylase nanoparticles was determined to be 658 a.u. at 610 nm and the average particle size of nanoamylase was found to be about 71.8 nm. Both free α-amylase and nanoparticles were used in the hydrolysis of starch under varying reaction conditions such as pH and temperature that affect enzyme activity and the results were compared to each other. Km values were 0.26 and 0.87 mM and Vmax values were 0.36 IU mg(-1) and 22.32 IU mg(-1) for nanoenzyme and free enzyme, respectively. Then, thermal stability, storage stability and reusability were investigated and according to the results, activity was preserved 60% at 60 °C; 20% at 70-80 °C temperature values and 80% after 105 days storage. Finally after 10 cycles, the activity was preserved 90% and this novel enzymatic polymeric amylase nanoparticle has showed considerable potential as reusable catalyst.

  10. Cardiovascular effects of monoterpenes: a review

    Directory of Open Access Journals (Sweden)

    Márcio R. V. Santos

    2011-08-01

    Full Text Available The monoterpenes are secondary metabolites of plants. They have various pharmacological properties including antifungal, antibacterial, antioxidant, anticancer, anti-spasmodic, hypotensive, and vasorelaxant. The purpose of this research was to review the cardiovascular effects of monoterpenes. The data in this resarch were collected using the Internet portals Pubmed, Scopus, and ISI Web of Knowledge between the years 1987 and 2010. In the study 33 monoterpenes were included, which were related to each of the thirteen individual words: artery, cardiovascular, heart, myocyte, vasorelaxant, vessel, hypotension, hypotensive, cardiomyocyte, ventricular, vasodilatory, aorta, and aortic. The research utilized 22 articles published mainly in the journals Phytomedicine, Fundamental Clinical Pharmacology, Planta Medica, Life Science, European Journal of Pharmacology, and Brazilian Journal of Medical and Biological Research. Of the 33 monoterpenes studied surveyed, sixteen of them had already been studied for their effects on the cardiovascular system: carvacrol, citronellol, p-cymene, eucalyptol (1,8-cineole, linalool, menthol, myrtenal, myrtenol, α-pinene, rotundifolone (piperitenone oxide, sobrerol, thymol, α-limonene, α-terpinen-4-ol, α-terpineol, and perillyl alcohol. The main effects observed were vasorelaxation, decreased heart rate and blood pressure. This review showed that the monoterpenes may be considered promising agents for prevention or treatment of diseases of the cardiovascular system.

  11. Polyhydroxyalkanoates (PHA) production from synthetic waste using Pseudomonas pseudoflava: PHA synthase enzyme activity analysis from P. pseudoflava and P. palleronii.

    Science.gov (United States)

    Venkateswar Reddy, M; Mawatari, Yasuteru; Onodera, Rui; Nakamura, Yuki; Yajima, Yuka; Chang, Young-Cheol

    2017-03-04

    Synthetic wastewater (SW) at various carbon concentrations (5-60g/l) were evaluated for polyhydroxyalkanoates (PHA) production using the bacteria Pseudomonas pseudoflava. Bacteria showed highest PHA production with 20g/l (57±5%), and highest carbon removal at 5g/l (74±6%) concentrations respectively. Structure, molecular weight, and thermal properties of the produced PHA were evaluated using various analytical techniques. Bacteria produced homo-polymer [poly-3-hydroxybutyrate (P3HB)] when only acetate was used as carbon source; and it produced co-polymer [poly-(3-hydroxybutyrate-co-3-hydroxyvalerate) P(3HB-co-3HV)] by addition of co-substrate propionate. PHA synthase, the enzyme which produce PHA was extracted from two bacterial strains i.e., P. pseudoflava and P. palleronii and its molecular weight was analysed using SDS-PAGE. Protein concentration, and PHA synthase enzyme activity of P. pseudoflava and P. palleronii was carried out using spectrophotometer. Results denoted that P. pseudoflava can be used for degradation of organic carbon persistent in wastewaters and their subsequent conversion into PHA.

  12. A comparison of new measurements of total monoterpene flux with improved measurements of speciated monoterpene flux

    Directory of Open Access Journals (Sweden)

    A. Lee

    2005-01-01

    Full Text Available Many monoterpenes have been identified in forest emissions using gas chromatography (GC. Until now, it has been impossible to determine whether all monoterpenes are appropriately measured using GC techniques. We used a proton transfer reaction mass spectrometer (PTR-MS coupled with the eddy covariance (EC technique to measure mixing ratios and fluxes of total monoterpenes above a ponderosa pine plantation. We compared PTR-MS-EC results with simultaneous measurements of eight speciated monoterpenes, β-pinene, α-pinene, 3-carene, d-limonene, β-phellandrene, α-terpinene, camphene, and terpinolene, made with an automated, in situ gas chromatograph with flame ionization detectors (GC-FID, coupled to a relaxed eddy accumulation system (REA. Monoterpene mixing ratios and fluxes measured by PTR-MS averaged 30±2.3% and 31±9.2% larger than by GC-FID, with larger mixing ratio discrepancies between the two techniques at night than during the day. Two unidentified peaks that correlated with β-pinene were resolved in the chromatograms and completely accounted for the daytime difference and reduced the nighttime mixing ratio difference to 20±2.9%. Measurements of total monoterpenes by PTR-MS-EC indicated that GC-FID-REA measured the common, longer-lived monoterpenes well, but that additional terpenes were emitted from the ecosystem that represented an important contribution to the total mixing ratio above the forest at night.

  13. INHIBITORY POTENTIAL OF SOME SYNTHETIC CINNAMIC ACID DERIVATIVES TOWARDS TYROSINASE ENZYME

    Directory of Open Access Journals (Sweden)

    Lanny Hartanti

    2010-06-01

    Full Text Available Cinnamic acid is one of known tyrosinase inhibitors. This study investigated the inhibition of tyrosinase activity of some cinnamic acid derivatives, i.e. 4-buthoxy-cinnamic acid, 4-n-butylcinnamic acid and 4-phenylcinnamic acid. Each inhibitor used in this research had the same type of inhibition towards enzymatic activity, i.e. mixed type inhibition of competitive and non competitive type. The potential sequence of tyrosinase inhibition based on the ratio of its IC50 compared to cinnamic acid, from the lowest to the highest were 4-buthoxycinnamic acid, 4-phenylcinnamic acid and 4-n-butylcinnamic acid. Based on the obtained results of this research, it was disclosed that n-butyl substituent on para position did not increase the inhibition effect of cinnamic acid towards tyrosinase enzymatic reaction. But in the other hand, buthoxy and phenyl substituent on para position could increase the inhibition effect of cinnamic acid towards tyrosinase enzymatic reaction because buthoxy substituent increased the similarity of its structure with the substrate of enzymatic reaction while phenyl susbtituent blocked the substrate-enzyme reaction.   Keywords: tyrosinase; L-DOPA; inhibition kinetics; IC50, cinnamic acid

  14. Identification of the human P450 enzymes involved in the in vitro metabolism of the synthetic steroidal hormones Org 4060 and Org 30659

    NARCIS (Netherlands)

    Verhoeven, CHJ; Van Munster, TTM; Groothuis, GMM; Vos, RME; Rietjens, IMCM

    2002-01-01

    1. The type of human P450 enzymes involved in the in vitro metabolism of Org 4060 and Org 30659, two synthetic steroidal hormones currently under clinical development by NV Organon for use in oral contraceptive and hormone replacement therapy, was investigated. 2. Both steroids were mainly hydroxyla

  15. Inhibitory effects of monoterpenes on seed germination and seedling growth.

    Science.gov (United States)

    Kordali, Saban; Cakir, Ahmet; Sutay, Sunay

    2007-01-01

    Monoterpenes, the chemical constituents of essential oils found in plants, are known biologically active compounds. The present study was conducted to investigate the inhibitory effects of 30 monoterpenes including monoterpene hydrocarbons and oxygenated monoterpenes on seed germination and seedling growth of Amaranthus retroflexus, Chenopodium album and Rumex crispus under laboratory conditions. The monoterpenes were applied at contents of 10 and 20 microl for liquid compounds and 10 and 20 microg for solid compounds. The results show that most of the monoterpenes significantly inhibited seed germination and seedling growth of the tested plants. Oxygenated monoterpenes including beta-citronellol, nerol and terpinen-4-ol completely inhibited seed germination and seedling growth of all tested plants. Their inhibitory effects were also stronger than that of the herbicide 2,4-D. In general, monoterpenes were less effective against seed germination and seedling growth of C. album as compared with R. crispus and A. retroflexus. Phytotoxic effects of monoterpene hydrocarbons were found to be lower than those of oxygenated monoterpenes. The alcohol derivatives of oxygenated monoterpenes were also found to be more phytotoxic as compared with their acetate derivatives. Based on the present results, it can be concluded that the oxygenated monoterpenes can be used as potential bio-herbicides.

  16. Effect of a synthetic drilling fluid (IPAR) on antioxidant enzymes and peroxisome proliferation in the American lobster, Homarsus americanus

    Energy Technology Data Exchange (ETDEWEB)

    Hamoutene, D.; Payne, J.F.; Andrews, C.; Wells, J.; Guiney, J.

    2004-07-01

    The acute, sublethal toxicity of a synthetic paraffinic drilling fluid (IPAR) was examined in this study which exposed 2 sets of 14 lobsters to the substance. Synthetic-based muds (SBMs) make up the fluid component of drilling muds along with water-based muds (WBMs) and oil-based muds (OBMs). Although SBMs are proposed to replace OBMs, little is known about their environmental impact. IPAR, an ultra-pure isoalkane with no aromatics or sulphur compounds, is currently used in the Newfoundland offshore. This study examined the effect of IPAR on benthic crustacean because most of the wastes discharged from drilling platforms sediment quickly and the impact is greatest on benthic animals. The lobsters were injected with 1 mL of IPAR every 3 days, to a maximum of 5 mL. They were also exposed to very high levels of the fluid, which would not be expected under field conditions. Different aspects of lipid and protein metabolism were monitored along with the effect of IPAR on peroxisome proliferations and various serum and organ enzymes. The study showed that even at the high dose administered to the lobsters, the isoalkane mixture had no influence on peroxisome proliferation. Increased amounts of protein was found in claw muscles, but no increase was observed in gills, hepatopancreas or heart, suggesting no adverse impact of IPAR. A slight increase was also noted in serum aminotransferases. The study results are in agreement with the hypothesis that IPAR has little or no ecotoxicological potential. 32 refs., 3 tabs., 2 figs.

  17. Highly oxygenated monoterpenes from Chenopodium ambrosioides.

    Science.gov (United States)

    Ahmed, A A

    2000-07-01

    Three new monoterpenes (3-5) were isolated from an organic extract of the aerial parts of Chenopodium ambrosioides. Structures were established on the basis of MS and NMR spectroscopic ((1)H, (13)C, (1)H-(1)H COSY, HMQC and HMBC) data.

  18. Structural relationships and vasorelaxant activity of monoterpenes

    Directory of Open Access Journals (Sweden)

    Cardoso Lima Tamires

    2012-09-01

    Full Text Available Abstract Background and purpose of the study The hypotensive activity of the essential oil of Mentha x villosa and its main constituent, the monoterpene rotundifolone, have been reported. Therefore, our objective was to evaluate the vasorelaxant effect of monoterpenes found in medicinal plants and establish the structure-activity relationship of rotundifolone and its structural analogues on the rat superior mesenteric artery. Methods Contractions of the vessels were induced with 10 μM of phenylephine (Phe in rings with endothelium. During the tonic phase of the contraction, the monoterpenes (10-8 - 10-3, cumulatively were added to the organ bath. The extent of relaxation was expressed as the percentage of Phe-induced contraction. Results The results from the present study showed that both oxygenated terpenes (rotundifolone, (+-limonene epoxide, pulegone epoxide, carvone epoxide, and (+-pulegone and non-oxygenated terpene ((+-limonene exhibit relaxation activity. The absence of an oxygenated molecular structure was not a critical requirement for the molecule to be bioactive. Also it was found that the position of ketone and epoxide groups in the monoterpene structures influence the vasorelaxant potency and efficacy. Major conclusion The results suggest that the presence of functional groups in the chemical structure of rotundifolone is not essential for its vasorelaxant activity.

  19. Structural Relationships and Vasorelaxant Activity of Monoterpenes

    Directory of Open Access Journals (Sweden)

    Tamires Cardoso Lima

    2012-09-01

    Full Text Available Background and purpose of the study The hypotensive activity of the essential oil of Mentha x villosa and its main constituent, the monoterpene rotundifolone, have been reported. Therefore, our objective was to evaluate the vasorelaxant effect of monoterpenes found in medicinal plants and establish the structureactivity relationship of rotundifolone and its structural analogues on the rat superior mesenteric artery. Methods:Contractions of the vessels were induced with 10 muM of phenylephine (Phe in rings with endothelium. During the tonic phase of the contraction, the monoterpenes (10-8 - 10-3, cumulatively were added to the organ bath. The extent of relaxation was expressed as the percentage of Phe-induced contraction. Results:The results from the present study showed that both oxygenated terpenes (rotundifolone, (+- limonene epoxide, pulegone epoxide, carvone epoxide, and (+-pulegone and nonoxygenated terpene ((+-limonene exhibit relaxation activity. The absence of an oxygenated molecular structure was not a critical requirement for the molecule to be bioactive. Also it was found that the position of ketone and epoxide groups in the monoterpene structures influence the vasorelaxant potency and efficacy. Major conclusion The results suggest that the presence of functional groups in the chemical structure of rotundifolone is not essential for its vasorelaxant activity.

  20. Enzyme engineering: A synthetic biology approach for more effective library generation and automated high-throughput screening

    Science.gov (United States)

    Ebert, Maximilian C. C. J. C.; Mugford, Paul F.; Pelletier, Joelle N.

    2017-01-01

    The Golden Gate strategy entails the use of type IIS restriction enzymes, which cut outside of their recognition sequence. It enables unrestricted design of unique DNA fragments that can be readily and seamlessly recombined. Successfully employed in other synthetic biology applications, we demonstrate its advantageous use to engineer a biocatalyst. Hot-spots for mutations were individuated in three distinct regions of Candida antarctica lipase A (Cal-A), the biocatalyst chosen as a target to demonstrate the versatility of this recombination method. The three corresponding gene segments were subjected to the most appropriate method of mutagenesis (targeted or random). Their straightforward reassembly allowed combining products of different mutagenesis methods in a single round for rapid production of a series of diverse libraries, thus facilitating directed evolution. Screening to improve discrimination of short-chain versus long-chain fatty acid substrates was aided by development of a general, automated method for visual discrimination of the hydrolysis of varied substrates by whole cells. PMID:28178357

  1. Alcohol Selectivity in a Synthetic Thermophilic n-Butanol Pathway Is Driven by Biocatalytic and Thermostability Characteristics of Constituent Enzymes

    Science.gov (United States)

    Loder, Andrew J.; Zeldes, Benjamin M.; Garrison, G. Dale; Lipscomb, Gina L.; Adams, Michael W. W.

    2015-01-01

    n-Butanol is generated as a natural product of metabolism by several microorganisms, but almost all grow at mesophilic temperatures. A synthetic pathway for n-butanol production from acetyl coenzyme A (acetyl-CoA) that functioned at 70°C was assembled in vitro from enzymes recruited from thermophilic bacteria to inform efforts for engineering butanol production into thermophilic hosts. Recombinant versions of eight thermophilic enzymes (β-ketothiolase [Thl], 3-hydroxybutyryl-CoA dehydrogenase [Hbd], and 3-hydroxybutyryl-CoA dehydratase [Crt] from Caldanaerobacter subterraneus subsp. tengcongensis; trans-2-enoyl-CoA reductase [Ter] from Spirochaeta thermophila; bifunctional acetaldehyde dehydrogenase/alcohol dehydrogenase [AdhE] from Clostridium thermocellum; and AdhE, aldehyde dehydrogenase [Bad], and butanol dehydrogenase [Bdh] from Thermoanaerobacter sp. strain X514) were utilized to examine three possible pathways for n-butanol. These pathways differed in the two steps required to convert butyryl-CoA to n-butanol: Thl-Hbd-Crt-Ter-AdhE (C. thermocellum), Thl-Hbd-Crt-Ter-AdhE (Thermoanaerobacter X514), and Thl-Hbd-Crt-Ter-Bad-Bdh. n-Butanol was produced at 70°C, but with different amounts of ethanol as a coproduct, because of the broad substrate specificities of AdhE, Bad, and Bdh. A reaction kinetics model, validated via comparison to in vitro experiments, was used to determine relative enzyme ratios needed to maximize n-butanol production. By using large relative amounts of Thl and Hbd and small amounts of Bad and Bdh, >70% conversion to n-butanol was observed in vitro, but with a 60% decrease in the predicted pathway flux. With more-selective hypothetical versions of Bad and Bdh, >70% conversion to n-butanol is predicted, with a 19% increase in pathway flux. Thus, more-selective thermophilic versions of Bad, Bdh, and AdhE are needed to fully exploit biocatalytic n-butanol production at elevated temperatures. PMID:26253677

  2. 2,2-Diphenyl-1-picrylhydrazyl as a screening tool for recombinant monoterpene biosynthesis

    Science.gov (United States)

    2013-01-01

    Background Monoterpenes are a class of natural C10 compounds with a range of potential applications including use as fuel additives, fragrances, and chemical feedstocks. Biosynthesis of monoterpenes in heterologous systems is yet to reach commercially-viable levels, and therefore is the subject of strain engineering and fermentation optimization studies. Detection of monoterpenes typically relies on gas chromatography/mass spectrometry; this represents a significant analytical bottleneck which limits the potential to analyse combinatorial sets of conditions. To address this, we developed a high-throughput method for pre-screening monoterpene biosynthesis. Results An optimised DPPH assay was developed for detecting monoterpenes from two-phase microbial cultures using dodecane as the extraction solvent. The assay was useful for reproducible qualitative ranking of monoterpene concentrations, and detected standard preparations of myrcene and γ-terpinene dissolved in dodecane at concentrations as low as 10 and 15 μM, respectively, and limonene as low as 200 μM. The assay could not be used quantitatively due to technical difficulties in capturing the initial reaction rate in a multi-well plate and the presence of minor DPPH-reactive contaminants. Initially, limonene biosynthesis in Saccharomyces cerevisiae was tested using two different limonene synthase enzymes and three medium compositions. The assay indicated that limonene biosynthesis was enhanced in a supplemented YP medium and that the Citrus limon limonene synthase (CLLS) was more effective than the Mentha spicata limonene synthase (MSLS). GC-MS analysis revealed that the DPPH assay had correctly identified the best limonene synthase (CLLS) and culture medium (supplemented YP medium). Because only traces of limonene were detected in SD medium, we subsequently identified medium components that improved limonene production and developed a defined medium based on these findings. The best limonene titres obtained

  3. Product Variability of the ‘Cineole Cassette'Monoterpene Synthases of Related Nicotiana Species

    Institute of Scientific and Technical Information of China (English)

    Anke F(a)hnrich; Katrin Krause; Birgit Piechulla

    2011-01-01

    Nicotiana species of the section Alatae characteristically emit the floral scent compounds of the ‘cineole cassere' comprising 1,8-cineole,limonene,myrcene,α-pinene,β-pinene,sabinene,and α-terpineol.We successfully isolated genes of Nicotiana alata and Nicotiana langsdorfii that encoded enzymes,which produced the characteristic monoterpenes of this ‘cineole cassette' with α-terpineol being most abundant in the volatile spectra.The amino acid sequences of both terpineol synthases were 99% identical.The enzymes cluster in a monophyletic branch together with the closely related cineole synthase of Nicotiana suaveolens and monoterpene synthase 1 of Solanum lycopersicum.The cyclization reactions (α-terpineol to 1,8-cineole) of the terpineol synthases of N.alata and N.langsdorfii were less efficient compared to the ‘cineole cassette′ monoterpene synthases of Arabidopsis thaliana,N.suaveolens,Salvia fruticosa,Salvia officinalis,and Citrus unshiu.The terpineol synthases of N.alata and N.langsdorfii were localized in pistils and in the adaxial and abaxial epidermis of the petals.The enzyme activities reached their maxima at the second day after anthesis when flowers were fully opened and the enzyme activity in N.alata was highest at the transition from day to night (diurnal rhythm).

  4. Stereochemical mechanism of two sabinene hydrate synthases forming antipodal monoterpenes in thyme (Thymus vulgaris).

    Science.gov (United States)

    Krause, Sandra T; Köllner, Tobias G; Asbach, Julia; Degenhardt, Jörg

    2013-01-15

    The essential oil of Thymus vulgaris consists of a complex blend of mono- and sesquiterpenes that provides the plant with its characteristic aromatic odor. Several chemotypes have been described for thyme. In this study, we identified two enzymes of the sabinene hydrate chemotype which are responsible for the biosynthesis of its major monoterpene alcohols, (1S,2R,4S)-(Z)-sabinene hydrate and (1S,2S,4R)-(E)-sabinene hydrate. Both TPS6 and TPS7 are multiproduct enzymes that formed 16 monoterpenes and thus cover almost the whole monoterpene spectrum of the chemotype. Although the product spectra of both enzymes are similar, they form opposing enantiomers of their chiral products. Incubation of the enzymes with the potential reaction intermediates revealed that the stereospecificity of TPS6 and TPS7 is determined by the formation of the first intermediate, linalyl diphosphate. Since TPS6 and TPS7 shared an amino acid sequence identity of 85%, a mutagenesis study was employed to identify the amino acids that determine the stereoselectivity. One amino acid position had a major influence on the stereochemistry of the formed products. Based on comparative models of TPS6 and TPS7 protein structures with the GPP substrate docked in the active site pocket, the influence of this amino acid residue on the reaction mechanism is discussed.

  5. Capturing of the monoterpene olefin limonene produced in Saccharomyces cerevisiae.

    Science.gov (United States)

    Jongedijk, Esmer; Cankar, Katarina; Ranzijn, Jorn; van der Krol, Sander; Bouwmeester, Harro; Beekwilder, Jules

    2015-01-01

    Monoterpene olefins such as limonene are plant compounds with applications as flavouring and fragrance agents, as solvents and potentially also in polymer and fuel chemistry. We engineered baker's yeast Saccharomyces cerevisiae to express a (-)-limonene synthase from Perilla frutescens and a (+)-limonene synthase from Citrus limon. Both proteins were expressed either with their native plastid targeting signal or in a truncated form in which the plastidial sorting signal was removed. The yeast host strain for expression was AE9 K197G, which expresses a mutant Erg20 enzyme. This enzyme catalyses the formation of geranyl diphosphate, which is the precursor for monoterpenes. Several methods were tested to capture limonene produced by the yeast. Extraction from the culture medium by pentane, or by the addition of CaCl2 followed by solid-phase micro-extraction, did not lead to detectable limonene, indicating that limonene is rapidly lost from the culture medium. Volatile terpenes such as limonene may also be trapped in a dodecane phase added to the medium during fermentation. This method resulted in recovery of 0.028 mg/l (+)-limonene and 0.060 mg/l (-)-limonene in strains using the truncated Citrus and Perilla synthases, respectively. Trapping the headspace during culture of the limonene synthase-expressing strains resulted in higher titres, at 0.12 mg/l (+)-limonene and 0.49 mg/l (-)-limonene. These results show that the volatile properties of the olefins produced require specific methods for efficient recovery of these molecules from biotechnological production systems.

  6. Autotaxin, a synthetic enzyme of lysophosphatidic acid (LPA, mediates the induction of nerve-injured neuropathic pain

    Directory of Open Access Journals (Sweden)

    Chun Jerold

    2008-02-01

    Full Text Available Abstract Recently, we reported that lysophosphatidic acid (LPA induces long-lasting mechanical allodynia and thermal hyperalgesia as well as demyelination and upregulation of pain-related proteins through one of its cognate receptors, LPA1. In addition, mice lacking the LPA1 receptor gene (lpa1-/- mice lost these nerve injury-induced neuropathic pain behaviors and phenomena. However, since lpa1-/- mice did not exhibit any effects on the basal nociceptive threshold, it is possible that nerve injury-induced neuropathic pain and its machineries are initiated by LPA via defined biosynthetic pathways that involve multiple enzymes. Here, we attempted to clarify the involvement of a single synthetic enzyme of LPA known as autotaxin (ATX in nerve injury-induced neuropathic pain. Wild-type mice with partial sciatic nerve injury showed robust mechanical allodynia starting from day 3 after the nerve injury and persisting for at least 14 days, along with thermal hyperalgesia. On the other hand, heterozygous mutant mice for the autotaxin gene (atx+/-, which have 50% ATX protein and 50% lysophospholipase D activity compared with wild-type mice, showed approximately 50% recovery of nerve injury-induced neuropathic pain. In addition, hypersensitization of myelinated Aβ˜ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGafqOSdiMbaGaaaaa@2D83@- or Aδ-fiber function following nerve injury was observed in electrical stimuli-induced paw withdrawal tests using a Neurometer®. The hyperalgesia was completely abolished in lpa1-/- mice, and reduced by 50% in atx+/- mice. Taken together, these findings suggest that LPA biosynthesis through ATX is the source of LPA for LPA1 receptor-mediated neuropathic pain. Therefore, targeted inhibition of ATX-mediated LPA biosynthesis as well as

  7. Highly Oxygenated Monoterpenes from Eupatorium fortunei

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    A pair of epimers of highly-oxygenated monoterpenes were isolated from the traditional Chinese medicine Eupatorium fortunei. Their structures were elucidated on the basis of the spectral analysis as (1R*, 2S*, 3R*, 4R*, 6S*)-1, 2, 3, 6-tetrehydroxy-p-menthane (1) and (1S*,2S*, 3S*, 4R*, 6R*)-1, 2, 3, 6-tetrehydroxy-p-menthane (2).

  8. Development of new peptide synthetic method of enzyme using the extraction reactivity; Chushutsu hanno wo mochiita shiki pepuchido koso goseiho no kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    Hirata, Makoto [Oita University, Oita (Japan)

    1999-03-05

    Recently, taste and bioactivation of large number of oligopeptide become clear, and the development of the efficient synthetic method becomes the urgency. In the production process by conventional enzyme reaction which combined the crystallization, because the solubility of the product to the water which is reaction solvent is low, the yield remained at about 60%, and the problem of reaction inhibition of the product by the crystal had also been indicated. In the enzyme synthesis of the aspartame in which he is the representative oligopeptide, it aimed at the establishment of the new synthesis method which can improve yield and reaction rate, while the segregation enzyme was continuously utilized. In this synthetic method, supply of organic solvent which dissolved the substrate, extraction of the substrate from organic solvent to water phase, synthesis reaction by the segregation enzyme in water phase, extraction of the aspartame which is a product from water phase to organic solvent progress, and they continuously progress by one complete mixing reactor. The process which controlled these speeds and yields was quantitatively analyzed, and material balance style considering substrate, enzyme and mass transfer of the product and enzyme reaction speed was deduced. The optimum operating condition for improving yield and productivity of the purpose product using this solution was examined, and optimum supply concentration and agitation speed of aspartic acid which was a substrate were started, and the optimum operating condition which realizes the improvement in high yield and productivity over 90% of the aspartame was clarified. Like this, it is that this research adopts features of liquid Citrus nobilis two-phase partition for the enzyme synthesis of the aspartame, and it is considered that there is a value, because it is the creative research which verified that the productivity can be greatly improved by the utilization of the chemical-engineering technique, and

  9. Organization of monoterpene biosynthesis in Mentha. Immunocytochemical localizations of geranyl diphosphate synthase, limonene-6-hydroxylase, isopiperitenol dehydrogenase, and pulegone reductase.

    Science.gov (United States)

    Turner, Glenn W; Croteau, Rodney

    2004-12-01

    We present immunocytochemical localizations of four enzymes involved in p-menthane monoterpene biosynthesis in mint: the large and small subunits of peppermint (Mentha x piperita) geranyl diphosphate synthase, spearmint (Mentha spicata) (-)-(4S)-limonene-6-hydroxylase, peppermint (-)-trans-isopiperitenol dehydrogenase, and peppermint (+)-pulegone reductase. All were localized to the secretory cells of peltate glandular trichomes with abundant labeling corresponding to the secretory phase of gland development. Immunogold labeling of geranyl diphosphate synthase occurred within secretory cell leucoplasts, (-)-4S-limonene-6-hydroxylase labeling was associated with gland cell endoplasmic reticulum, (-)-trans-isopiperitenol dehydrogenase labeling was restricted to secretory cell mitochondria, while (+)-pulegone reductase labeling occurred only in secretory cell cytoplasm. We discuss this pathway compartmentalization in relation to possible mechanisms for the intracellular movement of monoterpene metabolites, and for monoterpene secretion into the extracellular essential oil storage cavity.

  10. Biosynthesis of ascaridole: iodide peroxidase-catalyzed synthesis of a monoterpene endoperoxide in soluble extracts of Chenopodium ambrosioides fruit.

    Science.gov (United States)

    Johnson, M A; Croteau, R

    1984-11-15

    Ascaridole, an asymmetric monoterpene endoperoxide with anthelmintic properties, occurs as a major constituent (60-80%) in the volatile oil of American wormseed fruit (Chenopodium ambrosioides: Chenopodiaceae), and as a lesser component in the leaf pocket oil of the boldo tree (Peumus boldus: Monimiaceae). Determination of optical activity and chromatographic resolution of naturally occurring ascaridole, and several synthetic derivatives, showed that both wormseed and boldo produce ascaridole in racemic form. The biosynthesis of ascaridole from the conjugated, symmetrical diene alpha-terpinene (a major component of the oil from wormseed) was shown to be catalyzed by a soluble iodide peroxidase isolated from homogenates of C. ambrosioides fruit and leaves. The enzymatic synthesis of ascaridole was confirmed by capillary gas-liquid chromatography and mass spectrometry of the product, which was also shown to be racemic. Optimal enzymatic activity occurred at pH 4.0 in the presence of 2.5 mM H2O2 and 1 mM NaI. Soluble enzyme extracts were fractionated by gel filtration on both Sephacryl S-300 and Sephadex G-100, and were shown to consist of a high-molecular-weight peroxidase component (Mr greater than 1,000,000, 30% of total activity) and two other peroxidase species having apparent molecular weights of 62,000 and 45,000 (major component). Peroxidase activity was susceptible to proteolytic destruction only after periodate treatment, suggesting an association of the enzyme(s) with polysaccharide material. Ascaridole biosynthesis from alpha-terpinene was inhibited by cyanide, catalase, and reducing agents, but not by compounds that trap superoxide or quench singlet oxygen. A peroxide transfer reaction initiated by peroxidase-generated I+ is proposed for the conversion of alpha-terpinene to ascaridole.

  11. Strategies for transgenic manipulation of monoterpene biosynthesis in plants.

    Science.gov (United States)

    Mahmoud, Soheil S; Croteau, Rodney B

    2002-08-01

    Monoterpenes, the C(10) isoprenoids, are a large family of natural products that are best known as constituents of the essential oils and defensive oleoresins of aromatic plants. In addition to ecological roles in pollinator attraction, allelopathy and plant defense, monoterpenes are used extensively in the food, cosmetic and pharmaceutical industries. The importance of these plant products has prompted the definition of many monoterpene biosynthetic pathways, the cloning of the relevant genes and the development of genetic transformation techniques for agronomically significant monoterpene-producing plants. Metabolic engineering of monoterpene biosynthesis in the model plant peppermint has resulted in yield increase and compositional improvement of the essential oil, and also provided strategies for manipulating flavor and fragrance production, and plant defense.

  12. Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

    Science.gov (United States)

    Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

    2010-07-01

    Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

  13. Optimization of a synthetic mixture composed of major Trichoderma reesei enzymes for the hydrolysis of steam-exploded wheat straw

    Directory of Open Access Journals (Sweden)

    Billard Hélène

    2012-02-01

    Full Text Available Abstract Background An efficient hydrolysis of lignocellulosic substrates to soluble sugars for biofuel production necessitates the interplay and synergistic interaction of multiple enzymes. An optimized enzyme mixture is crucial for reduced cost of the enzymatic hydrolysis step in a bioethanol production process and its composition will depend on the substrate and type of pretreatment used. In the present study, an experimental design was used to determine the optimal composition of a Trichoderma reesei enzyme mixture, comprising the main cellulase and hemicellulase activities, for the hydrolysis of steam-exploded wheat straw. Methods Six enzymes, CBH1 (Cel7a, CBH2 (Cel6a, EG1 (Cel7b, EG2 (Cel5a, as well as the xyloglucanase Cel74a and the xylanase XYN1 (Xyl11a were purified from a T. reesei culture under lactose/xylose-induced conditions. Sugar release was followed in milliliter-scale hydrolysis assays for 48 hours and the influence of the mixture on initial conversion rates and final yields is assessed. Results The developed model could show that both responses were strongly correlated. Model predictions suggest that optimal hydrolysis yields can be obtained over a wide range of CBH1 to CBH2 ratios, but necessitates a high proportion of EG1 (13% to 25% which cannot be replaced by EG2. Whereas 5% to 10% of the latter enzyme and a xylanase content above 6% are required for highest yields, these enzymes are predicted to be less important in the initial stage of hydrolysis. Conclusions The developed model could reliably predict hydrolysis yields of enzyme mixtures in the studied domain and highlighted the importance of the respective enzyme components in both the initial and the final hydrolysis phase of steam-exploded wheat straw.

  14. Enhanced pyridoxal 5'-phosphate synthetic enzyme immunoreactivities do not contribute to GABAergic inhibition in the rat hippocampus following pilocarpine-induced status epilepticus.

    Science.gov (United States)

    Kwak, S-E; Kim, J-E; Kim, D-W; Kwon, O-S; Choi, S-Y; Kang, T-C

    2009-03-31

    To comprehend the role of pyridoxal 5'-phosphate (PLP) in epilepsy or seizure, we investigated whether the expressions of two PLP synthetic enzymes (pyridoxal kinase, PLK; pyridoxine-5'-phosphate oxidase, PNPO) are altered in the hippocampus and whether changes in paired-pulse responses in the hippocampus are associated with altered PLP synthetic enzyme expressions following status epilepticus (SE). PLK and PNPO immunoreactivities were significantly increased in the rat hippocampus accompanied by reductions in paired-pulse inhibition at 1 day and 1 week after SE. Four weeks after SE, PLK and PNPO immunoreactivities in dentate granule cells were similar to those in control animals, while their immunoreactivities were markedly reduced in Cornu Ammonis 1 (CA1) pyramidal cells due to neuronal loss. Linear regression analysis identified a direct proportional relationship between PLK/PNPO immunoreactivity and normalized population spike amplitude ratio in the dentate gyrus and the CA1 region as excluded the data obtained from 4 weeks after SE. These findings indicate that the upregulation of PLK and PNPO immunoreactivities in principal neurons may not be involved in gamma-aminobutyric acid (GABA)ergic inhibition, but rather in enhanced excitability during epileptogenic periods.

  15. Monoterpenes from thyme (Thymus vulgaris) as potential mosquito repellents.

    Science.gov (United States)

    Park, Byeoung-Soo; Choi, Won-Sik; Kim, Jeong-Han; Kim, Kap-Ho; Lee, Sung-Eun

    2005-03-01

    Five monoterpenes (carvacrol, p-cymene, linalool, alpha-terpinene, and thymol) derived from the essential oil of thyme (Thymus vulgaris) were examined for their repellency against the mosquito Culex pipiens pallens. All 5 monoterpenes effectively repelled mosquitoes based on a human forearm bioassay. Alpha-terpinene and carvacrol showed significantly greater repellency than a commercial formulation, N,N-diethyl-m-methylbenzamide (deet), whereas thymol showed similar repellency to that of deet. The duration of repellency after application for all these monoterpenes was equal to or higher than that of deet. These findings indicate that a spray-type solution containing 2% alpha-terpinene may serve as an alternative mosquito repellent.

  16. Structure-function studies of BPP-BrachyNH2 and synthetic analogues thereof with Angiotensin I-Converting Enzyme

    DEFF Research Database (Denmark)

    Arcanjo, Daniel Dias Rufino; Vasconcelos, Andreanne Gomes; Nascimento, Lucas A

    2017-01-01

    The vasoactive proline-rich oligopeptide termed BPP-BrachyNH2 (H-WPPPKVSP-NH2) induces in vitro inhibitory activity of angiotensin I-converting enzyme (ACE) in rat blood serum. In the present study, the removal of N-terminal tryptophan or C-terminal proline from BPP-BrachyNH2 was investigated in ...

  17. Typical Monoterpenes as Insecticides and Repellents against Stored Grain Pests

    Directory of Open Access Journals (Sweden)

    Suelen L. Reis

    2016-02-01

    Full Text Available Five monoterpenes naturally occurring in essential oils were tested for their insecticidal and repellent activities against the bruchid beetle Callosobruchus maculatus and the maize weevil Sitophilus zeamais. The monoterpenes were highly efficient as inducers of mortality or repellency against both insect species. They were more efficient in their fumigant activity against C. maculatus than against S. zeamais, while this profile of action was inverted when considering the repellent activities. Eugenol was one the most effective fumigants against both insects and one the most effective repellent against C. maculatus, while citronellal and geranial were one the most effective repellents against S. zeamais. Functional and positional isomerism of the monoterpenes pairs appears to exert little or no influence on theirs effects, especially in case of repellency. The validation of the insecticidal/repellent efficacy of isolated monoterpenes may permit a more advantageous, rapid, economic and optimized approach to the identification of promising oils for commercial formulations when combined with ethnobotanical strategies.

  18. Two New Monoterpene Diglycosides from Winchia calophylla A. DC

    Institute of Scientific and Technical Information of China (English)

    Wei Ming ZHU; Bin Gui WANG; Wen Yi KANG; Xin HONG; Jun ZHOU; Xiao Jiang HAO

    2003-01-01

    Two new monoterpene diglycosides, wincaloside A (1) and wincaloside B (2), alongwith loganin (3) were isolated from the stem barks of Winchia calophylla A. DC. The structuresof 1 and 2 were established by spectroscopic and chemical methods.

  19. Assessment of the repellent effect of Lippia alba essential oil and major monoterpenes on the cattle tick Rhipicephalus microplus.

    Science.gov (United States)

    Lima, A da Silva; Carvalho, J F de; Peixoto, M G; Blank, A F; Borges, L M F; Costa Junior, L M

    2016-03-01

    The control of Rhipicephalus microplus (Ixodida: Ixodidae) is achieved using synthetic acaricides. However, resistant tick populations are widespread around the world. Plant essential oils can act as repellents, keeping ticks away from hosts and decreasing the selection pressure on synthetic acaricides. The aim of this study was to evaluate the in vitro repellent effect of Lippia alba essential oil on R. microplus larvae. Leaves from two L. alba genotypes maintained under the same agronomic and environmental conditions were collected. Essential oil was extracted by hydrodistillation and analysed by gas chromatography-mass spectrometry (GC-MS). The major monoterpenes detected in the chemical analysis were commercially acquired and tested. For the repellency test, a glass rod was vertically fixed to measure active climbing of approximately 30 R. microplus larvae aged 14-21 days in response to essential oils and monoterpenes. Repellency was evaluated at 1 h, 3 h and 5 h after treatment. Variation in repellent action was detected between the genotypes. The major monoterpenes identified in the essential oils (limonene and carvone) showed low repellent effects in comparison with intact essential oils. Thus, the present results showed that L. alba essential oil contains bioactive compounds with great repellent activity against ticks that varies according to the plant genotype.

  20. Crude soybean hull peroxidase treatment of phenol in synthetic and real wastewater: enzyme economy enhanced by Triton X-100.

    Science.gov (United States)

    Steevensz, Aaron; Madur, Sneha; Feng, Wei; Taylor, Keith E; Bewtra, Jatinder K; Biswas, Nihar

    2014-02-05

    Soybean peroxidase (SBP)-catalyzed removal of phenol from wastewater has been demonstrated as a feasible wastewater treatment strategy and a non-ionic surfactant, Triton X-100, has the potential for increasing the enzyme economy of the process. Systematic studies on the enzyme-surfactant system have been lacking as well as demonstration of its applicability to industrial wastewater. This paper addresses those two gaps, the latter based on real wastewater from alkyd resin manufacture. The minimum effective Triton X-100 concentrations for crude SBP-catalyzed phenol conversion (≥95%) over 1-10 mM showed a linear trend. To illustrate translation of such lab results to real-world samples, this data were used to optimize crude SBP needed for phenol conversion over that concentration range. Triton X-100 increases enzyme economy by 10- to 13-fold. This treatment protocol was directly applied to tote-scale (700-1000 L) treatment of alkyd resin wastewater, with phenol ranging from 7 to 28 mM and total organic carbon content of >40 g/L, using a crude SBP extract derived from dry soybean hulls by simple aqueous elution. This extract can be used to remove phenol from a complex industrial wastewater and the process is markedly more efficient in the presence of Triton X-100. The water is thus rendered amenable to conventional biological treatment whilst the hulls could still be used in feed, thus adding further value to the crop.

  1. Synthetic Biology for Cell-Free Biosynthesis: Fundamentals of Designing Novel In Vitro Multi-Enzyme Reaction Networks.

    Science.gov (United States)

    Morgado, Gaspar; Gerngross, Daniel; Roberts, Tania M; Panke, Sven

    2016-10-19

    Cell-free biosynthesis in the form of in vitro multi-enzyme reaction networks or enzyme cascade reactions emerges as a promising tool to carry out complex catalysis in one-step, one-vessel settings. It combines the advantages of well-established in vitro biocatalysis with the power of multi-step in vivo pathways. Such cascades have been successfully applied to the synthesis of fine and bulk chemicals, monomers and complex polymers of chemical importance, and energy molecules from renewable resources as well as electricity. The scale of these initial attempts remains small, suggesting that more robust control of such systems and more efficient optimization are currently major bottlenecks. To this end, the very nature of enzyme cascade reactions as multi-membered systems requires novel approaches for implementation and optimization, some of which can be obtained from in vivo disciplines (such as pathway refactoring and DNA assembly), and some of which can be built on the unique, cell-free properties of cascade reactions (such as easy analytical access to all system intermediates to facilitate modeling).

  2. Myometrial prostaglandin E2 synthetic enzyme mRNA expression: spatial and temporal variations with pregnancy and labour.

    Science.gov (United States)

    Sooranna, S R; Grigsby, P L; Engineer, N; Liang, Z; Sun, K; Myatt, L; Johnson, M R

    2006-10-01

    We have investigated the hypothesis that the expression of the enzymes involved in PGE(2) synthesis in the human uterus is co-ordinated. We have studied (i) the mRNA expression of the enzymes involved in PGE(2) synthesis [phospholipases (cPLA(2) and sPLA(2)), prostaglandin H synthase (PGHS)-2 and PG E synthases (PGES-1 and -2)] and their relationship to the expression of inflammatory cytokines in samples of myometrium obtained from pregnant women undergoing caesarean section (LSCS) either before or after the onset of labour at or before term; and (ii) the effect of IL-1beta, IL-6, TNF-alpha, PGE(2) and stretch on PGE(2) enzyme mRNA expression. We found that cPLA(2), sPLA(2) and PGHS-2 mRNA expression were greater in labour samples; cPLA(2), sPLA(2), PGHS-2, PGES-1 and -2 mRNA expression were greater in lower- than upper-segment samples; and there was no effect of gestational age. PGHS-2 mRNA levels correlated with those of PGES-1, cPLA(2), IL-1beta and IL-8; PGES-1 mRNA levels correlated with those of IL-1beta, IL-8 and cPLA(2). In primary cultures of uterine myocytes, cPLA(2) mRNA expression was increased by IL-1beta and IL-6; PGHS-2 mRNA expression was increased by IL-1beta, PGE(2) and stretch; and PGES-1 mRNA expression was increased by IL-1beta only. These data show that labour is associated with increased expression of the enzymes involved in PGE(2) synthesis and their expression is greater in the lower uterine segment. The presence of associations between the levels of PGE(2) enzyme mRNA expression and the effects of IL-1beta suggest that their expression is co-ordinated and that IL-1beta is the responsible factor.

  3. Antitumor Activity of Monoterpenes Found in Essential Oils

    Directory of Open Access Journals (Sweden)

    Marianna Vieira Sobral

    2014-01-01

    Full Text Available Cancer is a complex genetic disease that is a major public health problem worldwide, accounting for about 7 million deaths each year. Many anticancer drugs currently used clinically have been isolated from plant species or are based on such substances. Accumulating data has revealed anticancer activity in plant-derived monoterpenes. In this review the antitumor activity of 37 monoterpenes found in essential oils is discussed. Chemical structures, experimental models, and mechanisms of action for bioactive substances are presented.

  4. Synthetic Routes to Methylerythritol Phosphate Pathway Intermediates and Downstream Isoprenoids

    Science.gov (United States)

    Jarchow-Choy, Sarah K; Koppisch, Andrew T; Fox, David T

    2014-01-01

    Isoprenoids constitute the largest class of natural products with greater than 55,000 identified members. They play essential roles in maintaining proper cellular function leading to maintenance of human health, plant defense mechanisms against predators, and are often exploited for their beneficial properties in the pharmaceutical and nutraceutical industries. Most impressively, all known isoprenoids are derived from one of two C5-precursors, isopentenyl diphosphate (IPP) or dimethylallyl diphosphate (DMAPP). In order to study the enzyme transformations leading to the extensive structural diversity found within this class of compounds there must be access to the substrates. Sometimes, intermediates within a biological pathway can be isolated and used directly to study enzyme/pathway function. However, the primary route to most of the isoprenoid intermediates is through chemical catalysis. As such, this review provides the first exhaustive examination of synthetic routes to isoprenoid and isoprenoid precursors with particular emphasis on the syntheses of intermediates found as part of the 2C-methylerythritol 4-phosphate (MEP) pathway. In addition, representative syntheses are presented for the monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), triterpenes (C30) and tetraterpenes (C40). Finally, in some instances, the synthetic routes to substrate analogs found both within the MEP pathway and downstream isoprenoids are examined. PMID:25009443

  5. Atorvastatin induces bile acid-synthetic enzyme Cyp7a1 by suppressing FXR signaling in both liver and intestine in mice.

    Science.gov (United States)

    Fu, Zidong Donna; Cui, Julia Yue; Klaassen, Curtis D

    2014-12-01

    Statins are effective cholesterol-lowering drugs to treat CVDs. Bile acids (BAs), the end products of cholesterol metabolism in the liver, are important nutrient and energy regulators. The present study aims to investigate how statins affect BA homeostasis in the enterohepatic circulation. Male C57BL/6 mice were treated with atorvastatin (100 mg/kg/day po) for 1 week, followed by BA profiling by ultra-performance LC-MS/MS. Atorvastatin decreased BA pool size, mainly due to less BA in the intestine. Surprisingly, atorvastatin did not alter total BAs in the serum or liver. Atorvastatin increased the ratio of 12α-OH/non12α-OH BAs. Atorvastatin increased the mRNAs of the BA-synthetic enzymes cholesterol 7α-hydroxylase (Cyp7a1) (over 10-fold) and cytochrome P450 27a1, the BA uptake transporters Na⁺/taurocholate cotransporting polypeptide and organic anion transporting polypeptide 1b2, and the efflux transporter multidrug resistance-associated protein 2 in the liver. Noticeably, atorvastatin suppressed the expression of BA nuclear receptor farnesoid X receptor (FXR) target genes, namely small heterodimer partner (liver) and fibroblast growth factor 15 (ileum). Furthermore, atorvastatin increased the mRNAs of the organic cation uptake transporter 1 and cholesterol efflux transporters Abcg5 and Abcg8 in the liver. The increased expression of BA-synthetic enzymes and BA transporters appear to be a compensatory response to maintain BA homeostasis after atorvastatin treatment. The Cyp7a1 induction by atorvastatin appears to be due to suppressed FXR signaling in both the liver and intestine.

  6. Monoterpene metabolism. Cloning, expression, and characterization of (-)-isopiperitenol/(-)-carveol dehydrogenase of peppermint and spearmint.

    Science.gov (United States)

    Ringer, Kerry L; Davis, Edward M; Croteau, Rodney

    2005-03-01

    The essential oils of peppermint (Mentha x piperita) and spearmint (Mentha spicata) are distinguished by the oxygenation position on the p-menthane ring of the constitutive monoterpenes that is conferred by two regiospecific cytochrome P450 limonene-3- and limonene-6-hydroxylases. Following hydroxylation of limonene, an apparently similar dehydrogenase oxidizes (-)-trans-isopiperitenol to (-)-isopiperitenone in peppermint and (-)-trans-carveol to (-)-carvone in spearmint. Random sequencing of a peppermint oil gland secretory cell cDNA library revealed a large number of clones that specified redox-type enzymes, including dehydrogenases. Full-length dehydrogenase clones were screened by functional expression in Escherichia coli using a recently developed in situ assay. A single full-length acquisition encoding (-)-trans-isopiperitenol dehydrogenase (ISPD) was isolated. The (-)-ISPD cDNA has an open reading frame of 795 bp that encodes a 265-residue enzyme with a calculated molecular mass of 27,191. Nondegenerate primers were designed based on the (-)-trans-ISPD cDNA sequence and employed to screen a spearmint oil gland secretory cell cDNA library from which a 5'-truncated cDNA encoding the spearmint homolog, (-)-trans-carveol-dehydrogenase, was isolated. Reverse transcription-PCR amplification and RACE were used to acquire the remaining 5'-sequence from RNA isolated from oil gland secretory cells of spearmint leaf. The full-length spearmint dehydrogenase shares >99% amino acid identity with its peppermint homolog and both dehydrogenases are capable of utilizing (-)-trans-isopiperitenol and (-)-trans-carveol. These isopiperitenol/carveol dehydrogenases are members of the short-chain dehydrogenase/reductase superfamily and are related to other plant short-chain dehydrogenases/reductases involved in secondary metabolism (lignan biosynthesis), stress responses, and phytosteroid biosynthesis, but they are quite dissimilar (approximately 13% identity) to the monoterpene

  7. Polyol monoterpenes isolated from Chenopodium ambrosioides.

    Science.gov (United States)

    Hou, Shu-Qun; Li, Yan-Hong; Huang, Xiang-Zhong; Li, Rong; Lu, Huai; Tian, Kai; Ruan, Rong-Sheng; Li, Yu-Kui

    2017-04-12

    Phytochemical study on the 95% ethyl alcohol extract of stems of Chenopodium ambrosioides resulted in the isolation of two new polyol monoterpenes, 4-hydroxy-4(α or β)-isopropyl-2-methyl-2-cyclohexen-1-one (1) and 1-methyl-4β- isopropyl-1-cyclohexene-4α,5α,6α-triol (2), together with five known compounds, (1S,2S,3R,4S)-1-methyl-4-(propan-2-yl)cyclohexane-1,2,3,4-tetrol (3), (1R,2S,3S,4S)- 1,2,3,4-tetrahydroxy-p-menthane (4), (1R,2S)-3-p-menthen-1,2-diol (5), (1R,4S)-p- menth-2-en-1-ol (6) and 1,4-dihydroxy-p-menth-2-ene (7). The structures of the new compounds were established on the basis of detailed spectroscopic evidence including extensive 1D and 2D NMR techniques. Compounds 1-7 were evaluated for their anti-inflammatory activity, and compound 1 showed moderate ability to inhibit NO production of LPS-stimulated RAW 264.7 macrophages with an IC50 value of 16.83 μM.

  8. Organization of Monoterpene Biosynthesis in Mentha. Immunocytochemical Localizations of Geranyl Diphosphate Synthase, Limonene-6-Hydroxylase, Isopiperitenol Dehydrogenase, and Pulegone Reductase1

    Science.gov (United States)

    Turner, Glenn W.; Croteau, Rodney

    2004-01-01

    We present immunocytochemical localizations of four enzymes involved in p-menthane monoterpene biosynthesis in mint: the large and small subunits of peppermint (Mentha x piperita) geranyl diphosphate synthase, spearmint (Mentha spicata) (−)-(4S)-limonene-6-hydroxylase, peppermint (−)-trans-isopiperitenol dehydrogenase, and peppermint (+)-pulegone reductase. All were localized to the secretory cells of peltate glandular trichomes with abundant labeling corresponding to the secretory phase of gland development. Immunogold labeling of geranyl diphosphate synthase occurred within secretory cell leucoplasts, (−)-4S-limonene-6-hydroxylase labeling was associated with gland cell endoplasmic reticulum, (−)-trans-isopiperitenol dehydrogenase labeling was restricted to secretory cell mitochondria, while (+)-pulegone reductase labeling occurred only in secretory cell cytoplasm. We discuss this pathway compartmentalization in relation to possible mechanisms for the intracellular movement of monoterpene metabolites, and for monoterpene secretion into the extracellular essential oil storage cavity. PMID:15542490

  9. Isolation and expression of cytochrome P450 genes in the antennae and gut of pine beetle Dendroctonus rhizophagus (Curculionidae: Scolytinae) following exposure to host monoterpenes.

    Science.gov (United States)

    Cano-Ramírez, Claudia; López, María Fernanda; Cesar-Ayala, Ana K; Pineda-Martínez, Verónica; Sullivan, Brian T; Zúñiga, Gerardo

    2013-05-10

    Bark beetles oxidize the defensive monoterpenes of their host trees both to detoxify them and convert them into components of their pheromone system. This oxidation is catalyzed by cytochrome P450 enzymes and occurs in different tissues of the insect, including the gut (i.e., the site where the beetle's pheromones are produced and accumulated) and the antennae (i.e., the olfactory organs used for perception of airborne defensive monoterpenes as well as other host-associated compounds and pheromones). We identified ten new CYP genes in the pine beetle Dendroctonus rhizophagus in either antennae or gut tissue after stimulation with the vapors of major host monoterpenes α-pinene, β-pinene and 3-carene. Five genes belong to the CYP4 family, four to the CYP6 family and one to the CYP9 family. Differential expression of almost all of the CYP genes was observed between sexes, and within these significant differences among time, stimuli, anatomical region, and their interactions were found upon exposure to host monoterpenes. Increased expression of cytochrome P450 genes suggests that they play a role in the detoxification of monoterpenes released by this insect's host trees. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  11. Expression of spearmint limonene synthase in transgenic spike lavender results in an altered monoterpene composition in developing leaves.

    Science.gov (United States)

    Muñoz-Bertomeu, Jesús; Ros, Roc; Arrillaga, Isabel; Segura, Juan

    2008-01-01

    We generated transgenic spike lavender (Lavandula latifolia) plants constitutively expressing the limonene synthase (LS) gene from spearmint (Mentha spicata), encoding the LS enzyme that catalyzes the synthesis of limonene from geranyl diphosphate. Overexpression of the LS transgene did not consistently affect monoterpene profile in pooled leaves or flowers from transgenic T(0) plants. Analyses from cohorts of leaves sampled at different developmental stages showed that essential oil accumulation in transgenic and control plants was higher in developing than in mature leaves. Furthermore, developing leaves of transgenic plants contained increased limonene contents (more than 450% increase compared to controls) that correlated with the highest transcript accumulation of the LS gene. The levels of other monoterpene pathway components were also significantly altered. T(0) transgenic plants were grown for 2 years, self-pollinated, and the T(1) seeds obtained. The increased limonene phenotype was maintained in the progenies that inherited the LS transgene.

  12. Synthetic glycosylation of proteins using N-(beta-saccharide) iodoacetamides: applications in site-specific glycosylation and solid-phase enzymic oligosaccharide synthesis.

    Science.gov (United States)

    Wong, S Y; Guile, G R; Dwek, R A; Arsequell, G

    1994-06-15

    A simple and efficient synthetic glycosylation method suitable for use in solid-phase enzymic oligosaccharide synthesis and site-specific glycosylation of recombinant proteins to produce defined glycoforms is described. This strategy utilizes N-(beta-saccharide) haloacetamides for attaching oligosaccharides specifically to cysteine residues of proteins in solution to form neoglycoproteins. The alkylation reaction was tested using N-(beta-chitotriose) bromoacetamide and an unprotected synthetic hexapeptide containing a single cysteine residue. The glycosylated product was confirmed by amino acid and hexosamine analyses as well as laser desorption mass spectrometry. Similarly N-(beta-chitotriose) iodoacetamide was covalently linked to non-reduced BSA to produce a defined glycoform of this protein. The specific attachment of chitotriose at the single cysteine residue in non-reduced serum albumin was suggested by Ellman's assay for free thiols. This was verified by amino acid sequencing of tryptic glycopeptide derived from this neoglycoprotein. Multiple sugar attachment was accomplished using fully reduced serum albumin as demonstrated by the formation of two neoglycoproteins using iodoacetamide derivatives of galactose beta 1-3-N-acetylgalactosamine (Gal beta 1-3GalNAc) and the major xylose/fucose-class plant-type oligosaccharide of horseradish peroxidase. These two neoglycoproteins with an average of 18-21 sugar residues attached were assayed positively for binding to peanut agglutinin and a sugar-specific anti-(horseradish peroxidase) monoclonal antibody YZ1/2.23 respectively. Sialylation of the neoglycoprotein containing Gal beta 1-3GalNAc was accomplished using alpha-2,3-sialyltransferase and radiolabelled CMP-N-acetylneuraminic acid. Significantly, glycan attachment using this conjugation method is reversible as demonstrated by the release of oligosaccharides from these two neoglycoproteins using hydrazinolysis. Therefore this method could provide invaluable

  13. Factors affecting the emission of monoterpenes from red pine (Pinus densiflora)

    Energy Technology Data Exchange (ETDEWEB)

    Yokouchi, Y.; Ambe, Y.

    1984-08-01

    The mechanism of monoterpene emission from Pinus densiflora was studied using an environmentally controlled gas cabinet. It was found that monoterpene emission rate increases exponentially with temperature and is also influenced by light. These observations were explained reasonably by a mechanism whereby monoterpene emission rate depends on the monoterpene amount in the leaf oil and its saturated vapor pressure. 14 references, 2 figures, 1 table.

  14. Do monoterpenes released from feverfew (Tanacetum parthenium) plants cause airborne Compositae dermatitis?

    DEFF Research Database (Denmark)

    Paulsen, E.; Christensen, Lars Porskjær; Andersen, K.E.

    2002-01-01

    and parthenolide were tested with 15 selected monoterpenes and 2 sesquiterpenes. Of the 17 persons, 13 had positive and/or doubtful positive reactions to 1 or more monoterpenes. Only 1 person was allergic to several monoterpenes. Her history of gradually worsening Compositae dermatitis culminating in a probable...

  15. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  16. Monoterpene synthases from grand fir (Abies grandis). cDNA isolation, characterization, and functional expression of myrcene synthase, (-)-(4S)-limonene synthase, and (-)-(1S,5S)-pinene synthase.

    Science.gov (United States)

    Bohlmann, J; Steele, C L; Croteau, R

    1997-08-29

    Grand fir (Abies grandis) has been developed as a model system for studying defensive oleoresin formation in conifers in response to insect attack or other injury. The turpentine fraction of the oleoresin is a complex mixture of monoterpene (C10) olefins in which (-)-limonene and (-)-alpha- and (-)-beta-pinene are prominent components; (-)-limonene and (-)-pinene synthase activities are also induced upon stem wounding. A similarity based cloning strategy yielded three new cDNA species from a wounded stem cDNA library that appeared to encode three distinct monoterpene synthases. After expression in Escherichia coli and enzyme assay with geranyl diphosphate as substrate, subsequent analysis of the terpene products by chiral phase gas chromatography and mass spectrometry showed that these sequences encoded a (-)-limonene synthase, a myrcene synthase, and a (-)-pinene synthase that produces both alpha-pinene and beta-pinene. In properties and reaction stereochemistry, the recombinant enzymes resemble the corresponding native monoterpene synthases of wound-induced grand fir stem. The deduced amino acid sequences indicated the limonene synthase to be 637 residues in length (73.5 kDa), the myrcene synthase to be 627 residues in length (72.5 kDa), and the pinene synthase to be 628 residues in length (71.5 kDa); all of these monoterpene synthases appear to be translated as preproteins bearing an amino-terminal plastid targeting sequence. Sequence comparison revealed that these monoterpene synthases from grand fir resemble sesquiterpene (C15) synthases and diterpene (C20) synthases from conifers more closely than other monoterpene synthases from angiosperm species. This similarity between extant monoterpene, sesquiterpene, and diterpene synthases of gymnosperms is surprising since functional diversification of this enzyme class is assumed to have occurred over 300 million years ago. Wound-induced accumulation of transcripts for monoterpene synthases was demonstrated by RNA

  17. Demonstration that limonene is the first cyclic intermediate in the biosynthesis of oxygenated p-menthane monoterpenes in Mentha piperita and other Mentha species

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.; Kjonaas, R.

    1983-01-01

    The volatile oil of mature Mentha piperita (peppermint) leaves contains as major components the oxygenated p-menthane monoterpenes l-menthol (47%) and l-menthone (24%) as well as very low levels of the monoterpene olefins limonene (1%) and terpinolene (0.1%), which are considered to be probable precursors of the oxygenated derivatives. Immature leaves, which are actively synthesizing monoterpenes, produce an oil with comparatively higher levels of limonene approx.3%), and isolation of the pure olefin showed this compound to consist of approx.80% of the l-(4S)-enantiomer and approx.20% of the d-(4R)-enantiomer. The time course of incorporation of (U-/sup 14/C)sucrose into the monoterpenes of M. piperita shoot tips was consistent with the inital formation of limonene and its subsequent conversion to menthone via pulegone. d,l-(9-/sup 3/H)Limonene and (9,10-/sup 3/H)terpinolene were prepared and tested directly as precursors of oxygenated p-menthane monoterpenes in M. piperita shoot tips. Limonene was readily incorporated into pulegone, menthone, and other oxygenated derivatives, whereas terpinolene was not appreciably incorporated into these compounds. Similarly, d,l-(9-/sup 3/H)limonene was specifically incorporated into pulegone in Mentha pulegium and into the C-2-oxygenated derivative carvone in Mentha spicata, confirming the role of this olefin as the essential precursor of oxygenated p-menthane monoterpenes. Soluble enzyme preparations from the epidermis of immature M. piperita leaves converted the acyclic terpenoid precursor (1-/sup 3/H)geranyl pyrophosphate to limonene as the major cyclic product.

  18. Monoterpene Glycosides from the Roots of Paeonia lactiflora

    Institute of Scientific and Technical Information of China (English)

    Xiao Ling WANG; Wei JIAO; Xun LIAO; Shu Ling PENG; Li Sheng DING

    2006-01-01

    A new monoterpene glycoside, together with nine known ones, 3-O-methylpaeoniflorin,mudanpioside J, paeoniflorin, benzoylpaeoniflorin, oxypaeoniflorin, benzoyloxypaeoniflorin,oxybenzoylpaeoniflorin, albiflorin and lactiflorin, was isolated from the roots of Paeonia lactiflora Pall.. The structure of the new compound was elucidated as galloylalbiflorin by the spectroscopic evidence including ESI-MS, 1D- and 2D-NMR spectra.

  19. A Concise Synthesis of Monoterpene Pyridine Alkaloid Aucubinine B

    Institute of Scientific and Technical Information of China (English)

    杨晓霞; 赵景瑞; 贾学顺; 杨力维; 翟宏斌

    2003-01-01

    Aucubinine B (4), a monoterpene alkaloid obtained from the metabolites of aucubin in the presence of human intestinal bacteria, has been synthesized from 3-bromo-4-pyridinecarboxaldehyde (5) in four steps with 39% overall yield. The construction of the cyclopenta[c]pyridine intermediate (7) was realized by an intramolecular Heck reaction.

  20. Investigation of Monoterpene Degradation in the Atmospheric Simulation Chamber SAPHIR

    Science.gov (United States)

    Kaminski, Martin; Acir, Ismail-Hakki; Bohn, Birger; Brauers, Theo; Dorn, Hans-Peter; Fuchs, Hendrik; Haeseler, Rolf; Hofzumahaus, Andreas; Li, Xin; Lutz, Anna; Nehr, Sascha; Rohrer, Franz; Tillmann, Ralf; Wegener, Robert; Wahner, Andreas

    2013-04-01

    Monoterpenes are the volatile organic compound (VOC) species with the highest emission rates on a global scale beside isoprene. In the atmosphere these compounds are rapidly oxidized. Due to their high reactivity towards hydroxyl radicals (OH) they determine the radical chemistry under biogenic conditions if monoterpene concentration is higher than isoprene concentration. Recent field campaigns showed large discrepancies between measured and modeled OH concentration at low NOx conditions together with high reactivity of VOC towards OH (Hofzumahaus et al. 2009) especially in tropical forest areas (Lelieveld et al. 2008). These discrepancies were partly explained by new reaction pathways in the isoprene degradation mechanism (Whalley et al 2011). However, even an additional recycling rate of 2.7 was insufficient to explain the measured OH concentration. So other VOC species could be involved in a nonclassical OH recycling. Since the discrepancies in OH also occurred in the morning hours when the OH chemistry was mainly dominated by monoterpenes, it was assumed that also the degradation of monoterpenes may lead to OH recycling in the absence of NO. (Whalley et al 2011). The photochemical degradation of four monoterpene species was studied under high VOC reactivity and low NOx conditions in a dedicated series of experiments in the atmospheric simulation chamber SAPHIR from August to September 2012 to overcome the lack of mechanistic information for monoterpene degradation schemes. α-Pinene, β-pinene and limonene were chosen as most prominent representatives of this substance class. Moreover the degradation of myrcene was investigated due to its structural analogy to isoprene. The SAPHIR chamber was equipped with instrumentation to measure all important OH precursors (O3, HONO, HCHO), the parent VOC and their main oxidation products, radicals (OH, HO2, RO2), the total OH reactivity, and photolysis frequencies to investigate the degradation mechanism of monoterpenes in

  1. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

  2. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; El Tamer, M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the pe

  3. In situ localization of gene transcriptions for monoterpene synthesis in irregular parenchymic cells surrounding the secretory cavities in rough lemon (Citrus jambhiri).

    Science.gov (United States)

    Yamasaki, Yumiko; Akimitsu, Kazuya

    2007-11-01

    A cDNA (RlemispF) encoding 2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase, an enzyme of the methyl erythritol phosphate (MEP) pathway, and two homologs (RlemTPS1 and RlemTPS2) of citrus monoterpene synthase cDNA were isolated from the rough lemon (Citrus jambhiri). Transient localization of all or a part of RlemispF fused to a green fluorescence protein using particle gun-mediated DNA delivery localized RlemispF in the chloroplast. Transcripts of RlemispF and other monoterpene synthase genes are constitutively expressed in leaves of rough lemon. Transcript accumulations of RlemispF and RlemTPS1 were not induced by microbe attacks, but microbe attack weakly induced RlemTPS2 expression. Wounding decreased RlemispF expression. RlemispF and two different monoterpene synthase genes were specifically expressed in the epithelial tissue cells with dense cytoplasm that surround secretory cavities, which form a broadly round package containing a large volume of essential oils composed of monoterpenes. Interestingly, although expressions of RlemTPS1 and RlemTPS2 were detected at both mature and developing secretory cavities, the RlemispF-expressing cells were found more at around developing secretory cavities.

  4. A Review on Anti-Inflammatory Activity of Monoterpenes

    Directory of Open Access Journals (Sweden)

    Damião Pergentino de Sousa

    2013-01-01

    Full Text Available Faced with the need to find new anti-inflammatory agents, great effort has been expended on the development of drugs for the treatment of inflammation. This disorder reduces the quality of life and overall average productivity, causing huge financial losses. In this review the anti-inflammatory activity of 32 bioactive monoterpenes found in essential oils is discussed. The data demonstrate the pharmacological potential of this group of natural chemicals to act as anti-inflammatory drugs.

  5. The Antigerminative Activity of Twenty-Seven Monoterpenes

    Directory of Open Access Journals (Sweden)

    Laura De Martino

    2010-09-01

    Full Text Available Monoterpenes, the main constituents of essential oils, are known for their many biological activities. The present work studied the potential biological activity of twenty-seven monoterpenes, including monoterpene hydrocarbons and oxygenated ones, against seed germination and subsequent primary radicle growth of Raphanus sativus L. (radish and Lepidium sativum L. (garden cress, under laboratory conditions. The compounds, belonging to different chemical classes, showed different potency in affecting both parameters evaluated. The assayed compounds demonstrated a good inhibitory activity in a dose-dependent way. In general, radish seed is more sensitive than garden cress and its germination appeares more inhibited by alcohols; at the highest concentration tested, the more active substances were geraniol, borneol, (±-β-citronellol and α-terpineol. Geraniol and carvone inhibited, in a significant way, the germination of garden cress, at the highest concentration tested. Radicle elongation of two test species was inhibited mainly by alcohols and ketones. Carvone inhibited the radicle elongation of both seeds, at almost all concentrations assayed, while 1,8-cineole inhibited their radicle elongation at the lowest concentrations (10−5 M, 10−6 M.

  6. The antigerminative activity of twenty-seven monoterpenes.

    Science.gov (United States)

    De Martino, Laura; Mancini, Emilia; de Almeida, Luiz Fernando Rolim; De Feo, Vincenzo

    2010-09-21

    Monoterpenes, the main constituents of essential oils, are known for their many biological activities. The present work studied the potential biological activity of twenty-seven monoterpenes, including monoterpene hydrocarbons and oxygenated ones, against seed germination and subsequent primary radicle growth of Raphanus sativus L. (radish) and Lepidium sativum L. (garden cress), under laboratory conditions. The compounds, belonging to different chemical classes, showed different potency in affecting both parameters evaluated. The assayed compounds demonstrated a good inhibitory activity in a dose-dependent way. In general, radish seed is more sensitive than garden cress and its germination appeares more inhibited by alcohols; at the highest concentration tested, the more active substances were geraniol, borneol, (±)-β-citronellol and α-terpineol. Geraniol and carvone inhibited, in a significant way, the germination of garden cress, at the highest concentration tested. Radicle elongation of two test species was inhibited mainly by alcohols and ketones. Carvone inhibited the radicle elongation of both seeds, at almost all concentrations assayed, while 1,8-cineole inhibited their radicle elongation at the lowest concentrations (10(-5) M, 10(-6) M).

  7. Dynamics of monoterpene emissions in Pinus sylvestris during early spring

    Energy Technology Data Exchange (ETDEWEB)

    Baeck, J.; Hari, P.; Juurola, E. [Department of Forest Ecology, University of Helsinki (Finland); Hakola, H. [Finnish Meteorological Institute, Research and Development, Helsinki (Finland); Kulmala, M. [Department of Physical Sciences, University of Helsinki (Finland)

    2005-07-01

    The seasonal dynamics of biogenic volatile organic compound (BVOC) emissions, which can be related to the formation and growth of secondary organic aerosols, represent an important but at the present poorly understood linkage between vegetation activity and climate. Although a close relationship between photosynthesis and terpenoid emissions has been proposed, high monoterpene emission rates for Scots pine shoots (Pinus sylvestris) are frequently recorded during spring, in times when photosynthetic activity is strongly inhibited due to inherent seasonal restrictions. We suggest that terpenoid emissions are related to either photosynthesis or photorespiration for precursors for terpenoid biosynthesis. We developed two dynamic models describing temporal fluctuations in Scots pine monoterpene emissions, calculating the emissions by using CO{sub 2} exchange and ambient climate data. The models accurately predicted the measured monoterpene flux, and especially in March-April, during the time when photosynthesis was negligible and ambient temperatures were between -5 and +15 C, a good agreement was found with measured emissions and the model involving photorespiration. (orig.)

  8. Oxygenated VOC and monoterpene emissions from a boreal coniferous forest

    Science.gov (United States)

    Taipale, R.; Rantala, P.; Kajos, M. K.; Patokoski, J.; Ruuskanen, T. M.; Aalto, J.; Kolari, P.; Bäck, J.; Hari, P.; Kulmala, M.; Rinne, J.

    2012-04-01

    Compared with terpenoids, emissions of oxygenated volatile organic compounds (VOCs) from boreal ecosystems have been poorly characterized. We measured ecosystem scale emissions of three oxygenated compounds (methanol, acetaldehyde, and acetone) and monoterpenes from a Scots pine dominated forest in southern Finland during the summers 2006-2008. The measurements were conducted using the disjunct eddy covariance method combined with proton transfer reaction mass spectrometry. The contribution of the three oxygenated compounds to the measured total emissions was 40-60 %. The highest oxygenated VOC emissions were those of methanol, comprising 20-30 % of the total, followed by acetone with a share of 10-20 %. The acetaldehyde emissions were 5-10 % of the total. This emission composition will be compared with that obtained from shoot enclosure measurements. Methanol showed deposition during some periods although its overall flux was towards the atmosphere. The monoterpene emissions had a light dependent component, suggesting that part of the emissions originated directly from monoterpene biosynthesis. Diurnal, seasonal, and inter-annual variations in the emissions, along with temperature and light dependencies, will be discussed.

  9. Monoterpene Metabolism. Cloning, Expression, and Characterization of (−)-Isopiperitenol/(−)-Carveol Dehydrogenase of Peppermint and Spearmint1

    Science.gov (United States)

    Ringer, Kerry L.; Davis, Edward M.; Croteau, Rodney

    2005-01-01

    The essential oils of peppermint (Mentha x piperita) and spearmint (Mentha spicata) are distinguished by the oxygenation position on the p-menthane ring of the constitutive monoterpenes that is conferred by two regiospecific cytochrome P450 limonene-3- and limonene-6-hydroxylases. Following hydroxylation of limonene, an apparently similar dehydrogenase oxidizes (−)-trans-isopiperitenol to (−)-isopiperitenone in peppermint and (−)-trans-carveol to (−)-carvone in spearmint. Random sequencing of a peppermint oil gland secretory cell cDNA library revealed a large number of clones that specified redox-type enzymes, including dehydrogenases. Full-length dehydrogenase clones were screened by functional expression in Escherichia coli using a recently developed in situ assay. A single full-length acquisition encoding (−)-trans-isopiperitenol dehydrogenase (ISPD) was isolated. The (−)-ISPD cDNA has an open reading frame of 795 bp that encodes a 265-residue enzyme with a calculated molecular mass of 27,191. Nondegenerate primers were designed based on the (−)-trans-ISPD cDNA sequence and employed to screen a spearmint oil gland secretory cell cDNA library from which a 5′-truncated cDNA encoding the spearmint homolog, (−)-trans-carveol-dehydrogenase, was isolated. Reverse transcription-PCR amplification and RACE were used to acquire the remaining 5′-sequence from RNA isolated from oil gland secretory cells of spearmint leaf. The full-length spearmint dehydrogenase shares >99% amino acid identity with its peppermint homolog and both dehydrogenases are capable of utilizing (−)-trans-isopiperitenol and (−)-trans-carveol. These isopiperitenol/carveol dehydrogenases are members of the short-chain dehydrogenase/reductase superfamily and are related to other plant short-chain dehydrogenases/reductases involved in secondary metabolism (lignan biosynthesis), stress responses, and phytosteroid biosynthesis, but they are quite dissimilar (approximately 13

  10. Demonstration that limonene is the first cyclic intermediate in the biosynthesis of oxygenated p-menthane monoterpenes in Mentha piperita and other Mentha species.

    Science.gov (United States)

    Kjonaas, R; Croteau, R

    1983-01-01

    The volatile oil of mature Mentha piperita (peppermint) leaves contains as major components the oxygenated p-menthane monoterpenes l-menthol (47%) and l-menthone (24%) as well as very low levels of the monoterpene olefins limonene (1%) and terpinolene (0.1%), which are considered to be probable precursors of the oxygenated derivatives. Immature leaves, which are actively synthesizing monoterpenes, produce an oil with comparatively higher levels of limonene (approximately 3%), and isolation of the pure olefin showed this compound to consist of approximately 80% of the l-(4S)-enantiomer and approximately 20% of the d-(4R)-enantiomer. The time course of incorporation of [U-14C]sucrose into the monoterpenes of M. piperita shoot tips was consistent with the initial formation of limonene and its subsequent conversion to menthone via pulegone. d,l-[9-3H]Limonene and [9,10-3H]terpinolene were prepared and tested directly as precursors of oxygenated p-menthane monoterpenes in M. piperita shoot tips. Limonene was readily incorporated into pulegone, menthone, and other oxygenated derivatives, whereas terpinolene was not appreciably incorporated into these compounds. Similarly, d,l-[9-3H]limonene was specifically incorporated into pulegone in Mentha pulegium and into the C-2-oxygenated derivative carvone in Mentha spicata, confirming the role of this olefin as the essential precursor of oxygenated p-menthane monoterpenes. Soluble enzyme preparations from the epidermis of immature M. piperita leaves converted the acyclic terpenoid precursor [1-3H]geranyl pyrophosphate to limonene as the major cyclic product, providing a further indication that this olefin plays a central role in the formation of oxygenated monoterpenes in Mentha. No free intermediates were detected in the cyclization of geranyl pyrophosphate to limonene, suggesting that the olefin is the first cyclic intermediate to arise in the pathway, and resolution of the biosynthetic limonene, by crystallization of the

  11. The effects of increasing atmospheric ozone on biogenic monoterpene profiles and the formation of secondary aerosols

    Science.gov (United States)

    Pinto, Delia M.; Tiiva, Päivi; Miettinen, Pasi; Joutsensaari, Jorma; Kokkola, Harri; Nerg, Anne-Marja; Laaksonen, Ari; Holopainen, Jarmo K.

    Monoterpenes are biogenic volatile organic compounds (BVOCs) which play an important role in plant adaptation to stresses, atmospheric chemistry, plant-plant and plant-insect interactions. In this study, we determined whether ozonolysis can influence the monoterpenes in the headspace of cabbage. The monoterpenes were mixed with an air-flow enriched with 100, 200 or 400 ppbv of ozone (O 3) in a Teflon chamber. The changes in the monoterpene and O 3 concentrations, and the formation of secondary organic aerosols (SOA) were determined during ozonolysis. Furthermore, the monoterpene reactions with O 3 and OH were modelled using reaction kinetics equations. The results showed that all of the monoterpenes were unequally affected: α-thujene, sabinene and D-limonene were affected to the greatest extend, whereas the 1,8-cineole concentration did not change. In addition, plant monoterpene emissions reduced the O 3 concentration by 12-24%. The SOA formation was dependent on O 3 concentration. At 100 ppbv of O 3, virtually no new particles were formed but clear SOA formation was observed at the higher ozone concentrations. The modelled results showed rather good agreements for α-pinene and 1,8-cineole, whereas the measured concentrations were clearly lower compared to modelled values for sabinene and limonene. In summary, O 3-quenching by monoterpenes occurs beyond the boundary layer of leaves and results in a decreased O 3 concentration, altered monoterpene profiles and SOA formation.

  12. Volatile and non-volatile monoterpenes produced by elicitor-stimulated Cupressus lusitanica cultured cells.

    Science.gov (United States)

    De Alwis, Ransika; Fujita, Koki; Ashitani, Tatsuya; Kuroda, Ken'ichi

    2009-05-01

    Elicitor treatment initiates defense responses in cultured Cupressus lusitanica cells. In order to investigate the defense mechanism with a yeast extract elicitor, we carried out solid-phase microextraction coupled with gas chromatography for monoterpene analysis. Ten hydrocarbon monoterpenes, including high amounts of sabinene and limonene, were detected in the gas phase of the elicitor-treated cell cultures. Six oxidized monoterpenes including beta-thujaplicin were also detected in the ether extract of the cells and the medium. Time-course profiles of volatile monoterpenes showed that one group of hydrocarbon monoterpenes was maximized on the second day after elicitation, while the other group was maximized on the third day. There were no oxidized monoterpenes that are structurally related to sabinene and limonene in the gas phase or cell extracts, suggesting that these compounds are produced exclusively for emission. Other monoterpenes, which are produced during later stages of elicitation, are metabolized into more complex compounds such as oxidized monoterpenes, including beta-thujaplicin. Although terpinolene synthase was the principal monoterpene synthase in these cell cultures, terpinolene was detected only as a minor compound in the gas phase. The time course for terpinolene synthase activity coincided with beta-thujaplicin biosynthesis. Thus, most of the terpinolene is metabolized rapidly to oxidized terpenes such as beta-thujaplicin rather than emitted.

  13. Effects of synthetic cohesin-containing scaffold protein architecture on binding dockerin-enzyme fusions on the surface of Lactococcus lactis

    Directory of Open Access Journals (Sweden)

    Wieczorek Andrew S

    2012-12-01

    Full Text Available Abstract Background The microbial synthesis of fuels, commodity chemicals, and bioactive compounds necessitates the assemblage of multiple enzyme activities to carry out sequential chemical reactions, often via substrate channeling by means of multi-domain or multi-enzyme complexes. Engineering the controlled incorporation of enzymes in recombinant protein complexes is therefore of interest. The cellulosome of Clostridium thermocellum is an extracellular enzyme complex that efficiently hydrolyzes crystalline cellulose. Enzymes interact with protein scaffolds via type 1 dockerin/cohesin interactions, while scaffolds in turn bind surface anchor proteins by means of type 2 dockerin/cohesin interactions, which demonstrate a different binding specificity than their type 1 counterparts. Recombinant chimeric scaffold proteins containing cohesins of different specificity allow binding of multiple enzymes to specific sites within an engineered complex. Results We report the successful display of engineered chimeric scaffold proteins containing both type 1 and type 2 cohesins on the surface of Lactococcus lactis cells. The chimeric scaffold proteins were able to form complexes with the Escherichia coli β-glucuronidase fused to either type 1 or type 2 dockerin, and differences in binding efficiencies were correlated with scaffold architecture. We used E. coli β-galactosidase, also fused to type 1 or type 2 dockerins, to demonstrate the targeted incorporation of two enzymes into the complexes. The simultaneous binding of enzyme pairs each containing a different dockerin resulted in bi-enzymatic complexes tethered to the cell surface. The sequential binding of the two enzymes yielded insights into parameters affecting assembly of the complex such as protein size and position within the scaffold. Conclusions The spatial organization of enzymes into complexes is an important strategy for increasing the efficiency of biochemical pathways. In this study

  14. Potential applications of the oxidoreductive enzymes in the decolorization and detoxification of textile and other synthetic dyes from polluted water: a review.

    Science.gov (United States)

    Husain, Qayyum

    2006-01-01

    Recently, the enzymatic approach has attracted much interest in the decolorization/degradation of textile and other industrially important dyes from wastewater as an alternative strategy to conventional chemical, physical and biological treatments, which pose serious limitations. Enzymatic treatment is very useful due to the action of enzymes on pollutants even when they are present in very dilute solutions and recalcitrant to the action of various microbes participating in the degradation of dyes. The potential of the enzymes (peroxidases, manganese peroxidases, lignin peroxidases, laccases, microperoxidase-11, polyphenol oxidases, and azoreductases) has been exploited in the decolorization and degradation of dyes. Some of the recalcitrant dyes were not degraded/decolorized in the presence of such enzymes. The addition of certain redox mediators enhanced the range of substrates and efficiency of degradation of the recalcitrant compounds. Several redox mediators have been reported in the literature, but very few of them are frequently used (e.g., 1-hydroxybenzotriazole, veratryl alcohol, violuric acid, 2-methoxy-phenothiazone). Soluble enzymes cannot be exploited at the large scale due to limitations such as stability and reusability. Therefore, the use of immobilized enzymes has significant advantages over soluble enzymes. In the near future, technology based on the enzymatic treatment of dyes present in the industrial effluents/wastewater will play a vital role. Treatment of wastewater on a large scale will also be possible by using reactors containing immobilized enzymes.

  15. Process-based modelling of biogenic monoterpene emissions combining production and release from storage

    NARCIS (Netherlands)

    Schurgers, G.; Arneth, A.; Holzinger, R.; Goldstein, A.H.

    2009-01-01

    Monoterpenes, primarily emitted by terrestrial vegetation, can influence atmospheric ozone chemistry, and can form precursors for secondary organic aerosol. The short-term emissions of monoterpenes have been well studied and understood, but their long-term variability, which is particularly importan

  16. Monoterpene fluxes measured above a Japanese red pine forest at Oshiba plateau, Japan

    Science.gov (United States)

    Tani, A.; Nozoe, S.; Aoki, M.; Hewitt, C. N.

    Monoterpene fluxes above a Japanese red pine ( Pinus densiflora) forest in Japan were measured with a heat balance method from May to November 2000. The most abundant monoterpenes were α-pinene and limonene+ β-phellandrene. Degradation losses of the major monoterpenes by the reactions with ozone and OH during transfer between the two sampling heights were estimated to be negligibly small. The highest values of average fluxes were observed in June measurement period, with values for α-pinene and limonene+ β-phellandrene of 0.6 and 0.5 nmol m -2 s -1. Their average fluxes in September, October and November measurement periods were almost the same and lowest. Vertical profiles of monoterpene concentrations inside the forest suggest that large amounts of monoterpenes are accumulated in the aerial space in the forest and transferred to the atmosphere above. The difference between logarithms of measured and calculated total monoterpene fluxes, ln F mea-ln F cal, had positive values in many morning measurements and negative values in most late afternoon measurements, indicating that monoterpenes accumulated during the night were transported to the upper atmosphere the next morning and they began to accumulate again in the late afternoon, following a decrease of turbulent mixing. Leaf wetness effect was also considered and, finally, a simple model was proposed to explain controlling parameters for monoterpene flux above the forest.

  17. Host-tree monoterpenes and biosynthesis of aggregation pheromones in the bark beetle ips paraconfusus

    Science.gov (United States)

    In the 1970-80s, vapors of the common conifer tree monoterpenes, myrcene and a-pinene, were shown to serve as precursors of ipsenol, ipsdienol and cis-verbenol, aggregation pheromone components of Ips paraconfusus. A paradigm developed that Ips bark beetles utilize pre-formed monoterpene precursors ...

  18. Process-based modelling of biogenic monoterpene emissions combining production and release from storage

    NARCIS (Netherlands)

    Schurgers, G.; Arneth, A.; Holzinger, R.|info:eu-repo/dai/nl/337989338; Goldstein, A.H.

    2009-01-01

    Monoterpenes, primarily emitted by terrestrial vegetation, can influence atmospheric ozone chemistry, and can form precursors for secondary organic aerosol. The short-term emissions of monoterpenes have been well studied and understood, but their long-term variability, which is particularly importan

  19. Monoterpene emissions from boreal tree species: Determination of de novo and pool emissions

    Science.gov (United States)

    Ghirardo, Andrea; Koch, Kristine; Taipale, Risto; Zimmer, Ina; Schnitzler, Joerg-Peter; Rinne, Janne

    2010-05-01

    Boreal forests emit a large amount of monoterpenes into the atmosphere. Traditionally these emissions are assumed to originate as evaporation from large storage pools. Thus their diurnal cycle would depend mostly on temperature. However, there is indication that a significant part of the monoterpene emission would originate directly from de novo synthesis. By applying 13CO2 fumigation and analyzing the isotope fractions with proton transfer reaction mass spectrometry (PTR-MS) and classical GC-MS we studied the origin of monoterpene emissions from some major Eurasian boreal and alpine tree species. We determined the fractions originating from de novo biosynthesis and from large internal monoterpene storages for three coniferous tree species with specialized monoterpene storage structures and one dicotyledon species without such structures. The emission from dicotyledon species Betula pendula originated solely from the de novo synthesis. The origin of the emissions from coniferous species was mixed with varying fraction originating from de novo synthesis (Pinus sylvestris 58 %, Picea abies 33.5 %, Larix decidua 9.8 %) and the rest from large internal monoterpene storage pools. We have also measured the ecosystem scale monoterpene emission fluxes from a boreal Pinus sylvestris forest by disjunct eddy covariance technique. Application of the observed fraction of emission originating from de novo synthesis and large storage pools in a hybrid emission algorithm resulted in a better description of ecosystem scale monoterpene emissions, as compared to the measured fluxes.

  20. Global isoprene and monoterpene emissions under changing climate, vegetation, CO2 and land use

    DEFF Research Database (Denmark)

    Hantson, Stijn; Knorr, Wolfgang; Schurgers, Guy

    2017-01-01

    .). It is therefore necessary to know how isoprene and monoterpene emissions have changed over the past and how future changes in climate, land-use and other factors will impact them. Here we present emission estimates of isoprene and monoterpenes over the period 1901–2 100 based on the dynamic global vegetation...... model LPJ-GUESS, including the effects of all known important drivers. We find that both isoprene and monoterpene emissions at the beginning of the 20th century were higher than at present. While anthropogenic land-use change largely drives the global decreasing trend for isoprene over the 20th century......, changes in natural vegetation composition caused a decreasing trend for monoterpene emissions. Future global isoprene and monoterpene emissions depend strongly on the climate and land-use scenarios considered. Over the 21st century, global isoprene emissions are simulated to either remain stable (RCP 4...

  1. Seasonal variations of monoterpene emissions from Pinus densiflora in East Asia.

    Science.gov (United States)

    Lim, Jun-Ho; Kim, Jo-Chun; Kim, Ki-Joon; Son, Youn-Suk; Sunwoo, Young; Han, Jin-Seok

    2008-09-01

    The emission rates and compositions of monoterpene from Pinus densiflora were investigated in the Gumsung (GM) and Worak (WM) mountains. The standard emission rates (ERs: ERs is the monoterpene emission rate at standard temperature, 30 degrees C) from P. densiflora ranged from 0.817 to 1.704 (microgC/gdw-h). The ERs and beta-values of total monoterpene were measured at the two study sites (GM and WM). In the spring and summer, the ERs were the highest, while relatively low values (densiflora were alpha-pinene, myrcene, beta-phellandrene, d-limonene and alpha-terpinene. The fractional compositions of individual monoterpene compounds were significantly different between the two test sites in the summer and winter. The ERs of the older group (31-40 years) were higher than those in the younger group (21-30 years). However, the monoterpene compositions were similar between the two age groups.

  2. Monoterpene hydroperoxides with trypanocidal activity from Chenopodium ambrosioides.

    Science.gov (United States)

    Kiuchi, Fumiyuki; Itano, Yoshiaki; Uchiyama, Nahoko; Honda, Gisho; Tsubouchi, Akiko; Nakajima-Shimada, Junko; Aoki, Takashi

    2002-04-01

    Four monoterpene hydroperoxides were isolated from aerial parts of Chenopodium ambrosioides along with ascaridole (1), the anthelmintic principle of this plant, as anti-trypanosomal compounds. The structures of these monoterpenes were determined to be (-)-(2S,4S)- and (-)-(2R,4S)-p-mentha-1(7),8-dien-2-hydroperoxide (2a and 3a) and (-)-(1R,4S)- and (-)-(1S,4S)-p-mentha-2,8-dien-1-hydroperoxide (4a and 5a) on the basis of spectroscopic methods and chemical correlations. In vitro trypanocidal activities of ascaridole (1) and these hydroperoxides (2a-5a) against epimastigotes of Trypanosoma cruzi were 23, 1.2, 1.6, 3.1, and 0.8 microM, respectively. Fresh leaves of C. ambrosioides also contained isomeric hydroperoxides 6a and 7a, and the content ratio of 2a-7a suggested that these hydroperoxides were formed through the singlet-oxygen oxidation of limonene.

  3. Do multiple herbivores maintain chemical diversity of Scots pine monoterpenes?

    Science.gov (United States)

    Iason, Glenn R; O'Reilly-Wapstra, Julianne M; Brewer, Mark J; Summers, Ron W; Moore, Ben D

    2011-05-12

    A central issue in our understanding of the evolution of the diversity of plant secondary metabolites (PSMs) is whether or not compounds are functional, conferring an advantage to the plant, or non-functional. We examine the hypothesis that the diversity of monoterpene PSMs within a plant species (Scots pine Pinus sylvestris) may be explained by different compounds acting as defences against high-impact herbivores operating at different life stages. We also hypothesize that pairwise coevolution, with uncorrelated interactions, is more likely to result in greater PSM diversity, than diffuse coevolution. We tested whether up to 13 different monoterpenes in Scots pine were inhibitory to herbivory by slugs (Arion ater), bank voles (Clethrionomys glareolus), red deer (Cervus elaphus) and capercaillie (Tetrao urogallus), each of which attack trees at a different life stage. Plants containing more α-pinene were avoided by both slugs and capercaillie, which may act as reinforcing selective agents for this dominant defensive compound. Herbivory by red deer and capercaillie were, respectively, weakly negatively associated with δ(3)-carene, and strongly negatively correlated with the minor compound β-ocimene. Three of the four herbivores are probably contributory selective agents on some of the terpenes, and thus maintain some, but by no means all, of the phytochemical diversity in the species. The correlated defensive function of α-pinene against slugs and capercaillie is consistent with diffuse coevolutionary processes.

  4. Evaluation of light dependence of monoterpene emission and its effect on surface ozone concentration

    Science.gov (United States)

    Nishimura, Hiroshi; Shimadera, Hikari; Kondo, Akira; Bao, Hai; Shrestha, Kundan Lal; Inoue, Yoshio

    2015-03-01

    This study evaluated the effect of light intensity on monoterpene emission from the three dominant coniferous tree species in Japan (Cryptomeria japonica, Chamaecyparis obtusa and Pinus densiflora). Monoterpene emission experiments were conducted by using a growth chamber where temperature and light intensity can be controlled. In the experiments, air temperature was set at 30 °C and light intensity was set at 0, 500, 700, 850, 1200, and 1400 μmol m-2s-1. Because monoterpene emissions from the three tree species similarly increased with increasing light intensity, a new empirical equation considering light dependence was proposed to estimate monoterpene emission. In addition, monoterpene emission in the Kinki region of Japan was estimated with and without light dependence using meteorological field produced by the Weather Research and Forecasting model (WRF) in summer 2010. The monoterpene emissions estimated with light dependence were larger than those without light dependence in the daytime under clear sky conditions and consistently smaller in the nighttime. In order to evaluate the effect of light dependence of monoterpene emission on ozone concentration in the Kinki region, two cases of air quality simulations by the Community Multiscale Air Quality model (CMAQ) were conducted using the monoterpene emission data estimated with and without light dependence. Comparisons of the two cases showed that the monoterpene emission changes due to light dependence slightly but systematically affected ozone concentrations. Monoterpene generally played a role of reducing ozone concentration in the CMAQ simulations. Consequently, because of the light dependence, the mean daily maximum ozone concentrations decreased by 0.3 ppb on average with a maximum of 2.2 ppb, and the mean daily minimum values increased by 0.4 ppb on average with a maximum of 1.8 ppb in the Kinki region in summer 2010.

  5. Changes in monoterpene mixing ratios during summer storms in rural New Hampshire (USA

    Directory of Open Access Journals (Sweden)

    K. B. Haase

    2011-11-01

    Full Text Available Monoterpenes are an important class of biogenic hydrocarbons that influence ambient air quality and are a principle source of secondary organic aerosol (SOA. Emitted from vegetation, monoterpenes are a product of photosynthesis and act as a response to a variety of environmental factors. Most parameterizations of monoterpene emissions are based on clear weather models that do not take into account episodic conditions that can drastically change production and release rates into the atmosphere. Here, the monoterpene dataset from the rural Thompson Farm measurement site in Durham, New Hampshire is examined in the context of a set of known severe storm events. While some storm systems had a negligible influence on ambient monoterpene mixing ratios, the average storm event increased mixing ratios by 0.59 ± 0.21 ppbv, a factor of 93% above pre-storm levels. In some events, mixing ratios reached the 10's of ppbv range and persisted overnight. These mixing ratios correspond to increases in the monoterpene emission rate, ranging from 120 to 1240 g km−2 h−1 compared to an estimated clear weather rate of 116 to 193 g km−2 h−1. Considering the regularity of storm events over most forested areas, this could be an important factor to consider when modeling global monoterpene emissions and their resulting influence on the formation of organic aerosols.

  6. Changes in monoterpene mixing ratios during summer storms in rural New Hampshire (USA)

    Science.gov (United States)

    Haase, K.B.; Jordan, C.; Mentis, E.; Cottrell, L.; Mayne, H.R.; Talbot, R.; Sive, B.C.

    2011-01-01

    Monoterpenes are an important class of biogenic hydrocarbons that influence ambient air quality and are a principle source of secondary organic aerosol (SOA). Emitted from vegetation, monoterpenes are a product of photosynthesis and act as a response to a variety of environmental factors. Most parameterizations of monoterpene emissions are based on clear weather models that do not take into account episodic conditions that can drastically change production and release rates into the atmosphere. Here, the ongoing monoterpene dataset from the rural Thompson Farm measurement site in Durham, New Hampshire is examined in the context of a set of known severe storm events. While some storm systems had a negligible influence on ambient monoterpene mixing ratios, the average storm event increased mixing ratios by 0.59 ?? 0.21 ppbv, a factor of 93 % above pre-storm levels. In some events, mixing ratios reached the 10's of ppbv range and persisted overnight. These mixing ratios correspond to increases in the monoterpene emission rate, ranging from 120 to 1240 g km-2 h -1 compared to an estimated clear weather rate of 116 to 193 g km-2 h-1. Considering the regularity of storm events over most forested areas, this could be an important factor to consider when modeling global monoterpene emissions and their resulting influence on the formation of organic aerosols. ?? 2011 Author(s).

  7. Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

    Science.gov (United States)

    Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

    2015-10-01

    The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Genomics-Based Discovery of Plant Genes for Synthetic Biology of Terpenoid Fragrances: A Case Study in Sandalwood oil Biosynthesis.

    Science.gov (United States)

    Celedon, J M; Bohlmann, J

    2016-01-01

    Terpenoid fragrances are powerful mediators of ecological interactions in nature and have a long history of traditional and modern industrial applications. Plants produce a great diversity of fragrant terpenoid metabolites, which make them a superb source of biosynthetic genes and enzymes. Advances in fragrance gene discovery have enabled new approaches in synthetic biology of high-value speciality molecules toward applications in the fragrance and flavor, food and beverage, cosmetics, and other industries. Rapid developments in transcriptome and genome sequencing of nonmodel plant species have accelerated the discovery of fragrance biosynthetic pathways. In parallel, advances in metabolic engineering of microbial and plant systems have established platforms for synthetic biology applications of some of the thousands of plant genes that underlie fragrance diversity. While many fragrance molecules (eg, simple monoterpenes) are abundant in readily renewable plant materials, some highly valuable fragrant terpenoids (eg, santalols, ambroxides) are rare in nature and interesting targets for synthetic biology. As a representative example for genomics/transcriptomics enabled gene and enzyme discovery, we describe a strategy used successfully for elucidation of a complete fragrance biosynthetic pathway in sandalwood (Santalum album) and its reconstruction in yeast (Saccharomyces cerevisiae). We address questions related to the discovery of specific genes within large gene families and recovery of rare gene transcripts that are selectively expressed in recalcitrant tissues. To substantiate the validity of the approaches, we describe the combination of methods used in the gene and enzyme discovery of a cytochrome P450 in the fragrant heartwood of tropical sandalwood, responsible for the fragrance defining, final step in the biosynthesis of (Z)-santalols. © 2016 Elsevier Inc. All rights reserved.

  9. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    Directory of Open Access Journals (Sweden)

    Liu Ping-Li

    2012-11-01

    Full Text Available Abstract Background Chrysanthemyl diphosphate synthase (CDS is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS.

  10. Acyclic monoterpenes in tree essential oils as a shrinking agent for waste-expanded polystyrene.

    Science.gov (United States)

    Shimotori, Yasutaka; Hattori, Kazuyuki; Aoyama, Masakazu; Miyakoshi, Tetsuo

    2011-01-01

    We examined the dissolution of polystyrene (PS) into acyclic monoterpenes present in tree essential oils, to develop an environmentally friendly shrinking agent for waste-expanded polystyrene (EPS). The dissolving powers of geranyl acetate, geranylacetone, and geranyl formate [221.8-241.2 g PS (100 g solvent)(-1)] compared favorably with that of (R)-limonene [181.7 g PS (100 g solvent)(-1)]. Their favorable dissolving powers for PS can be explained by their flexible linear structures, which may be more accessible to the inside of bulk PS compared with cyclic monoterpenes. These acyclic monoterpenes and PS were recovered almost quantitatively by simple steam distillation of the PS solution.

  11. Enhancement of sterol synthesis by the monoterpene perillyl alcohol is unaffected by competitive 3-hydroxy-3-methylglutaryl-CoA reductase inhibition.

    Science.gov (United States)

    Cerda, S R; Wilkinson, J; Branch, S K; Broitman, S A

    1999-06-01

    Monoterpenes such as limonene and perillyl alcohol (PA) are currently under investigation for their chemotherapeutic properties which have been tied to their ability to affect protein isoprenylation. Because PA affects the synthesis of isoprenoids, such as ubiquinone, and cholesterol is the end product of the synthetic pathway from which this isoprenoid pathway branches, we investigated the effects of this compound upon cholesterol metabolism in the colonic adenocarcinoma cell line SW480. PA (1 mM) inhibited incorporation of 14C-mevalonate into 21-26 kDa proteins by 25% in SW480 cells. Cholesterol (CH) biosynthesis was assessed by measuring the incorporation of 14C-acetate and 14C-mevalonate into 27-carbon-sterols. Cells treated with PA (1 mM) exhibited a fourfold increase in the incorporation of 14C-acetate but not 14C-mevalonate into cholesterol. Mevinolin (lovastatin), an inhibitor of 3-hydroxy-3-methylglutaryl-CoA(HMG-CoA) reductase, at 2 microM concentration, inhibited CH synthesis from 14C-acetate by 80%. Surprisingly, concurrent addition of mevinolin and PA did not significantly alter the stimulatory effects of PA. As observed differences in 14C-acetate and 14C-mevalonate precursor labeling could indicate PA affects early pathway events, the effects of this monoterpene on HMG-CoA reductase activity were evaluated. Unexpectedly, 1 mM PA did not stimulate activity of this enzyme. Consistent with its action as a reversibly bound inhibitor, in washed microsomes, 2 microM mevinolin pretreatment increased reductase protein expression causing a 12.7 (+/- 2.4)-fold compensatory HMG-CoA reductase activity increase; concurrent treatment with 1 mM PA attenuated this to a 5.3 (+/- 0.03)-fold increase. Gas chromatographic analysis confirmed CH was the major lipid present in the measured thin-layer chromatography spot. Since 14C-acetate incorporation into free fatty acid and phospholipid pools was not significantly affected by PA treatment, nonspecific changes in whole

  12. Emission of monoterpenes from European beech (Fagus sylvatica L. as a function of light and temperature

    Directory of Open Access Journals (Sweden)

    J. Kesselmeier

    2005-01-01

    Full Text Available Using a dynamic branch enclosure technique European beech (Fagus sylvatica L. was characterised as a strong emitter of monoterpenes, with sabinene being the predominant compound released. Since monoterpene emission was demonstrated to be a function of light and temperature, application of light and temperature dependent algorithms resulted in reasonable agreement with the measured data. Furthermore, during high temperature periods the depression of net CO2 exchange during midday (midday depression was accompanied by a depression of monoterpene emission on one occasion. The species dependent standard emission factor and the light and temperature regulated release of monoterpenes is of crucial importance for European VOC emissions. All measurements were performed within the framework of the ECHO project (Emission and CHemical transformation of biogenic volatile Organic compounds during two intensive field campaigns in the summers of 2002 and 2003.

  13. A New Monoterpene Glucoside from the Leaves of Betula platyphylla Suk.

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new monoterpene glucoside, (2E,6Z)-2,6-dimethyl-8-b-D-glucosyloxy-2,6-octadien- oic acid, was isolated from the leaves of Betula platyphylla Suk. The structure was established by spectroscopic data.

  14. Isotope ratio analysis by HRGC-MS of monoterpene hydrocarbons from citrus essential oils.

    Science.gov (United States)

    Satake, Atsushi; Une, Akitoshi; Ueno, Takao; Ukeda, Hiroyuki; Sawamura, Masayoshi

    2003-03-01

    The isotope ratio of monoterpene hydrocarbons in citrus essential oils of different origins was measured by ordinary high-resolution gas chromatography-mass spectrometry (HRGC-MS). The isotope ratio (Ir) was determined by the ratio of the isotope peak intensity (m/z 137) to the molecular mass peak intensity (m/z 136) of the monoterpene hydrocarbons. The accuracy of Ir was examined by measuring monoterpene hydrocarbon standards and 13C-labeled compounds. The isotope fingerprints based on the values of monoterpene hydrocarbons from lemon, lime and yuzu essential oils were determined. These citrus essential oils were also discriminated by a principal component analysis of their Ir data. The characteristic vectors showed that alpha-terpinene, beta-pinene and beta-phellandrene were important components for distinguishing between the citrus species. It is suggested that this technique will be applicable to evaluate the quality, genuineness and origin of citrus fruits and their products.

  15. Quantitative and enantioselective analysis of monoterpenes from plant chambers and in ambient air using SPME

    Directory of Open Access Journals (Sweden)

    N. Yassaa

    2010-11-01

    Full Text Available A headspace solid-phase microextraction (HS-SPME and gas chromatography/mass spectrometry (GC/MS system has been developed for quantifying enantiomeric and nonenantiomeric monoterpenes in plant chamber studies and ambient air. Performance of this system was checked using a capillary diffusion system to produce monoterpene standards. The adsorption efficiency, competitive adsorption and chromatographic peak resolution of monoterpene enantiomer pairs were compared for three SPME fibre coatings: 75 μm Carboxen-PDMS (CAR-PDMS, 50/30 μm divinylbenzene-carboxen-polydimethylsiloxane (DVB-CAR-PDMS and 65 μm divinylbenzene-polydimethylsiloxane (DVB-PDMS. Key parameters such as the linearity and reproducibility of the SPME system have been investigated in this work. The best compromise between the enantiomeric separation of monoterpenes and competitive adsorption of the isoprenoids on the solid SPME fibre coating was found for DVB-PDMS fibres. The optimum conditions using DVB-PDMS fibres were applied to measure the exchange rates of monoterpenes in the emission of Quercus ilex using a laboratory whole plant enclosure under light and dark conditions, as well as in ambient air. With 592 and 223 ng m−2 s−1 respectively, β-myrcene and limonene were the predominant monoterpenes in the emission of Q. ilex. These values were closely comparable to those obtained using a zNose and cartridge GC-FID systems.

  16. Quantitative and enantioselective analysis of monoterpenes from plant chambers and in ambient air using SPME

    Directory of Open Access Journals (Sweden)

    N. Yassaa

    2010-08-01

    Full Text Available A solid-phase microextraction (HS-SPME and gas chromatography/mass spectrometry (GC/MS system has been developed for quantifying enantiomeric and nonenantiomeric monoterpenes in plant chamber studies and ambient air. Performance of this system was checked using a capillary diffusion system to produce monoterpene standards. The adsorption efficiency, competitive adsorption and chromatographic peak resolution of monoterpene enantiomer pairs were compared for three SPME fibre coatings: 75 μm Carboxen-PDMS (CAR-PDMS, 50/30 μm, divinylbenzene-carboxen-polydimethylsiloxane (DVB-CAR-PDMS and 65 μm divinylbenzene-polydimethyl-siloxane (DVB-PDMS. Key parameters such as the linearity and reproducibility of the SPME system have been investigated in this work. The best compromise between the enantiomeric separation of monoterpenes and competitive adsorption of the isoprenoids on the solid SPME fibre coating was found for DVB-PDMS fibres. The optimum conditions using DVB-PDMS fibres were applied to measure the exchange rates of monoterpenes in the emission of Quercus ilex using a laboratory whole plant enclosure under light and dark conditions, as well as in ambient air. With 592 and 223 ng m−2 s−1, respectively, β-myrcene and limonene were the predominant monoterpenes in the emission of Q. ilex. These values were closely comparable to those obtained using a zNose and cartridge GC-FID systems.

  17. Mechanical properties of the compass depressors of the sea-urchin Paracentrotus lividus (Echinodermata, Echinoidea and the effects of enzymes, neurotransmitters and synthetic tensilin-like protein.

    Directory of Open Access Journals (Sweden)

    Iain C Wilkie

    Full Text Available The compass depressors (CDs of the sea-urchin lantern are ligaments consisting mainly of discontinuous collagen fibrils associated with a small population of myocytes. They are mutable collagenous structures, which can change their mechanical properties rapidly and reversibly under nervous control. The aims of this investigation were to characterise the baseline (i.e. unmanipulated static mechanical properties of the CDs of Paracentrotus lividus by means of creep tests and incremental force-extension tests, and to determine the effects on their mechanical behaviour of a range of agents. Under constant load the CDs exhibited a three-phase creep curve, the mean coefficient of viscosity being 561±365 MPa.s. The stress-strain curve showed toe, linear and yield regions; the mean strain at the toe-linear inflection was 0.86±0.61; the mean Young's modulus was 18.62±10.30 MPa; and the mean tensile strength was 8.14±5.73 MPa. Hyaluronidase from Streptomyces hyalurolyticus had no effect on creep behaviour, whilst chondroitinase ABC prolonged primary creep but had no effect on secondary creep or on any force-extension parameters; it thus appears that neither hyaluronic acid nor sulphated glycosaminoglycans have an interfibrillar load transfer function in the CD. Acetylcholine, the muscarinic agonists arecoline and methacholine, and the nicotinic agonists nicotine and 1-[1-(3,4-dimethyl-phenyl-ethyl]-piperazine produced an abrupt increase in CD viscosity; the CDs were not differentially sensitive to muscarinic or nicotinic agonists. CDs showed either no, or no consistent, response to adrenaline, L-glutamic acid, 5-hydroxytryptamine and γ-aminobutyric acid. Synthetic echinoid tensilin-like protein had a weak and inconsistent stiffening effect, indicating that, in contrast to holothurian tensilins, the echinoid molecule may not be involved in the regulation of collagenous tissue tensility. We compare in detail the mechanical behaviour of the CD with that

  18. Mechanical Properties of the Compass Depressors of the Sea-Urchin Paracentrotus lividus (Echinodermata, Echinoidea) and the Effects of Enzymes, Neurotransmitters and Synthetic Tensilin-Like Protein

    Science.gov (United States)

    Wilkie, Iain C.; Fassini, Dario; Cullorà, Emanuele; Barbaglio, Alice; Tricarico, Serena; Sugni, Michela; Del Giacco, Luca; Candia Carnevali, M. Daniela

    2015-01-01

    The compass depressors (CDs) of the sea-urchin lantern are ligaments consisting mainly of discontinuous collagen fibrils associated with a small population of myocytes. They are mutable collagenous structures, which can change their mechanical properties rapidly and reversibly under nervous control. The aims of this investigation were to characterise the baseline (i.e. unmanipulated) static mechanical properties of the CDs of Paracentrotus lividus by means of creep tests and incremental force-extension tests, and to determine the effects on their mechanical behaviour of a range of agents. Under constant load the CDs exhibited a three-phase creep curve, the mean coefficient of viscosity being 561±365 MPa.s. The stress-strain curve showed toe, linear and yield regions; the mean strain at the toe-linear inflection was 0.86±0.61; the mean Young’s modulus was 18.62±10.30 MPa; and the mean tensile strength was 8.14±5.73 MPa. Hyaluronidase from Streptomyces hyalurolyticus had no effect on creep behaviour, whilst chondroitinase ABC prolonged primary creep but had no effect on secondary creep or on any force-extension parameters; it thus appears that neither hyaluronic acid nor sulphated glycosaminoglycans have an interfibrillar load transfer function in the CD. Acetylcholine, the muscarinic agonists arecoline and methacholine, and the nicotinic agonists nicotine and 1-[1-(3,4-dimethyl-phenyl)-ethyl]-piperazine produced an abrupt increase in CD viscosity; the CDs were not differentially sensitive to muscarinic or nicotinic agonists. CDs showed either no, or no consistent, response to adrenaline, L-glutamic acid, 5-hydroxytryptamine and γ-aminobutyric acid. Synthetic echinoid tensilin-like protein had a weak and inconsistent stiffening effect, indicating that, in contrast to holothurian tensilins, the echinoid molecule may not be involved in the regulation of collagenous tissue tensility. We compare in detail the mechanical behaviour of the CD with that of mammalian

  19. Isoprene and monoterpene emissions from an Inner Mongolia grassland

    Science.gov (United States)

    Bai, Jianhui; Baker, Bradly; Liang, Baosheng; Greenberg, James; Guenther, Alex

    Terpenoid emissions were measured at a grassland site in Inner Mongolia, China during four campaigns over a 2-year period. Emissions were strongly correlated with light and temperature and the variations could be simulated using a canopy emission model. Substantial seasonal and interannual variations in isoprene emissions were also observed. Area averaged isoprene emissions normalized to standard above-canopy temperature and light conditions (30 °C and 1500 μmol m -2 s -1) ranged from about 50 to 500 μg m -2 h -1. These rates are more than an order of magnitude higher than those previously reported for temperate grasslands but are lower than emission rates observed from ground cover vegetation at higher latitudes. Isoprene emissions from this Inner Mongolia grassland may be dominated by emissions from sedges, e.g. Carex appendiculata. Total monoterpene emissions normalized to a standard temperature of 30 °C were only about 3 μg m -2 h -1 and consisted primarily of carene and limonene with smaller contributions of α-pinene and β-pinene. A model sensitivity study showed that grass and other herbaceous ground cover can contribute >10% of the total isoprene emission from certain regions, such as Inner Mongolia, but are<4% on a global annual scale.

  20. Monoterpenes Released from Fruit, Plant, and Vegetable Systems

    Science.gov (United States)

    Iqbal, Mohammad Asif; Kim, Ki-Hyun; Ahn, Jeong Hyeon

    2014-01-01

    To quantify the emission rate of monoterpenes (MTs) from diverse natural sources, the sorbent tube (ST)-thermal desorption (TD) method was employed to conduct the collection and subsequent detection of MTs by gas chromatography. The calibration of MTs, when made by both mass spectrometric (MS) and flame ionization detector (FID), consistently exhibited high coefficient of determination values (R2 > 0.99). This approach was employed to measure their emission rate from different fruit/plant/vegetable (F/P/V) samples with the aid of an impinger-based dynamic headspace sampling system. The results obtained from 10 samples (consisting of carrot, pine needle (P. sylvestris), tangerine, tangerine peel, strawberry, sepals of strawberry, plum, apple, apple peel, and orange juice) marked α-pinene, β-pinene, myrcene, α-terpinene, R-limonene, γ-terpinene, and p-cymene as the most common MTs. R-limonene was the major species emitted from citrus fruits and beverages with its abundance exceeding 90%. In contrast, α-pinene was the most abundant MT (37%) for carrot, while it was myrcene (31%) for pine needle. The overall results for F/P/V samples confirmed α-pinene, β-pinene, myrcene, α-terpinene, and γ-terpinene as common MTs. Nonetheless, the types and magnitude of MTs released from fruits were distinguished from those of vegetables and plants. PMID:25268921

  1. Monoterpenes Released from Fruit, Plant, and Vegetable Systems

    Directory of Open Access Journals (Sweden)

    Mohammad Asif Iqbal

    2014-09-01

    Full Text Available To quantify the emission rate of monoterpenes (MTs from diverse natural sources, the sorbent tube (ST-thermal desorption (TD method was employed to conduct the collection and subsequent detection of MTs by gas chromatography. The calibration of MTs, when made by both mass spectrometric (MS and flame ionization detector (FID, consistently exhibited high coefficient of determination values (R2 > 0.99. This approach was employed to measure their emission rate from different fruit/plant/vegetable (F/P/V samples with the aid of an impinger-based dynamic headspace sampling system. The results obtained from 10 samples (consisting of carrot, pine needle (P. sylvestris, tangerine, tangerine peel, strawberry, sepals of strawberry, plum, apple, apple peel, and orange juice marked α-pinene, β-pinene, myrcene, α-terpinene, R-limonene, γ-terpinene, and p-cymene as the most common MTs. R-limonene was the major species emitted from citrus fruits and beverages with its abundance exceeding 90%. In contrast, α-pinene was the most abundant MT (37% for carrot, while it was myrcene (31% for pine needle. The overall results for F/P/V samples confirmed α-pinene, β-pinene, myrcene, α-terpinene, and γ-terpinene as common MTs. Nonetheless, the types and magnitude of MTs released from fruits were distinguished from those of vegetables and plants.

  2. Localization and expression of the Bacillus subtilis DL-endopeptidase LytF are influenced by mutations in LTA synthases and glycolipid anchor synthetic enzymes.

    Science.gov (United States)

    Kiriyama, Yuuka; Yazawa, Kazuya; Tanaka, Tatsuhito; Yoshikawa, Ritsuko; Yamane, Hisaya; Hashimoto, Masayuki; Sekiguchi, Junichi; Yamamoto, Hiroki

    2014-12-01

    Bacillus subtilis LytF plays a principal role in cell separation through its localization at the septa and poles on the vegetative cell surface. In this study, we found that a mutation in a major lipoteichoic acid (LTA) synthase gene--ltaS--results in a considerable reduction in the σ(D)-dependent transcription of lytF. The lytF transcription was also reduced in mutants that affected glycolipid anchor biosynthesis. Immunofluorescence microscopy revealed that both the numbers of cells expressing LytF and the LytF foci in these mutants were decreased. In addition, the transcriptional activity of lytF was almost abolished in the double (ltaS yfnI), triple (ltaS yfnI yqgS), and quadruple (ltaS yfnI yqgS yvgJ) mutants during vegetative growth. Cell separation defects in these mutants were partially restored with artificial expression of LytF. Interestingly, when lytF transcription was induced in the ltaS single or multiple mutants, LytF was localized not only at the septum, but also along the sidewall. The amounts of LytF bound to cell wall in the single (ltaS) and double (ltaS yfnI) mutants gradually increased as compared with that in the WT strain, and those in the triple (ltaS yfnI yqgS) and quadruple mutants were almost similar to that in the double mutant. Moreover, reduction of the lytF transcription and chained cell morphology in the ltaS mutant were completely restored with artificial induction of the yqgS gene. These results strongly suggest that LTA influences the temporal, σ(D)-dependent transcription of lytF and is an additional inhibitory component to the vegetative cell separation enzyme LytF.

  3. Preparation of Ecofriendly Formulations Containing Biologically Active Monoterpenes with Their Fumigant and Residual Toxicities against Adults of Culex pipiens

    Directory of Open Access Journals (Sweden)

    Mohamed E. I. Badawy

    2016-01-01

    Full Text Available Different mixtures of monoterpenes (ketone, alcohol, and alkene were loaded on paper discs and wax and their knockdown activities were evaluated against Culex pipiens adults. Some individual monoterpenes were also evaluated by residual toxicity technique. Citronella oil as a reference was also loaded separately or in combination with monoterpenes on paper discs and wax. The ketone monoterpenes mixture (camphor, menthone, carvone, and fenchone on paper discs was the most active (KT50 = 17.20 min followed by ketone monoterpenes with citronella oil (KT50 = 20.79 min and citronella oil alone (KT50 = 28.72 min. Wax formulations proved that the ketone and alcohol (geraniol, thymol, and menthol monoterpenes gave the most activity as knockdown (KT50 = 31.79 and 43.39 min, resp.. Alcohol monoterpenes formulation recorded KT50 = 43.39 min. Residual activity of tested individual monoterpenes reported that the menthol was more toxic than camphor and camphene. Generally, this study suggests that the monoterpenes have the properties, which make them used as eco-friendly compounds in the control programs of Cx. pipiens adult. The use of paper discs is more applicable than wax in the adulticidal formulations.

  4. Monoterpene metabolism. Cloning, expression, and characterization of menthone reductases from peppermint.

    Science.gov (United States)

    Davis, Edward M; Ringer, Kerry L; McConkey, Marie E; Croteau, Rodney

    2005-03-01

    (-)-Menthone is the predominant monoterpene produced in the essential oil of maturing peppermint (Mentha x piperita) leaves during the filling of epidermal oil glands. This early biosynthetic process is followed by a second, later oil maturation program (approximately coincident with flower initiation) in which the C3-carbonyl of menthone is reduced to yield (-)-(3R)-menthol and (+)-(3S)-neomenthol by two distinct NADPH-dependent ketoreductases. An activity-based in situ screen, by expression in Escherichia coli of 23 putative redox enzymes from an immature peppermint oil gland expressed sequence tag library, was used to isolate a cDNA encoding the latter menthone:(+)-(3S)-neomenthol reductase. Reverse transcription-PCR amplification and RACE were used to acquire the former menthone:(-)-(3R)-menthol reductase directly from mRNA isolated from the oil gland secretory cells of mature leaves. The deduced amino acid sequences of these two reductases share 73% identity, provide no apparent subcellular targeting information, and predict inclusion in the short-chain dehydrogenase/reductase family of enzymes. The menthone:(+)-(3S)-neomenthol reductase cDNA encodes a 35,722-D protein, and the recombinant enzyme yields 94% (+)-(3S)-neomenthol and 6% (-)-(3R)-menthol from (-)-menthone as substrate, and 86% (+)-(3S)-isomenthol and 14% (+)-(3R)-neoisomenthol from (+)-isomenthone as substrate, has a pH optimum of 9.3, and K(m) values of 674 mum, > 1 mm, and 10 mum for menthone, isomenthone, and NADPH, respectively, with a k(cat) of 0.06 s(-1). The recombinant menthone:(-)-(3R)-menthol reductase has a deduced size of 34,070 D and converts (-)-menthone to 95% (-)-(3R)-menthol and 5% (+)-(3S)-neomenthol, and (+)-isomenthone to 87% (+)-(3R)-neoisomenthol and 13% (+)-(3S)-isomenthol, displays optimum activity at neutral pH, and has K(m) values of 3.0 mum, 41 mum, and 0.12 mum for menthone, isomenthone, and NADPH, respectively, with a k(cat) of 0.6 s(-1). The respective activities of

  5. [Effect of drying methods on monoterpenes, phenolic acids and flavonoids in Mentha haplocalyx].

    Science.gov (United States)

    Zhu, Shao-qing; Zhu, Zhen-hua; Guo, Sheng; Zhao, Yu-yang; Lu, Xue-jun; Sha, Xiu-xiu; Qian, Da-wei; Duan, Jin-ao

    2015-12-01

    To provide a scientific basis for the selection of the appropriate drying method for Mentha Haplocalyx Herba (MHH), determine 2 monoterpenes, 4 phenolic acids and 5 flavonoids in MHH by GC-MS and UPLC-TQ-MS methods, and investigate the effects of the drying methods on the changes in contents of these analytes. The qualities of products obtained with different drying methods were evaluated by the multivariate statistical method of Technique for Order Preference by Similarity to Ideal Solution (TOPSIS). Results showed that the drying methods had the greatest impact on menthol, caffeic acid, and rosemary acid, which were followed by chlorogenic acid and diosmetin-7-O-glucoside. The contents in these analytes processed with hot-air-drying method were higher than those with microwave-drying and infrared-drying methods at the same temperatures. The contents in these analytes processed under low temperature (40-45 °C) were higher than those under higher temperature (60-70 °C). Above all, the contents in phenolic acids processed with microwave fixation (exposed under microwave at 100 °C for several minutes) were obviously higher than those of not being processed, showing an inhibition of some enzymes in samples after fixation. The TOPSIS evaluation showed that the variable temperature drying method of 'Hot-Air 45-60 °C' was the most suitable approach for the primary drying processing of MHH. The results could provide the scientific basis for the selection of appropriate drying method for MHH, and helpful reference for the primary drying proces of herbs containing volatile chemical components.

  6. Menthol: a simple monoterpene with remarkable biological properties.

    Science.gov (United States)

    Kamatou, Guy P P; Vermaak, Ilze; Viljoen, Alvaro M; Lawrence, Brian M

    2013-12-01

    Menthol is a cyclic monoterpene alcohol which possesses well-known cooling characteristics and a residual minty smell of the oil remnants from which it was obtained. Because of these attributes it is one of the most important flavouring additives besides vanilla and citrus. Due to this reason it is used in a variety of consumer products ranging from confections such as chocolate and chewing gum to oral-care products such as toothpaste as well as in over-the-counter medicinal products for its cooling and biological effects. Its cooling effects are not exclusive to medicinal use. Approximately one quarter of the cigarettes on the market contain menthol and small amounts of menthol are even included in non-mentholated cigarettes. Natural menthol is isolated exclusively from Mentha canadensis, but can also be synthesised on industrial scale through various processes. Although menthol exists in eight stereoisomeric forms, (-)-menthol from the natural source and synthesised menthol with the same structure is the most preferred isomer. The demand for menthol is high and it was previously estimated that the worldwide use of menthol was 30-32,000 metric tonnes per annum. Menthol is not a predominant compound of the essential oils as it can only be found as a constituent of a limited number of aromatic plants. These plants are known to exhibit biological activity in vitro and in vivo such as antibacterial, antifungal, antipruritic, anticancer and analgesic effects, and are also an effective fumigant. In addition, menthol is one of the most effective terpenes used to enhance the dermal penetration of pharmaceuticals. This review summarises the chemical and biological properties of menthol and highlights its cooling effects and toxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Larvicidal efficacy of monoterpenes against the larvae of Anopheles gambiae

    Institute of Scientific and Technical Information of China (English)

    Eliningaya J.Kweka; Tamires Cardoso Lima; Chrian M.Marciale; Dami?o Pergentino de Sousa

    2016-01-01

    Objective:To evaluate the larvicidal efficacy of eight volatile components of essential oils against 3rd instar larvae of Anopheles gambiae s.s.Methods:Larvicidal effects of each compound were evaluated in both laboratory and semi-field trials.Stock solution was prepared and serial dilutions were made in six concentrations for each compound.A total of 20 larvae were exposed to larvicides for each replicate and monitored at intervals of 12,24,48 and 72 h.Larvae monitoring was done on basis of dead and live larvae in all intervals.Results:All assayed compounds were larvicides and presented varying degrees of larval toxicity,with LC50 values ranging from 1.28 to 1 938.92 mg/L depending on the treatment time(12,24,48 or 72 h).(-)-Perillyl alcohol presented the strongest larvicidal activity towards Anopheles gambiae larvae,with LC50 values of 73.60,18.36,1.72 and1.28 mg/L after 12,24,48 and 72 h of exposure,respectively.The next strongest were(-)-isopulegol(LC50= 135.10,49.39,34.39 and 20.22 mg/L) and(-)-carvone epoxide(LC50= 168.86,124.74,80.84 and 23.46 mg/L).After 12,24 and 48 h of treatment,hydroxydihydrocarvone was the least toxic compound,with LC50 values of 1 938.92,1 172.18 and 401.03 mg/L,respectively.Conclusions:The data obtained in this study suggest that all evaluated monoterpenes,especially(-)-perillyl alcohol,have remarkable larvicidal effects and may be considered as potential sources for the development of suitable natural larvicides for mosquito management programs.Further small-scale field trials should be conducted.

  8. Gastroprotective Mechanisms of the Monoterpene 1,8-Cineole (Eucalyptol.

    Directory of Open Access Journals (Sweden)

    Germana Freire Rocha Caldas

    Full Text Available Recently, our research group identified and reported 1,8-cineole (CIN, a monoterpene that naturally occur in many aromatic plants, as one of the major constituent of the essential oil from leaves of Hyptis martiusii (EOHM, as well as characterized the gastroprotective action of this oil. The aim of this study was to investigate the mechanisms of action involved in the antiulcer and healing activity of CIN, in order to confirm its correlation with the gastroprotective effect of EOHM. Wistar rats were exposed to different protocols (acute ulceration, gastrointestinal motility and antisecretory activity. In addition, were determinated the involvement of nitric oxide and sulphydryl groups; the levels of gastric mucus, lipid peroxidation, sulphydryl groups and myeloperoxidase activity. The healing ability was evaluated by acetic acid-induced chronic ulcer and histological and immunohistochemical analysis (PCNA, Ki-67 and BrdU. The treatment with CIN inhibited ethanol-, ethanol/HCl- and indomethacin-induced gastric lesions. The highest doses of CIN inhibited gastric emptying, but did not affect intestinal transit. CIN (100 mg/kg reduced the volume of basal but not stimulated acid secretion. CIN increased levels of mucus (89.3%, prevented depletion of -SH groups (62.6% and reduced the level of lipid peroxidation (55.3% and myeloperoxidase activity (59.4% in the gastric mucosa. In chronic ulcer model, CIN reduced in 43.1% the gastric area lesion, promoted significant regeneration and restoration of the levels of mucus in glandular cells as confirmed by histological analysis; and promoted increase in cell proliferation as evidenced by reactivity for PCNA, Ki-67 and BrdU. This findings demonstrate the role of 1,8-cineole as an important ulcer healing agent and indicate the involvement of antioxidant and cytoprotective mechanisms in the gastroprotective effect of compound. This study also provides evidence that 1,8-cineole is related to the

  9. Antiviral activity of monoterpenes beta-pinene and limonene against herpes simplex virus in vitro.

    Directory of Open Access Journals (Sweden)

    Akram Astani

    2014-06-01

    Full Text Available Essential oils are complex mixtures containing compounds of several different functional- group classes. Depending on the structure, we can distinguish monoterpenes, phenylpropanes, and other components. Here in this study two monoterpene compounds of essential oils, i.e. β-pinene and limonene were examined for their antiviral activity against herpes simplex virus type 1 (HSV-1 in vitro.All antiviral assays were performed using RC-37 cells. Cytotoxicity was determined in a neutral red assay, antiviral assays were performed with HSV-1 strain KOS. The mode of antiviral action was evaluated at different periods during the viral replication cycle. Acyclovir was used as positive antiviral control.Beta-pinenene and limonenen reduced viral infectivity by 100 %. The mode of antiviral action has been determined, only moderate antiviral effects were revealed by monoterpenes when these drugs were added to host cells prior infection or after entry of HSV into cells. However, both monoterpenes exhibited high anti-HSV-1 activity by direct interaction with free virus particles. Both tested drugs interacted with HSV-1 in a dose-dependent manner thereby inactivating viral infection.These results suggest that monoterpenes in essential oils exhibit antiherpetic activity in the early phase of viral multiplication and might be used as potential antiviral agents.

  10. Seasonal variability of monoterpene emission factors for a ponderosa pine plantation in California

    Directory of Open Access Journals (Sweden)

    R. Holzinger

    2006-01-01

    Full Text Available Monoterpene fluxes have been measured over an 11 month period from June 2003 to April 2004. During all seasons ambient air temperature was the environmental factor most closely related to the measured emission rates. The monoterpene flux was modeled using a basal emission rate multiplied by an exponential function of a temperature, following the typical practice for modelling temperature dependent biogenic emissions. A basal emission of 1.0 μmol h−1 m−2 (at 30°C, based on leaf area and a temperature dependence (β of 0.12°C−1 reproduced measured summer emissions well but underestimated spring and winter measured emissions by 60–130%. The total annual monoterpene emission may be underestimated by ~50% when using a model optimized to reproduce monoterpene emissions in summer. The long term dataset also reveals an indirect connection between non-stomatal ozone and monoterpene flux beyond the dependence on temperature that has been shown for both fluxes.

  11. A Systematic Review of the Wound-Healing Effects of Monoterpenes and Iridoid Derivatives

    Directory of Open Access Journals (Sweden)

    Rosana S.S. Barreto

    2014-01-01

    Full Text Available The search for more effective and lower cost therapeutic approaches for wound healing remains a challenge for modern medicine. In the search for new therapeutic options, plants and their metabolites are a great source of novel biomolecules. Among their constituents, the monoterpenes represent 90% of essential oils, and have a variety of structures with several activities such as antimicrobial, anti-inflammatory, antioxidant and wound healing. Based on that, and also due to the lack of reviews concerning the wound-healing activity of monoterpenes, we performed this systematic review—which provides an overview of their characteristics and mechanisms of action. In this search, the terms “terpenes”, “monoterpenes”, “wound healing” and “wound closure techniques” were used to retrieve articles published in LILACS, PUBMED and EMBASE until May 2013. Seven papers were found concerning the potential wound healing effect of five compouds (three monoterpenes and two iridoid derivatives in preclinical studies. Among the products used for wound care, the films were the most studied pharmaceutical form. Monoterpenes are a class of compounds of great diversity of biological activities and therapeutic potential. The data reviewed here suggest that monoterpenes, although poorly studied in this context, are promising compounds for the treatment of chronic wound conditions.

  12. Tree water relations trigger monoterpene emissions from Scots pine stem during spring recovery

    Directory of Open Access Journals (Sweden)

    A. Vanhatalo

    2015-05-01

    Full Text Available Tree canopies are known to emit large amounts of VOCs (volatile organic compounds such as monoterpenes to the surrounding air. The main source for these is considered to be the green biomass, i.e. foliage, but emissions from the woody compartments have not been quantified. A VOC emission anomaly has been observed during transition from winter to summer activity. We analyzed if non-foliar components could partially explain the anomaly. We measured the VOC emissions from Scots pine (Pinus sylvestris L. stems and shoots during the dehardening phase of trees in field conditions in two consecutive springs. We observed a large, transient monoterpene burst from stems, while the shoot monoterpene emissions and transpiration remained low. The burst lasted about 12 h. Simultaneously, an unusual night-time sap flow and an anomalous diurnal pattern of tree diameter were detected. Hence, we suggest that the monoterpene burst was a consequence of the recovery of the stem from winter-time. This indicates that the dominant processes and environmental drivers triggering the monoterpene emissions are different between stems and foliage.

  13. Production of beta-thujaplicin in Cupressus lusitanica suspension cultures fed with organic acids and monoterpenes.

    Science.gov (United States)

    Zhao, J; Fujita, K; Sakai, K

    2001-05-01

    Effects of some organic acids and monoterpenes on production of beta-thujaplicin were studied in Cupressus lusitanica suspension cultures. The fungal elicitor-induced biosynthesis of beta-thujaplicin was promoted by the feedings of malate, pyruvate, fumarate, succinate, and acetate. These results suggest some relationships between acetate/pyruvate metabolism and beta-thujaplicin biosynthesis, or between tricarboxylic acid cycle and beta-thujaplicin biosynthesis. Feedings of C. lusitanica suspension cultures with some monoterpenes inhibited elicitor-triggered beta-thujaplicin biosynthesis, but 2-carene and terpinyl acetate feedings significantly improved the beta-thujaplicin production of C. lusitanica suspension cultures. These results indicate a possible involvement of terpinyl acetate and 2-carene in beta-thujaplicin biosynthesis, as well as potential uses of these monoterpenes in large-scale beta-thujaplicin production.

  14. Monoterpene derivatives with anti-allergic activity from red peony root, the root of Paeonia lactiflora.

    Science.gov (United States)

    Shi, Yan-Hong; Zhu, Shu; Ge, Yue-Wei; He, Yu-Min; Kazuma, Kohei; Wang, Zhengtao; Yoshimatsu, Kayo; Komatsu, Katsuko

    2016-01-01

    The methanolic extract and its subfractions from red peony root, the dried roots of Paeonia lactiflora Pallas showed potent antiallergic effects, as inhibition of immunoglobulin E (IgE)-mediated degranulation in rat basophil leukemia (RBL)-2H3 cells. Bioassay-guided fractionation led to the isolation of 16 monoterpene derivatives, including 3 new compounds, paeoniflorol (1), 4'-hydroxypaeoniflorigenone (2) and 4-epi-albiflorin (3), together with 13 known ones (4-16). The chemical structures of the new compounds were elucidated on the basis of spectroscopic and chemical evidences. Among the isolated monoterpene derivatives, nine compounds showed potent anti-allergic effects and compound 1 was the most effective. A primary structure-activity relationship of monoterpene derivatives was discussed.

  15. Synthetic environments

    Science.gov (United States)

    Lukes, George E.; Cain, Joel M.

    1996-02-01

    The Advanced Distributed Simulation (ADS) Synthetic Environments Program seeks to create robust virtual worlds from operational terrain and environmental data sources of sufficient fidelity and currency to interact with the real world. While some applications can be met by direct exploitation of standard digital terrain data, more demanding applications -- particularly those support operations 'close to the ground' -- are well-served by emerging capabilities for 'value-adding' by the user working with controlled imagery. For users to rigorously refine and exploit controlled imagery within functionally different workstations they must have a shared framework to allow interoperability within and between these environments in terms of passing image and object coordinates and other information using a variety of validated sensor models. The Synthetic Environments Program is now being expanded to address rapid construction of virtual worlds with research initiatives in digital mapping, softcopy workstations, and cartographic image understanding. The Synthetic Environments Program is also participating in a joint initiative for a sensor model applications programer's interface (API) to ensure that a common controlled imagery exploitation framework is available to all researchers, developers and users. This presentation provides an introduction to ADS and the associated requirements for synthetic environments to support synthetic theaters of war. It provides a technical rationale for exploring applications of image understanding technology to automated cartography in support of ADS and related programs benefitting from automated analysis of mapping, earth resources and reconnaissance imagery. And it provides an overview and status of the joint initiative for a sensor model API.

  16. Monoterpene Compositions of Three Forested Ecosystems in the Central Amazon Basin

    Science.gov (United States)

    Jardine, A.; Fuentes, J. D.; Manzi, A. O.; Higuchi, N.; Chambers, J. Q.; Jardine, K.

    2014-12-01

    Monoterpenes play fundamental roles as secondary metabolites in forested ecosystems and as gas and liquid phase secondary organic aerosol (SOA) precursors in their surrounding atmospheres. While the chemical pathways involved in ozonolysis driven SOA formation from individual monoterpene precursors is known, local and regional chemical transport models are still lacking observations of speciated monoterpenes from forested atmospheres. Here, we present high vertically resolved mixing ratio profiles of speciated monoterpenes from the ambient air of three neighboring forested ecosystems in the central Amazon Basin. Two well-drained plateau primary forests and one seasonally flooded valley forest were sampled during the afternoon hours (13:00 - 16:30) on walkup towers from the initiation of the 2013-14 wet season through the onset of the 2014 dry season (Nov 2013 - Jul 2014). Ambient mixing ratios in all three ecosystems were greatest in the upper canopy with secondary sources of some monoterpenes within the sub-canopies. Relative vertical compositions of monoterpenes did not change significantly throughout the seasons for either ecosystem type. Both ecosystem types were dominated by d-limonene (up to 1.6 ppb) with equally strong mixing ratios of alpha-pinene in the valley compared to the much weaker a-pinene mixing ratios on the plateaus (up to 200 ppt). The highly reactive cis- and trans-beta-ocimene were consistently present in both ecosystems (up to 250 ppt) with the addition of equally high camphene mixing ratios in the valley forest (up to 200 ppt) which is present in the plateau ecosystems in low quantities (50 ppt). With respect to clean atmosphere mixing ratios of 10 ppb ozone, lifetimes are below 2 hours for camphene and below 30 minutes for ocimene, suggesting a potentially large impact on local and possibly regional ozonolysis and subsequent SOA composition.

  17. Process-based modelling of biogenic monoterpene emissions combining production and release from storage

    Directory of Open Access Journals (Sweden)

    G. Schurgers

    2009-05-01

    Full Text Available Monoterpenes, primarily emitted by terrestrial vegetation, can influence atmospheric ozone chemistry, and can form precursors for secondary organic aerosol. The short-term emissions of monoterpenes have been well studied and understood, but their long-term variability, which is particularly important for atmospheric chemistry, has not. This understanding is crucial for the understanding of future changes.

    In this study, two algorithms of terrestrial biogenic monoterpene emissions, the first one based on the short-term volatilization of monoterpenes, as commonly used for temperature-dependent emissions, and the second one based on long-term production of monoterpenes (linked to photosynthesis combined with emissions from storage, were compared and evaluated with measurements from a Ponderosa pine plantation (Blodgett Forest, California. The measurements were used to parameterize the long-term storage of monoterpenes, which takes place in specific storage organs and which determines the temporal distribution of the emissions over the year. The difference in assumptions between the first (emission-based method and the second (production-based method, which causes a difference in upscaling from instantaneous to daily emissions, requires roughly a doubling of emission capacities to bridge the gap to production capacities. The sensitivities to changes in temperature and light were tested for the new methods, the temperature sensitivity was slightly higher than that of the short-term temperature dependent algorithm.

    Applied on a global scale, the first algorithm resulted in annual total emissions of 29.6 Tg C a−1, the second algorithm resulted in 31.8 Tg C a−1 when applying the correction factor 2 between emission capacities and production capacities. However, the exact magnitude of such a correction is spatially varying and hard to determine as a global average.

  18. Process-based modelling of biogenic monoterpene emissions: sensitivity to temperature and light

    Directory of Open Access Journals (Sweden)

    G. Schurgers

    2009-01-01

    Full Text Available Monoterpenes, primarily emitted by terrestrial vegetation, can influence atmospheric ozone chemistry, and can form precursors for secondary organic aerosol. The short-term emissions of monoterpenes have been well studied and understood, but their long-term variability, which is particularly important for atmospheric chemistry, has not. This understanding is crucial for the understanding of future changes.

    In this study, two algorithms of terrestrial biogenic monoterpene emissions, the first one based on the short-term volatilization of monoterpenes, as commonly used for temperature-dependent emissions, and the second one based on long-term production of monoterpenes (linked to photosynthesis combined with emissions from storage, were compared and evaluated with measurements from a Ponderosa pine plantation (Blodgett Forest, California. The measurements were used to parameterize the long-term storage of monoterpenes, which takes place in specific storage organs and which determines the temporal distribution of the emissions over the year. The difference in assumptions between the first (emission-based method and the second (production-based method, which causes a difference in upscaling from instantaneous to daily emissions, requires roughly a doubling of emission capacities to bridge the gap to production capacities. The sensitivities to changes in temperature and light were tested for the new methods, the temperature sensitivity was slightly higher than that of the short-term temperature dependent algorithm.

    Applied on a global scale, the first algorithm resulted in annual total emissions of 29.6 Tg C a−1, the second algorithm resulted in 31.8 Tg C a−1 when applying the correction factor 2 between emission capacities and production capacities. However, the exact magnitude of such a correction is spatially varying and hard to determine as a global average.

  19. Qualitative and quantitative variation in monoterpene co-occurrence and composition in the essential oil of Thymus vulgaris chemotypes.

    Science.gov (United States)

    Thompson, John D; Chalchat, Jean-Claude; Michet, André; Linhart, Yan B; Ehlers, Bodil

    2003-04-01

    Thymus vulgaris has a chemical polymorphism with six different chemotypes that show marked spatial segregation in nature. Although some populations have a single chemotype in majority, many have two or three chemotypes. In this study we analyze the quantitative variation among T. vulgaris populations in the percentage of oil composed of the dominant monoterpene(s) for each chemotype. In general, phenolic chemotypes (thymol and carvacrol), which occur at the end of the biosynthetic chain, have a significantly lower proportion of their oil composed of their dominant monoterpene than nonphenolic chemotypes (geraniol, alpha-terpineol, and linalool). This is due to the presence of high amounts of precursors (gamma-terpinene and paracymene) in the oil of phenolic chemotypes. The essential oil of the nonphenolic thuyanol chemotype has four characteristic monoterpenes that together make up a lower proportion of the oil than the single dominant monoterpene of the other nonphenolic chemotypes. For all chemotypes, the percentage composition of the dominant monoterpene decreased significantly at sites where the chemotype is not the majority type. This decrease is correlated with a significant increase in either the proportion of the two precursors for the thymol chemotype or the monoterpenes characteristic of the other chemotypes at the site. The latter result suggests that a plant with dominant genes is responsible for the production of different monoterpenes can produce several molecules.

  20. Toxicity of Monoterpene Structure, Diversity and Concentration to Mountain Pine Beetles, Dendroctonus ponderosae: Beetle Traits Matter More.

    Science.gov (United States)

    Reid, Mary L; Sekhon, Jagdeep K; LaFramboise, Lanielle M

    2017-03-03

    A high diversity of plant defenses may be a response to herbivore diversity or may be collectively more toxic than single compounds, either of which may be important for understanding insect-plant associations. Monoterpenes in conifers are particularly diverse. We tested the fumigant toxicity of four monoterpenes, alone and in combination, to mountain pine beetles, Dendroctonus ponderosae, in the context of the beetles' individual body traits. Chemical structures of tested monoterpene hydrocarbons had modest effects on beetle survival, mass loss, water content and fat content, with (R)-(+)-limonene tending to be more toxic than (-)-α-pinene, (-)-β-pinene, and (+)-3-carene. Monoterpene diversity (all qualitative combinations of one to four monoterpenes) did not affect toxicity. Concentration (0 to 1200 ppm) of individual monoterpenes was a strong determinant of toxicity. Beetle body size and body condition index strongly and positively affected survival during monoterpene treatments. Larger beetles in better condition lost proportionally less mass during exposure, where proportion mass loss negatively affected survivorship. Toxicity was much more associated with water loss than with fat loss, suggesting that a main cost of detoxification is excretion, a process that has received little attention. These results provide insight into the determinants of beetle success in historic and novel hosts that differ in monoterpene composition and concentration. We also suggest that water availability will affect beetle success directly through their ability to tolerate detoxification as well as indirectly through host responses to drought.

  1. Synthetic foldamers.

    Science.gov (United States)

    Guichard, Gilles; Huc, Ivan

    2011-06-07

    Foldamers are artificial folded molecular architectures inspired by the structures and functions of biopolymers. This highlight focuses on important developments concerning foldamers produced by chemical synthesis and on the perspectives that these new self-organized molecular scaffolds offer. Progress in the field has led to synthetic objects that resemble small proteins in terms of size and complexity yet that may not contain any α-amino acids. Foldamers have introduced new tools and concepts to develop biologically active substances, synthetic receptors and novel materials.

  2. Simple proxies for estimating the concentrations of monoterpenes and their oxidation products at a boreal forest site

    Science.gov (United States)

    Kontkanen, Jenni; Paasonen, Pauli; Aalto, Juho; Bäck, Jaana; Rantala, Pekka; Petäjä, Tuukka; Kulmala, Markku

    2016-10-01

    The oxidation products of monoterpenes likely have a crucial role in the formation and growth of aerosol particles in boreal forests. However, the continuous measurements of monoterpene concentrations are usually not available on decadal timescales, and the direct measurements of the concentrations of monoterpene oxidation product have so far been scarce. In this study we developed proxies for the concentrations of monoterpenes and their oxidation products at a boreal forest site in Hyytiälä, southern Finland. For deriving the proxies we used the monoterpene concentration measured with a proton transfer reaction mass spectrometer (PTR-MS) during 2006-2013. Our proxies for the monoterpene concentration take into account the temperature-controlled emissions from the forest ecosystem, the dilution caused by the mixing within the boundary layer and different oxidation processes. All the versions of our proxies captured the seasonal variation of the monoterpene concentration, the typical proxy-to-measurements ratios being between 0.8 and 1.3 in summer and between 0.6 and 2.6 in winter. In addition, the proxies were able to describe the diurnal variation of the monoterpene concentration rather well, especially in summer months. By utilizing one of the proxies, we calculated the concentration of oxidation products of monoterpenes by considering their production in the oxidation and their loss due to condensation on aerosol particles. The concentration of oxidation products was found to have a clear seasonal cycle, with a maximum in summer and a minimum in winter. The concentration of oxidation products was lowest in the morning or around noon and highest in the evening. In the future, our proxies for the monoterpene concentration and their oxidation products can be used, for example, in the analysis of new particle formation and growth in boreal environments.

  3. Deoxyxylulose 5-phosphate reductoisomerase is not a rate-determining enzyme for essential oil production in spike lavender.

    Science.gov (United States)

    Mendoza-Poudereux, Isabel; Muñoz-Bertomeu, Jesús; Arrillaga, Isabel; Segura, Juan

    2014-11-01

    Spike lavender (Lavandula latifolia) is an economically important aromatic plant producing essential oils, whose components (mostly monoterpenes) are mainly synthesized through the plastidial methylerythritol 4-phosphate (MEP) pathway. 1-Deoxy-D-xylulose-5-phosphate (DXP) synthase (DXS), that catalyzes the first step of the MEP pathway, plays a crucial role in monoterpene precursors biosynthesis in spike lavender. To date, however, it is not known whether the DXP reductoisomerase (DXR), that catalyzes the conversion of DXP into MEP, is also a rate-limiting enzyme for the biosynthesis of monoterpenes in spike lavender. To investigate it, we generated transgenic spike lavender plants constitutively expressing the Arabidopsis thaliana DXR gene. Although two out of the seven transgenic T0 plants analyzed accumulated more essential oils than the controls, this is hardly imputable to the DXR transgene effect since a clear correlation between transcript accumulation and monoterpene production could not be established. Furthermore, these increased essential oil phenotypes were not maintained in their respective T1 progenies. Similar results were obtained when total chlorophyll and carotenoid content in both T0 transgenic plants and their progenies were analyzed. Our results then demonstrate that DXR enzyme does not play a crucial role in the synthesis of plastidial monoterpene precursors, suggesting that the control flux of the MEP pathway in spike lavender is primarily exerted by the DXS enzyme.

  4. Synthetic Astrobiology

    Science.gov (United States)

    Rothschild, Lynn J.

    2016-01-01

    Synthetic biology - the design and construction of new biological parts and systems and the redesign of existing ones for useful purposes - has the potential to transform fields from pharmaceuticals to fuels. Our lab has focused on the potential of synthetic biology to revolutionize all three major parts of astrobiology: Where do we come from? Where are we going? and Are we alone? For the first and third, synthetic biology is allowing us to answer whether the evolutionary narrative that has played out on planet earth is likely to have been unique or universal. For example, in our lab we are re-evolving the biosynthetic pathways of amino acids in order to understand potential capabilities of an early organism with a limited repertoire of amino acids and developing techniques for the recovery of metals from spent electronics on other planetary bodies. And what about the limits for life? Can we create organisms that expand the envelope for life? In the future synthetic biology will play an increasing role in human activities both on earth, in fields as diverse as human health and the industrial production of novel bio-composites. Beyond earth, we will rely increasingly on biologically-provided life support, as we have throughout our evolutionary history. In order to do this, the field will build on two of the great contributions of astrobiology: studies of the origin of life and life in extreme environments.

  5. Synthetic Astrobiology

    Science.gov (United States)

    Rothschild, Lynn J.

    2015-01-01

    Synthetic biology - the design and construction of new biological parts and systems and the redesign of existing ones for useful purposes - has the potential to transform fields from pharmaceuticals to fuels. Our lab has focused on the potential of synthetic biology to revolutionize all three major parts of astrobiology: Where do we come from? Where are we going? and Are we alone? For the first and third, synthetic biology is allowing us to answer whether the evolutionary narrative that has played out on planet earth is likely to have been unique or universal. For example, in our lab we are re-evolving the biosynthetic pathways of amino acids in order to understand potential capabilities of an early organism with a limited repertoire of amino acids and developing techniques for the recovery of metals from spent electronics on other planetary bodies. In the future synthetic biology will play an increasing role in human activities both on earth, in fields as diverse as human health and the industrial production of novel bio-composites. Beyond earth, we will rely increasingly on biologically-provided life support, as we have throughout our evolutionary history. In order to do this, the field will build on two of the great contributions of astrobiology: studies of the origin of life and life in extreme environments.

  6. Role of de novo biosynthesis in ecosystem scale monoterpene emissions from a boreal Scots pine forest

    Directory of Open Access Journals (Sweden)

    R. Taipale

    2011-08-01

    Full Text Available Monoterpene emissions from Scots pine have traditionally been assumed to originate as evaporation from specialized storage pools. More recently, the significance of de novo emissions, originating directly from monoterpene biosynthesis, has been recognized. To study the role of biosynthesis at the ecosystem scale, we measured monoterpene emissions from a Scots pine dominated forest in southern Finland using the disjunct eddy covariance method combined with proton transfer reaction mass spectrometry. The interpretation of the measurements was based on a correlation analysis and a hybrid emission algorithm describing both de novo and pool emissions. During the measurement period May–August 2007, the monthly medians of daytime emissions were 200, 290, 180, and 200 μg m−2 h−1. The emissions were partly light dependent, probably due to de novo biosynthesis. The emission potential for both de novo and pool emissions exhibited a decreasing summertime trend. The ratio of the de novo emission potential to the total emission potential varied between 30 % and 46 %. Although the monthly changes were not significant, the ratio always differed statistically from zero, suggesting that the role of de novo biosynthesis was observable. Given the uncertainties in this study, we conclude that more accurate estimates of the contribution of de novo emissions are required for improving monoterpene emission algorithms for Scots pine dominated forests.

  7. The monoterpenes of Artemisia tridentata ssp. vaseyana, Artemisia cana ssp. viscidula and Artemisia tridentata ssp. spiciformis.

    Science.gov (United States)

    Gunawardena, K; Rivera, S B; Epstein, W W

    2002-01-01

    Monoterpenes from three different members of the Anthemideae family, Artemisia tridentata ssp. vaseyana, Artemisia cana ssp. viscidula and Artemisia tridentata ssp. spiciformis were isolated and their structures determined using spectroscopic techniques. A total of 26 irregular and regular monoterpenes were identified. Among these, 20 had previously been identified in the Anthemideae family. Of the remaining six, four were known, but previously unidentified in this family. 2,2-Dimethyl-6-isopropenyl-2H-pyran, 2,3-dimethyl-6-isopropyl-4H-pyran and 2-isopropenyl-5-methylhexa-trans-3,5-diene-1-ol were isolated from both A. tridentata ssp. vaseyana and A. cana ssp. viscidula. The irregular monoterpene 2,2-dimethyl-6-isopropenyl-2H-pyran has a carbon skeleton analogous to the biologically important triterpene squalene. Two additional irregular monoterpenes, artemisia triene and trans-chrysanthemal were isolated from A. cana ssp. viscidula and lavandulol was isolated from A. tridentata ssp. spiciformis. This is the first time a compound possessing a lavandulyl-skeletal type has been found in the Anthemideae family.

  8. Comparative study of the antitumor effect of natural monoterpenes: relationship to cell cycle analysis

    Directory of Open Access Journals (Sweden)

    Abdeslam Jaafari

    2012-06-01

    Full Text Available Monoterpenes have been identified as responsible of important therapeutic effects of plant-extracts. In this work, we try to compare the cytotoxic effect of six monoterpenes (carvacrol, thymol, carveol, carvone, eugenol and isopulegol as well as their molecular mechanisms. The in vitro antitumor activity of the tested products, evaluated against five tumor cell lines, show that the carvacrol is the most cytotoxic monoterpene. The investigation of an eventual synergistic effect of the six natural monoterpenes with two anticancer drugs revealed that there is a significant synergy between them (p<5%. On the other hand, the effect of the tested products on cell cycle progression was examined by flow cytometry after DNA staining in order to investigate the molecular mechanism of their cytotoxic activity. The results revealed that carvacrol and carveol stopped the cell cycle progression in S phase; however, thymol and isopulegol stopped it in G0/G1 phase. Regarding carvone and eugenol, no effect on cell cycle was observed.

  9. Xylem monoterpenes of some hard pines of Western North America: three studies

    Science.gov (United States)

    Richard H. Smith

    1982-01-01

    Monoterpene composition was studied in a number of hard pine species and results were compared with earlier work. (1) Intratree measurements showed strong constancy of composition in both single-stemmed and forked trees of ponderosa, Jeffrey, Coulter, and Jeffrey x ponderosa pines. In grafts of these and other pines, the scion influenced the root stock, but not the...

  10. Synthetic chromosomes.

    Science.gov (United States)

    Schindler, Daniel; Waldminghaus, Torsten

    2015-11-01

    What a living organism looks like and how it works and what are its components-all this is encoded on DNA, the genetic blueprint. Consequently, the way to change an organism is to change its genetic information. Since the first pieces of recombinant DNA have been used to transform cells in the 1970s, this approach has been enormously extended. Bigger and bigger parts of the genetic information have been exchanged or added over the years. Now we are at a point where the construction of entire chromosomes becomes a reachable goal and first examples appear. This development leads to fundamental new questions, for example, about what is possible and desirable to build or what construction rules one needs to follow when building synthetic chromosomes. Here we review the recent progress in the field, discuss current challenges and speculate on the appearance of future synthetic chromosomes.

  11. Monoterpenes produced by Cupressus lusitanica cultured cells including a novel monoterpene (1R, 2S, 6S)-(+)-1,6-epoxy-4(8)-p-menthen-2-ol [corrected].

    Science.gov (United States)

    Matsunaga, Yoko; Fujita, Koki; Yamada, Junko; Ashitani, Tatsuya; Sakai, Kokki

    2003-12-01

    A novel monoterpene,(1R, 2S, 6S)-(+)-1,6-epoxy-4(8)-p-menthen-2-ol [corrected], was isolated from an elicitor-treated cell culture of Cupressus lusitanica (Mexican cypress). Ten known monoterpenes--limonene, myrcene, beta-ocimene, sabinene, terpinolene, 4-terpineol, alpha-terpineol, 4(8)-p-menthen-1,2-diol, 4-hydroxyphellandric acid methylester and beta-thujaplicin methylether--were also identified. Regioselective metabolisms of monoterpenes were observed in this culture.

  12. Origin of monoterpene emissions from boreal tree species: Determination of de novo and pool emissions by 13CO2 labeling

    Science.gov (United States)

    Rinne, J.; Ghirardo, A.; Koch, K.; Taipale, R.; Zimmer, I.; Schnitzler, J.

    2009-12-01

    Boreal forests emit a large amount of monoterpenes into the atmosphere. Traditionally these emissions are assumed to originate as evaporation from large storage pools. Thus their diurnal cycle would depend mostly on temperature. However, there is indication that a significant part of the monoterpene emission would originate directly from de novo synthesis. By applying 13CO2 fumigation and analyzing the isotope fractions with proton transfer reaction mass spectrometry (PTR-MS) and classical GC-MS we studied the origin of monoterpene emissions from some major Eurasian boreal and alpine tree species. We determined the fractions originating from de novo biosynthesis and from large internal monoterpene storages for three coniferous tree species with specialized monoterpene storage structures and one dicotyledon species without such structures. The emission from dicotyledon species Betula pendula originated solely from the de novo synthesis. The origin of the emissions from coniferous species was mixed with varying fraction originating from de novo synthesis (Pinus sylvestris 58%, Picea abies 33.5%, Larix decidua 9.8%) and the rest from large internal monoterpene storage pools. Application of the observed fractions of emission originating from de novo synthesis and large storage pools in a hybrid emission algorithm resulted in a better description of ecosystem scale monoterpene emissions from a boreal Scots pine forest stand.

  13. Quantifying environmental stress-induced emissions of algal isoprene and monoterpenes using laboratory measurements

    Science.gov (United States)

    Meskhidze, N.; Sabolis, A.; Reed, R.; Kamykowski, D.

    2015-02-01

    We report here production rates of isoprene and monoterpene compounds (α-pinene, β-pinene, camphene and d-limonene) from six phytoplankton monocultures as a function of irradiance and temperature. Irradiance experiments were carried out for diatom strains (Thalassiosira weissflogii and Thalassiosira pseudonana), prymnesiophyte strains (Pleurochrysis carterae), dinoflagellate strains (Karenia brevis and Prorocentrum minimum), and cryptophyte strains (Rhodomonas salina), while temperature experiments were carried out for diatom strains (Thalassiosira weissflogii and Thalassiosira pseudonana). Phytoplankton species, incubated in a climate-controlled room, were subject to variable light (90 to 900 μmol m-2 s-1) and temperature (18 to 30 °C) regimes. Compared to isoprene, monoterpene emissions were an order of magnitude lower at all light and temperature levels. Emission rates are normalized by cell count and Chlorophyll a (Chl a) content. Diatom strains were the largest emitters, with ~ 2 × 10-17 g(cell)-1h-1 (~ 35 μg (g Chl a)-1 h-1) for isoprene and ~ 5 × 10-19 g (cell)-1 h-1 (~ 1 μg (g Chl a)-1) h-1) for α-pinene. The contribution to the total monoterpene production was ~ 70% from α-pinene, ~ 20% for d-limonene, and 250 μmol m-2 s-1) irradiance. Measurements revealed different patterns for time-averaged emissions rates over two successive days. On the first day, most of the species showed a distinct increase in production rates within the first 4 h while, on the second day, the emission rates were overall higher, but less variable. The data suggest that enhanced amounts of isoprene and monoterpenes are emitted from phytoplankton as a result of perturbations in environmental conditions that cause imbalance in chloroplasts and force primary producers to acclimate physiologically. This relationship could be a valuable tool for development of dynamic ecosystem modeling approaches for global marine isoprene and monoterpene emissions based on phytoplankton

  14. Quantifying environmental stress induced emissions of algal isoprene and monoterpenes using laboratory measurements

    Science.gov (United States)

    Meskhidze, N.; Sabolis, A.; Reed, R.; Kamykowski, D.

    2014-09-01

    We report here production rates of isoprene and monoterpene compounds (α-pinene, β-pinene, camphene and d-limonene) from six phytoplankton monocultures as a function of irradiance and temperature. Irradiance experiments were carried out for diatom strains - Thalassiosira weissflogii and Thalassiosira pseudonana; prymnesiophyte strains - Pleurochrysis carterae; dinoflagellate strains - Karenia brevis and Prorocentrum minimum; cryptophyte strains - Rhodomonas salina, while temperature experiments were carried out for diatom strains - Thalassiosira weissflogii and Thalassiosira pseudonana. Phytoplankton species, incubated in a climate-controlled room, were subject to variable light (90 to 900 μmol m-2s-1) and temperature (18 to 30 °C) regimes. Compared to isoprene, monoterpene emissions were an order of magnitude lower at all light and temperature levels. Emission rates are normalized by cell count and Chlorophyll a (Chl a) content. Diatom strains were the largest emitters, with ~2x1017g (cell)-1h-1 (~35 μg (g Chl a)-1h-1) for isoprene and ~5x10-19 g (cell)-1h-1 (~1μg (g Chl a)-1) h-1) for α-pinene. The contribution to the total monoterpene production was ~70% from α-pinene, ~20% for d-limonene, and 250 μmol m-2s-1) irradiance. Measurements revealed different patterns for time-averaged emissions rates over two successive days. On the first day most of the species showed distinct increase in production rates within the first four hours, while on the second day the emission rates were overall higher, but less variable. The data suggest that enhanced amounts of isoprene and monoterpenes are emitted from phytoplankton as a result of perturbations in environmental conditions that cause disbalance in chloroplasts and forces primary producers to acclimate physiologically. This relationship could be a valuable tool for development of dynamic ecosystem modeling approaches for global marine isoprene and monoterpene emissions based on phytoplankton physiological

  15. Laboratory and field measurements of enantiomeric monoterpene emissions as a function of chemotype, light and temperature

    Science.gov (United States)

    Song, W.; Staudt, M.; Bourgeois, I.; Williams, J.

    2014-03-01

    Plants emit significant amounts of monoterpenes into the earth's atmosphere, where they react rapidly to form a multitude of gas phase species and particles. Many monoterpenes exist in mirror-image forms or enantiomers. In this study the enantiomeric monoterpene profile for several representative plants (Quercus ilex L., Rosmarinus officinalis L., and Pinus halepensis Mill.) was investigated as a function of chemotype, light and temperature both in the laboratory and in the field. Analysis of enantiomeric monoterpenes from 19 Quercus ilex individuals from Southern France and Spain revealed four regiospecific chemotypes (genetically fixed emission patterns). In agreement with previous work, only Quercus ilex emissions increased strongly with light. However, for all three plant species no consistent enantiomeric variation was observed as a function of light, and the enantiomeric ratio of α-pinene was found to vary by less than 20% from 100 and 1000 μmol m-2 s-1 PAR (photosynthetically active radiation). The rate of monoterpene emission increased with temperature from all three plant species, but little variation in the enantiomeric distribution of α-pinene was observed with temperature. There was more enantiomeric variability between individuals of the same species than could be induced by either light or temperature. Field measurements of α-pinene enantiomer mixing ratios in the air, taken at a Quercus ilex forest in Southern France, and several other previously reported field enantiomeric ratio diel cycle profiles are compared. All show smoothly varying diel cycles (some positive and some negative) even over changing wind directions. This is surprising in comparison with variations of enantiomeric emission patterns shown by individuals of the same species.

  16. Mutational analysis of a monoterpene synthase reaction: altered catalysis through directed mutagenesis of (-)-pinene synthase from Abies grandis.

    Science.gov (United States)

    Hyatt, David C; Croteau, Rodney

    2005-07-15

    Two monoterpene synthases, (-)-pinene synthase and (-)-camphene synthase, from grand fir (Abies grandis) produce different product mixtures despite having highly homologous amino acid sequences and, presumably, very similar three-dimensional structures. The major product of (-)-camphene synthase, (-)-camphene, and the major products of (-)-pinene synthase, (-)-alpha-pinene, and (-)-beta-pinene, arise through distinct mechanistic variations of the electrophilic reaction cascade that is common to terpenoid synthases. Structural modeling followed by directed mutagenesis in (-)-pinene synthase was used to replace selected amino acid residues with the corresponding residues from (-)-camphene synthase in an effort to identify the amino acids responsible for the catalytic differences. This approach produced an enzyme in which more than half of the product was channeled through an alternative pathway. It was also shown that several (-)-pinene synthase to (-)-camphene synthase amino acid substitutions were necessary before catalysis was significantly altered. The data support a model in which the collective action of many key amino acids, located both in and distant from the active site pocket, regulate the course of the electrophilic reaction cascade.

  17. Hypnotic activity of melatonin: involvement of semicarbazide hydrochloride, blocker of synthetic enzyme for GABA%GABA合成酶抑制剂盐酸氨基脲对褪黑激素催眠作用的影响

    Institute of Scientific and Technical Information of China (English)

    王芳; 李经才; 吴春福; 杨静玉; 徐峰; 彭飞

    2002-01-01

    目的:观察GABA合成酶抑制剂盐酸氨基脲对褪黑激素催眠作用的影响.方法:采用小鼠协同戊巴比妥钠睡眠法和大鼠脑电图描记法测定盐酸氨基脲对睡眠和褪黑激素催眠作用的影响.结果:褪黑激素对小鼠和大鼠均具有明显的催眠作用.盐酸氨基脲单独使用对小鼠和大鼠的睡眠无影响,但能明显阻断褪黑激素对戊巴比妥钠引起的小鼠睡眠时间的延长,并且明显抑制褪黑激素引起的大鼠总睡眠时间,慢波睡眠时间,快波睡眠时间的增加和觉醒时间的减少.结论:盐酸氨基脲能明显拮抗褪黑激素的催眠作用,提示褪黑素的催眠作用由GABA能系统介导.%AIM: To assess the effect of semicarbazide hydrochloride (SCZ), the blocker of synthetic enzyme for GABA, onthe hypnotic activity of melatonin. METHODS: Righting reflex method in mice and electroencephalography (EEG)in rats were used to determine effects of SCZ on sleep and hypnotic activity of melatonin. RESULTS: Melatonindisplayed a marked hypnotic activity both in righting reflex experiment and EEG recording. SCZ had no influenceon sleep parameters in mice and rats when it was used alone. However, it blocked the sleep-potentiation effect ofmelatonin in mice. SCZ also inhibited melatonin-induced increase in total sleep time, slow wave sleep time, andparadoxical sleep time, and prevented melatonin-induced decrease in awake time in rats. CONCLUSION: SCZantagonized the hypnotic activity of melatonin. It is thought that the hypnotic activity of melatonin is mediated byGABAergic system.

  18. Synthetic Cannabinoids.

    Science.gov (United States)

    Mills, Brooke; Yepes, Andres; Nugent, Kenneth

    2015-07-01

    Synthetic cannabinoids (SCBs), also known under the brand names of "Spice," "K2," "herbal incense," "Cloud 9," "Mojo" and many others, are becoming a large public health concern due not only to their increasing use but also to their unpredictable toxicity and abuse potential. There are many types of SCBs, each having a unique binding affinity for cannabinoid receptors. Although both Δ-tetrahydrocannabinol (THC) and SCBs stimulate the same receptors, cannabinoid receptor 1 (CB1) and cannabinoid receptor 2 (CB2), studies have shown that SCBs are associated with higher rates of toxicity and hospital admissions than is natural cannabis. This is likely due to SCBs being direct agonists of the cannabinoid receptors, whereas THC is a partial agonist. Furthermore, the different chemical structures of SCBs found in Spice or K2 may interact in unpredictable ways to elicit previously unknown, and the commercial products may have unknown contaminants. The largest group of users is men in their 20s who participate in polydrug use. The most common reported toxicities with SCB use based on studies using Texas Poison Control records are tachycardia, agitation and irritability, drowsiness, hallucinations, delusions, hypertension, nausea, confusion, dizziness, vertigo and chest pain. Acute kidney injury has also been strongly associated with SCB use. Treatment mostly involves symptom management and supportive care. More research is needed to identify which contaminants are typically found in synthetic marijuana and to understand the interactions between different SBCs to better predict adverse health outcomes.

  19. Natural - synthetic - artificial!

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2010-01-01

    The terms "natural," "synthetic" and "artificial" are discussed in relation to synthetic and artificial chromosomes and genomes, synthetic and artificial cells and artificial life.......The terms "natural," "synthetic" and "artificial" are discussed in relation to synthetic and artificial chromosomes and genomes, synthetic and artificial cells and artificial life....

  20. Synthesis of both enantiomers of isorobinal, a novel cyclic monoterpene isolated from the astigmatid mite, Rhizoglyphus sp.

    Science.gov (United States)

    Liang, Ting; Kuwahara, Shigefumi

    2002-11-01

    Both enantiomers of isorobinal, a cyclic monoterpene isolated from the astigmatid mite (Rhizoglyphus sp.), were synthesized from the enantiomers of perillaldehyde in four steps by using PCC-oxidation of a tertiary allylic alcohol intermediate as the key step.

  1. Drought reduced monoterpene emissions from the evergreen Mediterranean oak Quercus ilex: results from a throughfall displacement experiment

    Directory of Open Access Journals (Sweden)

    S. Rambal

    2009-07-01

    Full Text Available The effects of water limitations on the emission of biogenic volatile organic compounds are not well understood. Experimental approaches studying drought effects in natural conditions are still missing. To address this question, a throughfall displacement experiment was set up in a natural forest of Quercus ilex, an evergreen Mediterranean oak emitting monoterpenes. Mature trees were exposed in 2005 and 2006 either to an additional drought, to irrigation or to natural drought (untreated control. In both years, absolute monoterpene emission rates as well as the respective standard factors of the trees exposed to normal and additional drought strongly declined during the drought periods. Monoterpene emissions were lower in year 2006 than in year 2005 (factor 2 due to a more pronounced summer drought period in this respective year. We observed a significant difference between the irrigation and additional drought or control treatment: irrigated trees emitted 82% more monoterpenes during the drought period 2006 than the trees of the other treatments. However, no significant effect on monoterpene emission was observed between normal and additional drought treatments, despite a significant effect on leaf water potential and photochemical efficiency. During the development of drought, monoterpene emissions responded exponentially rather than linearly to decreasing leaf water potential. Emissions rapidly declined when the water potential dropped below −2 MPa and photosynthesis was persistently inhibited. Monoterpene synthase activities measured in vitro showed no clear reduction during the same period. From our results we conclude that drought significantly reduces monoterpene fluxes of Mediterranean Holm oak forest into the atmosphere due to a lack of primary substrates coming from photosynthetic processes.

  2. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents.

    Directory of Open Access Journals (Sweden)

    Anna Gliszczyńska

    Full Text Available The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59-87% and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts. The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2.

  3. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    Science.gov (United States)

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  4. Selective removal of monoterpenes from bergamot oil by inclusion in deoxycholic acid.

    Science.gov (United States)

    Fantin, Giancarlo; Fogagnolo, Marco; Maietti, Silvia; Rossetti, Stefano

    2010-05-12

    A new approach for removing monoterpenes (MTs) from bergamot oil by selective inclusion in deoxycholic acid (DCA) is proposed. The inclusion process is very efficient, the included fraction being composed mainly of limonene (71.7%) and gamma-terpinene (19.8%). On the other hand, the deterpenated bergamot oil fraction showed for the linalool and linalyl acetate derivatives significant increases from 16.6 and 21.4% to 18.3 and 42.2%, respectively. The major advantages of this methodology are its simplicity, the mild conditions employed, and the quantitative recovery of both host (DCA) and guest (monoterpenes) compounds. Differential scanning calorimetry (DSC), thermal gravimetry (TG), powder X-ray diffractometry (XRPD), infrared spectroscopy (IR), and proton magnetic resonance ((1)H NMR) analysis were used to investigate and characterize the inclusion compounds.

  5. Synthetic Brainbows

    KAUST Repository

    Wan, Y.

    2013-06-01

    Brainbow is a genetic engineering technique that randomly colorizes cells. Biological samples processed with this technique and imaged with confocal microscopy have distinctive colors for individual cells. Complex cellular structures can then be easily visualized. However, the complexity of the Brainbow technique limits its applications. In practice, most confocal microscopy scans use different florescence staining with typically at most three distinct cellular structures. These structures are often packed and obscure each other in rendered images making analysis difficult. In this paper, we leverage a process known as GPU framebuffer feedback loops to synthesize Brainbow-like images. In addition, we incorporate ID shuffing and Monte-Carlo sampling into our technique, so that it can be applied to single-channel confocal microscopy data. The synthesized Brainbow images are presented to domain experts with positive feedback. A user survey demonstrates that our synthetic Brainbow technique improves visualizations of volume data with complex structures for biologists.

  6. Biosynthesis of monoterpenes: Stereochemistry of the coupled isomerization and cyclization of geranyl pyrophosphate to camphane and isocamphane monoterpenes

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.; Gershenzon, J.; Wheeler, C.J.; Satterwhite, D.M. (Washington State Univ., Pullman (USA))

    1990-03-01

    The conversion of geranyl pyrophosphate to (+)-bornyl pyrophosphate and (+)-camphene is considered to proceed by the initial isomerization of the substrate to (-)-(3R)-linalyl pyrophosphate and the subsequent cyclization of this bound intermediate. In the case of (-)-bornyl pyrophosphate and (-)-camphene, isomerization of the substrate to the (+)-(3S)-linalyl intermediate precedes cyclization. The geranyl and linalyl precursors were shown to be mutually competitive substrates (inhibitors) of the relevant cyclization enzymes isolated from Salvia officinalis (sage) and Tanacetum vulgare (tansy) by the mixed substrate analysis method, demonstrating that isomerization and cyclization take place at the same active site. Incubation of partially purified enzyme preparations with (3R)-(1Z-3H)linalyl pyrophosphate plus (1-14C)geranyl pyrophosphate gave rise to double-labeled (+)-bornyl pyrophosphate and (+)-camphene, whereas incubation of enzyme preparations catalyzing the antipodal cyclizations with (3S)-(1Z-3H)-linalyl pyrophosphate plus (1-14C)geranyl pyrophosphate yielded double-labeled (-)-bornyl pyrophosphate and (-)-camphene. Each product was then transformed to the corresponding (+)- or (-)-camphor without change in the 3H:14C isotope ratio, and the location of the tritium label was deduced in each case by stereoselective, base-catalyzed exchange of the exo-alpha-hydrogen of the derived ketone. The finding that the 1Z-3H of the linalyl precursor was positioned at the endo-alpha-hydrogen of the corresponding camphor in all cases, coupled to the previously demonstrated retention of configuration at C1 of the geranyl substrate in these transformations, confirmed the syn-isomerization of geranyl pyrophosphate to linalyl pyrophosphate and the cyclization of the latter via the anti,endo- conformer.

  7. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  8. Evaluating the Potential Importance of Monoterpene Degradation for Global Acetone Production

    Science.gov (United States)

    Kelp, M. M.; Brewer, J.; Keller, C. A.; Fischer, E. V.

    2015-12-01

    Acetone is one of the most abundant volatile organic compounds (VOCs) in the atmosphere, but estimates of the global source of acetone vary widely. A better understanding of acetone sources is essential because acetone serves as a source of HOx in the upper troposphere and as a precursor to the NOx reservoir species peroxyacetyl nitrate (PAN). Although there are primary anthropogenic and pyrogenic sources of acetone, the dominant acetone sources are thought to be from direct biogenic emissions and photochemical production, particularly from the oxidation of iso-alkanes. Recent work suggests that the photochemical degradation of monoterpenes may also represent a significant contribution to global acetone production. We investigate that hypothesis using the GEOS-Chem chemical transport model. In this work, we calculate the emissions of eight terpene species (α-pinene, β-pinene, limonene, Δ3-carene, myrcene, sabinene, trans-β-ocimene, and an 'other monoterpenes' category which contains 34 other trace species) and couple these with upper and lower bound literature yields from species-specific chamber studies. We compare the simulated acetone distributions against in situ acetone measurements from a global suite of NASA aircraft campaigns. When simulating an upper bound on yields, the model-to-measurement comparison improves for North America at both the surface and in the upper troposphere. The inclusion of acetone production from monoterpene degradation also improves the ability of the model to reproduce observations of acetone in East Asian outflow. However, in general the addition of monoterpenes degrades the model comparison for the Southern Hemisphere.

  9. European emissions of isoprene and monoterpenes from the Last Glacial Maximum to present

    OpenAIRE

    Schurgers, G.; Hickler, T.; Miller, P. A.; Arneth, A.

    2009-01-01

    Biogenic volatile organic compounds (BVOC), such as isoprene and monoterpenes, play an important role in atmospheric processes. BVOC species are oxidized in the atmosphere and influence levels of ozone. The less volatile amongst the BVOC and their oxidation products are important for the formation and growth of secondary biogenic aerosol. In this way, the earth's radiation balance is affected.

    Geographic distribution and temporal changes in BVOC emissions are highly uncer...

  10. Improving monoterpene geraniol production through geranyl diphosphate synthesis regulation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Zhao, Jianzhi; Bao, Xiaoming; Li, Chen; Shen, Yu; Hou, Jin

    2016-05-01

    Monoterpenes have wide applications in the food, cosmetics, and medicine industries and have recently received increased attention as advanced biofuels. However, compared with sesquiterpenes, monoterpene production is still lagging in Saccharomyces cerevisiae. In this study, geraniol, a valuable acyclic monoterpene alcohol, was synthesized in S. cerevisiae. We evaluated three geraniol synthases in S. cerevisiae, and the geraniol synthase Valeriana officinalis (tVoGES), which lacked a plastid-targeting peptide, yielded the highest geraniol production. To improve geraniol production, synthesis of the precursor geranyl diphosphate (GPP) was regulated by comparing three specific GPP synthase genes derived from different plants and the endogenous farnesyl diphosphate synthase gene variants ERG20 (G) (ERG20 (K197G) ) and ERG20 (WW) (ERG20 (F96W-N127W) ), and controlling endogenous ERG20 expression, coupled with increasing the expression of the mevalonate pathway by co-overexpressing IDI1, tHMG1, and UPC2-1. The results showed that overexpressing ERG20 (WW) and strengthening the mevalonate pathway significantly improved geraniol production, while expressing heterologous GPP synthase genes or down-regulating endogenous ERG20 expression did not show positive effect. In addition, we constructed an Erg20p(F96W-N127W)-tVoGES fusion protein, and geraniol production reached 66.2 mg/L after optimizing the amino acid linker and the order of the proteins. The best strain yielded 293 mg/L geraniol in a fed-batch cultivation, a sevenfold improvement over the highest titer previously reported in an engineered S. cerevisiae strain. Finally, we showed that the toxicity of geraniol limited its production. The platform developed here can be readily used to synthesize other monoterpenes.

  11. Remote sensing estimation of isoprene and monoterpene emissions generated by natural vegetation in Monterrey, Mexico.

    Science.gov (United States)

    Gastelum, Sandra L; Mejía-Velázquez, G M; Lozano-García, D Fabián

    2016-06-01

    In addition to oxygen, hydrocarbons are the most reactive chemical compounds produced by plants into the atmosphere. These compounds are part of the family of volatile organic compounds (VOCs) and are discharged in a great variety of forms. Among the VOCs produced by natural sources such as vegetation, the most studied until today are the isoprene and monoterpene. These substances can play an important role in the chemical balance of the atmosphere of a region. In this project, we develop a methodology to estimate the natural (vegetation) emission of isoprene and monoterpenes and applied it to the Monterrey Metropolitan Area, Mexico and its surrounding areas. Landsat-TM data was used to identify the dominant vegetation communities and field work to determine the foliage biomass density of key species. The studied communities were submontane scrub, oak, and pine forests and a combination of both. We carried out the estimation of emissions for isoprene and monoterpenes compounds in the different plant communities, with two different criteria: (1) taking into account the average foliage biomass density obtained from the various sample point in each vegetation community, and (2) using the foliage biomass density obtained for each transect, associated to an individual spectral class within a particular vegetation type. With this information, we obtained emission maps for each case. The results show that the main producers of isoprene are the communities that include species of the genus Quercus, located mainly on the Sierra Madre Oriental and Sierra de Picachos, with average isoprene emissions of 314.6 ton/day and 207.3 ton/day for the two methods utilized. The higher estimates of monoterpenes were found in the submontane scrub areas distributed along the valley of the metropolitan zone, with an estimated average emissions of 47.1 ton/day and 181.4 tons for the two methods respectively.

  12. The contribution of wine-derived monoterpene glycosides to retronasal odour during tasting.

    Science.gov (United States)

    Parker, Mango; Black, Cory A; Barker, Alice; Pearson, Wes; Hayasaka, Yoji; Francis, I Leigh

    2017-10-01

    This study investigated the sensory significance of monoterpene glycosides during tasting, by retronasal perception of odorant aglycones released in-mouth. Monoterpene glycosides were isolated from Gewürztraminer and Riesling juices and wines, chemically characterised and studied using sensory time-intensity methodology, together with a synthesised monoterpene glucoside. When assessed in model wine at five times wine-like concentration, Gewürztraminer glycosides and geranyl glucoside gave significant fruity flavour, although at wine-like concentrations, or in the presence of wine volatiles, the effect was not significant. Gewürztraminer glycosides, geranyl glucoside and guaiacyl glucoside were investigated using a sensory panel (n=39), revealing large inter-individual variability, with 77% of panellists responding to at least one glycoside. The study showed for the first time that grape-derived glycosides can contribute perceptible fruity flavour, providing a means of enhancing flavour in wines, and confirms the results of previous studies that the effect is highly variable across individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. In situ measurements of isoprene and monoterpenes within a south-east Asian tropical rainforest

    Directory of Open Access Journals (Sweden)

    C. E. Jones

    2011-07-01

    Full Text Available Biogenic volatile organic compounds (BVOCs emitted from tropical rainforests comprise a substantial fraction of global atmospheric VOC emissions, however there are only relatively limited measurements of these species in tropical rainforest regions. We present observations of isoprene, α-pinene, camphene, Δ-3-carene, γ-terpinene and limonene, as well as oxygenated VOCs (OVOCs of biogenic origin such as methacrolein, in ambient air above a tropical rainforest in Malaysian Borneo during the Oxidant and Particle Photochemical Processes above a south-east Asian tropical rainforest (OP3 project in 2008. Daytime composition was dominated by isoprene, with an average mixing ratio of the order of ~1 ppb. γ-terpinene, limonene and camphene were the most abundant monoterpenes, with average daytime mixing ratios of 102, 71 and 66 ppt respectively, and with an average monoterpene toisoprene ratio of 0.3 during sunlit hours, compared to 2.0 at night. Limonene and camphene abundances were seen to be related to both temperature and light conditions. In contrast, γ-terpinene emission continued into the late afternoon/evening, under relatively low temperature and light conditions. The contributions of isoprene, monoterpenes and other classes of VOC to the volatile carbon budget and OH reactivity have been summarised for this rainforest location. We observe good agreement between surface and aircraft measurements of boundary layer isoprene and methacrolein above the natural rainforest, suggesting that the ground-level observations are broadly representative of isoprene emissions from this region.

  14. Biocontrol potential of essential oil monoterpenes against housefly, Musca domestica (Diptera: Muscidae).

    Science.gov (United States)

    Kumar, Peeyush; Mishra, Sapna; Malik, Anushree; Satya, Santosh

    2014-02-01

    Housefly (Musca domestica L.), one of the most common insects in human settlements, has been associated as vectors for various food-borne pathogens, causing food spoilage and disease transmission. The control of housefly was attempted using plant monoterpenes; menthone, menthol, menthyl acetate, limonene, citral and 1,8-cineole, against different life stages of housefly. Bioefficacy against housefly adults revealed highest repellent activity by menthol (95.6 percent) and menthone (83.3 percent). Against housefly larvae, menthol with an LC90 of 0.02 µl/cm(2) in contact toxicity assay and menthone with a LC90 value of 5.4 µl/L in fumigation assay were found to be most effective control agent. With respect to pupicidal activity, superior performance was shown by menthol, citral and 1,8-cineole in contact toxicity assay and citral and 1,8-cineole in fumigation assay. Limonene was found to be the poorest performer in all the assays. Overall, highest efficacy observed for menthol and menthone in various bioassays was in agreement with the results of essential oil activity obtained previously. Significant activity of monoterpenes against various life stages of housefly demonstrates their potential as excellent insecticides with prospects of monoterpenes being developed into eco-friendly and acceptable products for housefly control.

  15. Emissions of isoprene, monoterpene and short-chained carbonyl compounds from Eucalyptus spp. in southern Australia

    Science.gov (United States)

    Winters, Anthony J.; Adams, Mark A.; Bleby, Tim M.; Rennenberg, Heinz; Steigner, Dominik; Steinbrecher, Rainer; Kreuzwieser, Jürgen

    Eucalypts are among the highest emitters of biogenic volatile organic compounds, yet there is relatively little data available from field studies of this genus. Emissions of isoprene, monoterpenes and the short-chained carbonyls formaldehyde, acetaldehyde and acetone were determined from four species ( Eucalyptus camaldulensis, Eucalyptus globulus, Eucalyptus grandis, and Eucalytpus viminalis) in Australia. A smaller comparative study was conducted on E. camaldulensis in south-eastern Australia. Carbonyl emissions, reported here for the first time from eucalypts, were generally comparable with rates reported for other species, with diurnal emissions peaking at about 4, 75 and 34 nmol m -2 min -1 for acetone, formaldehyde and acetaldehyde respectively. There was wide variation in diurnal isoprene and monoterpene emissions between species, but under standard conditions, isoprene emissions were much lower than previous reports. Conversely, standard emission rates of monoterpenes were as much as six times greater than previous reports for some species. Emission of each carbonyl was correlated with its ambient concentration across different species, but more weakly related to temperature. Acetaldehyde emission in particular was significantly correlated with transpiration, but not with sap flow or with ethanol concentrations in xylem sap, suggesting fermentation within the leaf and stomatal conductance are primary controlling processes. Differences in acetaldehyde exchange velocities between sites, in addition to transpiration differences, suggest stomata may indeed exert long term emission regulation, in contrast to compounds for which no biological sink exists.

  16. CCN activity and droplet growth kinetics of fresh and aged monoterpene secondary organic aerosol

    Directory of Open Access Journals (Sweden)

    G. J. Engelhart

    2008-01-01

    Full Text Available The ability of secondary organic aerosol (SOA produced from the ozonolysis of α-pinene and monoterpene mixtures (α-pinene, β-pinene, limonene and 3-carene to become cloud droplets was investigated. Monoterpene SOA is quite active and would likely be a good source of cloud condensation nuclei (CCN in the atmosphere. A static CCN counter and a Scanning Mobility CCN Analyser (a Scanning Mobility Particle Sizer coupled with a Continuous Flow counter were used for the CCN measurements. A decrease in CCN activation diameter for α-pinene SOA of approximately 3 nm h−1 was observed as the aerosol continued to react with oxidants. Hydroxyl radicals further oxidize the SOA particles thereby enhancing the particle CCN activity with time. The initial concentrations of ozone and monoterpene precursor (for concentrations lower than 40 ppb do not appear to affect the activity of the resulting SOA. Köhler Theory Analysis (KTA is used to infer the molar mass of the SOA sampled online and offline from atomized filter samples. KTA suggests that the aged aerosol (both from α-pinene and the mixed monoterpene oxidation is primarily water-soluble (around 70–80%, with an estimated average molar mass of 180±55 g mol−1 (consistent with existing SOA speciation studies. CCN activity measurements of the SOA mixed with (NH42SO4 suggest that the organic can depress surface tension by as much as 10 nM m−1 (with respect to pure water. The droplet growth kinetics of SOA samples are similar to (NH42SO4, except at low supersaturation, where SOA tends to grow more slowly. The CCN activity of α-pinene and mixed monoterpene SOA can be modelled by a very simple implementation of Köhler theory, assuming complete dissolution of the particles, no dissociation into ions, molecular weight of 180 g mol−1, density of 1.5 g cm−3, and surface tension to

  17. CCN activity and droplet growth kinetics of fresh and aged monoterpene secondary organic aerosol

    Directory of Open Access Journals (Sweden)

    G. J. Engelhart

    2008-07-01

    Full Text Available The ability of secondary organic aerosol (SOA produced from the ozonolysis of α-pinene and monoterpene mixtures (α-pinene, β-pinene, limonene and 3-carene to become cloud droplets was investigated. A static CCN counter and a Scanning Mobility CCN Analyser (a Scanning Mobility Particle Sizer coupled with a Continuous Flow counter were used for the CCN measurements. Consistent with previous studies monoterpene SOA is quite active and would likely be a good source of cloud condensation nuclei (CCN in the atmosphere. A decrease in CCN activation diameter for α-pinene SOA of approximately 3 nm hr−1 was observed as the aerosol continued to react with oxidants. Hydroxyl radicals further oxidize the SOA particles thereby enhancing the particle CCN activity with time. The initial concentrations of ozone and monoterpene precursor (for concentrations lower than 40 ppb do not appear to affect the activity of the resulting SOA. Köhler Theory Analysis (KTA is used to infer the molar mass of the SOA sampled online and offline from atomized filter samples. The estimated average molar mass of online SOA was determined to be 180±55 g mol−1 (consistent with existing SOA speciation studies assuming complete solubility. KTA suggests that the aged aerosol (both from α-pinene and the mixed monoterpene oxidation is primarily water-soluble (around 65%. CCN activity measurements of the SOA mixed with (NH42SO4 suggest that the organic can depress surface tension by as much as 10 N m−1 (with respect to pure water. The droplet growth kinetics of SOA samples are similar to (NH42SO4, except at low supersaturation, where SOA tends to grow more slowly. The CCN activation diameter of α-pinene and mixed monoterpene SOA can be modelled to within 10–15% of experiments by a simple implementation of Köhler theory, assuming complete dissolution of the particles, no

  18. Quantifying environmental stress induced emissions of algal isoprene and monoterpenes using laboratory measurements

    Directory of Open Access Journals (Sweden)

    N. Meskhidze

    2014-09-01

    Full Text Available We report here production rates of isoprene and monoterpene compounds (α-pinene, β-pinene, camphene and d-limonene from six phytoplankton monocultures as a function of irradiance and temperature. Irradiance experiments were carried out for diatom strains – Thalassiosira weissflogii and Thalassiosira pseudonana; prymnesiophyte strains – Pleurochrysis carterae; dinoflagellate strains – Karenia brevis and Prorocentrum minimum; cryptophyte strains – Rhodomonas salina, while temperature experiments were carried out for diatom strains – Thalassiosira weissflogii and Thalassiosira pseudonana. Phytoplankton species, incubated in a climate-controlled room, were subject to variable light (90 to 900 μmol m−2s−1 and temperature (18 to 30 °C regimes. Compared to isoprene, monoterpene emissions were an order of magnitude lower at all light and temperature levels. Emission rates are normalized by cell count and Chlorophyll a (Chl a content. Diatom strains were the largest emitters, with ~2x1017g (cell−1h−1 (~35 μg (g Chl a−1h−1 for isoprene and ~5x10−19 g (cell−1h−1 (~1μg (g Chl a−1 h−1 for α-pinene. The contribution to the total monoterpene production was ~70% from α-pinene, ~20% for d-limonene, and −2s−1 and a gradual increase at high (>250 μmol m−2s−1 irradiance. Measurements revealed different patterns for time-averaged emissions rates over two successive days. On the first day most of the species showed distinct increase in production rates within the first four hours, while on the second day the emission rates were overall higher, but less variable. The data suggest that enhanced amounts of isoprene and monoterpenes are emitted from phytoplankton as a result of perturbations in environmental conditions that cause disbalance in chloroplasts and forces primary producers to acclimate physiologically. This relationship could be a valuable tool for development of dynamic ecosystem modeling approaches for global

  19. Secondary organic aerosol formation from hydroxyl radical oxidation and ozonolysis of monoterpenes

    Science.gov (United States)

    Zhao, D. F.; Kaminski, M.; Schlag, P.; Fuchs, H.; Acir, I.-H.; Bohn, B.; Häseler, R.; Kiendler-Scharr, A.; Rohrer, F.; Tillmann, R.; Wang, M. J.; Wegener, R.; Wildt, J.; Wahner, A.; Mentel, Th. F.

    2015-01-01

    Oxidation by hydroxyl radical (OH) and ozonolysis are the two major pathways of daytime biogenic volatile organic compound (BVOC) oxidation and secondary organic aerosol (SOA) formation. In this study, we investigated the particle formation of several common monoterpenes (α-pinene, β-pinene and limonene) by OH-dominated oxidation, which has seldom been investigated. OH oxidation experiments were carried out in the SAPHIR (Simulation of Atmospheric PHotochemistry In a large Reaction) chamber in Jülich, Germany, at low NOx (0.01 ~ 1 ppbV) and low ozone (O3) concentration (< 20 ppbV). OH concentration and total OH reactivity (kOH) were measured directly, and through this the overall reaction rate of total organics with OH in each reaction system was quantified. Multi-generation reaction process, particle growth, new particle formation (NPF), particle yield and chemical composition were analyzed and compared with that of monoterpene ozonolysis. Multi-generation products were found to be important in OH-dominated SOA formation. The relative role of functionalization and fragmentation in the reaction process of OH oxidation was analyzed by examining the particle mass and the particle size as a function of OH dose. We developed a novel method which quantitatively links particle growth to the reaction rate of OH with total organics in a reaction system. This method was also used to analyze the evolution of functionalization and fragmentation of organics in the particle formation by OH oxidation. It shows that functionalization of organics was dominant in the beginning of the reaction (within two lifetimes of the monoterpene) and fragmentation started to play an important role after that. We compared particle formation from OH oxidation with that from pure ozonolysis. In individual experiments, growth rates of the particle size did not necessarily correlate with the reaction rate of monoterpene with OH and O3. Comparing the size growth rates at the similar reaction rates

  20. JWH-018 ω-OH, a shared hydroxy metabolite of the two synthetic cannabinoids JWH-018 and AM-2201, undergoes oxidation by alcohol dehydrogenase and aldehyde dehydrogenase enzymes in vitro forming the carboxylic acid metabolite

    DEFF Research Database (Denmark)

    Holm, Niels Bjerre; Noble, Carolina; Linnet, Kristian

    2016-01-01

    +)-dependent alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) enzymes. The sole end-product identified in HLC was the JWH-018 ω-COOH metabolite, while trapping tests with methoxyamine proved the presence of the aldehyde intermediate. ADH/ALDH and UDP-glucuronosyl-transferases (UGT) enzymes may therefore...

  1. Synthetic Astrobiology

    Science.gov (United States)

    Rothschild, Lynn J.

    2017-01-01

    "Are we alone?" is one of the primary questions of astrobiology, and whose answer defines our significance in the universe. Unfortunately, this quest is hindered by the fact that we have only one confirmed example of life, that of earth. While this is enormously helpful in helping to define the minimum envelope for life, it strains credulity to imagine that life, if it arose multiple times, has not taken other routes. To help fill this gap, our lab has begun using synthetic biology - the design and construction of new biological parts and systems and the redesign of existing ones for useful purposes - as an enabling technology. One theme, the "Hell Cell" project, focuses on creating artificial extremophiles in order to push the limits for Earth life, and to understand how difficult it is for life to evolve into extreme niches. In another project, we are re-evolving biotic functions using only the most thermodynamically stable amino acids in order to understand potential capabilities of an early organism with a limited repertoire of amino acids.

  2. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  3. Pectic enzymes

    NARCIS (Netherlands)

    Benen, J.A.E.; Voragen, A.G.J.; Visser, J.

    2003-01-01

    The pectic enzymes comprise a diverse group of enzymes. They consist of main-chain depolymerases and esterases active on methyl- and acetylesters of galacturonosyl uronic acid residues. The depolymerizing enzymes comprise hydrolases as wel as lyases

  4. Isoprene and Monoterpene Emissions from Duke Forest: A Comparison of Ambient and Elevated CO2 Environments

    Science.gov (United States)

    Sive, B. C.; Varner, R. K.; Neilsen, C.; Russo, R. S.; Zhou, Y.; White, M. L.; Csakai, A.; Beckman, P.; Ambrose, J.; Wingenter, O. W.; Mao, H.; Talbot, R. W.

    2005-12-01

    elevated CO2 ring. The isoprene oxidation products methyl vinyl ketone (MVK) and methacrolein (MACR) followed the same trend as isoprene, with levels being enhanced at Ring 2 compared to Ring 1. Significant gradients were observed from the PTR-MS measurements for the total monoterpenes in addition to the speciated monoterpenes from the canister samples at both rings. However, in contrast to isoprene, monoterpene mixing ratios were lower in the elevated CO2 environment. Canopy fluxes calculated using the measured CO2 gradient and the eddy covariance data show that isoprene fluxes were higher in Ring 2 while monoterpene fluxes were higher in Ring 1. We returned to the FACTS-1 Research Facility in June 2005 to conduct direct branch flux measurements of isoprene and monoterpenes. Teflon bag enclosures were placed on branches of Pinus taeda (loblolly pine) and Liquidambar styraciflua (sweetgum) over two 48-hour sampling periods. Ambient and post-branch enclosure samples were collected in 2-L electropolished stainless steel canisters at both Rings 1 and 2 approximately every 2 hours for each tree species. The canister analysis revealed significantly enhanced mixing ratios of isoprene and monoterpenes from ambient to post-branch enclosure. Flux calculations based on the emission per leaf area of the branch confirm our 2004 results of enhanced isoprene and suppressed monoterpene mixing ratios in an elevated CO2 environment.

  5. Enzyme assays.

    Science.gov (United States)

    Reymond, Jean-Louis; Fluxà, Viviana S; Maillard, Noélie

    2009-01-07

    Enzyme assays are analytical tools to visualize enzyme activities. In recent years a large variety of enzyme assays have been developed to assist the discovery and optimization of industrial enzymes, in particular for "white biotechnology" where selective enzymes are used with great success for economically viable, mild and environmentally benign production processes. The present article highlights the aspects of fluorogenic and chromogenic substrates, sensors, and enzyme fingerprinting, which are our particular areas of interest.

  6. Alleviating monoterpene toxicity using a two-phase extractive fermentation for the bioproduction of jet fuel mixtures in Saccharomyces cerevisiae.

    Science.gov (United States)

    Brennan, Timothy C R; Turner, Christopher D; Krömer, Jens O; Nielsen, Lars K

    2012-10-01

    Monoterpenes are a diverse class of compounds with applications as flavors and fragrances, pharmaceuticals and more recently, jet fuels. Engineering biosynthetic pathways for monoterpene production in microbial hosts has received increasing attention. However, monoterpenes are highly toxic to many microorganisms including Saccharomyces cerevisiae, a widely used industrial biocatalyst. In this work, the minimum inhibitory concentration (MIC) for S. cerevisiae was determined for five monoterpenes: β-pinene, limonene, myrcene, γ-terpinene, and terpinolene (1.52, 0.44, 2.12, 0.70, 0.53 mM, respectively). Given the low MIC for all compounds tested, a liquid two-phase solvent extraction system to alleviate toxicity during fermentation was evaluated. Ten solvents were tested for biocompatibility, monoterpene distribution, phase separation, and price. The solvents dioctyl phthalate, dibutyl phthalate, isopropyl myristate, and farnesene showed greater than 100-fold increase in the MIC compared to the monoterpenes in a solvent-free system. In particular, the MIC for limonene in dibutyl phthalate showed a 702-fold (308 mM, 42.1 g L(-1) of limonene) improvement while cell viability was maintained above 90%, demonstrating that extractive fermentation is a suitable tool for the reduction of monoterpene toxicity. Finally, we estimated that a limonane to farnesane ratio of 1:9 has physicochemical properties similar to traditional Jet-A aviation fuel. Since farnesene is currently produced in S. cerevisiae, its use as a co-product and extractant for microbial terpene-based jet fuel production in a two-phase system offers an attractive bioprocessing option. Copyright © 2012 Wiley Periodicals, Inc.

  7. Process for assembly and transformation into Saccharomyces cerevisiae of a synthetic yeast artificial chromosome containing a multigene cassette to express enzymes that enhance xylose utilization designed for an automated pla

    Science.gov (United States)

    A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system ...

  8. Diversification of the monoterpene synthase gene family (TPSb) in Protium, a highly diverse genus of tropical trees.

    Science.gov (United States)

    Zapata, Felipe; Fine, Paul V A

    2013-09-01

    Plant monoterpenes are a diverse class of secondary metabolites mediating biotic and abiotic interactions with direct effects on plant fitness. To evaluate the hypothesis that monoterpene diversity is related to functional diversification after gene duplication, we reconstructed the evolutionary history of monoterpene synthases (TPSb)--the genes underlying monoterpene synthesis--in Protium, a taxonomically and chemically diverse genus of tropical trees. We isolated multiple copies of TPSb genes from chemically divergent Protium species, reconstructed the phylogeny of this gene family, used maximum-likelihood estimation of selection coefficients, and inferred residues evolving under positive selection. We found evidence for one ancient and multiple more recent duplication events giving rise to three, and potentially five, copies of TPSb genes currently present in Protium. There was evidence for adaptive evolution in one copy with a positively selected residue likely involved in protein folding and product specificity. All other copies were inferred to be evolving under a combination of stabilizing and/or relaxed selection. Although gene copy number is consistent with the extensive phenotypic diversity in monoterpenes shown in Protium, selection analyses suggest that not all copies are undergoing divergent selection consistent with a coevolutionary arms race with enemies, but instead may be under stabilizing and relaxed selection consistent with signaling or physiological stress functionality.

  9. Process-based simulation of seasonality and drought stress in monoterpene emission models

    Directory of Open Access Journals (Sweden)

    R. Grote

    2009-09-01

    Full Text Available Canopy emissions of volatile hydrocarbons such as isoprene and monoterpenes play an important role in air chemistry. They depend on various environmental conditions, are highly species-specific and are expected to be affected by global change. In order to estimate future emissions of these isoprenoids, differently complex models are available. However, seasonal dynamics driven by phenology, enzymatic activity, or drought stress strongly modify annual ecosystem emissions. Although these impacts depend themselves on environmental conditions, they have yet received little attention in mechanistic modelling.

    In this paper we propose the application of a mechanistic method for considering the seasonal dynamics of emission potential using the ''Seasonal Isoprenoid synthase Model'' (Lehning et al., 2001. We test this approach with three different models (GUENTHER, Guenther et al., 1993; NIINEMETS, Niinemets et al., 2002a; BIM2, Grote et al., 2006 that are developed for simulating light-dependent monoterpene emission. We also suggest specific drought stress representations for each model. Additionally, the proposed model developments are compared with the approach realized in the MEGAN (Guenther et al., 2006 emission model. Models are applied to a Mediterranean Holm oak (Quercus ilex site with measured weather data.

    The simulation results demonstrate that the consideration of a dynamic emission potential has a strong effect on annual monoterpene emission estimates. The investigated models, however, show different sensitivities to the procedure for determining this seasonality impact. Considering a drought impact reduced the differences between the applied models and decreased emissions at the investigation site by approximately 33% on average over a 10 year period. Although this overall reduction was similar in all models, the sensitivity to weather conditions in specific years was different. We conclude that the proposed

  10. Stability of Enzymes in Granular Enzyme Products for Laundry Detergents

    OpenAIRE

    Biran, Suzan; Jensen, Anker Degn; Kiil, Søren; Bach, Poul; Simonsen, Ole

    2010-01-01

    Enzymes have long been of interest to the detergent industry due to their ability to improve the cleaning efficiency of synthetic detergents, contribute to shortening washing times, and reduce energy and water consumption, provision of environmentally friendlier wash water effluents and fabric care. However, incorporating enzymes in detergent formulations gives rise to numerous practical problems due to their incompatibility with and stability against various detergent components. In powdered...

  11. CYP345E2, an antenna-specific cytochrome P450 from the mountain pine beetle, Dendroctonus ponderosae Hopkins, catalyses the oxidation of pine host monoterpene volatiles.

    Science.gov (United States)

    Keeling, Christopher I; Henderson, Hannah; Li, Maria; Dullat, Harpreet K; Ohnishi, Toshiyuki; Bohlmann, Jörg

    2013-12-01

    The mountain pine beetle (MPB, Dendroctonus ponderosae Hopkins) is a significant pest of western North American pine forests. This beetle responds to pheromones and host volatiles in order to mass attack and thus overcome the terpenoid chemical defences of its host. The ability of MPB antennae to rapidly process odorants is necessary to avoid odorant receptor saturation and thus the enzymes responsible for odorant clearance are an important aspect of host colonization. An antenna-specific cytochrome P450, DponCYP345E2, is the most highly expressed transcript in adult MPB antenna. In in vitro assays with recombinant enzyme, DponCYP345E2 used several pine host monoterpenes as substrates, including (+)-(3)-carene, (+)-β-pinene, (-)-β-pinene, (+)-limonene, (-)-limonene, (-)-camphene, (+)-α-pinene, (-)-α-pinene, and terpinolene. The substrates were epoxidized or hydroxylated, depending upon the substrate. To complement DponCYP345E2, we also functionally characterized the NADPH-dependent cytochrome P450 reductase and the cytochrome b5 from MPB. DponCYP345E2 is the first cytochrome P450 to be functionally characterized in insect olfaction and in MPB.

  12. Purification and characterization of a Baeyer-Villiger mono-oxygenase from Rhodococcus erythropolis DCL14 involved in three different monoterpene degradation pathways

    NARCIS (Netherlands)

    Werf, van der M.J.

    2000-01-01

    A Baeyer-Villiger mono-oxygenase (BVMO), catalysing the NADPH- and oxygen-dependent oxidation of the monocyclic monoterpene ketones 1-hydroxy-2-oxolimonene, dihydrocarvone and menthone, was purified to homogeneity from Rhodococcus erythropolis DCL14. Monocyclic monoterpene ketone mono-oxygenase (MMK

  13. Purification and characterization of a Baeyer-Villiger mono-oxygenase from Rhodococcus erythropolis DCL14 involved in three different monocyclic monoterpene degradation pathways

    NARCIS (Netherlands)

    Werf, M.J. van der

    2000-01-01

    A Baeyer-Villiger mono-oxygenase (BVMO), catalysing the NADPH- and oxygen-dependent oxidation of the monocyclic monoterpene ketones 1-hydroxy-2-oxolimonene, dihydrocarvone and menthone, was purified to homogeneity from Rhodococcus erythropolis DCL14. Monocyclic monoterpene ketone mono-oxygenase (MMK

  14. Pondering the monoterpene composition of Pinus serotina Michx.: can limonene be used as a chemotaxonomic marker for the identification of old turpentine stumps?

    Science.gov (United States)

    Thomas L. Eberhardt; Jolie M. Mahfouz; Philip M. Sheridan

    2010-01-01

    Wood samples from old turpentine stumps in Virginia were analyzed by GC-MS to determine if the monoterpene compositions could be used for species identification. Given that limonene is reported to be the predominant monoterpene for pond pine (Pinus serotina Michx.), low relative proportions of limonene in these samples appeared to suggest that these...

  15. Monoterpene Indole Alkaloids from the Fruit of Tabernaemontana litoralis and Differential Alkaloid Composition in Various Fruit Components.

    Science.gov (United States)

    Qu, Yang; Simonescu, Razvan; De Luca, Vincenzo

    2016-12-23

    Two new monoterpene indole alkaloids, isoakuammiline (1) and 18-hydroxypseudovincadifformine (2), and five known alkaloids, coronaridine (3), heyneanine (4), 3,19-oxidocoronaridine (5), tabersonine, and strictosidine, were identified from the fruit of Tabernaemontana litoralis. The structures of the alkaloids were determined using NMR and MS data analyses. While 18-hydroxypseudovincadifformine (2) showed a new hydroxylation pattern, isoakuammiline (1) revealed a novel skeleton for monoterpene indole alkaloids. In spite of the isolation of stemmadenine from the fruit tissues in other Tabernaemontana species, this vital biosynthetic precursor of iboga, aspidosperma, and pseudoaspidosperma skeletons was not found in T. litoralis.

  16. In silico and in vitro physicochemical screening of Rigidoporus sp. crude laccase-assisted decolorization of synthetic dyes--approaches for a cost-effective enzyme-based remediation methodology.

    Science.gov (United States)

    Sridhar, S; Chinnathambi, V; Arumugam, P; Suresh, P K

    2013-02-01

    The objective of this paper is to compare in silico data with wet lab physicochemical properties of crude laccase enzyme isolated from Rigidoporus sp. using wheat bran as solid substrate support towards dye decolorization. Molecular docking analysis of selected nine textile and non-textile dyes were performed using laccase from Rigidoporus lignosus as reference protein. Enzyme-based remediation methodology using crude enzyme enriched from solid state fermentation was applied to screen the effect of four influencing variables such as pH, temperature, dye concentration, and incubation time toward dye decolorization. The extracellular crude enzyme decolorized 69.8 % Acid Blue 113, 45.07 % Reactive Blue 19, 36.61 % Reactive Orange 122, 30.55 % Acid Red 88, 24.59 % Direct Blue 14, 18.48 % Reactive Black B, 16.49 % Reactive Blue RGB, and 11.66 % Acid Blue 9 at 100 mg/l dye concentration at their optimal pH at room temperature under static and dark conditions after 1 h of incubation without addition of any externally added mediators. Our wet lab studies approach, barring other factors, validate in silico for screening and ranking textile dyes based on their proximity to the T1 site. We are reporting for the first time a combinatorial approach involving in silico methods and wet lab-based crude laccase-mediated dye decolorization without any external mediators.

  17. Host-Tree Monoterpenes and Biosynthesis of Aggregation Pheromones in the Bark Beetle Ips paraconfusus

    Directory of Open Access Journals (Sweden)

    John A. Byers

    2012-01-01

    Full Text Available A paradigm developed in the 1970s that Ips bark beetles biosynthesize their aggregation pheromone components ipsenol and ipsdienol by hydroxylating myrcene, a host tree monoterpene. Similarly, host α-pinene was hydroxylated to a third pheromone component cis-verbenol. In 1990, however, we reported that amounts of ipsenol and ipsdienol produced by male Ips paraconfusus (Coleoptera: Scolytinae feeding in five host pine species were nearly the same, even though no detectable myrcene precursor was detected in one of these pines (Pinus sabiniana. Subsequent research showed ipsenol and ipsdienol are also biosynthesized from smaller precursors such as acetate and mevalonate, and this de novo pathway is the major one, while host tree myrcene conversion by the beetle is the minor one. We report concentrations of myrcene, α-pinene and other major monoterpenes in five pine hosts (Pinus ponderosa, P. lambertiana, P. jeffreyi, P. sabiniana, and P. contorta of I. paraconfusus. A scheme for biosynthesis of ipsdienol and ipsenol from myrcene and possible metabolites such as ipsenone is presented. Mass spectra and quantities of ipsenone are reported and its possible role in biosynthesis of aggregation pheromone. Coevolution of bark beetles and host trees is discussed in relation to pheromone biosynthesis, host plant selection/suitability, and plant resistance.

  18. Monoterpene variation mediated attack preference evolution of the bark beetle Dendroctonus valens.

    Science.gov (United States)

    Liu, Zhudong; Wang, Bo; Xu, Bingbing; Sun, Jianghua

    2011-01-01

    Several studies suggest that some bark beetle like to attack large trees. The invasive red turpentine beetle (RTB), Dendroctonus valens LeConte, one of the most destructive forest pests in China, is known to exhibit this behavior. Our previous study demonstrated that RTBs preferred to attack large-diameter trees (diameter at breast height, DBH ≥30 cm) over small-diameter trees (DBH ≤10 cm) in the field. In the current study, we studied the attacking behavior and the underlying mechanisms in the laboratory. Behavioral assays showed that RTBs preferred the bark of large-DBH trees and had a higher attack rate on the bolts of these trees. Y-tube assays showed that RTBs preferred the volatiles released by large-DBH trees to those released by small-DBH trees. Subsequent analysis revealed that both large- and small-DBH trees had the same composition of monoterpenes, but the concentration of each component differed; thus it appeared that the concentrations acted as cues for RTBs to locate the right-sized host which was confirmed by further behavioral assays. Moreover, large-DBH pine trees provided more spacious habitat and contained more nutrients, such as nitrogen, than did small-DBH pine trees, which benefited RTBs' fecundity and larval development. RTBs seem to have evolved mechanisms to locate those large hosts that will allow them to maximize their fitness. Monoterpene variation mediated attack preference implies the potential for the management of RTB.

  19. Induction of senescence and identification of differentially expressed genes in tomato in response to monoterpene.

    Directory of Open Access Journals (Sweden)

    Sumit Ghosh

    Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.

  20. Development and Evaluation of Stability of a Gel Formulation Containing the Monoterpene Borneol

    Directory of Open Access Journals (Sweden)

    Milla Gabriela Belarmino Dantas

    2016-01-01

    Full Text Available Borneol is a bicyclic monoterpenoid alcohol commonly used in traditional Chinese and Indian medicine. It is extracted from the essential oil of various medicinal plants. It has antibacterial, analgesic, and anti-inflammatory action proven in studies that used oral and intraperitoneal applications of this monoterpene in mice. The current study was designed to develop a topical gel formulation containing the monoterpene borneol using carbopol as gel base and to evaluate its stability. The prepared formulation was subjected to physical characterization and physical-chemistry assessment. The gel was prepared from carbopol and 5% of borneol. The prepared gel was subjected to pharmacotechnical tests such as its pH, viscosity, conductivity, spreadability, centrifugation, and accelerated stability with freezing-thaw cycle. The borneol was successfully incorporated into the carbopol formulation. Borneol gel (BG5 showed good stability after eight months of its development and after 12 days in the freeze-thaw cycle, not showing statistical difference in pH value, conductivity, and viscosity before and after test. Furthermore, the formulation showed a good spreadability. Therefore, it was concluded that the formulation could be very promising alternative for the topical or transdermal treatment of skin diseases.

  1. Impact of diffuse light on isoprene and monoterpene emissions from a mixed temperate forest

    Science.gov (United States)

    Laffineur, Q.; Aubinet, M.; Schoon, N.; Amelynck, C.; Müller, J.-F.; Dewulf, J.; Steppe, K.; Heinesch, B.

    2013-08-01

    This study investigated the impact of diffuse light on canopy scale emission of isoprene and monoterpenes measured continuously above a mixed temperate forest, using the disjunct eddy-covariance by mass scanning technique with a proton transfer reaction-mass spectrometer (PTR-MS) instrument. To assess this impact, the relationship between emissions/radiation and emissions/gross primary production (GPP) under clear sky and cloudy conditions were analysed. Under cloudy conditions (high proportion of diffuse radiation), the isoprene and monoterpene fluxes were enhanced compared to clear sky conditions (low proportion of diffuse radiation) at equivalent temperature and above-canopy total radiation. The whole-canopy enzymatic activity of the metabolic isoprene production pathway, however, was suggested to be lower under cloudy conditions than under clear sky conditions at equivalent temperature. The mechanisms behind these observations are probably linked to the better penetration of diffuse radiation in the canopy. Shade leaves/needles receive more radiation in cloudy conditions than in clear sky conditions, thereby inducing the observed effects.

  2. In situ measurements of isoprene and monoterpenes within a South-East Asian tropical rainforest

    Directory of Open Access Journals (Sweden)

    C. E. Jones

    2011-01-01

    Full Text Available Biogenic volatile organic compounds (BVOCs emitted from tropical rainforests comprise a substantial fraction of global atmospheric VOC emissions, however there are only relatively limited measurements of these species in tropical rainforest regions. We present observations of isoprene, α-pinene, camphene, Δ-3-carene, γ-terpinene and limonene, and oxygenated VOCs (OVOCs of biogenic origin such as methacrolein, in ambient air above a~tropical rainforest in Malaysian Borneo. Daytime composition was dominated by isoprene, with an average mixing ratio of the order of ~1 ppb. γ-terpinene, limonene and camphene were the most abundant monoterpenes, with average daytime mixing ratios of 102, 71 and 66 ppt, respectively, and with an average monoterpene to isoprene ratio of 0.3 during sunlight hours, compared to 2.0 at night. Limonene and camphene abundances were seen to be related to both temperature and light conditions. In contrast, γ-terpinene emission occurred into the late afternoon/evening, under relatively low temperature and light conditions. We observe good agreement between surface and aircraft measurements of boundary layer isoprene and methacrolein above the natural rainforest, suggesting that the ground-level observations are broadly representative of isoprene emissions from this region.

  3. Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile

    Directory of Open Access Journals (Sweden)

    S. Saeidnia

    2014-04-01

    Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.

  4. Monoterpene and sesquiterpene emissions of three Mediterranean species through calcareous and siliceous soils in natural conditions

    Science.gov (United States)

    Ormeño, E.; Fernandez, C.; Bousquet-Mélou, A.; Greff, S.; Morin, E.; Robles, C.; Vila, B.; Bonin, G.

    Little is known about terpene emissions released by plants in response to abiotic factors, except for climate-related factors. Standard emissions ( ES) of monoterpenes ( ESM) and sesquiterpenes ( ESS) of Rosmarinus officinalis, Pinus halepensis and Cistus albidus in siliceous and calcareous sites were examined. Their dependency on some nutrients in these soils was also analyzed. The study was carried out in the south of France at the end of March, when C. albidus exhibited a leaf growth state, while the other two species exhibited a pre-budbreak state. The results revealed that ES of all major monoterpenes released by R. officinalis and ES of α-pinene and α-humulene of P. halepensis were higher in plants growing in calcareous soils. In contrast, for C. albidus, ESM and ES of β-bourbonene and α-humulene were higher in siliceous soils. ESM of all species was mainly correlated with nitrogen ( N) and available phosphorous (P A), while dependency on Ca 2+ or K + was variable. None of these nutrients was significantly correlated with ESS, suggesting that sesquiterpene synthesis pathway requires different nutrient supplies. While higher soil nutrient content stimulated ESM of R. officinalis and P. halepensis, it had a negative effect on ESM of C. albidus, probably because C. albidus exhibited a different phenological state. Considering the soil nature, and particularly N and P A as inputs in plant terpene inventories could hence contribute to obtain more accurate terpene estimates.

  5. Anxiolytic-like effect of the monoterpene 1,4-cineole in mice.

    Science.gov (United States)

    Gomes, Patrícia Bezerra; Feitosa, Mariana Lima; Silva, Maria Izabel Gomes; Noronha, Emmanuelle Coelho; Moura, Brinell Arcanjo; Venâncio, Edith Teles; Rios, Emiliano Ricardo Vasconcelos; de Sousa, Damião Pergentino; de Vasconcelos, Silvânia Maria Mendes; Fonteles, Marta Maria de França; de Sousa, Francisca Cléa Florenço

    2010-09-01

    Recent studies have shown that some monoterpenes exert anxiolytic- and depressant-like actions, however, these effects from monoterpene 1,4-cineole are still unknown. This work aimed to study the effects of 1,4-cineole in classic animal models for depression- and anxiety-like behavior, specifically the elevated plus maze (EPM), hole board, open field, pentobarbital sleeping time, forced swimming, tail suspension and rota rod tests. 1,4-Cineole was administered orally to mice (100, 200 and 400 mg/kg), while diazepam (1 or 2 mg/kg) and imipramine (10 or 30 mg/kg) were used as standard drugs. 1,4-Cineole (400 mg/kg) modified all parameters observed in the EPM, while no significant variation was observed on general motor activity in the open-field test. In the hole-board assay, 1,4-cineole induced increase on the number of head dips. Forced swimming and tail suspension tests showed that cineole (200 and/or 400 mg/kg) was able to promote significant increase on the immobility time, while a decreased sleep latency was observed (200 and 400 mg/kg ) on the pentobarbital sleeping time. Cineole had no effect on the motor coordination of animals in the rota rod test. The results suggest that 1,4-cineole presents potential anxiolytic-like action consistent with possible general depression of the CNS.

  6. Suffruyabiosides A and B, Two New Monoterpene Diglycosides from Moutan Cortex

    Directory of Open Access Journals (Sweden)

    Hideyuki Shigemori

    2012-04-01

    Full Text Available Two new monoterpene diglycosides, suffruyabiosides A (1 and B (2, and seven known compounds 39 were isolated from Moutan Cortex (root cortex of Paeonia suffruticosa Andrews. The structures were elucidated on the basis of 2D NMR spectral data. Suffruyabiosides A (1 and B (2 are rare monoterpene diglycosides, including a cellobiose in the molecules. Salicylpaeoniflorin (4 had a antiproliferation effect similar to paeoniflorin (3 on human lung adenocarcinoma epitherial A549 cells. Galloylpaeoniflorin (8 and salicylpaeoniflorin (4 revealed a more pronounced radical scavenging effect than a-tocopherol (positive control. An increase in the number of phenolic hydroxyl groups produced a more effective radical scavenging effect [8 > mudanpioside E (6 > oxypaeoniflorin (5]. Comparison of the effects of 4 and 5 showed that o-substitution with a phenolic hydroxyl group was more effective than p-substitution. The results suggest that salicylpaeoniflorin (4 may be useful as a cytotoxic and a radical scavenging agent.

  7. Monoterpene variation mediated attack preference evolution of the bark beetle Dendroctonus valens.

    Directory of Open Access Journals (Sweden)

    Zhudong Liu

    Full Text Available Several studies suggest that some bark beetle like to attack large trees. The invasive red turpentine beetle (RTB, Dendroctonus valens LeConte, one of the most destructive forest pests in China, is known to exhibit this behavior. Our previous study demonstrated that RTBs preferred to attack large-diameter trees (diameter at breast height, DBH ≥30 cm over small-diameter trees (DBH ≤10 cm in the field. In the current study, we studied the attacking behavior and the underlying mechanisms in the laboratory. Behavioral assays showed that RTBs preferred the bark of large-DBH trees and had a higher attack rate on the bolts of these trees. Y-tube assays showed that RTBs preferred the volatiles released by large-DBH trees to those released by small-DBH trees. Subsequent analysis revealed that both large- and small-DBH trees had the same composition of monoterpenes, but the concentration of each component differed; thus it appeared that the concentrations acted as cues for RTBs to locate the right-sized host which was confirmed by further behavioral assays. Moreover, large-DBH pine trees provided more spacious habitat and contained more nutrients, such as nitrogen, than did small-DBH pine trees, which benefited RTBs' fecundity and larval development. RTBs seem to have evolved mechanisms to locate those large hosts that will allow them to maximize their fitness. Monoterpene variation mediated attack preference implies the potential for the management of RTB.

  8. Multiphase processing of organic hydroxynitrates in secondary organic aerosol from the radical-initiated oxidation of multi-olefinic monoterpenes

    Science.gov (United States)

    Slade, J. H.; Lee, L. S.; Shepson, P. B.; De Perre, C.

    2015-12-01

    One of the greatest challenges facing atmospheric and climate science is understanding the impacts human activities have on the natural environment and atmospheric chemistry. The production of condensable organic compounds due to interactions between atmospheric oxidants, nitrogenous pollutants, and biogenic volatile organic compounds (BVOCs) emitted from the terrestrial biosphere can contribute significantly to the formation and growth of secondary organic aerosol (SOA). Aerosol particles influence atmospheric radiative transfer, cloud formation, and thus atmospheric temperatures. Due to their solubility in water and adsorptive nature, hydroxylated organic nitrates (HORONO2) may contribute significantly to the formation and chemical aging of SOA, and serve as an important sink for NOx (NO+NO2). We recently observed that a monoterpene β-hydroxy-organic nitrate (C10H17NO4), produced from the OH oxidation of α-pinene in the presence of NOx, undergoes rapid processing in the aerosol phase via an acid-catalyzed and pH-dependent hydrolysis mechanism, potentially impacting SOA growth and molecular composition. Further processing in the aerosol phase via polymerization and formation of organosulfates is expected, yet studies related to product identification and their formation mechanisms are limited. In this presentation, I will discuss recent laboratory-based reaction chamber studies of gas-phase organic nitrate production, SOA formation, and acidity-dependent aerosol-phase processing of organic nitrates produced from the NO3 oxidation of γ-terpinene. This BVOC is a diolefin, which as modeling studies suggest, may be an important nighttime organic nitrate precursor. Gas-phase organic nitrate compounds resulting from NO3 oxidation were qualitatively identified applying I- chemical ionization mass spectrometry (CIMS) and quantified via calibration using synthetic standards generated in our laboratory. Aerosol-phase analysis was carried out employing Fourier transform

  9. Synthetic biology, inspired by synthetic chemistry.

    Science.gov (United States)

    Malinova, V; Nallani, M; Meier, W P; Sinner, E K

    2012-07-16

    The topic synthetic biology appears still as an 'empty basket to be filled'. However, there is already plenty of claims and visions, as well as convincing research strategies about the theme of synthetic biology. First of all, synthetic biology seems to be about the engineering of biology - about bottom-up and top-down approaches, compromising complexity versus stability of artificial architectures, relevant in biology. Synthetic biology accounts for heterogeneous approaches towards minimal and even artificial life, the engineering of biochemical pathways on the organismic level, the modelling of molecular processes and finally, the combination of synthetic with nature-derived materials and architectural concepts, such as a cellular membrane. Still, synthetic biology is a discipline, which embraces interdisciplinary attempts in order to have a profound, scientific base to enable the re-design of nature and to compose architectures and processes with man-made matter. We like to give an overview about the developments in the field of synthetic biology, regarding polymer-based analogs of cellular membranes and what questions can be answered by applying synthetic polymer science towards the smallest unit in life, namely a cell.

  10. Enzyme inhibitor studies reveal complex control of methyl-D-erythritol 4-phosphate (MEP pathway enzyme expression in Catharanthus roseus.

    Directory of Open Access Journals (Sweden)

    Mei Han

    Full Text Available In Catharanthus roseus, the monoterpene moiety exerts a strong flux control for monoterpene indole alkaloid (MIA formation. Monoterpene synthesis depends on the methyl-D-erythritol 4-phosphate (MEP pathway. Here, we have explored the regulation of this pathway in response to developmental and environmental cues and in response to specific enzyme inhibitors. For the MEP pathway entry enzyme 1-deoxy-D-xylulose 5-phosphate synthase (DXS, a new (type I DXS isoform, CrDXS1, has been cloned, which, in contrast to previous reports on type II CrDXS, was not transcriptionally activated by the transcription factor ORCA3. Regulation of the MEP pathway in response to metabolic perturbations has been explored using the enzyme inhibitors clomazone (precursor of 5-ketochlomazone, inhibitor of DXS and fosmidomycin (inhibitor of deoxyxylulose 5-phosphate reductoisomerase (DXR, respectively. Young leaves of non-flowering plants were exposed to both inhibitors, adopting a non-invasive in vivo technique. Transcripts and proteins of DXS (3 isoforms, DXR, and hydroxymethylbutenyl diphosphate synthase (HDS were monitored, and protein stability was followed in isolated chloroplasts. Transcripts for DXS1 were repressed by both inhibitors, whereas transcripts for DXS2A&B, DXR and HDS increased after clomazone treatment but were barely affected by fosmidomycin treatment. DXS protein accumulated in response to both inhibitors, whereas DXR and HDS proteins were less affected. Fosmidomycin-induced accumulation of DXS protein indicated substantial posttranscriptional regulation. Furthermore, fosmidomycin effectively protected DXR against degradation in planta and in isolated chloroplasts. Thus our results suggest that DXR protein stability may be affected by substrate binding. In summary, the present results provide novel insight into the regulation of DXS expression in C. roseus in response to MEP-pathway perturbation.

  11. Enzyme inhibitor studies reveal complex control of methyl-D-erythritol 4-phosphate (MEP) pathway enzyme expression in Catharanthus roseus.

    Science.gov (United States)

    Han, Mei; Heppel, Simon C; Su, Tao; Bogs, Jochen; Zu, Yuangang; An, Zhigang; Rausch, Thomas

    2013-01-01

    In Catharanthus roseus, the monoterpene moiety exerts a strong flux control for monoterpene indole alkaloid (MIA) formation. Monoterpene synthesis depends on the methyl-D-erythritol 4-phosphate (MEP) pathway. Here, we have explored the regulation of this pathway in response to developmental and environmental cues and in response to specific enzyme inhibitors. For the MEP pathway entry enzyme 1-deoxy-D-xylulose 5-phosphate synthase (DXS), a new (type I) DXS isoform, CrDXS1, has been cloned, which, in contrast to previous reports on type II CrDXS, was not transcriptionally activated by the transcription factor ORCA3. Regulation of the MEP pathway in response to metabolic perturbations has been explored using the enzyme inhibitors clomazone (precursor of 5-ketochlomazone, inhibitor of DXS) and fosmidomycin (inhibitor of deoxyxylulose 5-phosphate reductoisomerase (DXR)), respectively. Young leaves of non-flowering plants were exposed to both inhibitors, adopting a non-invasive in vivo technique. Transcripts and proteins of DXS (3 isoforms), DXR, and hydroxymethylbutenyl diphosphate synthase (HDS) were monitored, and protein stability was followed in isolated chloroplasts. Transcripts for DXS1 were repressed by both inhibitors, whereas transcripts for DXS2A&B, DXR and HDS increased after clomazone treatment but were barely affected by fosmidomycin treatment. DXS protein accumulated in response to both inhibitors, whereas DXR and HDS proteins were less affected. Fosmidomycin-induced accumulation of DXS protein indicated substantial posttranscriptional regulation. Furthermore, fosmidomycin effectively protected DXR against degradation in planta and in isolated chloroplasts. Thus our results suggest that DXR protein stability may be affected by substrate binding. In summary, the present results provide novel insight into the regulation of DXS expression in C. roseus in response to MEP-pathway perturbation.

  12. Isoprene and monoterpene emission from the coniferous species Abies Borisii-regis - implications for regional air chemistry in Greece

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, D.; Hunter, M.C.; Lewis, A.C.; Seakins, P.W. [Leeds Univ., School of Chemistry, Leeds (United Kingdom); Nunes, T.V.; Pio, C.A. [Universidade de Aveiro, Dept. de Ambiente e Ordenamento, Aveiro (Portugal)

    2001-07-01

    The emission of isoprene has been studied from a forest of Abies Borisii-regis, a Mediterranean fir species previously thought to emit only monoterpenes. Emission studies from two independent enclosure experiments indicated a standardised isoprene emission rate of (18.4{+-}3.8){mu}gg{sub dry-weight} {sup -1}h{sup -1}, similar in magnitude to species such as eucalyptus and oak which are considered to be strong isoprene emitters. Isoprene emission depended strongly on both leaf temperature (2degC-34degC) and photosynthetically active radiation (PAR) below 250{mu}molm{sup -2}s{sup -1}, becoming saturated with respect to PAR above this value. The annual isoprene emission rate was estimated to be (132{+-}29) kTyr{sup -1} for those trees growing within Greece, comparable to current estimates of the total isoprene budget of Greece as a whole, and contributing significantly to regional ozone and carbon monoxide budgets. Monoterpene emission exhibited exponential temperature dependence, with 1,8-cineole, {alpha}-pinene, {beta}-pinene and limonene forming the primary emissions. A standardised total monoterpene emission rate of (2.7{+-}1.1){mu}gg{sub dry-weight} {sup -1}h{sup -1} was calculated, corresponding to an annual monoterpene emission rate of (24{+-}12) kTyr{sup -1}. Research was conducted as part of the AEROBIC'97 (AEROsol formation from Biogenic organic Carbon) series of field campaigns. (Author)

  13. Bark Beetles, Pityogenes bidentatus, Orienting to Aggregation Pheromone Avoid Conifer Monoterpene Odors When Flying but Not When Walking

    Directory of Open Access Journals (Sweden)

    John A. Byers

    2012-01-01

    Full Text Available Previous studies and data presented here suggest that odors from healthy host Scotch pine (Pinus sylvestris and nonhost Norway spruce (Picea abies, as well as major monoterpenes of these trees at natural release rates, significantly reduce the attraction of flying bark beetles, Pityogenes bidentatus, of both sexes to their aggregation pheromone components grandisol and cis-verbenol in the field, as tested by slow rotation of trap pairs. In contrast, P. bidentatus males and females walking in an open-arena olfactometer in the laboratory did not avoid monoterpene vapors at release rates spanning several orders of magnitude in combination with aggregation pheromone. The bark beetle may avoid monoterpenes when flying as a mechanism for avoiding nonhost species, vigorous and thus unsuitable host trees, as well as harmful resinous areas of hosts. Inhibition of this flight avoidance response in beetles after landing would allow them to initiate, or to find and enter, gallery holes with high monoterpene vapor concentrations in order to feed and reproduce.

  14. Dose-Dependent and Species-Specific Responses of Pine Bark Beetles (Coeoptera: Scolytidae) to Monoterpenes in Association with Phermones

    Science.gov (United States)

    Daniel R. Miller; John H. Borden

    2000-01-01

    Monoterpenes affected the attraction of three sympatric species of bark beetles (Coleoptera: Scolytidae) to pheromone-baited multiple-funnel traps in stands of lodgepole pine. Catches of Ips pini(Say) in traps baited with its pheromone, ipsdienol, were directly related to the release rates of 3-carene, ß-pphellandrene, and ß-pinene. Catches of

  15. Secondary Organic Aerosol (SOA) Formation from Hydroxyl Radical Oxidation and Ozonolysis of Monoterpenes

    Science.gov (United States)

    Zhao, Defeng; Kaminski, Martin; Schlag, Patrick; Fuchs, Hendrik; Acir, Ismail-Hakki; Bohn, Birger; Haeseler, Rolf; Kiendler-Scharr, Astrid; Rohrer, Franz; Tillmann, Ralf; Wang, Mingjin; Wegner, Robert; Wahner, Andreas; Mentel, Thomas

    2014-05-01

    Hydroxyl radical (OH) oxidation and ozonolysis are the two major pathways of daytime biogenic volatile organic compounds (VOCs) oxidation and secondary organic aerosol (SOA) formation. The pure OH oxidation of monoterpenes, an important biogenic VOC class, has seldom been investigated. In order to elucidate the importance of the reaction pathyways of the OH oxidation and ozonolysis and their roles in particle formation and growth, we investigated the particle formation of several common monoterpenes (alpha-pinene, beta-pinene, and limonene) in the large atmosphere simulation chamber SAPHIR in Juelich, Germany. The experiments were conducted for both OH dominant and pure ozonolysis case (in the presence of CO as OH scavenger) at ambient relevant conditions (low OA, low VOC and low NOx concentration). OH and ozone (O3) concentrations were measured so that the oxidation rates of OH and O3 with precursors were quantified. The particle formation and growth, aerosol yield, multi-generation reaction process and aerosol composition were analyzed. Pure ozonolysis generated a large amount of particles indicating ozonolysis plays an important role in particle formation as well as OH oxidation. In individual experiments, particle growth rates did not necessarily correlate with OH or O3 oxidation rates. However, comparing the growth rates at similar OH or O3 oxidation rates shows that generally, OH oxidation and ozonolysis have similar efficiency in particle growth. Multi-generation products are shown to be important in the OH oxidation experiment based on aerosol yield "growth curve" (Ng et al., 2006). The reaction process of OH oxidation experiments was analyzed as a function of OH dose to elucidate the role of functionalization and fragmentation. A novel analysis was developed to link the particle formation with the reaction with OH, which was also used to examine the role of functionalization and fragmentation in the particle formation by OH oxidation. These analyses show

  16. Plant synthetic biology.

    Science.gov (United States)

    Liu, Wusheng; Stewart, C Neal

    2015-05-01

    Plant synthetic biology is an emerging field that combines engineering principles with plant biology toward the design and production of new devices. This emerging field should play an important role in future agriculture for traditional crop improvement, but also in enabling novel bioproduction in plants. In this review we discuss the design cycles of synthetic biology as well as key engineering principles, genetic parts, and computational tools that can be utilized in plant synthetic biology. Some pioneering examples are offered as a demonstration of how synthetic biology can be used to modify plants for specific purposes. These include synthetic sensors, synthetic metabolic pathways, and synthetic genomes. We also speculate about the future of synthetic biology of plants.

  17. Synthetic Cathinones ("Bath Salts")

    Science.gov (United States)

    ... A recent study found that 3,4-methylenedioxypyrovalerone (MDPV), a common synthetic cathinone, affects the brain in ... but is at least 10 times more powerful. MDPV is the most common synthetic cathinone found in ...

  18. What Are Synthetic Cannabinoids?

    Science.gov (United States)

    ... dried plant materials. Chemical tests show that their active ingredients are man-made cannabinoid compounds. Synthetic cannabinoid users report some effects similar to those produced by marijuana: elevated mood relaxation altered perception symptoms of psychosis Synthetic cannabinoids can ...

  19. Fate and transport of monoterpenes through soils. Part II: calculation of the effect of soil temperature, water saturation and organic carbon content.

    Science.gov (United States)

    van Roon, André; Parsons, John R; Krap, Lenny; Govers, Harrie A J

    2005-09-01

    This theoretical study was performed to investigate the influence of soil temperature, soil water content and soil organic carbon fraction on the mobility of monoterpenes (C10HnOn') applied as pesticides to a top soil layer. This mobility was expressed as the amount volatilized and leached from the contaminated soil layer after a certain amount of time. For this, (slightly modified) published analytical solutions to a one dimensional, homogeneous medium, diffusion/advection/biodegradation mass balance equation were used. The required input-parameters were determined in a preceding study. Because the monoterpenes studied differ widely in the values for their physico-chemical properties, the relative importance of the various determinants also differed widely. Increasing soil water saturation reduced monoterpene vaporization and leaching losses although a modest increase was usually observed at high soil water contents. Organic matter served as the major retention domain, reducing volatilization and leaching losses. Increasing temperature resulted in higher volatilization and leaching losses. Monoterpene mobility was influenced by vertical water flow. Volatilization losses could be reduced by adding a clean soil layer on top of the contaminated soil. Detailed insight into the specific behaviour of different monoterpenes was obtained by discussing intermediate calculation results; the transport retardation factors and effective soil diffusion coefficients. One insight was that the air-water interface compartment is probably not an important partitioning domain for monoterpenes in most circumstances. The results further indicated that biodegradation is an important process for monoterpenes in soil.

  20. The impact of bark beetle infestation on monoterpene emissions and secondary organic aerosol formation in Western North America

    Directory of Open Access Journals (Sweden)

    A. R. Berg

    2012-11-01

    Full Text Available Over the last decade, extensive beetle outbreaks in Western North America have destroyed over 100 000 km2 of forest throughout British Columbia and the Western United States. Beetle infestations impact monoterpene emissions through both decreased emissions as trees are killed (mortality effect and increased emissions in trees under attack (attack effect. We use 14 yr of beetle mortality data together with beetle-induced monoterpene concentration data in the National Center for Atmospheric Research (NCAR Community Earth System Model (CESM to investigate the impact of beetle mortality and attack on monoterpene emissions and secondary organic aerosol (SOA formation in Western North America.

    Regionally, beetle infestations may have a significant impact on monoterpene emissions and SOA concentrations, with up to a 4-fold increase in monoterpene emissions and up to a 40% increase in SOA concentrations in some years (following a scenario where the attack effect is based on observed lodgepole pine response. Responses to beetle attack depend on the extent of previous mortality and the number of trees under attack in a given year, which can vary greatly over space and time. Simulated enhancements peak in 2004 (British Columbia and 2008 (US. Responses to beetle attack are shown to be substantially larger (up to a 3-fold localized increase in SOA concentrations when following a scenario based on bark-beetle attack in spruce trees. Placed in the context of observations from the IMPROVE network, the changes in SOA concentrations due to beetle attack are in most cases small compared to the large annual and interannual variability in total organic aerosol which is driven by wildfire activity in Western North America. This indicates that most beetle-induced SOA changes are not likely detectable in current observation networks; however these changes may impede efforts to achieve natural visibility conditions in the national parks and

  1. The impact of bark beetle infestations on monoterpene emissions and secondary organic aerosol formation in western North America

    Directory of Open Access Journals (Sweden)

    A. R. Berg

    2013-03-01

    Full Text Available Over the last decade, extensive beetle outbreaks in western North America have destroyed over 100 000 km2 of forest throughout British Columbia and the western United States. Beetle infestations impact monoterpene emissions through both decreased emissions as trees are killed (mortality effect and increased emissions in trees under attack (attack effect. We use 14 yr of beetle-induced tree mortality data together with beetle-induced monoterpene emission data in the National Center for Atmospheric Research (NCAR Community Earth System Model (CESM to investigate the impact of beetle-induced tree mortality and attack on monoterpene emissions and secondary organic aerosol (SOA formation in western North America. Regionally, beetle infestations may have a significant impact on monoterpene emissions and SOA concentrations, with up to a 4-fold increase in monoterpene emissions and up to a 40% increase in SOA concentrations in some years (in a scenario where the attack effect is based on observed lodgepole pine response. Responses to beetle attack depend on the extent of previous mortality and the number of trees under attack in a given year, which can vary greatly over space and time. Simulated enhancements peak in 2004 (British Columbia and 2008 (US. Responses to beetle attack are shown to be substantially larger (up to a 3-fold localized increase in summertime SOA concentrations in a scenario based on bark-beetle attack in spruce trees. Placed in the context of observations from the IMPROVE network, the changes in SOA concentrations due to beetle attack are in most cases small compared to the large annual and interannual variability in total organic aerosol which is driven by wildfire activity in western North America. This indicates that most beetle-induced SOA changes are not likely detectable in current observation networks; however, these changes may impede efforts to achieve natural visibility conditions in the national parks and wilderness

  2. The emerging world of synthetic genetics.

    Science.gov (United States)

    Chaput, John C; Yu, Hanyang; Zhang, Su

    2012-11-21

    For over 20 years, laboratories around the world have been applying the principles of Darwinian evolution to isolate DNA and RNA molecules with specific ligand-binding or catalytic activities. This area of synthetic biology, commonly referred to as in vitro genetics, is made possible by the availability of natural polymerases that can replicate genetic information in the laboratory. Moving beyond natural nucleic acids requires organic chemistry to synthesize unnatural analogues and polymerase engineering to create enzymes that recognize artificial substrates. Progress in both of these areas has led to the emerging field of synthetic genetics, which explores the structural and functional properties of synthetic genetic polymers by in vitro evolution. This review examines recent advances in the Darwinian evolution of artificial genetic polymers and their potential downstream applications in exobiology, molecular medicine, and synthetic biology.

  3. An NPF transporter exports a central monoterpene indole alkaloid intermediate from the vacuole.

    Science.gov (United States)

    Payne, Richard M E; Xu, Deyang; Foureau, Emilien; Teto Carqueijeiro, Marta Ines Soares; Oudin, Audrey; Bernonville, Thomas Dugé de; Novak, Vlastimil; Burow, Meike; Olsen, Carl-Erik; Jones, D Marc; Tatsis, Evangelos C; Pendle, Ali; Ann Halkier, Barbara; Geu-Flores, Fernando; Courdavault, Vincent; Nour-Eldin, Hussam Hassan; O'Connor, Sarah E

    2017-01-13

    Plants sequester intermediates of metabolic pathways into different cellular compartments, but the mechanisms by which these molecules are transported remain poorly understood. Monoterpene indole alkaloids, a class of specialized metabolites that includes the anticancer agent vincristine, antimalarial quinine and neurotoxin strychnine, are synthesized in several different cellular locations. However, the transporters that control the movement of these biosynthetic intermediates within cellular compartments have not been discovered. Here we present the discovery of a tonoplast localized nitrate/peptide family (NPF) transporter from Catharanthus roseus, CrNPF2.9, that exports strictosidine, the central intermediate of this pathway, into the cytosol from the vacuole. This discovery highlights the role that intracellular localization plays in specialized metabolism, and sets the stage for understanding and controlling the central branch point of this pharmacologically important group of compounds.

  4. Supercritical Fluid Extraction (SFE of Monoterpenes from the Leaves of Melaleuca alternifolia (Tea Tree

    Directory of Open Access Journals (Sweden)

    Deidre Tronson

    2001-01-01

    Full Text Available The technique of supercritical fluid extraction (SFE was applied to various sample matrices under a range of supercritical carbon dioxide (scCO2 densities and chamber temperatures. The purpose was to develop an effective extraction condition for the removal of eight target monoterpenes from Australian tea tree (Melaleuca alternifolia Cheel leaves. The optimum conditions for extraction were found to be 0.25 g/mL scCO2 density at a chamber temperature of 110oC. These condition were most effective when applied to whole fresh and rehydrated whole dried leaves, where it yielded maximum recovery of target analytes with minimum change in oil composition for the extractor system employed. This study demonstrates the importance of the type of sample matrix used in SFE work, and that a different extraction protocol would need to be developed for each matrix.

  5. New fatty acid, aromatic ester and monoterpenic benzyl glucoside from the fruits of Withania coagulans Dunal.

    Science.gov (United States)

    Ali, Abuzer; Jameel, Mohammad; Ali, Mohammed

    2015-01-01

    The fruits of Withania coagulans Dunal (family: Solanaceae) are sweet, sedative, emetic, alterative and diuretic; used to treat asthma, biliousness, strangury, wounds, dyspepsia, flatulent colic, liver complaints and intestinal infections in the indigenous system of medicine. Phytochemical investigation of the methanolic extract of W. coagulans fruits led to the isolation of a new fatty acid, an aromatic ester and a monoterpenic benzyl glucoside characterised as n-octatriacont-17-enoic acid (3), geranilan-10-olyl dihydrocinnamoate (4) and geranilan-8-oic acid-10-olyl salicyloxy-2-O-β-D-glucofuranosyl-(6″→1‴)-O-β-D-glucofuranosyl-6‴-n-octadec-9‴',11‴'-dienoate (5) along with two known fatty acids, n-dotriacont-21-enoic acid (1) and n-tetratriacontanoic acid (2). The structures of isolated phytoconstituents were established on the basis of 1D and 2D NMR, FT-IR, UV, and MS data and chemical means.

  6. Bioefficacy of acyclic monoterpenes and their saturated derivatives against the West Nile vector Culex pipiens.

    Science.gov (United States)

    Michaelakis, Antonios; Vidali, Veroniki P; Papachristos, Dimitrios P; Pitsinos, Emmanuel N; Koliopoulos, George; Couladouros, Elias A; Polissiou, Moschos G; Kimbaris, Athanasios C

    2014-02-01

    Twenty acyclic monoterpenes with different functional groups (acetoxy, hydroxyl, carbonyl and carboxyl) bearing a variable number of carbon double bonds were assayed as repellent and larvicidal agents against the West Nile vector Culex pipiens. Seven of them were derivatives that were synthesized through either hydrogenation or oxidation procedures. All repellent compounds were tested at the dose of 1mgcm(-2) and only neral and geranial were also tested at a 4-fold lower dose (0.25mgcm(-2)). Repellency results revealed that geranial, neral, nerol, citronellol, geranyl acetate and three more derivatives dihydrolinalool (3), dihydrocitronellol (5) and dihydrocitronellyl acetate (6) resulted in no landings. Based on the LC50 values the derivative dihydrocitronellyl acetate (6) was the most active of all, resulting in an LC50 value of 17.9mgL(-1). Linalyl acetate, citronellyl acetate, neryl acetate, geranyl acetate, dihydrocitronellol (5), dihydrocitronellal (7), citronellol, dihydrolinalyl acetate (2), citronellic acid and tetrahydrolinalyl acetate (1) were also toxic with LC50 values ranging from 23 to 45mgL(-1). Factors modulating toxicity have been identified, thus providing information on structural requirements for the selected acyclic monoterpenes. The acetoxy group enhanced toxicity, without being significantly affected by the unsaturation degree. Within esters, reduction of the vinyl group appears to decrease potency. Presence of a hydroxyl or carbonyl group resulted in increased activity but only in correlation to saturation degree. Branched alcohols proved ineffective compared to the corresponding linear isomers. Finally, as it concerns acids, data do not allow generalizations or correlations to be made.

  7. Contributions of organic peroxides to secondary aerosol formed from reactions of monoterpenes with O3.

    Science.gov (United States)

    Docherty, Kenneth S; Wu, Wilbur; Lim, Yong Bin; Ziemann, Paul J

    2005-06-01

    The role of organic peroxides in secondary organic aerosol (SOA) formation from reactions of monoterpenes with O3 was investigated in a series of environmental chamber experiments. Reactions were performed with endocyclic (alpha-pinene and delta3-carene) and exocyclic (beta-pinene and sabinene) alkenes in dry and humid air and in the presence of the OH radical scavengers: cyclohexane, 1-propanol, and formaldehyde. A thermal desorption particle beam mass spectrometer was used to probe the identity and volatility of SOA components, and an iodometric-spectrophotometric method was used to quantify organic peroxides. Thermal desorption profiles and mass spectra showed that the most volatile SOA components had vapor pressures similar to pinic acid and that much of the SOA consisted of less volatile species that were probably oligomeric compounds. Peroxide analyses indicated that the SOA was predominantly organic peroxides, providing evidence that the oligomers were mostly peroxyhemiacetals formed by heterogeneous reactions of hydroperoxides and aldehydes. For example, it was estimated that organic peroxides contributed approximately 47 and approximately 85% of the SOA mass formed in the alpha- and beta-pinene reactions, respectively. Reactions performed with different OH radical scavengers indicated that most of the hydroperoxides were formed through the hydroperoxide channel rather than by reactions of stabilized Criegee intermediates. The effect of the OH radical scavenger on the SOA yield was also investigated, and the results were consistent with results of recent experiments and model simulations that support a mechanism based on changes in the [HO2]/[RO2] ratios. These are the first measurements of organic peroxides in monoterpene SOA, and the results have important implications for understanding the mechanisms of SOA formation and the potential effects of atmospheric aerosol particles on the environment and human health.

  8. Transcriptome profiling, and cloning and characterization of the main monoterpene synthases of Coriandrum sativum L.

    Science.gov (United States)

    Galata, Mariana; Sarker, Lukman S; Mahmoud, Soheil S

    2014-06-01

    Terpenoids are a large and diverse class of specialized metabolites that are essential for the growth and development of plants, and have tremendous industrial applications. The mericarps of Coriandrum sativum L. (coriander) produce an essential oil (EO) rich in monoterpenes, volatile C10 terpenoids. To investigate EO metabolism, the transcriptome of coriander mericarps, at three developmental stages (early, mid, late) was sequenced via Illumina technology and a transcript library was produced. To validate the usability of the transcriptome sequences, two terpene synthase candidate genes, CsγTRPS and CsLINS, encoding 558 and 562 amino acid proteins were expressed in bacteria, and the recombinant proteins purified by Ni-NTA affinity chromatography. The 65.16 (CsγTRPS) and 65.91 (CsLINS)kDa recombinant proteins catalyzed the conversion of geranyl diphosphate, the precursor to monoterpenes, to γ-terpinene and (S)-linalool, respectively, with apparent Vmax and Km values of 2.24±0.16 (CsγTRPS); 19.63±1.05 (CsLINS)pkat/mg and 66.25±13 (CsγTRPS); 2.5±0.6 (CsLINS)μM, respectively. Together, CsγTRPS and CsLINS account for the majority of EO constituents in coriander mericarps. Investigation of the coriander transcriptome, and knowledge gained from these experiments will facilitate future studies concerning essential and fatty acid oil production in coriander. They also enable efforts to improve the coriander oils through metabolic engineering or plant breeding.

  9. Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen.

    Science.gov (United States)

    Bannai, Hiroshi; Nemoto, Manabu; Tsujimura, Koji; Yamanaka, Takashi; Maeda, Ken; Kondo, Takashi

    2016-02-01

    To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA.

  10. Process for Assembly and Transformation into Saccharomyces cerevisiae of a Synthetic Yeast Artificial Chromosome Containing a Multigene Cassette to Express Enzymes That Enhance Xylose Utilization Designed for an Automated Platform.

    Science.gov (United States)

    Hughes, Stephen R; Cox, Elby J; Bang, Sookie S; Pinkelman, Rebecca J; López-Núñez, Juan Carlos; Saha, Badal C; Qureshi, Nasib; Gibbons, William R; Fry, Michelle R; Moser, Bryan R; Bischoff, Kenneth M; Liu, Siqing; Sterner, David E; Butt, Tauseef R; Riedmuller, Steven B; Jones, Marjorie A; Riaño-Herrera, Néstor M

    2015-12-01

    A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system in yeast and to design an assembly process suitable for an automated platform. Expression of XI and XKS from the YAC was confirmed by Western blot and PCR analyses. The recombinant and wild-type strains showed similar growth on plates containing hexose sugars, but only recombinant grew on D-xylose and L-arabinose plates. In glucose fermentation, doubling time (4.6 h) and ethanol yield (0.44 g ethanol/g glucose) of recombinant were comparable to wild type (4.9 h and 0.44 g/g). In whole-corn hydrolysate, ethanol yield (0.55 g ethanol/g [glucose + xylose]) and xylose utilization (38%) for recombinant were higher than for wild type (0.47 g/g and 12%). In hydrolysate from spent coffee grounds, yield was 0.46 g ethanol/g (glucose + xylose), and xylose utilization was 93% for recombinant. These results indicate introducing a YAC expressing XI and XKS enhanced xylose utilization without affecting integrity of the host strain, and the process provides a potential platform for automated synthesis of a YAC for expression of multiple optimized genes to improve yeast strains.

  11. Chrysanthemyl diphosphate synthase: Isolation of the gene and characterization of the recombinant non-head-to-tail monoterpene synthase from Chrysanthemum cinerariaefolium

    OpenAIRE

    Rivera, Susan B.; Swedlund, Bradley D.; King, Gretchen J.; Bell, Russell N.; Hussey, Charles E.; Shattuck-Eidens, Donna M.; Wrobel, Wislawa M.; Peiser, Galen D.; Poulter, C. Dale

    2001-01-01

    Chrysanthemyl diphosphate synthase (CPPase) catalyzes the condensation of two molecules of dimethylallyl diphosphate to produce chrysanthemyl diphosphate (CPP), a monoterpene with a non-head-to-tail or irregular c1′-2-3 linkage between isoprenoid units. Irregular monoterpenes are common in Chrysanthemum cinerariaefolium and related members of the Asteraceae family. In C. cinerariaefolium, CPP is an intermediate in the biosynthesis of the pyrethrin ester insecticides. CPPa...

  12. Isotopically sensitive branching in the formation of cyclic monoterpenes: proof that (-)-alpha-pinene and (-)-beta-pinene are synthesized by the same monoterpene cyclase via deprotonation of a common intermediate

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wheeler, C.J.; Cane, D.E.; Ebert, R.; Ha, H.J.

    1987-08-25

    To determine whether the bicyclic monoterpene olefins (-)-alpha-pinene and (-)-beta-pinene arise biosynthetically from the same monoterpene cyclase by alternate deprotonations of a common carbocationic intermediate, the product distributions arising from the acyclic precursor (10-/sup 2/H/sub 3/,1-/sup 3/H)geranyl pyrophosphate were compared with those resulting from incubation of (1-3H)geranyl pyrophosphate with (-)-pinene cyclase from Salvia officinalis. Alteration in proportions of the olefinic products generated by the partially purified pinene cyclase resulted from the suppression of the formation of (-)-beta-pinene (C10 deprotonation) by a primary deuterium isotope effect with a compensating stimulation of the formation of (-)-alpha-pinene (C4 deprotonation). (-)-Pinene cyclase as well as (+)-pinene cyclase also exhibited a decrease in the proportion of the acyclic olefin myrcene generated from the deuteriated substrate, accompanied by a corresponding increase in the commitment to cyclized products. The observation of isotopically sensitive branching, in conjunction with quantitation of the magnitude of the secondary deuterium isotope effect on the overall rate of product formation by the (+)- and (-)-pinene cyclases as well as two other monoterpene cyclases from the same tissue, supports the biosynthetic origin of (-)-alpha-pinene and (-)-beta-pinene by alternative deprotonations of a common enzymatic intermediate. A biogenetic scheme consistent with these results is presented, and alternate proposals for the origin of the pinenes are addressed.

  13. [From synthetic biology to synthetic humankind].

    Science.gov (United States)

    Nouvel, Pascal

    2015-01-01

    In this paper, we propose an historical survey of the expression "synthetic biology" in order to identify its main philosophical components. The result of the analysis is then used to investigate the meaning of the notion of "synthetic man". It is shown that both notions share a common philosophical background that can be summed up by the short but meaningful assertion: "biology is technology". The analysis allows us to distinguish two notions that are often confused in transhumanist literature: the notion of synthetic man and the notion of renewed man. The consequences of this crucial distinction are discussed. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  14. Monoterpene emissions from needles of hybrid larch F1 (Larix gmelinii var. japonica × Larix kaempferi) grown under elevated carbon dioxide and ozone

    Science.gov (United States)

    Mochizuki, Tomoki; Watanabe, Makoto; Koike, Takayoshi; Tani, Akira

    2017-01-01

    We measured monoterpene emissions from needles of hybrid larch F1 (Larix gmelinii var. japonica × Larix kaempferi) to evaluate the response of monoterpene emission rates and their composition to elevated CO2 (600 μmol mol-1) and O3 (60 nmol mol-1) conditions. The dominant monoterpenes were α-pinene and β-pinene. The emission rate of total monoterpenes significantly decreased under elevated CO2 conditions (P photosynthetically fixed carbon also significantly decreased under elevated CO2 conditions. By contrast, elevated O3 did not significantly affect the emission rate of total monoterpenes. The ratios of α-pinene/β-pinene, limonene/β-pinene, and myrcene/β-pinene were all significantly decreased by O3 exposure (P < 0.05). High reactivity of α-pinene, limonene, and myrcene when combining with O3 may be able to mitigate oxidative damage inside the larch needles. No significant combined effects of elevated CO2 and O3 on individual or total monoterpene emissions were detected.

  15. Irreversible impacts of heat on the emissions of monoterpenes, sesquiterpenes, phenolic BVOC and green leaf volatiles from several tree species

    Directory of Open Access Journals (Sweden)

    E. Kleist

    2012-12-01

    Full Text Available Climate change will induce extended heat waves to parts of the vegetation more frequently. High temperatures may act as stress (thermal stress on plants changing emissions of biogenic volatile organic compounds (BVOCs. As BVOCs impact the atmospheric oxidation cycle and aerosol formation, it is important to explore possible alterations of BVOC emissions under high temperature conditions. Applying heat to European beech, Palestine oak, Scots pine, and Norway spruce in a laboratory setup either caused the well-known exponential increases of BVOC emissions or induced irreversible changes of BVOC emissions. Considering only irreversible changes of BVOC emissions as stress impacts, we found that high temperatures decreased the de novo emissions of monoterpenes, sesquiterpenes and phenolic BVOC. This behaviour was independent of the tree species and whether the de novo emissions were constitutive or induced by biotic stress.

    In contrast, application of thermal stress to conifers amplified the release of monoterpenes stored in resin ducts of conifers and induced emissions of green leaf volatiles. In particular during insect attack on conifers, the plants showed de novo emissions of sesquiterpenes and phenolic BVOCs, which exceeded constitutive monoterpene emissions from pools. The heat-induced decrease of de novo emissions was larger than the increased monoterpene release caused by damage of resin ducts. For insect-infested conifers the net effect of thermal stress on BVOC emissions could be an overall decrease.

    Global change-induced heat waves may put hard thermal stress on plants. If so, we project that BVOC emissions increase is more than predicted by models only in areas predominantly covered with conifers that do not emit high amounts of sesquiterpenes and phenolic BVOCs. Otherwise overall effects of high temperature stress will be lower increases of BVOC emissions than predicted by algorithms that do

  16. European emissions of isoprene and monoterpenes from the Last Glacial Maximum to present

    Directory of Open Access Journals (Sweden)

    G. Schurgers

    2009-12-01

    Full Text Available Biogenic volatile organic compounds (BVOC, such as isoprene and monoterpenes, play an important role in atmospheric processes. BVOC species are oxidized in the atmosphere and influence levels of ozone. The less volatile amongst the BVOC and their oxidation products are important for the formation and growth of secondary biogenic aerosol. In this way, the Earth's radiation balance is affected.

    Geographic distribution and temporal changes in BVOC emissions are highly uncertain. Here we assessed changes in emission patterns across Europe since the Last Glacial Maximum (LGM with a dynamic vegetation model. This model reproduces European tree species distribution and includes a process-based algorithm for terpenoid production. In a set of simulations the model was driven with paleoclimate anomalies and reconstructed CO2 concentrations. We quantified three main driving factors for the changes in emissions of isoprene and monoterpenes since the LGM: (1 the changes in climate, with temperature changes as the most important factor affecting plant physiology and terpenoid production in all plant species, (2 a change in species distribution related to the changes in climate, causing local shifts in emission characteristics of the vegetation, and (3 a change in CO2 concentration, causing opposing effects on the availability of different substrates for terpenoid production. The effect of atmospheric CO2 concentration is particularly uncertain, but sensitivity simulations showed an increase in European BVOC emissions in all sensitivity experiments irrespective of the use of a direct inhibition of terpenoid production by CO2. The effects of climate change on physiology and terpenoid production resulted in an overall relatively uniform increase of emissions in Europe over the simulation period, but regionally the effect of changes in species distribution and the related changes in emission capacities resulted

  17. European emissions of isoprene and monoterpenes from the Last Glacial Maximum to present

    Directory of Open Access Journals (Sweden)

    G. Schurgers

    2009-09-01

    Full Text Available Biogenic volatile organic compounds (BVOC, such as isoprene and monoterpenes, play an important role in atmospheric processes. BVOC species are oxidized in the atmosphere and influence levels of ozone. The less volatile amongst the BVOC and their oxidation products are important for the formation and growth of secondary biogenic aerosol. In this way, the earth's radiation balance is affected.

    Geographic distribution and temporal changes in BVOC emissions are highly uncertain. Here we assessed changes in emission patterns across Europe since the Last Glacial Maximum (LGM with a dynamic vegetation model that reproduces European tree species distribution and in which a process-based algorithm for terpenoid production was incorporated. In a set of simulations the model was driven with paleoclimate anomalies and reconstructed CO2 concentrations. We quantified three main driving factors for the changes in emissions of isoprene and monoterpenes since the LGM: (1 the changes in climate, with temperature changes as the most important factor affecting plant physiology and terpenoid production in all plant species, (2 a change in species distribution related to the changes in climate, causing local shifts in emission characteristics of the vegetation, and (3 a change in CO2 concentration, causing opposing effects on the availability of different substrates for terpenoid production. The effect of atmospheric CO2 concentration is particularly uncertain, but sensitivity simulations showed an increase in European BVOC emissions in all sensitivity experiments irrespective of the use of a direct inhibition of terpenoid production by CO2. The effects of climate change on physiology and terpenoid production resulted in an overall relatively uniform increase of emissions in Europe over the simulation period, but regionally the effect of changes in species distribution and the related changes in emission

  18. Hygroscopicity of secondary organic aerosols formed by oxidation of cycloalkenes, monoterpenes, sesquiterpenes, and related compounds

    Directory of Open Access Journals (Sweden)

    V. Varutbangkul

    2006-01-01

    Full Text Available A series of experiments has been conducted in the Caltech indoor smog chamber facility to investigate the water uptake properties of aerosol formed by oxidation of various organic precursors. Secondary organic aerosol (SOA from simple and substituted cycloalkenes (C5-C8 is produced in dark ozonolysis experiments in a dry chamber (RH~5%. Biogenic SOA from monoterpenes, sesquiterpenes, and oxygenated terpenes is formed by photooxidation in a humid chamber (~50% RH. Using the hygroscopicity tandem differential mobility analyzer (HTDMA, we measure the diameter-based hygroscopic growth factor (GF of the SOA as a function of time and relative humidity. All SOA studied is found to be slightly hygroscopic, with smaller water uptake than that of typical inorganic aerosol substances. The aerosol water uptake increases with time early in the experiments for the cycloalkene SOA, but decreases with time for the sesquiterpene SOA. This behavior could indicate competing effects between the formation of more highly oxidized polar compounds (more hygroscopic, and formation of longer-chained oligomers (less hygroscopic. All SOA also exhibit a smooth water uptake with RH with no deliquescence or efflorescence. The water uptake curves are found to be fitted well with an empirical three-parameter functional form. The measured pure organic GF values at 85% RH are between 1.09–1.16 for SOA from ozonolysis of cycloalkenes, 1.01–1.04 for sesquiterpene photooxidation SOA, and 1.06–1.10 for the monoterpene and oxygenated terpene SOA. The GF of pure SOA (GForg in experiments in which inorganic seed aerosol is used is determined by assuming volume-weighted water uptake (Zdanovskii-Stokes-Robinson or 'ZSR' approach and using the size-resolved organic mass fraction measured by the Aerodyne Aerosol Mass Spectrometer. Knowing the water content associated with the inorganic fraction yields GForg values. However, for each precursor, the GForg values computed from different

  19. Enzyme and biochemical producing fungi

    DEFF Research Database (Denmark)

    Lübeck, Peter Stephensen; Lübeck, Mette; Nilsson, Lena

    2010-01-01

    We are developing a biorefinery concept for biological production of chemicals, drugs, feed and fuels using plant biomass as raw material in well-defined cell-factories. Among the important goals is the discovery of new biocatalysts for production of enzymes, biochemicals and fuels and already our...... screening of a large collection of fungal strains isolated from natural habitats have resulted in identification of strains with high production of hydrolytic enzymes and excretion of organic acids. Our research focuses on creating a fungal platform based on synthetic biology for developing new cell...

  20. High-resolution MALDI mass spectrometry imaging of gallotannins and monoterpene glucosides in the root of Paeonia lactiflora

    Science.gov (United States)

    Li, Bin; Bhandari, Dhaka Ram; Römpp, Andreas; Spengler, Bernhard

    2016-10-01

    High-resolution atmospheric-pressure scanning microprobe matrix-assisted laser desorption/ionization mass spectrometry imaging (AP-SMALDI MSI) at 10 μm pixel size was performed to unravel the spatio-chemical distribution of major secondary metabolites in the root of Paeonia lactiflora. The spatial distributions of two major classes of bioactive components, gallotannins and monoterpene glucosides, were investigated and visualized at the cellular level in tissue sections of P. lactiflora roots. Accordingly, other primary and secondary metabolites were imaged, including amino acids, carbohydrates, lipids and monoterpenes, indicating the capability of untargeted localization of metabolites by using high-resolution MSI platform. The employed AP-SMALDI MSI system provides significant technological advancement in the visualization of individual molecular species at the cellular level. In contrast to previous histochemical studies of tannins using unspecific staining reagents, individual gallotannin species were accurately localized and unequivocally discriminated from other phenolic components in the root tissues. High-quality ion images were obtained, providing significant clues for understanding the biosynthetic pathway of gallotannins and monoterpene glucosides and possibly helping to decipher the role of tannins in xylem cells differentiation and in the defence mechanisms of plants, as well as to investigate the interrelationship between tannins and lignins.

  1. Designing synthetic biology.

    Science.gov (United States)

    Agapakis, Christina M

    2014-03-21

    Synthetic biology is frequently defined as the application of engineering design principles to biology. Such principles are intended to streamline the practice of biological engineering, to shorten the time required to design, build, and test synthetic gene networks. This streamlining of iterative design cycles can facilitate the future construction of biological systems for a range of applications in the production of fuels, foods, materials, and medicines. The promise of these potential applications as well as the emphasis on design has prompted critical reflection on synthetic biology from design theorists and practicing designers from many fields, who can bring valuable perspectives to the discipline. While interdisciplinary connections between biologists and engineers have built synthetic biology via the science and the technology of biology, interdisciplinary collaboration with artists, designers, and social theorists can provide insight on the connections between technology and society. Such collaborations can open up new avenues and new principles for research and design, as well as shed new light on the challenging context-dependence-both biological and social-that face living technologies at many scales. This review is inspired by the session titled "Design and Synthetic Biology: Connecting People and Technology" at Synthetic Biology 6.0 and covers a range of literature on design practice in synthetic biology and beyond. Critical engagement with how design is used to shape the discipline opens up new possibilities for how we might design the future of synthetic biology.

  2. Effect of Mentha x piperita essential oil and monoterpenes on cucumber root membrane potential.

    Science.gov (United States)

    Maffei, M; Camusso, W; Sacco, S

    2001-11-01

    Peppermint (Mentha piperita L.) essential oil and its main components were assessed for their ability to interfere with plant plasma membrane potentials. Tests were conducted on root segments isolated from etiolated seedlings of cucumber (Cucumis sativus L.). Increasing the concentration of peppermint essential oil from 5 to 50 ppm caused a decrease in membrane potential (Vm) hyperpolarization of 10-3 mV, whereas concentrations from 100 up to 900 ppm caused an increasing depolarization of Vm (from 5 to 110 mV). When tested at 300 ppm, (+)-menthyl acetate, (-)-limonene and 1,8-cineole did not exert any significant effect on V(m), whereas (+)-menthofuran (73 mV), (+)-pulegone (85 mV), (+)-neomenthol (96 mV), (-)-menthol (105 mV) and (-)-menthone (111 mV) showed increased ability to depolarize V(m). A plot of log of octanol-water partition coefficient (K(ow)) against their depolarizing effect showed a significant negative correlation, suggesting that among all monoterpenoids increased membrane depolarization depends on lower K(ow). However, among monoterpene ketones, alcohols and furans, increased membrane depolarization is associated with a decline in water solubility. The possible effect of monoterpenoids on membrane ion fluxes is also discussed, since changes in the bioelectric potential of cells imply changes in the flux of ions across the plasma membrane

  3. Biochemical and Histochemical Localization of Monoterpene Biosynthesis in the Glandular Trichomes of Spearmint (Mentha spicata) 12

    Science.gov (United States)

    Gershenzon, Jonathan; Maffei, Massimo; Croteau, Rodney

    1989-01-01

    The primary monoterpene accumulated in the glandular trichomes of spearmint (Mentha spicata) is the ketone (−)-carvone which is formed by cyclization of the C10 isoprenoid intermediate geranyl pyrophosphate to the olefin (−)-limonene, hydroxylation to (−)-trans-carveol and subsequent dehydrogenation. Selective extraction of the contents of the glandular trichomes indicated that essentially all of the cyclase and hydroxylase activities resided in these structures, whereas only about 30% of the carveol dehydrogenase was located here with the remainder located in the rest of the leaf. This distribution of carveol dehydrogenase activity was confirmed by histochemical methods. Electrophoretic analysis of the partially purified carveol dehydrogenase from extracts of both the glands and the leaves following gland removal indicated the presence of a unique carveol dehydrogenase species in the glandular trichomes, suggesting that the other dehydrogenase found throughout the leaf probably utilizes carveol only as an adventitious substrate. These results demonstrate that carvone biosynthesis takes place exclusively in the glandular trichomes in which this natural product accumulates. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:16666709

  4. Biochemical and histochemical localization of monoterpene biosynthesis in the glandular trichomes of spearmint (Mentha spicata)

    Energy Technology Data Exchange (ETDEWEB)

    Gershenzon, J.; Maffei, M.; Croteau, R. (Washington State Univ., Pullman (USA))

    1989-04-01

    The primary monoterpene accumulated in the glandular trichomes of spearmint (Mentha spicata) is the ketone (-)-carvone which is formed by cyclization of the C{sub 10} isoprenoid intermediate geranyl pyrophosphate to the olefin (-)-limonene, hydroxylation to (-)-trans-carveol and subsequent dehydrogenation. Selective extraction of the contents of the glandular trichomes indicated that essentially all of the cyclase and hydroxylase activities resided in these structures, whereas only about 30% of the carveol dehydrogenase was located here with the remainder located in the rest of the leaf. This distribution of carveol dehydrogenase activity was confirmed by histochemical methods. Electrophoretic analysis of the partially purified carveol dehydrogenase from extracts of both the glands and the leaves following gland removal indicated the presence of a unique carveol dehydrogenase species in the glandular trichomes, suggesting that the other dehydrogenase found throughout the leaf probably utilizes carveol only as an adventitious substrate. These results demonstrate that carvone biosynthesis takes place exclusively in the glandular trichomes in which this natural product accumulates.

  5. Antihypertensive effect of auraptene, a monoterpene coumarin from the genus Citrus, upon chronic administration

    Directory of Open Access Journals (Sweden)

    Bibi Marjan Razavi

    2015-02-01

    Full Text Available Objective(s: Auraptene, a monoterpene coumarin from Citrus species, exhibits cardioprotective effects.In this study, the effects of auraptene administration were investigated on blood pressure of normotensive and desoxycorticosterone acetate (DOCA salt induced hypertensive rats. Materials and Methods: Five weeks administration of auraptene (2, 4, 8 and 16 mg/kg/day and nifedipine (0.25, 0.5, 1, 2 and 4 mg/kg/day in different groups of normotensive and hypertensive rats (at the end of 3 weeks treatment by DOCA salt was carried out and their effects on mean systolic blood pressure (MSBP and mean heart rate (MHR were evaluated using tail cuff method. Results: Our results indicated that chronic administration of auraptene (2, 4, 8 and 16 mg/kg/day significantly reduced the MSBP in DOCA salt treated rats in a dose and time dependent manner. The percent of decreases in MSBP levels by the highest dose of auraptene (16 mg/kg at the end of 4 th to 8 th weeks, were 7.00%, 10.78%, 16.07%, 21.28% and 27.54% respectively(P

  6. Induction of allergic contact dermatitis by astigmatid mite-derived monoterpene, alpha-acaridial.

    Science.gov (United States)

    Sasai, Toshio; Hirano, Yunosuke; Maeda, Sayaka; Matsunaga, Isamu; Otsuka, Atsushi; Morita, Daisuke; Nishida, Ritsuo; Nakayama, Hideo; Kuwahara, Yasumasa; Sugita, Masahiko; Mori, Naoki

    2008-10-24

    alpha-Acaridial [2(E)-(4-methyl-3-pentenyl)butenedial] is a novel monoterpene secreted from the house dust mites. Because of its molecular nature of a highly reactive, small lipidic compound, we addressed whether alpha-acaridial might function as a haptenic allergen that induced allergic contact dermatitis. Mice sensitized with alpha-acaridial were challenged by the same antigen on the ear skin. After 2 days, significant ear swelling with a prominent infiltration of CD4(+) T lymphocytes was observed. In vitro, alpha-acaridial exhibited an outstanding ability to quickly interact with and chemically modify a reference protein. Virtually all cysteine residues and a sizable fraction of lysine residues were found to be selectively modified, suggesting that alpha-acaridial could potentially interact with any proteins. Previously, numerous mite-derived proteinaceous allergens have been associated with contact dermatitis. Our study now emphasizes that small lipidic compounds released from mites comprise a new class of mite allergens, and therefore, is of significant medical implications.

  7. Borneol, a Bicyclic Monoterpene Alcohol, Reduces Nociceptive Behavior and Inflammatory Response in Mice

    Directory of Open Access Journals (Sweden)

    Jackson Roberto Guedes da Silva Almeida

    2013-01-01

    Full Text Available Borneol, a bicyclic monoterpene, has been evaluated for antinociceptive and anti-inflammatory activities. Antinociceptive and anti-inflammatory activities were studied by measuring nociception by acetic acid, formalin, hot plate, and grip strength tests, while inflammation was prompted by carrageenan-induced peritonitis. The rotarod test was used to evaluate motor coordination. Borneol produced a significant (P<0.01 reduction of the nociceptive behavior at the early and late phases of paw licking and reduced the writhing reflex in mice (formalin and writhing tests, resp.. When the hot plate test was conducted, borneol (in higher dose produced an inhibition (P<0.05 of the nociceptive behavior. Such results were unlikely to be provoked by motor abnormality. Additionally, borneol-treated mice reduced the carrageenan-induced leukocytes migration to the peritoneal cavity. Together, our results suggest that borneol possess significant central and peripheral antinociceptive activity; it has also anti-inflammatory activity. In addition, borneol did not impair motor coordination.

  8. Optically active conjugated polymer from solvent chirality transfer polymerization in monoterpenes.

    Science.gov (United States)

    Kim, Hyojin; Lee, Daehoon; Lee, Seul; Suzuki, Nozomu; Fujiki, Michiya; Lee, Chang-Lyoul; Kwak, Giseop

    2013-09-01

    Disubstituted acetylene monomers [1,2-diphenylacetylenes (DPAs: DPA-pC1, DPA-mC1, DPA-pC8); 1-phenyl-2-hexylacetylene (PHA-pC1)] are tested for asymmetric polymerization in chiral monoterpenes used as solvents and compared with the corresponding monosubstituted acetylene monomer [1-phenylacetylene (PA-pC1)]. DPA-pC1 containing a trimethylsilyl group in the para-position of the phenyl ring produces an optically active polymer with a large Cotton effect, despite the absence of a stereogenic center. The polymer sample obtained by polymerization in 87% ee (-)-α-pinene shows the strongest CD signal (gCD value at 385 nm: ∼3.2 × 10⁻³). The Cotton bands of the polymers obtained in (-)- and (+)-α-pinenes show the opposite sign in the CD signals. Theoretical calculations show that only the cis-cisoid model adopts a helical conformation. A time-correlated single photon counting experiment shows that the emission of the chiral polymer originates from a virtually single excited species with a 98% component fraction. This polymer solution does not show any significant decrease in gCD value over a wide temperature range of 20 to 80 °C. No noticeable decrease in the gCD value is detected when the polymer solution is kept at relatively low temperatures for a prolonged period (35 d). In contrast, the other polymers show no CD signal.

  9. Active monoterpene ketones isolated from Rosmarinus officinalis with fumigant and contact action against Tyrophagus putrescentiae (Schrank).

    Science.gov (United States)

    Jeon, Ju-Hyun; Park, Jun-Hwan; Chung, Namhyun; Lee, Hoi-Seon

    2014-08-01

    The acaricidal activities of an active material derived from Rosmarinus officinalis oil and its relative monoterpene ketones were determined using fumigant and contact toxicity bioassays against Tyrophagus putrescentiae and were compared with that of a commercial acaricide (benzyl benzoate). The active component of R. officinalis oil, isolated by silica gel column chromatography and high-performance liquid chromatography, was identified as camphor, based on various spectroscopic analyses. In the fumigant toxicity bioassay, camphor (2.25 μg/cm(3)) was 5.58 times more active than benzyl benzoate (12.56 μg/cm(3)) against T. putrescentiae, followed by (+)-camphor (3.89 μg/cm(3)) and (-)-camphor (5.61 μg/cm(3)). In the contact toxicity bioassay, camphor (1.34 μg/cm(2)) was 6.74 times more toxic than benzyl benzoate (9.03 μg/cm(2)) against T. putrescentiae, followed by (+)-camphor (2.23 μg/cm(2)) and (-)-camphor (2.94 μg/cm(2)). These results indicate that camphor and its derivatives are very useful as potential control agents against stored food mites regardless of the application method.

  10. Inhibition of N-nitrosodiethylamine carcinogenesis in mice by naturally occurring organosulfur compounds and monoterpenes.

    Science.gov (United States)

    Wattenberg, L W; Sparnins, V L; Barany, G

    1989-05-15

    Naturally occurring compounds belonging to two chemical groups were studied for their capacities to inhibit N-nitrosodiethylamine (NDEA)-induced carcinogenesis in female A/J mice. One group consists of organosulfur compounds found in Allium species, including garlic, onions, leeks, and shallots, and the other, two monoterpenes, i.e., D-limonene and D-carvone. In an initial experiment, in which organosulfur compounds were investigated, diallyl disulfide, allyl mercaptan, and allyl methyl disulfide were found to produce a marked inhibition of NDEA-induced neoplasia of the forestomach when the test compounds were administered p.o. 96 and 48 h prior to NDEA. The most potent was diallyl disulfide which reduced forestomach tumor formation by more than 90%. Pulmonary adenoma formation also was inhibited but to a considerably lesser extent, i.e., about 30%. In three additional experiments, test compounds were given p.o. either 15 min or 1 h prior to NDEA. Under these conditions diallyl disulfide and allyl mercaptan again inhibited forestomach tumor formation substantially, i.e., greater than 75%, and pulmonary adenoma formation marginally, i.e., less than 20%. In these experiments D-limonene and D-carvone were tested and reduced forestomach tumor formation by slightly over 60% and pulmonary adenoma formation by about 35%. The results of these studies provide evidence of an increasing diversity of naturally occurring compounds having the capacity to inhibit nitrosamine carcinogenesis.

  11. Supercritical CO2 Extraction of Lavandula angustifolia Mill. Flowers: Optimisation of Oxygenated Monoterpenes, Coumarin and Herniarin Content.

    Science.gov (United States)

    Jerković, Igor; Molnar, Maja; Vidović, Senka; Vladić, Jelena; Jokić, Stela

    2017-07-14

    Lavandula angustifolia is good source of oxygenated monoterpenes containing coumarins as well, which are all soluble in supercritical CO2 (SC-CO2 ). The study objective is to investigate SC-CO2 extraction parameters on: the total yield; GC-MS profile of the extracts; relative content of oxygenated monoterpenes; the amount of coumarin and herniarin; and to determine optimal SC-CO2 extraction conditions by response surface methodology (RSM). SC-CO2 extraction was performed under different pressure, temperature and CO2 flow rate determined by Box-Behnken design (BBD). The sample mass and the extraction time were kept constant. The chemical profiles and relative content of oxygenated monoterpenes (as coumarin equivalents, CE) were determined by GC-MS. Coumarin and herniarin concentrations were dosed by HPLC. SC-CO2 extracts contained linalool (57.4-217.9 mg CE/100 g), camphor (10.6-154.4 mg CE/100 g), borneol (6.2-99.9 mg CE/100 g), 1,8-cineole (5.0-70.4 mg CE/100 g), linalyl acetate (86.1-267.9 mg CE/100 g), coumarin (0.95-18.16 mg/100 g), and herniarin (0.95-13.63 mg/100 g). The interaction between the pressure and CO2 flow rate as well as between the temperature and CO2 flow rate showed statistically significant influence on the extraction yield. Applying BBD, the optimum extraction conditions for higher monoterpenes and lower coumarin content were at 10 MPa, 41°C and CO2 flow rate 2.3 kg/h, and at 30 MPa, 50°C and CO2 flow rate 3 kg/h for higher monoterpenes and coumarin content. SC-CO2 extraction is a viable technique for obtaining lavender extracts with desirable flavour components. The second-order model based on BBD predicts the results for SC-CO2 extraction quite satisfactorily. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  12. How have both cultivation and warming influenced annual global isoprene and monoterpene emissions since the preindustrial era?

    Directory of Open Access Journals (Sweden)

    K. Tanaka

    2012-10-01

    Full Text Available To examine the influence of both crop cultivation and surface air temperatures (SATs on annual global isoprene and monoterpene emissions, which can lead to the formation of secondary organic aerosols (SOAs, we simulated, on a monthly basis, the annual emissions of volatile organic compounds (VOCs during the period 1854–2000. The model estimates were based on historical climate data such as SATs, and downward solar radiation (DSR reproduced with an atmospheric-ocean circulation model, as well as a time series of the global distribution of cropland (to test the hypothesis that conversion of forests into croplands lowers emissions. The simulations demonstrated that global SAT, DSR, the combination of SAT and DSR, and the expansion of cropland all affected emissions. The effect of cropland expansion (i.e., forest conversion on annual emissions during this period was larger for isoprene (~7% reduction on a global scale than for monoterpenes (~2% reduction, mainly because of the reduction in broadleaf evergreen forests (BEFs in Southeast Asia, which have the highest and most constant emissions of isoprene and where both temperature and radiation are high all year round. The reduction in the Amazon region and in parts of Africa, which are other primary sources of annual global isoprene emissions, but where the conversion of BEF to cropland has been much smaller than in Southeast Asia, was less remarkable, probably because the broadleaf deciduous forests and C4 grasslands in these areas have lower and seasonal emissions; hence, their conversion has less effect. On the other hand, the difference in the emission factors (ε between cropland and the other vegetation types was much lower for monoterpenes than for isoprene, although the ε for cropland was generally the lowest for both compounds. Thus, the expansion of cropland also contributed to the reduction in monoterpene emissions to some degree, but had less effect. A ~5% increase in emissions due to

  13. Fumigant toxicities of essential oils and two monoterpenes against potato tuber moth (Phthorimaea operculella Zeller

    Directory of Open Access Journals (Sweden)

    Tayoub Ghaleb

    2016-12-01

    Full Text Available Introduction: The potato tuber moth (PTM is the major economic pest of potato. Different approaches were tried to prevent and control this pest including natural pesticides and synthetic fumigants.

  14. Food Enzymes

    Science.gov (United States)

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  15. Food Enzymes

    Science.gov (United States)

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  16. Enzyme immunoassay

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, B; Dinesen, B; Deckert, M

    1985-01-01

    An enzyme linked immunoadsorbent assay for urinary albumin using commercially available reagents is described. The assay range is 2.5-120 micrograms/l. When samples are analysed in two standard dilutions, the assayable albumin concentration range is 2.5-240 mg/l, covering the clinical range from...

  17. Catalysts from synthetic genetic polymers.

    Science.gov (United States)

    Taylor, Alexander I; Pinheiro, Vitor B; Smola, Matthew J; Morgunov, Alexey S; Peak-Chew, Sew; Cozens, Christopher; Weeks, Kevin M; Herdewijn, Piet; Holliger, Philipp

    2015-02-19

    The emergence of catalysis in early genetic polymers such as RNA is considered a key transition in the origin of life, pre-dating the appearance of protein enzymes. DNA also demonstrates the capacity to fold into three-dimensional structures and form catalysts in vitro. However, to what degree these natural biopolymers comprise functionally privileged chemical scaffolds for folding or the evolution of catalysis is not known. The ability of synthetic genetic polymers (XNAs) with alternative backbone chemistries not found in nature to fold into defined structures and bind ligands raises the possibility that these too might be capable of forming catalysts (XNAzymes). Here we report the discovery of such XNAzymes, elaborated in four different chemistries (arabino nucleic acids, ANA; 2'-fluoroarabino nucleic acids, FANA; hexitol nucleic acids, HNA; and cyclohexene nucleic acids, CeNA) directly from random XNA oligomer pools, exhibiting in trans RNA endonuclease and ligase activities. We also describe an XNA-XNA ligase metalloenzyme in the FANA framework, establishing catalysis in an entirely synthetic system and enabling the synthesis of FANA oligomers and an active RNA endonuclease FANAzyme from its constituent parts. These results extend catalysis beyond biopolymers and establish technologies for the discovery of catalysts in a wide range of polymer scaffolds not found in nature. Evolution of catalysis independent of any natural polymer has implications for the definition of chemical boundary conditions for the emergence of life on Earth and elsewhere in the Universe.

  18. Significant light and temperature dependent monoterpene emissions from European beech (Fagus sylvatica L.) and their potential impact on the European volatile organic compound budget

    Science.gov (United States)

    Dindorf, T.; Kuhn, U.; Ganzeveld, L.; Schebeske, G.; Ciccioli, P.; Holzke, C.; KöBle, R.; Seufert, G.; Kesselmeier, J.

    2006-08-01

    By using a dynamic branch enclosure system the emission of monoterpenes from European beech (Fagus sylvatica L.) was investigated during two consecutive summer vegetation periods in the years of 2002 and 2003 in Germany. All measurements were performed under field conditions within the framework of the ECHO project (Emission and Chemical Transformation of Biogenic Volatile Organic Compounds, AFO 2000). European beech was characterized as a substantial emitter of monoterpenes, with sabinene being the predominant compound released. The monoterpene emission from European beech was shown to be a function of light and temperature and agreed well to emission algorithms that consider a light and temperature dependent release of volatile organics. Standard emission factors that were measured from these sunlit leaves of European beech ranged up to 4-13 μg g-1 h-1 (normalized to 1000 μmol m-2 s-1, 30°C) in the years of 2003 and 2002, respectively. The nighttime emission of monoterpene compounds was negligible. Also the artificial darkening of the sunlit branch during daylight conditions led to an immediate cessation of monoterpene emission. European beech is the dominating deciduous tree species in Europe. To demonstrate the effect of an updated monoterpene emission factor for European beech in combination with the consideration of a light and temperature dependent monoterpene emission, we applied a species based model simulation on a European scale. With respect to conventional estimates of the European volatile organic compound budget, the latter simulation resulted in relative increases of 16% by taking solely this tree species into account. On local scales these increases exceeded even more than 100% depending on the respective vegetation area coverage of European beech.

  19. Synthetic cathinone abuse

    Directory of Open Access Journals (Sweden)

    Capriola M

    2013-07-01

    Full Text Available Michael Capriola Thomasville Medical Center, Thomasville, NC, USA Abstract: The abuse of synthetic cathinones, widely known as bath salts, has been increasing since the mid-2000s. These substances are derivatives of the naturally occurring compound cathinone, which is the primary psychoactive component of khat. The toxicity of synthetic cathinones includes significant sympathomimetic effects, as well as psychosis, agitation, aggression, and sometimes violent and bizarre behavior. Mephedrone and methylenedioxypyrovalerone are currently the predominantly abused synthetic cathinones. Keywords: designer drugs/chemistry, street drugs/pharmacology, substance-related disorders/epidemiology, alkaloids/poisoning

  20. Synthetic Base Fluids

    Science.gov (United States)

    Brown, M.; Fotheringham, J. D.; Hoyes, T. J.; Mortier, R. M.; Orszulik, S. T.; Randles, S. J.; Stroud, P. M.

    The chemical nature and technology of the main synthetic lubricant base fluids is described, covering polyalphaolefins, alkylated aromatics, gas-to-liquid (GTL) base fluids, polybutenes, aliphatic diesters, polyolesters, polyalkylene glycols or PAGs and phosphate esters.Other synthetic lubricant base oils such as the silicones, borate esters, perfluoroethers and polyphenylene ethers are considered to have restricted applications due to either high cost or performance limitations and are not considered here.Each of the main synthetic base fluids is described for their chemical and physical properties, manufacture and production, their chemistry, key properties, applications and their implications when used in the environment.

  1. Analysis of Synthetic Polymers.

    Science.gov (United States)

    Smith, Charles G.; And Others

    1989-01-01

    Reviews techniques for the characterization and analysis of synthetic polymers, copolymers, and blends. Includes techniques for structure determination, separation, and quantitation of additives and residual monomers; determination of molecular weight; and the study of thermal properties including degradation mechanisms. (MVL)

  2. Functioned Calix[4]arenes as Artificial Enzymes Catalyze Aldol Condensation

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Aldolase models derived from calix[4]arene were designed and synthesized. The aldol condensation of p-nitrobenzaldehyde with acetone was catalyzed by the synthetic enzymes proceeded under mild conditions to offer chiefly aldol-type product in good yield.

  3. Development of transcriptomic resources for interrogating the biosynthesis of monoterpene indole alkaloids in medicinal plant species.

    Directory of Open Access Journals (Sweden)

    Elsa Góngora-Castillo

    Full Text Available The natural diversity of plant metabolism has long been a source for human medicines. One group of plant-derived compounds, the monoterpene indole alkaloids (MIAs, includes well-documented therapeutic agents used in the treatment of cancer (vinblastine, vincristine, camptothecin, hypertension (reserpine, ajmalicine, malaria (quinine, and as analgesics (7-hydroxymitragynine. Our understanding of the biochemical pathways that synthesize these commercially relevant compounds is incomplete due in part to a lack of molecular, genetic, and genomic resources for the identification of the genes involved in these specialized metabolic pathways. To address these limitations, we generated large-scale transcriptome sequence and expression profiles for three species of Asterids that produce medicinally important MIAs: Camptotheca acuminata, Catharanthus roseus, and Rauvolfia serpentina. Using next generation sequencing technology, we sampled the transcriptomes of these species across a diverse set of developmental tissues, and in the case of C. roseus, in cultured cells and roots following elicitor treatment. Through an iterative assembly process, we generated robust transcriptome assemblies for all three species with a substantial number of the assembled transcripts being full or near-full length. The majority of transcripts had a related sequence in either UniRef100, the Arabidopsis thaliana predicted proteome, or the Pfam protein domain database; however, we also identified transcripts that lacked similarity with entries in either database and thereby lack a known function. Representation of known genes within the MIA biosynthetic pathway was robust. As a diverse set of tissues and treatments were surveyed, expression abundances of transcripts in the three species could be estimated to reveal transcripts associated with development and response to elicitor treatment. Together, these transcriptomes and expression abundance matrices provide a rich resource

  4. β-Citronellol, an alcoholic monoterpene with inhibitory properties on the contractility of rat trachea

    Directory of Open Access Journals (Sweden)

    T.B. Vasconcelos

    2016-01-01

    Full Text Available β-Citronellol is an alcoholic monoterpene found in essential oils such Cymbopogon citratus (a plant with antihypertensive properties. β-Citronellol can act against pathogenic microorganisms that affect airways and, in virtue of the popular use of β-citronellol-enriched essential oils in aromatherapy, we assessed its pharmacologic effects on the contractility of rat trachea. Contractions of isolated tracheal rings were recorded isometrically through a force transducer connected to a data-acquisition device. β-Citronellol relaxed sustained contractions induced by acetylcholine or high extracellular potassium, but half-maximal inhibitory concentrations (IC50 for K+-elicited stimuli were smaller than those for cholinergic contractions. It also inhibited contractions induced by electrical field stimulation or sodium orthovanadate with pharmacologic potency equivalent to that seen against acetylcholine-induced contractions. When contractions were evoked by selective recruitment of Ca2+ from the extracellular medium, β-citronellol preferentially inhibited contractions that involved voltage-operated (but not receptor-operated pathways. β-Citronellol (but not verapamil inhibited contractions induced by restoration of external Ca2+ levels after depleting internal Ca2+ stores with the concomitant presence of thapsigargin and recurrent challenge with acetylcholine. Treatment of tracheal rings with L-NAME, indomethacin or tetraethylammonium did not change the relaxing effects of β-citronellol. Inhibition of transient receptor potential vanilloid subtype 1 (TRPV1 or transient receptor potential ankyrin 1 (TRPA1 receptors with selective antagonists caused no change in the effects of β-citronellol. In conclusion, β-citronellol exerted inhibitory effects on rat tracheal rings, with predominant effects on contractions that recruit Ca2+ inflow towards the cytosol by voltage-gated pathways, whereas it appears less active against contractions elicited by

  5. Antihypertensive effect of auraptene, a monoterpene coumarin from the genus Citrus, upon chronic administration

    Science.gov (United States)

    Razavi, Bibi Marjan; Arasteh, Ebrahim; Imenshahidi, Mohsen; Iranshahi, Mehrdad

    2015-01-01

    Objective(s): Auraptene, a monoterpene coumarin from Citrus species, exhibits cardioprotective effects. In this study, the effects of auraptene administration were investigated on blood pressure of normotensive and desoxycorticosterone acetate (DOCA) salt induced hypertensive rats. Materials and Methods: Five weeks administration of auraptene (2, 4, 8 and 16 mg/kg/day) and nifedipine (0.25, 0.5, 1, 2 and 4 mg/kg/day) in different groups of normotensive and hypertensive rats (at the end of 3 weeks treatment by DOCA salt) was carried out and their effects on mean systolic blood pressure (MSBP) and mean heart rate (MHR) were evaluated using tail cuff method. Results: Our results indicated that chronic administration of auraptene (2, 4, 8 and 16 mg/kg/day) significantly reduced the MSBP in DOCA salt treated rats in a dose and time dependent manner. The percent of decreases in MSBP levels by the highest dose of auraptene (16 mg/kg) at the end of 4 th to 8 th weeks, were 7.00%, 10.78%, 16.07%, 21.28% and 27.54% respectively (P<0.001). Moreover the antihypertensive effect of auraptene was less than nifedipine (ED50 value of nifedipine = 0.7 mg/kg at 8th week and ED50 value of auraptene = 5.64 mg/kg at 8 week). Conclusion: Auraptene considerably reduced MSBP in hypertensive rats, but not in normotensive (normal saline treated) rats. The results of MHR measurement showed that the increase in MHR was not significant in comparison with DOCA treated rats. PMID:25810889

  6. Structurally Related Monoterpenes p-Cymene, Carvacrol and Thymol Isolated from Essential Oil from Leaves of Lippia sidoides Cham. (Verbenaceae Protect Mice against Elastase-Induced Emphysema

    Directory of Open Access Journals (Sweden)

    Ellen Games

    2016-10-01

    Full Text Available Background: Chronic obstructive pulmonary disease (COPD is characterized by irreversible airflow obstruction and inflammation. Natural products, such as monoterpenes, displayed anti-inflammatory and anti-oxidant activities and can be used as a source of new compounds to COPD treatment. Our aim was to evaluate, in an elastase-induced pulmonary emphysema in mice, the effects of and underlying mechanisms of three related natural monoterpenes (p-cymene, carvacrol and thymol isolated from essential oil from leaves Lippia sidoides Cham. (Verbenaceae. Methods: Mices received porcine pancreatic elastase (PPE and were treated with p-cymene, carvacrol, thymol or vehicle 30 min later and again on 7th, 14th and 28th days. Lung inflammatory profile and histological sections were evaluated. Results: In the elastase-instilled animals, the tested monoterpenes reduced alveolar enlargement, macrophages and the levels of IL-1β, IL-6, IL-8 and IL-17 in bronchoalveolar lavage fluid (BALF, and collagen fibers, MMP-9 and p-65-NF-κB-positive cells in lung parenchyma (p < 0.05. All treatments attenuated levels of 8-iso-PGF2α but only thymol was able to reduced exhaled nitric oxide (p < 0.05. Conclusion: Monoterpenes p-cymene, carvacrol and thymol reduced lung emphysema and inflammation in mice. No significant differences among the three monoterpenes treatments were found, suggesting that the presence of hydroxyl group in the molecular structure of thymol and carvacrol do not play a central role in the anti-inflammatory effects.

  7. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  8. Production of Enzymes from Marine Actinobacteria.

    Science.gov (United States)

    Zhao, X Q; Xu, X N; Chen, L Y

    Marine actinobacteria are well recognized for their capabilities to produce valuable natural products, which have great potential for applications in medical, agricultural, and fine chemical industries. In addition to producing unique enzymes responsible for biosynthesis of natural products, many marine actinobacteria also produce hydrolytic enzymes which are able to degrade various biopolymers, such as cellulose, xylan, and chitin. These enzymes are important to produce biofuels and biochemicals of interest from renewable biomass. In this chapter, the recent reports of novel enzymes produced by marine actinobacteria are reviewed, and advanced technologies that can be applied to search for novel marine enzymes as well as for improved enzyme production by marine actinobacteria are summarized, which include ribosome engineering, genome mining, as well as synthetic biology studies. © 2016 Elsevier Inc. All rights reserved.

  9. High-resolution MALDI mass spectrometry imaging of gallotannins and monoterpene glucosides in the root of Paeonia lactiflora

    DEFF Research Database (Denmark)

    Li, Bin; Bhandari, Dhaka Ram; Römpp, Andreas

    2016-01-01

    High-resolution atmospheric-pressure scanning microprobe matrix-assisted laser desorption/ionization mass spectrometry imaging (AP-SMALDI MSI) at 10 μm pixel size was performed to unravel the spatio-chemical distribution of major secondary metabolites in the root of Paeonia lactiflora. The spatial...... distributions of two major classes of bioactive components, gallotannins and monoterpene glucosides, were investigated and visualized at the cellular level in tissue sections of P. lactiflora roots. Accordingly, other primary and secondary metabolites were imaged, including amino acids, carbohydrates, lipids...

  10. Improvement of FK506 production by synthetic biology approaches.

    Science.gov (United States)

    Fu, Li-Feng; Tao, Yang; Jin, Mei-Ying; Jiang, Hui

    2016-12-01

    Synthetic biology has been applied to direct improvement of valuable metabolite productions. Tacrolimus (FK506), a clinically used immunosuppressive agent isolated from many Streptomyces, is produced by fermentation in industry. Here we chose FK506 as an example to review recent progress in improving FK506 production, including enhancing transcription levels of biosynthetic genes, accelerating post-translational modification levels of biosynthetic enzymes, increasing activities of rate limiting enzymes, and rational supplement of limited precursors. FK506 production was increased from 25 % to sevenfold by these synthetic biology approaches.

  11. Directed evolution of aldolases for exploitation in synthetic organic chemistry

    Science.gov (United States)

    Bolt, Amanda; Berry, Alan; Nelson, Adam

    2008-01-01

    This review focuses on the directed evolution of aldolases with synthetically useful properties. Directed evolution has been used to address a number of limitations associated with the use of wild-type aldolases as catalysts in synthetic organic chemistry. The generation of aldolase enzymes with a modified or expanded substrate repertoire is described. Particular emphasis is placed on the directed evolution of aldolases with modified stereochemical properties: such enzymes can be useful catalysts in the stereoselective synthesis of biologically active small molecules. The review also describes some of the fundamental insights into mechanistic enzymology that directed evolution can provide. PMID:18230325

  12. The Synthetic Cannabinoids Phenomenon.

    Science.gov (United States)

    Karila, Laurent; Benyamina, Amine; Blecha, Lisa; Cottencin, Olivier; Billieux, Joël

    2016-01-01

    « Spice » is generally used to describe the diverse types of herbal blends that encompass synthetic cannabinoids on the market. The emergence of smokable herbal products containing synthetic cannabinoids, which mimic the effects of cannabis, appears to become increasingly popular, in the new psychoactive substances landscape. In 2014, the existence of 134 different types of synthetic cannabinoids were reported by the European Union Early Warning System. These drugs are mainly sold online as an alternative to controlled and regulated psychoactive substances. They appear to have a life cycle of about 1-2 years before being replaced by a next wave of products. Legislation controlling these designer drugs has been introduced in many countries with the objective to limit the spread of existing drugs and control potential new analogs. The majority of the synthetic cannabinoids are full agonists at the CB1 receptor and do not contain tobacco or cannabis. They are becoming increasingly popular in adolescents, students and clubbers as an abused substance. Relatively high incidence of adverse effects associated with synthetic cannabinoids use has been documented in the literature. Numerous fatalities linked with their use and abuse have been reported. In this paper, we will review the available data regarding the use and effects of synthetic cannabinoids in humans in order to highlight their impact on public health. To reach this objective, a literature search was performed on two representative databases (Pubmed, Google Scholar), the Erowid Center website (a US non-profit educational organization that provides information about psychoactive plants and chemicals), and various governmental websites. The terms used for the database search were: "synthetic cannabinoids", "spice", "new psychoactive substances", and/or "substance use disorder", and/or "adverse effects", and/or "fatalities". The search was limited to years 2005 to 2016 due to emerging scientific literature at

  13. Monoterpene emissions in response to long-term night-time warming, elevated CO2 and extended summer drought in a temperate heath ecosystem

    DEFF Research Database (Denmark)

    Tiiva, Päivi; Tang, Jing; Michelsen, Anders

    2017-01-01

    Monoterpenes emitted from plants have an important role in atmospheric chemistry through changing atmospheric oxidative capacity, forming new particles and secondary organic aerosols. The emission rates and patterns can be affected by changing climate. In this study, emission responses to six years...... and limonene. The emissions of these three compounds were positively correlated with light, chamber temperature and litter abundance, but negatively correlated with soil temperature. Elevated CO2 tended to decrease the average monoterpene emissions by 40% over the whole growing season, and significantly...... by drought. The inhibition effects of elevated CO2 on emissions were diminished when the treatment was combined with drought or warming. The emission responses to different treatments were not explained by vegetation changes, and the monoterpene emission profile was only moderately related to plant species...

  14. Synthetic biology approaches to fluorinated polyketides.

    Science.gov (United States)

    Thuronyi, Benjamin W; Chang, Michelle C Y

    2015-03-17

    The catalytic diversity of living systems offers a broad range of opportunities for developing new methods to produce small molecule targets such as fuels, materials, and pharmaceuticals. In addition to providing cost-effective and renewable methods for large-scale commercial processes, the exploration of the unusual chemical phenotypes found in living organisms can also enable the expansion of chemical space for discovery of novel function by combining orthogonal attributes from both synthetic and biological chemistry. In this context, we have focused on the development of new fluorine chemistry using synthetic biology approaches. While fluorine has become an important feature in compounds of synthetic origin, the scope of biological fluorine chemistry in living systems is limited, with fewer than 20 organofluorine natural products identified to date. In order to expand the diversity of biosynthetically accessible organofluorines, we have begun to develop methods for the site-selective introduction of fluorine into complex natural products by engineering biosynthetic machinery to incorporate fluorinated building blocks. To gain insight into how both enzyme active sites and metabolic pathways can be evolved to manage and select for fluorinated compounds, we have studied one of the only characterized natural hosts for organofluorine biosynthesis, the soil microbe Streptomyces cattleya. This information provides a template for designing engineered organofluorine enzymes, pathways, and hosts and has allowed us to initiate construction of enzymatic and cellular pathways for the production of fluorinated polyketides.

  15. Synthetic guide star generation

    Science.gov (United States)

    Payne, Stephen A [Castro Valley, CA; Page, Ralph H [Castro Valley, CA; Ebbers, Christopher A [Livermore, CA; Beach, Raymond J [Livermore, CA

    2008-06-10

    A system for assisting in observing a celestial object and providing synthetic guide star generation. A lasing system provides radiation at a frequency at or near 938 nm and radiation at a frequency at or near 1583 nm. The lasing system includes a fiber laser operating between 880 nm and 960 nm and a fiber laser operating between 1524 nm and 1650 nm. A frequency-conversion system mixes the radiation and generates light at a frequency at or near 589 nm. A system directs the light at a frequency at or near 589 nm toward the celestial object and provides synthetic guide star generation.

  16. VOC measurements within a boreal forest during spring 2005: the role of monoterpenes and sulphuric acid in selected intense nucleation events

    Directory of Open Access Journals (Sweden)

    G. Eerdekens

    2009-06-01

    Full Text Available In this study we present measurements of selected trace gases and aerosol made in a boreal forest during the BACCI-QUEST IV intensive field campaign in Hyytiälä, Finland in April 2005. Several clear aerosol "nucleation events" were observed and characterized. One type of "event" occurred synchronously with huge increases in monoterpenes, while a second event type correlated instead with sulphuric acid. Here we elucidate the origin of these two distinct forms of aerosol production at the Hyytiälä site using the measurement data, airmass back trajectories and the optical stereoisomery of monoterpenes.

  17. Formulation of sage essential oil (Salvia officinalis, L.) monoterpenes into chitosan hydrogels and permeation study with GC-MS analysis.

    Science.gov (United States)

    Kodadová, Alexandra; Vitková, Zuzana; Herdová, Petra; Ťažký, Anton; Oremusová, Jarmila; Grančai, Daniel; Mikuš, Peter

    2015-01-01

    This study deals with the formulation of natural drugs into hydrogels. For the first time, compounds from the sage essential oil were formulated into chitosan hydrogels. A sample preparation procedure for hydrophobic volatile analytes present in a hydrophilic water matrix along with an analytical method based on the gas chromatography coupled with the mass spectrometry (GC-MS) was developed and applied for the evaluation of the identity and quantity of essential oil components in the hydrogels and saline samples. The experimental results revealed that the chitosan hydrogels are suitable for the formulation of sage essential oil. The monoterpene release can be effectively controlled by both chitosan and caffeine concentration in the hydrogels. Permeation experiment, based on a hydrogel with the optimized composition [3.5% (w/w) sage essential oil, 2.0% (w/w) caffeine, 2.5% (w/w) chitosan and 0.1% (w/w) Tween-80] in donor compartment, saline solution in acceptor compartment, and semi-permeable cellophane membrane, demonstrated the useful permeation selectivity. Here, (according to lipophilicity) an enhanced permeation of the bicyclic monoterpenes with antiflogistic and antiseptic properties (eucalyptol, camphor and borneol) and, at the same time, suppressed permeation of toxic thujone (not exceeding its permitted applicable concentration) was observed. These properties highlight the pharmaceutical importance of the developed chitosan hydrogel formulating sage essential oil in the dermal applications.

  18. In vitro inhibition of the bovine viral diarrhoea virus by the essential oil of Ocimum basilicum (basil) and monoterpenes.

    Science.gov (United States)

    Kubiça, Thaís F; Alves, Sydney H; Weiblen, Rudi; Lovato, Luciane T

    2014-01-01

    The bovine viral diarrhoea virus (BVDV) is suggested as a model for antiviral studies of the hepatitis C virus (HCV). The antiviral activity of the essential oil of Ocimum basilicum and the monoterpenes camphor, thymol and 1,8-cineole against BVDV was investigated. The cytotoxicities of the compounds were measured by the MTT (3-(4.5-dimethylthiazol-2-yl)-2.5-diphenyltetrazolium bromide) test, and the antiviral activities were tested by the plaque reduction assay. The oil or compounds were added to the assay in three different time points: a) pre-treatment of the virus (virucidal assay); b) pre-treatment of the cells; or c) post-treatment of the cells (after virus inoculation). The percentage of plaques inhibition for each compound was determined based on the number of plaques in the viral control. The results were expressed by CC50 (50% cytotoxic concentration), IC50 (inhibitory concentration for 50% of plaques) and SI (selectivity index = CC50/IC50). Camphor (CC50 = 4420.12 μg mL(-1)) and 1,8-cineole (CC50 = 2996.10 μg mL(-1)) showed the lowest cytotoxicities and the best antiviral activities (camphor SI = 13.88 and 1,8-cineol SI = 9.05) in the virucidal assay. The higher activities achieved by the monoterpenes in the virucidal assay suggest that these compounds act directly on the viral particle.

  19. Synthetic Aperture Radar Interferometry

    Science.gov (United States)

    Rosen, P. A.; Hensley, S.; Joughin, I. R.; Li, F.; Madsen, S. N.; Rodriguez, E.; Goldstein, R. M.

    1998-01-01

    Synthetic aperture radar interferometry is an imaging technique for measuring the topography of a surface, its changes over time, and other changes in the detailed characteristics of the surface. This paper reviews the techniques of interferometry, systems and limitations, and applications in a rapidly growing area of science and engineering.

  20. Biodegradable synthetic bone composites

    Science.gov (United States)

    Liu, Gao; Zhao, Dacheng; Saiz, Eduardo; Tomsia, Antoni P.

    2013-01-01

    The invention provides for a biodegradable synthetic bone composition comprising a biodegradable hydrogel polymer scaffold comprising a plurality of hydrolytically unstable linkages, and an inorganic component; such as a biodegradable poly(hydroxyethylmethacrylate)/hydroxyapatite (pHEMA/HA) hydrogel composite possessing mineral content approximately that of human bone.

  1. Synthetic growth reference charts

    NARCIS (Netherlands)

    Hermanussen, Michael; Stec, Karol; Aßmann, Christian; Meigen, Christof; Van Buuren, Stef

    2016-01-01

    Objectives: To reanalyze the between-population variance in height, weight, and body mass index (BMI), and to provide a globally applicable technique for generating synthetic growth reference charts. Methods: Using a baseline set of 196 female and 197 male growth studies published since 1831, common

  2. Synthetic studies towards bottromycin

    Directory of Open Access Journals (Sweden)

    Stefanie Ackermann

    2012-10-01

    Full Text Available Thio-Ugi reactions are described as an excellent synthetic tool for the synthesis of sterically highly hindered endothiopeptides. S-Methylation and subsequent amidine formation can be carried out in an inter- as well as in an intramolecular fashion. The intramolecular approach allows the synthesis of the bottromycin ring system in a straightforward manner.

  3. Molecularly imprinted polymers: synthetic receptors in bioanalysis.

    Science.gov (United States)

    Tse Sum Bui, Bernadette; Haupt, Karsten

    2010-11-01

    Molecularly imprinted polymers (MIPs) are tailor-made synthetic materials possessing specific cavities designed for a target molecule. Since they recognise their target analyte with affinities and selectivities comparable to those of antibody-antigen, enzyme-substrate and ligand-receptor interactions, they are often referred to as synthetic receptors or plastic antibodies. In this review, we describe the great potential and recent developments of MIPs in affinity separations, with emphasis on their application to the solid-phase extraction (SPE) of analytes from complex matrices. Research efforts made in this field to obtain water-compatible polymers for their applicability in aqueous environments are described. We particularly discuss problems encountered in the use of MIPs in SPE and the attempts carried out to improve their efficiency.

  4. Library design and screening strategies for efficient enzyme evolution

    NARCIS (Netherlands)

    van Leeuwen, Johannes Gustaaf Ernst

    2015-01-01

    Enzymes are the catalysts of nature and they facilitate thousands of chemical conversions in living organisms. Enzymes work in an aqueous environment at neutral pH and ambient temperature. Such mild reaction conditions are also highly advantageous for synthetic organic synthesis because this can

  5. Synthetic Plant Defense Elicitors

    Directory of Open Access Journals (Sweden)

    Yasemin eBektas

    2015-01-01

    Full Text Available To defend themselves against invading pathogens plants utilize a complex regulatory network that coordinates extensive transcriptional and metabolic reprogramming. Although many of the key players of this immunity-associated network are known, the details of its topology and dynamics are still poorly understood. As an alternative to forward and reverse genetic studies, chemical genetics-related approaches based on bioactive small molecules have gained substantial popularity in the analysis of biological pathways and networks. Use of such molecular probes can allow researchers to access biological space that was previously inaccessible to genetic analyses due to gene redundancy or lethality of mutations. Synthetic elicitors are small drug like molecules that induce plant defense responses, but are distinct from known natural elicitors of plant immunity. While the discovery of the some synthetic elicitors had already been reported in the 1970s, recent breakthroughs in combinatorial chemical synthesis now allow for inexpensive high-throughput screens for bioactive plant defense-inducing compounds. Along with powerful reverse genetics tools and resources available for model plants and crop systems, comprehensive collections of new synthetic elicitors will likely allow plant scientists to study the intricacies of plant defense signaling pathways and networks in an unparalleled fashion. As synthetic elicitors can protect crops from diseases, without the need to be directly toxic for pathogenic organisms, they may also serve as promising alternatives to conventional biocidal pesticides, which often are harmful for the environment, farmers and consumers. Here we are discussing various types of synthetic elicitors that have been used for studies on the plant immune system, their modes-of-action as well as their application in crop protection.

  6. Synthetic River Valleys

    Science.gov (United States)

    Brown, R.; Pasternack, G. B.

    2011-12-01

    The description of fluvial form has evolved from anecdotal descriptions to artistic renderings to 2D plots of cross section or longitudinal profiles and more recently 3D digital models. Synthetic river valleys, artificial 3D topographic models of river topography, have a plethora of potential applications in fluvial geomorphology, and the earth sciences in general, as well as in computer science and ecology. Synthetic river channels have existed implicitly since approximately the 1970s and can be simulated from a variety of approaches spanning the artistic and numerical. An objective method of synthesizing 3D stream topography based on reach scale attributes would be valuable for sizing 3D flumes in the physical and numerical realms, as initial input topography for morphodynamic models, stream restoration design, historical reconstruction, and mechanistic testing of interactions of channel geometric elements. Quite simply - simulation of synthetic channel geometry of prescribed conditions can allow systematic evaluation of the dominant relationships between river flow and geometry. A new model, the control curve method, is presented that uses hierarchically scaled parametric curves in over-lapping 2D planes to create synthetic river valleys. The approach is able to simulate 3D stream geometry from paired 2D descriptions and can allow experimental insight into form-process relationships in addition to visualizing past measurements of channel form that are limited to two dimension descriptions. Results are presented that illustrate the models ability to simulate fluvial topography representative of real world rivers as well as how channel geometric elements can be adjusted. The testing of synthetic river valleys would open up a wealth of knowledge as to why some 3D attributes of river channels are more prevalent than others as well as bridging the gap between the 2D descriptions that have dominated fluvial geomorphology the past century and modern, more complete, 3D

  7. Studies on the incorporation of lipase in synthetic polymerisable vesicles.

    NARCIS (Netherlands)

    Mosmuller, E.W.J.

    1993-01-01

    This thesis describes studies on the suitability of synthetic polymerisable vesicles for the incorporation and stabilisation of lipase for the bioconversion of organic chemical compounds.In chapter 1 , some characteristics are reviewed of hydrolytic enzymes, and more specific those

  8. Reinvigorating natural product combinatorial biosynthesis with synthetic biology.

    Science.gov (United States)

    Kim, Eunji; Moore, Bradley S; Yoon, Yeo Joon

    2015-09-01

    Natural products continue to play a pivotal role in drug-discovery efforts and in the understanding if human health. The ability to extend nature's chemistry through combinatorial biosynthesis--altering functional groups, regiochemistry and scaffold backbones through the manipulation of biosynthetic enzymes--offers unique opportunities to create natural product analogs. Incorporating emerging synthetic biology techniques has the potential to further accelerate the refinement of combinatorial biosynthesis as a robust platform for the diversification of natural chemical drug leads. Two decades after the field originated, we discuss the current limitations, the realities and the state of the art of combinatorial biosynthesis, including the engineering of substrate specificity of biosynthetic enzymes and the development of heterologous expression systems for biosynthetic pathways. We also propose a new perspective for the combinatorial biosynthesis of natural products that could reinvigorate drug discovery by using synthetic biology in combination with synthetic chemistry.

  9. Survey of foliar monoterpenes across the range of jack pine reveal three widespread chemotypes: implications to host expansion of invasive mountain pine beetle

    Directory of Open Access Journals (Sweden)

    Spencer eTaft

    2015-05-01

    Full Text Available The secondary compounds of pines (Pinus can strongly affect the physiology, ecology and behaviors of the bark beetles (Coleoptera: Curculionidae, Scolytinae that feed on sub-cortical tissues of hosts. Jack pine (Pinus banksiana has a wide natural distribution range in North America (Canada and USA and thus variations in its secondary compounds, particularly monoterpenes, could affect the host expansion of invasive mountain pine beetle (Dendroctonus ponderosae, which has recently expanded its range into the novel jack pine boreal forest. We investigated monoterpene composition of 601 jack pine trees from natural and provenance forest stands representing 63 populations from Alberta to the Atlantic coast. Throughout its range, jack pine exhibited three chemotypes characterized by high proportions of α-pinene, β-pinene, or limonene. The frequency with which the α-pinene and β-pinene chemotypes occurred at individual sites was correlated to climatic variables, such as continentality and mean annual precipitation, as were the individual α-pinene and β-pinene concentrations. However, other monoterpenes were generally not correlated to climatic variables or geographic distribution. Finally, while the enantiomeric ratios of β-pinene and limonene remained constant across jack pine’s distribution, (‒:(+-α-pinene exhibited two separate trends, thereby delineating two α-pinene phenotypes, both of which occurred across jack pine’s range. These significant variations in jack pine monoterpene composition may have cascading effects on the continued eastward spread and success of D. ponderosae in the Canadian boreal forest.

  10. Significant light and temperature dependent monoterpene emissions from European beech (fagus sylvatiga L.) and their potential impact on the European VOC budget

    NARCIS (Netherlands)

    Dindorf, T.; Kuhn, U.; Ganzeveld, L.N.; Schebeske, G.; Ciccioli, P.; Holzke, C.; Köble, R.; Seufert, G.; Kesselmeier, J.

    2006-01-01

    By using a dynamic branch enclosure system the emission of monoterpenes from European beech (Fagus sylvatica L.) was investigated during two consecutive summer vegetation periods in the years of 2002 and 2003 in Germany. All measurements were performed under field conditions within the framework of

  11. The Differential Effects of the Blue-Stain Fungus Leptographium qinlingensis on Monoterpenes and Sesquiterpenes in the Stem of Chinese White Pine (Pinus armandi Saplings

    Directory of Open Access Journals (Sweden)

    Thanh Pham

    2014-11-01

    Full Text Available When conifers such as Chinese white pine (Pinus armandi Fr. are attacked by insects or pathogens, they respond by increasing their content of monoterpenes and sesquiterpenes. In this study, we determined the effects of the blue-stain fungus Leptographium qinlingensis Tang and Chen on monoterpenes and sesquiterpenes in the phloem and xylem of the stem of P. armandi saplings. We found that the total monoterpene concentrations in the phloem and xylem of the stem and the total sesquiterpene concentrations in the xylem of the stem were significantly higher in L. qinlingensis-inoculated saplings than in control (mechanically wounded saplings or untreated saplings. Additionally, the proportions of β-pinene in the xylem of the stem and limonene + β-phellandrene in the phloem and xylem of the stem were significantly higher in L. qinlingensis-inoculated saplings than in both control and untreated saplings. The proportions of individual sesquiterpenes in the phloem and xylem of the stem were significantly greater in L. qinlingensis-inoculated saplings than in untreated saplings. Based on the results of this study, we suggest that increases in total monoterpene and sesquiterpene concentrations, as well as increases in the concentrations of β-pinene and limonene + β-phellandrene, may play an important defensive role against blue-stain fungus L. qinlingensis inoculation.

  12. WET AND DRY SEASON ECOSYSTEM LEVEL FLUXES OF ISOPRENE AND MONOTERPENES FROM A SOUTHEAST ASIAN SECONDARY FOREST AND RUBBER TREE PLANTATION

    Science.gov (United States)

    Canopy scale fluxes of isoprene and monoterpenes were investigated in both wet and dry seasons above a rubber tree (Hevea brasiliensis)/secondary tropical forest in the Yunnan province of southwestern China. Drought conditions were unusually high during the dry season experiment....

  13. Challenges in modelling isoprene and monoterpene emission dynamics of Arctic plants: a case study from a subarctic tundra heath

    Science.gov (United States)

    Tang, Jing; Schurgers, Guy; Valolahti, Hanna; Faubert, Patrick; Tiiva, Päivi; Michelsen, Anders; Rinnan, Riikka

    2016-12-01

    The Arctic is warming at twice the global average speed, and the warming-induced increases in biogenic volatile organic compounds (BVOCs) emissions from Arctic plants are expected to be drastic. The current global models' estimations of minimal BVOC emissions from the Arctic are based on very few observations and have been challenged increasingly by field data. This study applied a dynamic ecosystem model, LPJ-GUESS, as a platform to investigate short-term and long-term BVOC emission responses to Arctic climate warming. Field observations in a subarctic tundra heath with long-term (13-year) warming treatments were extensively used for parameterizing and evaluating BVOC-related processes (photosynthesis, emission responses to temperature and vegetation composition). We propose an adjusted temperature (T) response curve for Arctic plants with much stronger T sensitivity than the commonly used algorithms for large-scale modelling. The simulated emission responses to 2 °C warming between the adjusted and original T response curves were evaluated against the observed warming responses (WRs) at short-term scales. Moreover, the model responses to warming by 4 and 8 °C were also investigated as a sensitivity test. The model showed reasonable agreement to the observed vegetation CO2 fluxes in the main growing season as well as day-to-day variability of isoprene and monoterpene emissions. The observed relatively high WRs were better captured by the adjusted T response curve than by the common one. During 1999-2012, the modelled annual mean isoprene and monoterpene emissions were 20 and 8 mg C m-2 yr-1, with an increase by 55 and 57 % for 2 °C summertime warming, respectively. Warming by 4 and 8 °C for the same period further elevated isoprene emission for all years, but the impacts on monoterpene emissions levelled off during the last few years. At hour-day scale, the WRs seem to be strongly impacted by canopy air T, while at the day-year scale, the WRs are a combined

  14. Why are estimates of global terrestrial isoprene emissions so similar (and why is this not so for monoterpenes)?

    Science.gov (United States)

    Arneth, A.; Monson, R. K.; Schurgers, G.; Niinemets, É.; Palmer, P. I.

    2008-08-01

    Emissions of biogenic volatile organic compounds (BVOC) are a chief uncertainty in calculating the burdens of important atmospheric compounds like tropospheric ozone or secondary organic aerosol, reflecting either imperfect chemical oxidation mechanisms or unreliable emission estimates, or both. To provide a starting point for a more systematic discussion we review here global isoprene and monoterpene emission estimates to-date. We note a surprisingly small variation in the predictions of global isoprene emission rate that is in stark contrast with our lack of process understanding and the small number of observations for model parameterisation and evaluation. Most of the models are based on similar emission algorithms, using fixed values for the emission capacity of various plant functional types. In some cases, these values are very similar but differ substantially in other models. The similarities with regard to the global isoprene emission rate would suggest that the dominant parameters driving the ultimate global estimate, and thus the dominant determinant of model sensitivity, are the specific emission algorithm and isoprene emission capacity. But the models also differ broadly with regard to their representation of net primary productivity, method of biome coverage determination and climate data. Contrary to isoprene, monoterpene estimates show significantly larger model-to-model variation although variation in terms of leaf algorithm, emission capacities, the way of model upscaling, vegetation cover or climatology used in terpene models are comparable to those used for isoprene. From our summary of published studies there appears to be no evidence that the terrestrial modelling community has been any more successful in "resolving unknowns" in the mechanisms that control global isoprene emissions, compared to global monoterpene emissions. Rather, the proliferation of common parameterization schemes within a large variety of model platforms lends the illusion

  15. Why are estimates of global isoprene emissions so similar (and why is this not so for monoterpenes)?

    Science.gov (United States)

    Arneth, A.; Monson, R. K.; Schurgers, G.; Niinemets, Ü.; Palmer, P. I.

    2008-04-01

    Emissions of biogenic volatile organic compounds (BVOC) are a chief uncertainty in calculating the burdens of important atmospheric compounds like tropospheric ozone or secondary organic aerosol, reflecting either imperfect chemical oxidation mechanisms or unreliable emission estimates, or both. To provide a starting point for a more systematic discussion we review here global isoprene and monoterpene emission estimates to-date. We note a surprisingly small variation in the predictions of global isoprene emission rate that is in stark contrast with our lack of process understanding and the small number of observations for model parameterisation and evaluation. Most of the models are based on similar emission algorithms, using fixed values for the emission capacity of various plant functional types. In some studies these values are very similar, but they differ substantially in others. The models differ also broadly with regard to their representation of net primary productivity, method of biome coverage determination and climate data. Their similarities with regard to the global isoprene emission rate would suggest that the dominant parameters driving the ultimate global estimate, and thus the dominant determinant of model sensitivity, are the specific emission algorithm and isoprene emission capacity. Contrary to isoprene, monoterpene estimates show significantly larger model-to-model variation although variation in terms of leaf algorithm, emission capacities, the way of model upscaling, vegetation cover or climatology used in terpene models are comparable to those used for isoprene. From our summary of published studies there appears to be no evidence that the terrestrial modelling community has been any more successful in "resolving unknowns" in the mechanisms that control global isoprene emissions, compared to global monoterpene emissions. Rather, the proliferation of common parameterization schemes within a large variety of model platforms lends the illusion

  16. Why are estimates of global isoprene emissions so similar (and why is this not so for monoterpenes?

    Directory of Open Access Journals (Sweden)

    A. Arneth

    2008-04-01

    Full Text Available Emissions of biogenic volatile organic compounds (BVOC are a chief uncertainty in calculating the burdens of important atmospheric compounds like tropospheric ozone or secondary organic aerosol, reflecting either imperfect chemical oxidation mechanisms or unreliable emission estimates, or both. To provide a starting point for a more systematic discussion we review here global isoprene and monoterpene emission estimates to-date. We note a surprisingly small variation in the predictions of global isoprene emission rate that is in stark contrast with our lack of process understanding and the small number of observations for model parameterisation and evaluation. Most of the models are based on similar emission algorithms, using fixed values for the emission capacity of various plant functional types. In some studies these values are very similar, but they differ substantially in others. The models differ also broadly with regard to their representation of net primary productivity, method of biome coverage determination and climate data. Their similarities with regard to the global isoprene emission rate would suggest that the dominant parameters driving the ultimate global estimate, and thus the dominant determinant of model sensitivity, are the specific emission algorithm and isoprene emission capacity. Contrary to isoprene, monoterpene estimates show significantly larger model-to-model variation although variation in terms of leaf algorithm, emission capacities, the way of model upscaling, vegetation cover or climatology used in terpene models are comparable to those used for isoprene. From our summary of published studies there appears to be no evidence that the terrestrial modelling community has been any more successful in "resolving unknowns" in the mechanisms that control global isoprene emissions, compared to global monoterpene emissions. Rather, the proliferation of common parameterization schemes within a large variety of model platforms

  17. Why are estimates of global terrestrial isoprene emissions so similar (and why is this not so for monoterpenes?

    Directory of Open Access Journals (Sweden)

    A. Arneth

    2008-08-01

    Full Text Available Emissions of biogenic volatile organic compounds (BVOC are a chief uncertainty in calculating the burdens of important atmospheric compounds like tropospheric ozone or secondary organic aerosol, reflecting either imperfect chemical oxidation mechanisms or unreliable emission estimates, or both. To provide a starting point for a more systematic discussion we review here global isoprene and monoterpene emission estimates to-date. We note a surprisingly small variation in the predictions of global isoprene emission rate that is in stark contrast with our lack of process understanding and the small number of observations for model parameterisation and evaluation. Most of the models are based on similar emission algorithms, using fixed values for the emission capacity of various plant functional types. In some cases, these values are very similar but differ substantially in other models. The similarities with regard to the global isoprene emission rate would suggest that the dominant parameters driving the ultimate global estimate, and thus the dominant determinant of model sensitivity, are the specific emission algorithm and isoprene emission capacity. But the models also differ broadly with regard to their representation of net primary productivity, method of biome coverage determination and climate data. Contrary to isoprene, monoterpene estimates show significantly larger model-to-model variation although variation in terms of leaf algorithm, emission capacities, the way of model upscaling, vegetation cover or climatology used in terpene models are comparable to those used for isoprene. From our summary of published studies there appears to be no evidence that the terrestrial modelling community has been any more successful in "resolving unknowns" in the mechanisms that control global isoprene emissions, compared to global monoterpene emissions. Rather, the proliferation of common parameterization schemes within a large variety of model platforms

  18. Effects of Acute Ozone Exposure and Methyl Jasmonate Treatment on White Pine Monoterpene and Sesquiterpene Emission Rates

    Science.gov (United States)

    Faiola, C. L.; Wagner, D.; Allwine, E.; Harley, P. C.; Vanreken, T. M.

    2010-12-01

    Biogenic volatile organic compounds (BVOCs) are produced by plants and include monoterpenes, sesquiterpenes, and their oxygenated derivatives. These BVOCs are one of the principal factors influencing the oxidative capacity of the atmosphere in forested regions, and impact both ozone concentration and secondary organic aerosol formation. Under unstressed conditions, the release of BVOCs to the atmosphere is primarily controlled by the vapor pressure of the relevant compounds within the plant tissue, which is in turn dependent on temperature as well as complex biochemical production processes. However, various natural and anthropogenic stressors can alter both the quantity and composition of the BVOCs emitted by plants. Many potential stressors are expected to become stronger as climate change effects escalate. The impacts of most stressors on BVOC emissions have not been well characterized, particularly in a field setting where changes in BVOC emissions could have influential feedbacks with climate. This study investigated the effects of two stressors on monoterpene and sesquiterpene emission rates at a field site in northern Michigan: acute ozone exposure and treatment with methyl jasmonate, an herbivory proxy. The study included six repetitions of the same experiment, each time using a new set of sub-canopy eastern white pine specimens. For each experiment, dynamic branch enclosures were simultaneously used on three specimens for sample collection: one ozone treatment tree, one methyl jasmonate treatment tree, and one control tree. Sampling lines were placed in each enclosure and VOCs were collected onto cartridges packed with Tenax GR adsorbent. Samples were collected several times per day for at least two days before treatment and for five days after treatment. Cartridges were analyzed via thermodesorption with an Agilent GC/MS/FID. This analysis allowed the identification and quantification of several monoterpene and sesquiterpene species in the samples

  19. Hydrolysis of synthetic mixed-acid phosphatides by phospholipase A from human pancreas

    NARCIS (Netherlands)

    Deenen, L.L.M. van; Haas, Gerard H. de; Heemskerk, C.H.Th.

    1963-01-01

    An investigation was made into the action of a human pancreatic phospholipase A on various synthetic phosphatides. L-α-Phosphatidyl ethanolamines were readily hydrolysed in an aqueous system by this enzyme. Synthetic lecithins, however, were not attacked in an appreciable rate by the mammalian phosp

  20. Hydrolysis of synthetic mixed-acid phosphatides by phospholipase A from human pancreas

    NARCIS (Netherlands)

    Deenen, L.L.M. van; Haas, Gerard H. de; Heemskerk, C.H.Th.

    1963-01-01

    An investigation was made into the action of a human pancreatic phospholipase A on various synthetic phosphatides. L-α-Phosphatidyl ethanolamines were readily hydrolysed in an aqueous system by this enzyme. Synthetic lecithins, however, were not attacked in an appreciable rate by the mammalian phosp

  1. Hydrolysis of synthetic mixed-acid phosphatides by phospholipase A from human pancreas

    NARCIS (Netherlands)

    Deenen, L.L.M. van; Haas, Gerard H. de; Heemskerk, C.H.Th.

    1963-01-01

    An investigation was made into the action of a human pancreatic phospholipase A on various synthetic phosphatides. L-α-Phosphatidyl ethanolamines were readily hydrolysed in an aqueous system by this enzyme. Synthetic lecithins, however, were not attacked in an appreciable rate by the mammalian

  2. An intercomparison of GC-FID and PTR-MS toluene measurements in ambient air under conditions of enhanced monoterpene loading

    Directory of Open Access Journals (Sweden)

    J. L. Ambrose

    2010-01-01

    Full Text Available Toluene was measured using both a gas chromatographic system (GC, with a flame ionization detector (FID, and a proton transfer reaction-mass spectrometer (PTR-MS at the AIRMAP atmospheric monitoring station Thompson Farm (THF in rural Durham, NH during the summer of 2004. Simultaneous measurements of monoterpenes, including α- and β-pinene, camphene, Δ3-carene, and d-limonene, by GC-FID demonstrated large enhancements in monoterpene mixing ratios relative to toluene, with median and maximum enhancement ratios of ~2 and ~30, respectively. A detailed intercomparison among the GC-FID and PTR-MS toluene measurements was conducted to test the specificity of PTR-MS for atmospheric toluene measurements under conditions often dominated by biogenic emissions. We derived quantitative estimates of potential interferences in the PTR-MS toluene measurements related to sampling and analysis of monoterpenes, including fragmentation of the monoterpenes and some of their primary carbonyl oxidation products via reactions with H3O+, O2+ and NO+ in the PTR-MS drift tube. The PTR-MS and GC-FID toluene measurements were in good quantitative agreement and the two systems tracked one another well from the instrumental limits of detection to maximum mixing ratios of ~0.5 ppbv. Discrepancies in the measured mixing ratios were not well correlated with enhancements in the monoterpenes. Better quantitative agreement between the two systems was obtained by correcting the PTR-MS measurements for contributions from monoterpene fragmentation in the PTR-MS drift tube; however, the improvement was minor. Interferences in the PTR-MS measurements from fragmentation of the monoterpene oxidation products pinonaldehyde, caronaldehyde and α-pinene oxide were also likely negligible. The results from THF suggest that toluene can be reliably quantified by PTR-MS using our operating conditions under the ambient

  3. These Synthetic Times

    Institute of Scientific and Technical Information of China (English)

    KIT GILLET

    2008-01-01

    @@ Already slated to be one of the most important cultural events in the buildup to this summer's Olympic games, Synthetic Times-Media Art China 2008 will feature the works of more than 30 artists from around the world. Upwards of 40 media art installations will be exhibited in the National Art Museum of China alone, along with performances, workshops, presentations, and discussion panels focusing on the art works and the growth of media art as a discipline.

  4. Synthetic gases production

    Energy Technology Data Exchange (ETDEWEB)

    Mazaud, J.P.

    1996-06-01

    The natural gas or naphtha are the main constituents used for the production of synthetic gases. Several production ways of synthetic gases are industrially used as for example the natural gas or naphtha catalytic reforming, the selective oxidation of natural gas or heavy fuels and the coal oxy-vapo-gasification. The aim of this work is to study the different steps of production and treatment of the synthetic gases by the way of catalytic reforming. The first step is the desulfurization of the hydrocarbons feedstocks. The process used in industry is described. Then is realized the catalytic hydrocarbons reforming process. After having recalled some historical data on the catalytic reforming, the author gives the reaction kinetics and thermodynamics. The possible reforming catalysts, industrial equipments and furnaces designs are then exposed. The carbon dioxide is a compound easily obtained during the reforming reactions. It is a wasteful and harmful component which has to be extracted of the gaseous stream. The last step is then the gases de-carbonation. Two examples of natural gas or naphtha reforming reactions are at last given: the carbon monoxide conversion by steam and the carbon oxides reactions with hydrogen (methanization). (O.M.). 8 figs., 6 tabs.

  5. Synthetic biology in plastids.

    Science.gov (United States)

    Scharff, Lars B; Bock, Ralph

    2014-06-01

    Plastids (chloroplasts) harbor a small gene-dense genome that is amenable to genetic manipulation by transformation. During 1 billion years of evolution from the cyanobacterial endosymbiont to present-day chloroplasts, the plastid genome has undergone a dramatic size reduction, mainly as a result of gene losses and the large-scale transfer of genes to the nuclear genome. Thus the plastid genome can be regarded as a naturally evolved miniature genome, the gradual size reduction and compaction of which has provided a blueprint for the design of minimum genomes. Furthermore, because of the largely prokaryotic genome structure and gene expression machinery, the high transgene expression levels attainable in transgenic chloroplasts and the very low production costs in plant systems, the chloroplast lends itself to synthetic biology applications that are directed towards the efficient synthesis of green chemicals, biopharmaceuticals and other metabolites of commercial interest. This review describes recent progress with the engineering of plastid genomes with large constructs of foreign or synthetic DNA, and highlights the potential of the chloroplast as a model system in bottom-up and top-down synthetic biology approaches.

  6. The use of natural and synthetic phospholipids as pharmaceutical excipients*

    Science.gov (United States)

    van Hoogevest, Peter; Wendel, Armin

    2014-01-01

    In pharmaceutical formulations, phospholipids obtained from plant or animal sources and synthetic phospholipids are used. Natural phospholipids are purified from, e.g., soybeans or egg yolk using non-toxic solvent extraction and chromatographic procedures with low consumption of energy and minimum possible waste. Because of the use of validated purification procedures and sourcing of raw materials with consistent quality, the resulting products differing in phosphatidylcholine content possess an excellent batch to batch reproducibility with respect to phospholipid and fatty acid composition. The natural phospholipids are described in pharmacopeias and relevant regulatory guidance documentation of the Food and Drug Administration (FDA) and European Medicines Agency (EMA). Synthetic phospholipids with specific polar head group, fatty acid composition can be manufactured using various synthesis routes. Synthetic phospholipids with the natural stereochemical configuration are preferably synthesized from glycerophosphocholine (GPC), which is obtained from natural phospholipids, using acylation and enzyme catalyzed reactions. Synthetic phospholipids play compared to natural phospholipid (including hydrogenated phospholipids), as derived from the number of drug products containing synthetic phospholipids, a minor role. Only in a few pharmaceutical products synthetic phospholipids are used. Natural phospholipids are used in oral, dermal, and parenteral products including liposomes. Natural phospholipids instead of synthetic phospholipids should be selected as phospholipid excipients for formulation development, whenever possible, because natural phospholipids are derived from renewable sources and produced with more ecologically friendly processes and are available in larger scale at relatively low costs compared to synthetic phospholipids. Practical applications: For selection of phospholipid excipients for pharmaceutical formulations, natural phospholipids are preferred

  7. Opportunities in plant synthetic biology.

    Science.gov (United States)

    Cook, Charis; Martin, Lisa; Bastow, Ruth

    2014-05-01

    Synthetic biology is an emerging field uniting scientists from all disciplines with the aim of designing or re-designing biological processes. Initially, synthetic biology breakthroughs came from microbiology, chemistry, physics, computer science, materials science, mathematics, and engineering disciplines. A transition to multicellular systems is the next logical step for synthetic biologists and plants will provide an ideal platform for this new phase of research. This meeting report highlights some of the exciting plant synthetic biology projects, and tools and resources, presented and discussed at the 2013 GARNet workshop on plant synthetic biology.

  8. Synthetic cannabis and respiratory depression.

    Science.gov (United States)

    Jinwala, Felecia N; Gupta, Mayank

    2012-12-01

    In recent years, synthetic cannabis use has been increasing in appeal among adolescents, and its use is now at a 30 year peak among high school seniors. The constituents of synthetic cannabis are difficult to monitor, given the drug's easy accessibility. Currently, 40 U.S. states have banned the distribution and use of some known synthetic cannabinoids, and have included these drugs in the Schedule I category. The depressive respiratory effect in humans caused by synthetic cannabis inhalation has not been thoroughly investigated in the medical literature. We are the first to report, to our knowledge, two cases of self-reported synthetic cannabis use leading to respiratory depression and necessary intubation.

  9. Plant glyco-biotechnology on the way to synthetic biology

    Directory of Open Access Journals (Sweden)

    Andreas eLoos

    2014-10-01

    Full Text Available Plants are increasingly being used for the production of recombinant proteins. One reason is that plants are highly amenable for glycan engineering processes and allow the production of therapeutic proteins with increased efficacies due to optimized glycosylation profiles. Removal and insertion of glycosylation reactions by knock-out/knock-down approaches and introduction of glycosylation enzymes have paved the way for the humanization of the plant glycosylation pathway. The insertion of heterologous enzymes at exactly the right stage of the existing glycosylation pathway has turned out to be of utmost importance for optimal results. To enable such precise targeting chimeric enzymes have been constructed. In this short review we will exemplify the importance of correct targeting of glycosyltransferases, we will give an overview of the targeting mechanism of glycosyltransferases, describe chimeric enzymes used in plant N-glycosylation engineering and illustrate how plant glycoengineering builds on the tools offered by synthetic biology to construct such chimeric enzymes.

  10. Enzyme detection by microfluidics

    DEFF Research Database (Denmark)

    2013-01-01

    Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...... by that enzyme...

  11. Biopolymers Versus Synthetic Polymers

    Directory of Open Access Journals (Sweden)

    Florentina Adriana Cziple

    2008-10-01

    Full Text Available This paper present an overview of important synthetic and natural polymers with emphasis on polymer structure, the chemistry of polymer formation. an introduction to polymer characterization. The biodegradation process can take place aerobically and anaerobically with or without the presence of light. These factors allow for biodegradation even in landfill conditions which are normally inconducive to any degradation. The sheeting used to make these packages differs significantly from other “degradable plastics” in the market as it does not attempt to replace the current popular materials but instead enhances them by rendering them biodegradable.

  12. CASH vs. SYNTHETIC CDOs

    Directory of Open Access Journals (Sweden)

    Silviu Eduard Dinca

    2015-12-01

    Full Text Available During the past few years, in the recent post-crisis aftermath, global asset managers are constantly searching new ways to optimize their investment portfolios while financial and banking institutions around the world are exploring new alternatives to better secure their financing and refinancing demands altogether with the enhancement of their risk management capabilities. We will exhibit herewith a comparison between the true-sale and synthetic CDO securitizations as financial markets-based funding, investment and risks mitigation techniques, highlighting certain key structuring and implementation specifics on each of them.

  13. 3rd congress on applied synthetic biology in Europe (Costa da Caparica, Portugal, February 2016).

    Science.gov (United States)

    Cueva, Miguel

    2017-03-25

    The third meeting organised by the European Federation of Biotechnology (EFB) on advances in Applied Synthetic Biotechnology in Europe (ASBE) was held in Costa da Caparica, Portugal, in February 2016. Abundant novel applications in synthetic biology were described in the six sessions of the meeting, which was divided into technology and tools for synthetic biology (I, II and III), bionanoscience, biosynthetic pathways and enzyme synthetic biology, and metabolic engineering and chemical manufacturing. The meeting presented numerous methods for the development of novel synthetic strains, synthetic biological tools and synthetic biology applications. With the aid of synthetic biology, production costs of chemicals, metabolites and food products are expected to decrease, by generating sustainable biochemical production of such resources. Also, such synthetic biological advances could be applied for medical purposes, as in pharmaceuticals and for biosensors. Recurrent, linked themes throughout the meeting were the shortage of resources, the world's transition into a bioeconomy, and how synthetic biology is helping tackle these issues through cutting-edge technologies. While there are still limitations in synthetic biology research, innovation is propelling the development of technology, the standardisation of synthetic biological tools and the use of suitable host organisms. These developments are laying a foundation to providing a future where cutting-edge research could generate potential solutions to society's pressing issues, thus incentivising a transition into a bioeconomy.

  14. Post-production modification of industrial enzymes.

    Science.gov (United States)

    Minten, Inge J; Abello, Nicolas; Schooneveld-Bergmans, Margot E F; van den Berg, Marco A

    2014-01-01

    Industry has an increasing interest in the use of enzymes as environmentally friendly, highly efficient, and specific bio-catalysts. Enzymes have primarily evolved to function in aqueous environments at ambient temperature and pressure. These conditions however do not always correspond with industrial processes or applications, and only a small portion of all known enzymes are therefore suitable for industrial use. Protein engineering can sometimes be applied to convey more desirable properties to enzymes, such as increased stability, but is limited to the 20 naturally occurring amino acids or homologs thereof. Using post-production modification, which has the potential to combine desirable properties from the enzyme and the conjugated compounds, enzymes can be modified with both natural and synthetic molecules. This offers access to a myriad of possibilities for tuning the properties of enzymes. At this moment, however, the effects of post-production modification cannot yet be reliably predicted. The increasing number of applications will improve this so that the potential of this technology can be fully exploited. This review will focus on post-production modification of enzymes and its use and opportunities in industry.

  15. Elevated Liver Enzymes

    Science.gov (United States)

    Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...

  16. The effects of crown ethers on the activity of enzymes in organic solvents

    NARCIS (Netherlands)

    van Unen, D.J.; Engbersen, Johannes F.J.; Reinhoudt, David; Vulfson, Evgeny N.; Halling, Peter J.; Holland, Herbert L.

    2001-01-01

    Currently, the applicability of enzymes in synthetic organic chemistry is well recognized. The field of enzyme-catalyzed organic synthesis has been further boosted by the recognition that enzymes can operate in organic solvents. The use of nonaqueous media for enzymatic conversions offers a number

  17. Synthetic collective intelligence.

    Science.gov (United States)

    Solé, Ricard; Amor, Daniel R; Duran-Nebreda, Salva; Conde-Pueyo, Núria; Carbonell-Ballestero, Max; Montañez, Raúl

    2016-10-01

    Intelligent systems have emerged in our biosphere in different contexts and achieving different levels of complexity. The requirement of communication in a social context has been in all cases a determinant. The human brain, probably co-evolving with language, is an exceedingly successful example. Similarly, social insects complex collective decisions emerge from information exchanges between many agents. The difference is that such processing is obtained out of a limited individual cognitive power. Computational models and embodied versions using non-living systems, particularly involving robot swarms, have been used to explore the potentiality of collective intelligence. Here we suggest a novel approach to the problem grounded in the genetic engineering of unicellular systems, which can be modified in order to interact, store memories or adapt to external stimuli in collective ways. What we label as Synthetic Swarm Intelligence defines a parallel approach to the evolution of computation and swarm intelligence and allows to explore potential embodied scenarios for decision making at the microscale. Here, we consider several relevant examples of collective intelligence and their synthetic organism counterparts.

  18. Freedom and Responsibility in Synthetic Genomics: The Synthetic Yeast Project

    OpenAIRE

    Sliva, Anna; Yang, Huanming; Boeke, Jef D.; Debra J. H. Mathews

    2015-01-01

    First introduced in 2011, the Synthetic Yeast Genome (Sc2.0) Project is a large international synthetic genomics project that will culminate in the first eukaryotic cell (Saccharomyces cerevisiae) with a fully synthetic genome. With collaborators from across the globe and from a range of institutions spanning from do-it-yourself biology (DIYbio) to commercial enterprises, it is important that all scientists working on this project are cognizant of the ethical and policy issues associated with...

  19. Tissue Harmonic Synthetic Aperture Imaging

    DEFF Research Database (Denmark)

    Rasmussen, Joachim

    The main purpose of this PhD project is to develop an ultrasonic method for tissue harmonic synthetic aperture imaging. The motivation is to advance the field of synthetic aperture imaging in ultrasound, which has shown great potentials in the clinic. Suggestions for synthetic aperture tissue...... system complexity compared to conventional synthetic aperture techniques. In this project, SASB is sought combined with a pulse inversion technique for 2nd harmonic tissue harmonic imaging. The advantages in tissue harmonic imaging (THI) are expected to further improve the image quality of SASB...... harmonic techniques have been made, but none of these methods have so far been applicable for in-vivo imaging. The basis of this project is a synthetic aperture technique known as synthetic aperture sequential beamforming (SASB). The technique utilizes a two step beamforming approach to drastically reduce...

  20. Synthetic biology and genetic causation.

    Science.gov (United States)

    Oftedal, Gry; Parkkinen, Veli-Pekka

    2013-06-01

    Synthetic biology research is often described in terms of programming cells through the introduction of synthetic genes. Genetic material is seemingly attributed with a high level of causal responsibility. We discuss genetic causation in synthetic biology and distinguish three gene concepts differing in their assumptions of genetic control. We argue that synthetic biology generally employs a difference-making approach to establishing genetic causes, and that this approach does not commit to a specific notion of genetic program or genetic control. Still, we suggest that a strong program concept of genetic material can be used as a successful heuristic in certain areas of synthetic biology. Its application requires control of causal context, and may stand in need of a modular decomposition of the target system. We relate different modularity concepts to the discussion of genetic causation and point to possible advantages of and important limitations to seeking modularity in synthetic biology systems. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Substrates and method for determining enzymes

    Science.gov (United States)

    Smith, Robert E.; Bissell, Eugene R.

    1981-01-01

    A method is disclosed for determining the presence of an enzyme in a biological fluid, which includes the steps of contacting the fluid with a synthetic chromogenic substrate, which is an amino acid derivative of 7-amino-4-trifluoromethylcoumarin; incubating the substrate-containing fluid to effect enzymatic hydrolysis; and fluorometrically determining the presence of the free 7-amino-4-trifluoromethylcoumarin chromophore in the hydrolyzate.

  2. Substrates and method for determining enzymes

    Science.gov (United States)

    Smith, R.E.; Bissell, E.R.

    1981-10-13

    A method is disclosed for determining the presence of an enzyme in a biological fluid, which includes the steps of contacting the fluid with a synthetic chromogenic substrate, which is an amino acid derivative of 7-amino-4-trifluoromethylcoumarin; incubating the substrate-containing fluid to effect enzymatic hydrolysis; and fluorometrically determining the presence of the free 7-amino-4-trifluoromethylcoumarin chromophore in the hydrolyzate. No Drawings

  3. Space Synthetic Biology Project

    Science.gov (United States)

    Howard, David; Roman, Monsi; Mansell, James (Matt)

    2015-01-01

    Synthetic biology is an effort to make genetic engineering more useful by standardizing sections of genetic code. By standardizing genetic components, biological engineering will become much more similar to traditional fields of engineering, in which well-defined components and subsystems are readily available in markets. Specifications of the behavior of those components and subsystems can be used to model a system which incorporates them. Then, the behavior of the novel system can be simulated and optimized. Finally, the components and subsystems can be purchased and assembled to create the optimized system, which most often will exhibit behavior similar to that indicated by the model. The Space Synthetic Biology project began in 2012 as a multi-Center effort. The purpose of this project was to harness Synthetic Biology principals to enable NASA's missions. A central target for application was to Environmental Control & Life Support (ECLS). Engineers from NASA Marshall Space Flight Center's (MSFC's) ECLS Systems Development Branch (ES62) were brought into the project to contribute expertise in operational ECLS systems. Project lead scientists chose to pursue the development of bioelectrochemical technologies to spacecraft life support. Therefore, the ECLS element of the project became essentially an effort to develop a bioelectrochemical ECLS subsystem. Bioelectrochemical systems exploit the ability of many microorganisms to drive their metabolisms by direct or indirect utilization of electrical potential gradients. Whereas many microorganisms are capable of deriving the energy required for the processes of interest (such as carbon dioxide (CO2) fixation) from sunlight, it is believed that subsystems utilizing electrotrophs will exhibit smaller mass, volume, and power requirements than those that derive their energy from sunlight. In the first 2 years of the project, MSFC personnel conducted modeling, simulation, and conceptual design efforts to assist the

  4. Life after the synthetic cell

    DEFF Research Database (Denmark)

    Rasmussen, Steen

    2010-01-01

    Nature asked eight synthetic-biology experts about the implications for science and society of the “synthetic cell” made by the J. Craig Venter Institute (JCVI). The institute's team assembled, modified and implanted a synthesized genome into a DNA-free bacterial shell to make a self-replicating ......Nature asked eight synthetic-biology experts about the implications for science and society of the “synthetic cell” made by the J. Craig Venter Institute (JCVI). The institute's team assembled, modified and implanted a synthesized genome into a DNA-free bacterial shell to make a self...

  5. Synthetic biology and occupational risk.

    Science.gov (United States)

    Howard, John; Murashov, Vladimir; Schulte, Paul

    2017-03-01

    Synthetic biology is an emerging interdisciplinary field of biotechnology that involves applying the principles of engineering and chemical design to biological systems. Biosafety professionals have done an excellent job in addressing research laboratory safety as synthetic biology and gene editing have emerged from the larger field of biotechnology. Despite these efforts, risks posed by synthetic biology are of increasing concern as research procedures scale up to industrial processes in the larger bioeconomy. A greater number and variety of workers will be exposed to commercial synthetic biology risks in the future, including risks to a variety of workers from the use of lentiviral vectors as gene transfer devices. There is a need to review and enhance current protection measures in the field of synthetic biology, whether in experimental laboratories where new advances are being researched, in health care settings where treatments using viral vectors as gene delivery systems are increasingly being used, or in the industrial bioeconomy. Enhanced worker protection measures should include increased injury and illness surveillance of the synthetic biology workforce; proactive risk assessment and management of synthetic biology products; research on the relative effectiveness of extrinsic and intrinsic biocontainment methods; specific safety guidance for synthetic biology industrial processes; determination of appropriate medical mitigation measures for lentiviral vector exposure incidents; and greater awareness and involvement in synthetic biology safety by the general occupational safety and health community as well as by government occupational safety and health research and regulatory agencies.

  6. Life after the synthetic cell

    DEFF Research Database (Denmark)

    Rasmussen, Steen

    2010-01-01

    Nature asked eight synthetic-biology experts about the implications for science and society of the “synthetic cell” made by the J. Craig Venter Institute (JCVI). The institute's team assembled, modified and implanted a synthesized genome into a DNA-free bacterial shell to make a self-replicating ......Nature asked eight synthetic-biology experts about the implications for science and society of the “synthetic cell” made by the J. Craig Venter Institute (JCVI). The institute's team assembled, modified and implanted a synthesized genome into a DNA-free bacterial shell to make a self...

  7. Synthetic Aperture Ultrasound Imaging

    DEFF Research Database (Denmark)

    Jensen, Jørgen Arendt; Nikolov, Svetoslav; Gammelmark, Kim Løkke

    2006-01-01

    The paper describes the use of synthetic aperture (SA) imaging in medical ultrasound. SA imaging is a radical break with today's commercial systems, where the image is acquired sequentially one image line at a time. This puts a strict limit on the frame rate and the possibility of acquiring...... a sufficient amount of data for high precision flow estimation. These constrictions can be lifted by employing SA imaging. Here data is acquired simultaneously from all directions over a number of emissions, and the full image can be reconstructed from this data. The talk will demonstrate the many benefits...... of SA imaging. Due to the complete data set, it is possible to have both dynamic transmit and receive focusing to improve contrast and resolution. It is also possible to improve penetration depth by employing codes during ultrasound transmission. Data sets for vector flow imaging can be acquired using...

  8. Computational synthetic geometry

    CERN Document Server

    Bokowski, Jürgen

    1989-01-01

    Computational synthetic geometry deals with methods for realizing abstract geometric objects in concrete vector spaces. This research monograph considers a large class of problems from convexity and discrete geometry including constructing convex polytopes from simplicial complexes, vector geometries from incidence structures and hyperplane arrangements from oriented matroids. It turns out that algorithms for these constructions exist if and only if arbitrary polynomial equations are decidable with respect to the underlying field. Besides such complexity theorems a variety of symbolic algorithms are discussed, and the methods are applied to obtain new mathematical results on convex polytopes, projective configurations and the combinatorics of Grassmann varieties. Finally algebraic varieties characterizing matroids and oriented matroids are introduced providing a new basis for applying computer algebra methods in this field. The necessary background knowledge is reviewed briefly. The text is accessible to stud...

  9. Transionospheric synthetic aperture imaging

    CERN Document Server

    Gilman, Mikhail; Tsynkov, Semyon

    2017-01-01

    This landmark monograph presents the most recent mathematical developments in the analysis of ionospheric distortions of SAR images and offers innovative new strategies for their mitigation. As a prerequisite to addressing these topics, the book also discusses the radar ambiguity theory as it applies to synthetic aperture imaging and the propagation of radio waves through the ionospheric plasma, including the anisotropic and turbulent cases. In addition, it covers a host of related subjects, such as the mathematical modeling of extended radar targets (as opposed to point-wise targets) and the scattering of radio waves off those targets, as well as the theoretical analysis of the start-stop approximation, which is used routinely in SAR signal processing but often without proper justification. The mathematics in this volume is clean and rigorous – no assumptions are hidden or ambiguously stated. The resulting work is truly interdisciplinary, providing both a comprehensive and thorough exposition of the field,...

  10. Variation and Synthetic Speech

    CERN Document Server

    Miller, C; Massey, N; Miller, Corey; Karaali, Orhan; Massey, Noel

    1997-01-01

    We describe the approach to linguistic variation taken by the Motorola speech synthesizer. A pan-dialectal pronunciation dictionary is described, which serves as the training data for a neural network based letter-to-sound converter. Subsequent to dictionary retrieval or letter-to-sound generation, pronunciations are submitted a neural network based postlexical module. The postlexical module has been trained on aligned dictionary pronunciations and hand-labeled narrow phonetic transcriptions. This architecture permits the learning of individual postlexical variation, and can be retrained for each speaker whose voice is being modeled for synthesis. Learning variation in this way can result in greater naturalness for the synthetic speech that is produced by the system.

  11. Synthetic Aperture Compound Imaging

    DEFF Research Database (Denmark)

    Hansen, Jens Munk

    Medical ultrasound imaging is used for many purposes, e.g. for localizing and classifying cysts, lesions, and other processes. Almost any mass is first observed using B-mode imaging and later classified using e.g. color flow, strain, or attenuation imaging. It is therefore important that the B....... The method is investigated using simulations and through measurements using both phased array and convex array transducers. The images all show an improved contrast compared to images without compounding, and by construction, imaging using an improved frame rate is possible. Using a phased array transducer...... and the limiting factor is the amount of memory IO resources available. An equally high demand for memory throughput is found in the computer gaming industry, where a large part of the processing takes place on the graphics processing unit (GPU). Using the GPU, a framework for synthetic aperture imaging...

  12. Enzyme detection by microfluidics

    DEFF Research Database (Denmark)

    2013-01-01

    Microfluidic-implemented methods of detecting an enzyme, in particular a DNA-modifying enzyme, are provided, as well as methods for detecting a cell, or a microorganism expressing said enzyme. The enzyme is detected by providing a nucleic acid substrate, which is specifically targeted...

  13. Monoterpene composition of essential oil from peppermint (Mentha x piperita L.) with regard to leaf position using solid-phase microextraction and gas chromatography/mass spectrometry analysis.

    Science.gov (United States)

    Rohloff, J

    1999-09-01

    Monoterpene compounds of leaf pairs and flowers of Mentha x piperita have been studied by direct headspace sampling using solid-phase microextraction coupled with gas chromatography/mass spectrometry (SPME-GC/MS). The content of peppermint-characteristic compounds such as menthol, menthyl acetate, and neomenthol increased in a basipetal direction (older plant parts), whereas menthone and isomenthone showed higher levels in the acropetal direction (younger plant parts). Higher levels of menthofuran were found in peppermint flowers in contrast to the leaves. SPME sampling resulted in relatively higher amounts of high-volatile monoterpenes and lower detection of less volatile compounds such as menthol and menthone, compared to solvent-based samples from essential oil distillation.

  14. Comparative study on the in vitro human skin permeation of monoterpenes and phenylpropanoids applied in rose oil and in form of neat single compounds.

    Science.gov (United States)

    Schmitt, S; Schaefer, U; Sporer, F; Reichling, J

    2010-02-01

    Essential oils are ingredients of cosmetic and health care products as well as massage oil used in aromatherapy. There is no doubt that essential oils and their components are able to permeate human skin. But information is rare dealing with percutanous absorption of essential oils in more detail. In this paper we investigated the in vitro skin permeation of monoterpenes and phenylpropanoids applied in pure rose oil and in form of neat single substances. We found that the application form had an exceeding influence on the skin permeation behaviour of the compounds. For substances applied in rose oil a clear relationship between their lipophilic character, chemical structure, and skin permeation could be confirmed. Regarding the P(app)-values the substances are ranked in the order: monoterpene hydrocarbons rose oil than in their neat form. This suggests that co-operative interactions between essential oil components may promote skin permeation behaviour of essential oil and its components.

  15. A new monoterpene acid from Marrubium vulgare with potential antihepatotoxic activity.

    Science.gov (United States)

    Ahmed, Bahar; Masoodi, Mubashir H; Siddique, Anwarul H; Khan, Shamshir

    2010-11-01

    The whole plant of Marrubium vulgare L. afforded a new terpenoid, characterised as p-menthane-5,6-dihydroxy-3-carboxylic acid (1), which has been designated as marrubic acid. Its structure has been elucidated on the basis of spectral and chemical analyses. The compound (1) also exhibited a significant antihepatotoxic activity by reducing the elevated levels of serum enzymes such as serum glutamate oxaloacetate transaminase (SGOT) by 40.16%, serum glutamate pyruvate oxaloacetate transaminase (SGPT) by 35.06%, and alkaline phosphatase (ALP) by 30.51%. On the other hand, total protein (TP) levels were increased by 34.07%, as compared to the standard drug silymarin, which decreased SGOT by 53.04%, SGPT by 55.96%, ALP by 35.87% and increased TP levels by 59.59%. These biochemical observations were also supplemented by histopathological examinations of liver sections.

  16. Structural investigation of the β-cyclodextrin complexes with chiral bicyclic monoterpenes - Influence of the functionality group on the host-guest stoichiometry

    Science.gov (United States)

    Ceborska, Magdalena

    2017-10-01

    The crystal structures of the complexes of β-cyclodextrin with (+)- and (-)-camphors are presented. The comparison of the obtained crystal structures with available data for other complexes of β-cyclodextrin with chiral bicyclic monoterpenes (hydrocarbon (+)-fenchene and alcohols: (-)-isopinocampheol, and (+)-, and (-)-borneols) obtained from Cambridge Structural Database (CSD) shows the trend of alcohols to form dimeric complexes of 2:3 stoichiometry, while hydrocarbons and ketones prefer to form 2:2 host-guest inclusion complexes.

  17. Monoterpene isolated from the essential oil of Trachyspermum ammi is cytotoxic to multidrug-resistant Pseudomonas aeruginosa and Staphylococcus aureus strains

    Directory of Open Access Journals (Sweden)

    Faride Hosseinkhani

    2016-04-01

    Full Text Available Abstract INTRODUCTION: The aim of this study was to determine whether an herbal extract containing monoterpene exhibited activity against multidrug-resistant Staphylococcus aureus and Pseudomonas aeruginosa isolated from clinical infection samples. METHODS: The essential oil of Trachyspermum ammi (L. Sprague ex Turrill (Apiaceae fruit was extracted by hydrodistillation. Fruit residues were treated with hydrochloric acid and re-hydrodistilled to obtain volatile compounds. Compounds in the distilled oil were identified using gas-chromatography (GC and GC-mass spectrometry (MS. The antibiotic susceptibility of all bacterial isolates was analyzed using both the disc diffusion method and determination of the minimum inhibitory concentration (MIC. The sensitivity of antibiotic-resistant isolates to essential oil was also determined by using the disc diffusion method and MIC determination. RESULTS: Of 26 clinical isolates, 92% were multidrug-resistant (MDR. Aromatic monoterpenes (thymol, paracymene, and gamma-terpinene were the major (90% components of the oil. Growth of S. aureus strains was successfully inhibited by the oil, with an inhibitory zone diameter (IZD between 30-60mm and MIC <0.02μL/mL. The oil had no antimicrobial activity against clinical isolates of P. aeruginosa; rather, it prevented pigment production in these isolates. CONCLUSIONS: This study revealed that the essential oil of Trachyspermum ammi, which contains monoterpene, has good antibacterial potency. Monoterpenes could thus be incorporated into antimicrobial ointment formulas in order to treat highly drug-resistant S. aureus infections. Our findings also underscore the utility of research on natural products in order to combat bacterial multidrug resistance.

  18. Ice core records of monoterpene- and isoprene-SOA tracers from Aurora Peak in Alaska since 1660s: Implication for climate change variability in the North Pacific Rim

    Science.gov (United States)

    Pokhrel, Ambarish; Kawamura, Kimitaka; Ono, Kaori; Seki, Osamu; Fu, Pingqing; Matoba, Sumio; Shiraiwa, Takayuki

    2016-04-01

    Monoterpene and isoprene secondary organic aerosol (SOA) tracers are reported for the first time in an Alaskan ice core to better understand the biological source strength before and after the industrial revolution in the Northern Hemisphere. We found significantly high concentrations of monoterpene- and isoprene-SOA tracers (e.g., pinic, pinonic, and 2-methylglyceric acids, 2-methylthreitol and 2-methylerythritol) in the ice core, which show historical trends with good correlation to each other since 1660s. They show positive correlations with sugar compounds (e.g., mannitol, fructose, glucose, inositol and sucrose), and anti-correlations with α-dicarbonyls (glyoxal and methylglyoxal) and fatty acids (e.g., C18:1) in the same ice core. These results suggest similar sources and transport pathways for monoterpene- and isoprene-SOA tracers. In addition, we found that concentrations of C5-alkene triols (e.g., 3-methyl-2,3,4-trihydroxy-1-butene, cis-2-methyl 1,3,4-trihydroxy-1-butene and trans-2-methyl-1,3,4-trihydroxy-1-butene) in the ice core have increased after the Great Pacific Climate Shift (late 1970s). They show positive correlations with α-dicarbonyls and fatty acids (e.g., C18:1) in the ice core, suggesting that enhanced oceanic emissions of biogenic organic compounds through the marine boundary layer are recorded in the ice core from Alaska. Photochemical oxidation process for these monoterpene- and isoprene-/sesquiterpene-SOA tracers are suggested to be linked with the periodicity of multi-decadal climate oscillations and retreat of sea ice in the Northern Hemisphere.

  19. Evaluation of fast enantioselective multidimensional gas chromatography methods for monoterpenic compounds: Authenticity control of Australian tea tree oil.

    Science.gov (United States)

    Wong, Yong Foo; West, Rachel N; Chin, Sung-Tong; Marriott, Philip J

    2015-08-07

    This work demonstrates the potential of fast multiple heart-cut enantioselective multidimensional gas chromatography (GC-eGC) and enantioselective comprehensive two-dimensional gas chromatography (eGC×GC), to perform the stereoisomeric analysis of three key chiral monoterpenes (limonene, terpinen-4-ol and α-terpineol) present in tea tree oil (TTO). In GC-eGC, separation was conducted using a combination of mid-polar first dimension ((1)D) column and a chiral second dimension ((2)D) column, providing interference-free enantioresolution of the individual antipodes of each optically active component. A combination of (1)D chiral column and (2)D polar columns (ionic liquid and wax phases) were tested for the eGC×GC study. Quantification was proposed based on summation of two major modulated peaks for each antipode, displaying comparable results with those derived from GC-eGC. Fast chiral separations were achieved within 25min for GC-eGC and<20min for eGC×GC, while ensuring adequate interference-free enantiomer separation. The suitability of using these two enantioselective multidimensional approaches for the routine assessment of chiral monoterpenes in TTO was evaluated and discussed. Exact enantiomeric composition of chiral markers for authentic TTOs was proposed by analysing a representative number of pure TTOs sourced directly from plantations of known provenance in Australia. Consistent enantiomeric fractions of 61.6±1.5% (+):38.4±1.5% (-) for limonene, 61.7±1.6% (+):38.3±1.6% (-) for terpinen-4-ol and 79.6±1.4% (+):20.4±1.4% (-) for α-terpineol were obtained for the 57 authentic Australian TTOs. The results were compared (using principle component analysis) with commercial TTOs (declared as derived from Melaleuca alternifolia) obtained from different continents. Assessing these data to determine adulteration, or additives that affect the enantiomeric ratios, in commercially sourced TTOs is discussed. The proposed method offers distinct advantages over e

  20. Diurnal and seasonal variation of monoterpene emission rates for two typical Mediterranean species (Pinus pinea and Quercus ilex) from field measurements - relationship with temperature and PAR

    Energy Technology Data Exchange (ETDEWEB)

    Sabillon, D.; Cremades, L.V. [Universitat Politecnica de Catalunya, Barcelona (Spain). Dept. de Projectes d' Enginyeria

    2001-07-01

    Two of the most typical Mediterranean tree species (Pinus pinea [Pp] and Quercus ilex [Qi]) were screened for emissions of monoterpenes during the period of June 1997-July 1998 in the field at a semi-rural location near Terrassa (Barcelona, Spain) using a bag-enclosure sampling method followed by gas chromatography analysis with mass selective detection (GC/MSD). A mean of about eight samples per day were measured. A periodical sampling throughout 1 yr allowed to examine data for long-term influences. The main compounds emitted from Pp were linalool, limonene, trans-ocimene and 1,8-cineole (80% on average). Eighty percent of total emissions in Qi were {beta}-pinene, {alpha}-pinene, myrcene and sabinene, followed by limonene, {beta}-phellandrene, {delta}-terpinene and trans-ocimene (20%). On average, the standard monoterpene emission rate from Qi was approximately three times higher than from Pp. Diurnal and seasonal emission variations were characterized with regard to temperature and PAR. For both species a statistically significant variation in monoterpene emissions was observed between seasons for 1 yr period. For Pp, the seasonal variability not accounted for by PAR and temperature is also estimated and compared with existing models in the literature. (author)

  1. Application of response surface methodology to optimize solid-phase microextraction procedure for chromatographic determination of aroma-active monoterpenes in berries.

    Science.gov (United States)

    Chmiel, Tomasz; Kupska, Magdalena; Wardencki, Waldemar; Namieśnik, Jacek

    2017-04-15

    Most of scientific papers concern the qualitative or semi-quantitative analysis of aroma-active terpenes in liquid food matrices. Therefore, the procedure based on solid-phase microextraction and two-dimensional gas chromatography-time-of-flight mass spectrometry for determination of monoterpenes in fresh berries was developed. The optimal extraction conditions using divinylbenzene-carboxen-polydimethylsiloxane fiber were: temperature of 50°C, extraction time of 26min, equilibrium time of 29min. The developed procedure provides a high recovery (70.8-99.2%), good repeatability (CV0.9915) and offers practical advantages over currently used methods: reliability of compounds identification, simplicity of extraction and at least one order of magnitude lower detection limits (0.10-0.011μg/L). The method was successfully applied to determine monoterpenes in 27 berry samples of different varieties and 4 berry products. Tukey's test revealed that monoterpenes content is a reliable indicator of fruit maturity and origin. It suggests that the method may be of interest to researchers and food industry.

  2. Enantiomeric and non-enantiomeric monoterpenes of Juniperus communis L. and Juniperus oxycedrus needles and berries determined by HS-SPME and enantioselective GC/MS.

    Science.gov (United States)

    Foudil-Cherif, Yazid; Yassaa, Noureddine

    2012-12-01

    For the first time, enantiomeric and non-enantiomeric distribution of monoterpenes in the headspace of Juniperus communis L. and Juniperus oxycedrus needles and berries has been determined using HS-SPME combined with enantioselective GC/MS. The essential oils from needles and berries of both Juniperus species obtained by hydrodistillation were also performed. HS-SPME has shown good potential to reproduce the same results as the commonly used hydrodistillation extraction technique. While needles and berries of J. communis showed high contents of sabinene, α-pinene and β-myrcene with 19-30%, 12-24% and 9-20%, respectively, J. oxycedrus was strongly dominated by α-pinene with 85-92% in both needles and berries. Large variations in chiral distribution of monoterpenes within the same plant species and between the two junipers were observed. Interestingly, similar enantiomeric preferences of monoterpenes were obtained between needles and berries of the two junipers. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Imaging with Synthetic Aperture Radar

    CERN Document Server

    Massonnet, Didier

    2008-01-01

    Describing a field that has been transformed by the recent availability of data from a new generation of space and airborne systems, the authors offer a synthetic geometrical approach to the description of synthetic aperture radar, one that addresses physicists, radar specialists, as well as experts in image processing.  

  4. Engineering Ecosystems and Synthetic Ecologies#

    OpenAIRE

    Mee, Michael T.; Wang, Harris H.

    2012-01-01

    Microbial ecosystems play an important role in nature. Engineering these systems for industrial, medical, or biotechnological purposes are important pursuits for synthetic biologists and biological engineers moving forward. Here, we provide a review of recent progress in engineering natural and synthetic microbial ecosystems. We highlight important forward engineering design principles, theoretical and quantitative models, new experimental and manipulation tools, and possible applications of ...

  5. Synthetic biology and metabolic engineering.

    Science.gov (United States)

    Stephanopoulos, Gregory

    2012-11-16

    Metabolic engineering emerged 20 years ago as the discipline occupied with the directed modification of metabolic pathways for the microbial synthesis of various products. As such, it deals with the engineering (design, construction, and optimization) of native as well as non-natural routes of product synthesis, aided in this task by the availability of synthetic DNA, the core enabling technology of synthetic biology. The two fields, however, only partially overlap in their interest in pathway engineering. While fabrication of biobricks, synthetic cells, genetic circuits, and nonlinear cell dynamics, along with pathway engineering, have occupied researchers in the field of synthetic biology, the sum total of these areas does not constitute a coherent definition of synthetic biology with a distinct intellectual foundation and well-defined areas of application. This paper reviews the origins of the two fields and advances two distinct paradigms for each of them: that of unit operations for metabolic engineering and electronic circuits for synthetic biology. In this context, metabolic engineering is about engineering cell factories for the biological manufacturing of chemical and pharmaceutical products, whereas the main focus of synthetic biology is fundamental biological research facilitated by the use of synthetic DNA and genetic circuits.

  6. Holographically Correcting Synthetic Aperture Aberrations.

    Science.gov (United States)

    1987-12-01

    Malacara (20:105-148). The synthetic aperture was aligned in accordance with the synthetic-aperture alignment technique of Gill (8:61-64). The...1987. 20. Malacara , Daniel, ed. Optical Shop Testing. New York: John Wiley & Sons, 1978. 21. Marciniak, Capt Michael. Tutorial Presentation of mV

  7. Synthetic peptides for antibody production

    NARCIS (Netherlands)

    Zegers, N.D.

    1995-01-01

    Synthetic peptides are useful tools for the generation of antibodies. The use of antibodies as specific reagents in inununochemical assays is widely applied. In this chapter, the application of synthetic peptides for the generation of antibodies is described. The different steps that lead to the uni

  8. Elution-extrusion counter-current chromatography for the separation of two pairs of isomeric monoterpenes from Paeoniae Alba Radix.

    Science.gov (United States)

    Chu, Chu; Zhang, Shidi; Tong, Shengqiang; Li, Xingnuo; Li, Qingyong; Yan, Jizhong

    2015-09-01

    In this work, a simple and efficient protocol for the rapid separation of two pairs of isomeric monoterpenes from Paeoniae Alba Radix was developed by combining macroporous resin and elution-extrusion counter-current chromatography. The crude extract was firstly subjected to a D101 macroporous resin column eluted with water and a series of different concentrations of ethanol. Then, effluents of 30 and 95% ethanol were collected as sample 1 and sample 2 for further counter-current chromatography purification. Finally, a pair of isomers, 96 mg of compound 1 and 48 mg of compound 2 with purities of 91.1 and 96.2%, respectively, was isolated from 200 mg of sample 1. The other pair of isomers, 14 mg of compound 3 and 8 mg of compound 4 with purities of 93.6 and 88.9%, respectively, was isolated from 48 mg of sample 2. Their purities were analyzed by high-performance liquid chromatography, and their chemical structures were identified by mass spectrometry and (1) H NMR spectroscopy. Compared to a normal counter-current chromatography separation, the separation time and solvent consumption of elution-extrusion counter-current chromatography were reduced while the resolutions were still good. The established protocol is promising for the separation of natural products with great disparity of content in herbal medicines. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A new monoterpene glucoside and complete assignments of dihydroflavonols of Pulicaria jaubertii: potential cytotoxic and blood pressure lowering activity.

    Science.gov (United States)

    Ragab, Ehab A; Raafat, Mohamed

    2016-06-01

    One new monoterpene glucoside and five dihydroflavonols were isolated for the first time from the aerial parts of Pulicaria jaubertii and identified as p-menthane-2-O-β-D-glucopyranoside [1], dihydroquercetin (taxifolin) [2], 7,3'-di-O-methyltaxifolin [3], 3'-O-methyltaxifolin [4], 7-O-methyltaxifolin (padmatin) [5] and 7-O-methyl-dihydrokampferol (7-O-methylaromadenderin) [6]. The structures of these compounds were unambiguously assigned on the basis of NMR spectroscopic data ((1)H, (13)C, DEPT, HSQC, HMBC) and MS analysis. 2D-NMR methods required revision of assignments of H-6 and H-8 for dihydroflavonol compounds. Possible cytotoxic activity as well as blood pressure (BP) lowering activity were tested. The alcoholic extract showed cytotoxic activity against prostate carcinoma (PC-3), breast carcinoma (MCF-7) and hepatocellular carcinoma (HepG-2) human cell lines with IC50 19.1, 20.0 and 24.1 μg, respectively. The higher dose levels of the alcoholic extract significantly reduced normal BP of rats in a dose-dependent manner.

  10. Two New Monoterpene Glycosides from Qing Shan Lu Shui Tea with Inhibitory Effects on Leukocyte-Type 12-Lipoxygenase Activity

    Directory of Open Access Journals (Sweden)

    Ding Zhi Fang

    2013-04-01

    Full Text Available We evaluated the inhibitory effect of 12 Chinese teas on leukocyte-type 12-lipoxygenase (LOX activity. Tea catechins such as epigallocatechin gallate have been known to exhibit leukocyte-type 12-LOX inhibition. Qing Shan Lu Shui, which contains lower catechin levels than the other tested teas, suppressed leukocyte-type 12-LOX activity. To characterize the bioactive components of Qing Shan Lu Shui, leukocyte-type 12-LOX inhibitory activity–guided fractionation of the aqueous ethanol extract of the tea was performed, resulting in the isolation of two new monoterpene glycosides: liguroside A (1 and B (2. The structures of compounds 1 and 2 were characterized as (2E,5E-7-hydroperoxy-3,7-dimethyl-2,5-octadienyl-O-(α-L-rhamnopyranosyl-(1″→3′-(4′″-O-trans-p-coumaroyl-β-D-glucopyranoside and (2E,5E-7-hydroperoxy-3,7-dimethyl-2,5-octa-dienyl- O-(α-L-rhamnopyranosyl-(1″→3′-(4′″-O-cis-p-coumaroyl-β-D-glucopyranoside, respectively, based on spectral and chemical evidence. Ligurosides A (1 and B (2 showed inhibitory effects on leukocyte-type 12-LOX activity, with IC50 values of 1.7 and 0.7 μM, respectively.

  11. Ecotoxicology of synthetic pyrethroids.

    Science.gov (United States)

    Maund, S J; Campbell, P J; Giddings, J M; Hamer, M J; Henry, K; Pilling, E D; Warinton, J S; Wheeler, J R

    2012-01-01

    In this chapter we review the ecotoxicology of the synthetic pyrethroids (SPs). SPs are potent, broad-spectrum insecticides. Their effects on a wide range of nontarget species have been broadly studied, and there is an extensive database available to evaluate their effects. SPs are highly toxic to fish and aquatic invertebrates in the laboratory, but effects in the field are mitigated by rapid dissipation and degradation. Due to their highly lipophilic nature, SPs partition extensively into sediments. Recent studies have shown that toxicity in sediment can be predicted on the basis of equilibrium partitioning, and whilst other factors can influence this, organic carbon content is a key determining variable. At present for SPs, there is no clear evidence for adverse population-relevant effects with an underlying endocrine mode of action. SPs have been studied intensively in aquatic field studies, and their effects under field conditions are mitigated from those measured in the laboratory by their rapid dissipation and degradation. Studies with a range of test systems have shown consistent aquatic field endpoints across a variety of geographies and trophic states. SPs are also highly toxic to bees and other nontarget arthropods in the laboratory. These effects are mitigated in the field through repellency and dissipation of residues, and recovery from any adverse effects tends to be rapid.

  12. The nature of chemical innovation: new enzymes by evolution.

    Science.gov (United States)

    Arnold, Frances H

    2015-11-01

    I describe how we direct the evolution of non-natural enzyme activities, using chemical intuition and information on structure and mechanism to guide us to the most promising reaction/enzyme systems. With synthetic reagents to generate new reactive intermediates and just a few amino acid substitutions to tune the active site, a cytochrome P450 can catalyze a variety of carbene and nitrene transfer reactions. The cyclopropanation, N-H insertion, C-H amination, sulfimidation, and aziridination reactions now demonstrated are all well known in chemical catalysis but have no counterparts in nature. The new enzymes are fully genetically encoded, assemble and function inside of cells, and can be optimized for different substrates, activities, and selectivities. We are learning how to use nature's innovation mechanisms to marry some of the synthetic chemists' favorite transformations with the exquisite selectivity and tunability of enzymes.

  13. Synthetic biology: lessons from the history of synthetic organic chemistry.

    Science.gov (United States)

    Yeh, Brian J; Lim, Wendell A

    2007-09-01

    The mid-nineteenth century saw the development of a radical new direction in chemistry: instead of simply analyzing existing molecules, chemists began to synthesize them--including molecules that did not exist in nature. The combination of this new synthetic approach with more traditional analytical approaches revolutionized chemistry, leading to a deep understanding of the fundamental principles of chemical structure and reactivity and to the emergence of the modern pharmaceutical and chemical industries. The history of synthetic chemistry offers a possible roadmap for the development and impact of synthetic biology, a nascent field in which the goal is to build novel biological systems.

  14. Synthetic Polypeptide Mimics of Marine Adhesives.

    Science.gov (United States)

    Yu; Deming

    1998-07-28

    Water soluble copolypeptides containing l-dihydroxyphenylalanine (DOPA) and l-lysine were prepared by ring-opening polymerization of alpha-amino acid N-carboxyanhydride (NCA) monomers. We have prepared a range of different copolymers to probe the effects of functional group composition on adhesive and cross-linking behavior. Aqueous solutions of these copolymers, when mixed with a suitable oxidizing agent (e.g., O2, mushroom tyrosinase, Fe3+, H2O2, or IO4-), formed cross-linked networks that were found to form moisture-resistant adhesive bonds to a variety of substrates (e.g., aluminum, steel, glass, and plastics). It was found that successful adhesive formation was dependent on oxidation conditions, with chemical oxidants giving the best results. Optimized systems were found to form adhesive bonds that rival in strength those formed by natural marine adhesive proteins. Our synthetic systems are readily prepared in large quantities and require no enzymes or other biological components.

  15. A comparison of GC-FID and PTR-MS toluene measurements in ambient air under conditions of enhanced monoterpene loading

    Directory of Open Access Journals (Sweden)

    J. L. Ambrose

    2010-07-01

    Full Text Available Toluene was measured using both a gas chromatographic system (GC, with a flame ionization detector (FID, and a proton transfer reaction-mass spectrometer (PTR-MS at the AIRMAP atmospheric monitoring station Thompson Farm (THF in rural Durham, NH during the summer of 2004. Simultaneous measurements of monoterpenes, including α- and β-pinene, camphene, Δ 3-carene, and d-limonene, by GC-FID demonstrated large enhancements in monoterpene mixing ratios relative to toluene, with median and maximum enhancement ratios of ~2 and ~30, respectively. A detailed comparison between the GC-FID and PTR-MS toluene measurements was conducted to test the specificity of PTR-MS for atmospheric toluene measurements under conditions often dominated by biogenic emissions. We derived quantitative estimates of potential interferences in the PTR-MS toluene measurements related to sampling and analysis of monoterpenes, including fragmentation of the monoterpenes and some of their primary carbonyl oxidation products via reactions with H3O+, O2+ and NO+ in the PTR-MS drift tube. The PTR-MS and GC-FID toluene measurements were in good quantitative agreement and the two systems tracked one another well from the instrumental limits of detection to maximum mixing ratios of ~0.5 ppbv. A correlation plot of the PTR-MS versus GC-FID toluene measurements was described by the least squares regression equation y=(1.13± 0.02x−(0.008±0.003 ppbv, suggesting a small ~13% positive bias in the PTR-MS measurements. The bias corresponded with a ~0.055 ppbv difference at the highest measured toluene level. The two systems agreed quantitatively within the combined 1σ measurement precisions for 60% of the measurements. Discrepancies in the measured mixing ratios were not well correlated with enhancements in the monoterpenes. Better quantitative agreement between the two systems was obtained by

  16. Protein- and peptide-modified synthetic polymeric biomaterials.

    Science.gov (United States)

    Krishna, Ohm D; Kiick, Kristi L

    2010-01-01

    This review presents an overview on bio-hybrid approaches of integrating the structural and functional features of proteins and peptides with synthetic polymers and the resulting unique properties in such hybrids, with a focus on bioresponsive/bioactive systems with biomaterials applications. The review is divided in two broad sections. First, we describe several examples of bio-hybrids produced by combining versatile synthetic polymers with proteins/enzymes and drugs that have resulted in (1) hybrid materials based on responsive polymers, (2) responsive hydrogels based on enzyme-catalyzed reactions, protein-protein interactions and protein-drug sensing, and (3) dynamic hydrogels based on conformational changes of a protein. Next, we present hybrids produced by combining synthetic polymers with peptides, classified based on the properties of the peptide domain: (1) peptides with different conformations, such as alpha-helical, coiled-coil, and beta-sheet; (2) peptides derived from structural protein domains such as silk, elastin, titin, and collagen; and (3) peptides with other biofunctional properties such as cell-binding domains and enzyme-recognized degradation domains. (c) 2010 Wiley Periodicals, Inc.

  17. Spicing thing up: Synthetic cannabinoids

    Science.gov (United States)

    Spaderna, Max; Addy, Peter H; D’Souza, Deepak Cyril

    2013-01-01

    Rationale Recently, products containing synthetic cannabinoids, collectively referred to as Spice, are increasingly being used recreationally. Objectives The availability, acute subjective effects—including self-reports posted on Erowid—laboratory detection, addictive potential, and regulatory challenges of the Spice phenomenon are reviewed. Results Spice is sold under the guise of potpourri or incense. Unlike THC, the synthetic cannabinoids present in Spice are high-potency, high-efficacy, cannabinoid-receptor full agonists. Since standard urine toxicology does not test for the synthetic cannabinoids in Spice, it is often used by those who want to avoid detection of drug use. These compounds have not yet been subjected to rigorous testing in humans. Acute psychoactive effects include changes in mood, anxiety, perception, thinking, memory, and attention. Adverse effects include anxiety, agitation, panic, dysphoria, psychosis, and bizarre behavior. Psychosis outcomes associated with Spice provide additional data linking cannabinoids and psychosis. Adverse events necessitating intervention by Poison Control Centers, law enforcement, emergency responders, and hospitals are increasing. Despite statutes prohibiting the manufacture, distribution, and sale of Spice products, manufacturers are replacing banned compounds with newer synthetic cannabinoids that are not banned. Conclusions There is an urgent need for better research on the effects of synthetic cannabinoids to help clinicians manage adverse events and to better understand cannabinoid pharmacology in humans. The reported psychosis outcomes associated with synthetic cannabinoids contribute to the ongoing debate on the association between cannabinoids and psychosis. Finally, drug-detection tests for synthetic cannabinoids need to become clinically available. PMID:23836028

  18. Synthetic biology and personalized medicine.

    Science.gov (United States)

    Jain, K K

    2013-01-01

    Synthetic biology, application of synthetic chemistry to biology, is a broad term that covers the engineering of biological systems with structures and functions not found in nature to process information, manipulate chemicals, produce energy, maintain cell environment and enhance human health. Synthetic biology devices contribute not only to improve our understanding of disease mechanisms, but also provide novel diagnostic tools. Methods based on synthetic biology enable the design of novel strategies for the treatment of cancer, immune diseases metabolic disorders and infectious diseases as well as the production of cheap drugs. The potential of synthetic genome, using an expanded genetic code that is designed for specific drug synthesis as well as delivery and activation of the drug in vivo by a pathological signal, was already pointed out during a lecture delivered at Kuwait University in 2005. Of two approaches to synthetic biology, top-down and bottom-up, the latter is more relevant to the development of personalized medicines as it provides more flexibility in constructing a partially synthetic cell from basic building blocks for a desired task. Copyright © 2012 S. Karger AG, Basel.

  19. Activity assessment of microbial fibrinolytic enzymes.

    Science.gov (United States)

    Kotb, Essam

    2013-08-01

    Conversion of fibrinogen to fibrin inside blood vessels results in thrombosis, leading to myocardial infarction and other cardiovascular diseases. In general, there are four therapy options: surgical operation, intake of antiplatelets, anticoagulants, or fibrinolytic enzymes. Microbial fibrinolytic enzymes have attracted much more attention than typical thrombolytic agents because of the expensive prices and the side effects of the latter. The fibrinolytic enzymes were successively discovered from different microorganisms, the most important among which is the genus Bacillus. Microbial fibrinolytic enzymes, especially those from food-grade microorganisms, have the potential to be developed as functional food additives and drugs to prevent or cure thrombosis and other related diseases. There are several assay methods for these enzymes; this may due to the insolubility of substrate, fibrin. Existing assay methods can be divided into three major groups. The first group consists of assay of fibrinolytic activity with natural proteins as substrates, e.g., fibrin plate methods. The second and third groups of assays are suitable for kinetic studies and are based on the determination of hydrolysis of synthetic peptide esters. This review will deal primarily with the microorganisms that have been reported in literature to produce fibrinolytic enzymes and the first review discussing the methods used to assay the fibrinolytic activity.

  20. Synthetic biology: advancing biological frontiers by building synthetic systems

    Science.gov (United States)

    2012-01-01

    Advances in synthetic biology are contributing to diverse research areas, from basic biology to biomanufacturing and disease therapy. We discuss the theoretical foundation, applications, and potential of this emerging field. PMID:22348749

  1. Synthetic biology: advancing biological frontiers by building synthetic systems

    OpenAIRE

    Chen, Yvonne Yu-Hsuan; Galloway, Kate E; Smolke, Christina D.

    2012-01-01

    Advances in synthetic biology are contributing to diverse research areas, from basic biology to biomanufacturing and disease therapy. We discuss the theoretical foundation, applications, and potential of this emerging field.

  2. The Ethics of Synthetic Biology

    DEFF Research Database (Denmark)

    Christiansen, Andreas

    The dissertation analyses and discusses a number of ethical issues that have been raised in connection with the development of synthetic biology. Synthetic biology is a set of new techniques for DNA-level design and construction of living beings with useful properties. The dissertation especially......) popular responsesto them succeed, and whether the objections are ultimately persuasive.2. Given that synthetic biology is a new technology, there is a certain degree of uncertainty about its ultimate effects, and many perceive the technology as risky. I discuss two common approaches in risk regulation...

  3. Synthetic biology for therapeutic applications.

    Science.gov (United States)

    Abil, Zhanar; Xiong, Xiong; Zhao, Huimin

    2015-02-02

    Synthetic biology is a relatively new field with the key aim of designing and constructing biological systems with novel functionalities. Today, synthetic biology devices are making their first steps in contributing new solutions to a number of biomedical challenges, such as emerging bacterial antibiotic resistance and cancer therapy. This review discusses some synthetic biology approaches and applications that were recently used in disease mechanism investigation and disease modeling, drug discovery and production, as well as vaccine development and treatment of infectious diseases, cancer, and metabolic disorders.

  4. The Ethics of Synthetic Biology

    DEFF Research Database (Denmark)

    Christiansen, Andreas

    The dissertation analyses and discusses a number of ethical issues that have been raised in connection with the development of synthetic biology. Synthetic biology is a set of new techniques for DNA-level design and construction of living beings with useful properties. The dissertation especially......) popular responsesto them succeed, and whether the objections are ultimately persuasive.2. Given that synthetic biology is a new technology, there is a certain degree of uncertainty about its ultimate effects, and many perceive the technology as risky. I discuss two common approaches in risk regulation...

  5. Marine Microbiological Enzymes: Studies with Multiple Strategies and Prospects

    Directory of Open Access Journals (Sweden)

    Yan Wang

    2016-09-01

    Full Text Available Marine microorganisms produce a series of promising enzymes that have been widely used or are potentially valuable for our daily life. Both classic and newly developed biochemistry technologies have been broadly used to study marine and terrestrial microbiological enzymes. In this brief review, we provide a research update and prospects regarding regulatory mechanisms and related strategies of acyl-homoserine lactones (AHL lactonase, which is an important but largely unexplored enzyme. We also detail the status and catalytic mechanism of the main types of polysaccharide-degrading enzymes that broadly exist among marine microorganisms but have been poorly explored. In order to facilitate understanding, the regulatory and synthetic biology strategies of terrestrial microorganisms are also mentioned in comparison. We anticipate that this review will provide an outline of multiple strategies for promising marine microbial enzymes and open new avenues for the exploration, engineering and application of various enzymes.

  6. Marine Microbiological Enzymes: Studies with Multiple Strategies and Prospects.

    Science.gov (United States)

    Wang, Yan; Song, Qinghao; Zhang, Xiao-Hua

    2016-09-22

    Marine microorganisms produce a series of promising enzymes that have been widely used or are potentially valuable for our daily life. Both classic and newly developed biochemistry technologies have been broadly used to study marine and terrestrial microbiological enzymes. In this brief review, we provide a research update and prospects regarding regulatory mechanisms and related strategies of acyl-homoserine lactones (AHL) lactonase, which is an important but largely unexplored enzyme. We also detail the status and catalytic mechanism of the main types of polysaccharide-degrading enzymes that broadly exist among marine microorganisms but have been poorly explored. In order to facilitate understanding, the regulatory and synthetic biology strategies of terrestrial microorganisms are also mentioned in comparison. We anticipate that this review will provide an outline of multiple strategies for promising marine microbial enzymes and open new avenues for the exploration, engineering and application of various enzymes.

  7. Enzyme inhibition by iminosugars

    DEFF Research Database (Denmark)

    López, Óscar; Qing, Feng-Ling; Pedersen, Christian Marcus

    2013-01-01

    Imino- and azasugar glycosidase inhibitors display pH dependant inhibition reflecting that both the inhibitor and the enzyme active site have groups that change protonation state with pH. With the enzyme having two acidic groups and the inhibitor one basic group, enzyme-inhibitor complexes...

  8. Degradation of Synthetic Dyes by Laccases – A Mini-Review

    Directory of Open Access Journals (Sweden)

    Legerská Barbora

    2016-06-01

    Full Text Available Laccases provide a promising future as a tool to be used in the field of biodegradation of synthetic dyes with different chemical structures. These enzymes are able to oxidize a wide range of phenolic substrates without the presence of additional co-factors. Laccases have been confirmed for their potential of synthetic dye degradation from wastewater and degradation products of these enzymatic reactions become less toxic than selected dyes. This study discusses the potential of laccase enzymes as agents for laccase-catalyzed degradation in terms of biodegradation efficiency of synthetic dyes, specifically: azo dyes, triphenylmethane, indigo and anthraquinone dyes. Review also summarizes the laccase-catalyzed degradation mechanisms of the selected synthetic dyes, as well as the degradation products and the toxicity of the dyes and their degradation products.

  9. Synthetic biology: ethical ramifications 2009.

    Science.gov (United States)

    Rabinow, Paul; Bennett, Gaymon

    2009-12-01

    During 2007 and 2008 synthetic biology moved from the manifesto stage to research programs. As of 2009, synthetic biology is ramifying; to ramify means to produce differentiated trajectories from previous determinations. From its inception, most of the players in synthetic biology agreed on the need for (a) rationalized design and construction of new biological parts, devices, and systems as well as (b) the re-design of natural biological systems for specified purposes, and that (c) the versatility of designed biological systems makes them suitable to address such challenges as renewable energy, the production of inexpensive drugs, and environmental remediation, as well as providing a catalyst for further growth of biotechnology. What is understood by these goals, however, is diverse. Those assorted understandings are currently contributing to different ramifications of synthetic biology. The Berkeley Human Practices Lab, led by Paul Rabinow, is currently devoting its efforts to documenting and analyzing these ramifications as they emerge.

  10. Programming languages for synthetic biology.

    Science.gov (United States)

    Umesh, P; Naveen, F; Rao, Chanchala Uma Maheswara; Nair, Achuthsankar S

    2010-12-01

    In the backdrop of accelerated efforts for creating synthetic organisms, the nature and scope of an ideal programming language for scripting synthetic organism in-silico has been receiving increasing attention. A few programming languages for synthetic biology capable of defining, constructing, networking, editing and delivering genome scale models of cellular processes have been recently attempted. All these represent important points in a spectrum of possibilities. This paper introduces Kera, a state of the art programming language for synthetic biology which is arguably ahead of similar languages or tools such as GEC, Antimony and GenoCAD. Kera is a full-fledged object oriented programming language which is tempered by biopart rule library named Samhita which captures the knowledge regarding the interaction of genome components and catalytic molecules. Prominent feature of the language are demonstrated through a toy example and the road map for the future development of Kera is also presented.

  11. Is synthetic biology mechanical biology?

    Science.gov (United States)

    Holm, Sune

    2015-12-01

    A widespread and influential characterization of synthetic biology emphasizes that synthetic biology is the application of engineering principles to living systems. Furthermore, there is a strong tendency to express the engineering approach to organisms in terms of what seems to be an ontological claim: organisms are machines. In the paper I investigate the ontological and heuristic significance of the machine analogy in synthetic biology. I argue that the use of the machine analogy and the aim of producing rationally designed organisms does not necessarily imply a commitment to mechanical biology. The ideal of applying engineering principles to biology is best understood as expressing recognition of the machine-unlikeness of natural organisms and the limits of human cognition. The paper suggests an interpretation of the identification of organisms with machines in synthetic biology according to which it expresses a strategy for representing, understanding, and constructing living systems that are more machine-like than natural organisms.

  12. Synthetic Biology for Specialty Chemicals.

    Science.gov (United States)

    Markham, Kelly A; Alper, Hal S

    2015-01-01

    In this review, we address recent advances in the field of synthetic biology and describe how those tools have been applied to produce a wide variety of chemicals in microorganisms. Here we classify the expansion of the synthetic biology toolbox into three different categories based on their primary function in strain engineering-for design, for construction, and for optimization. Next, focusing on recent years, we look at how chemicals have been produced using these new synthetic biology tools. Advances in producing fuels are briefly described, followed by a more thorough treatment of commodity chemicals, specialty chemicals, pharmaceuticals, and nutraceuticals. Throughout this review, an emphasis is placed on how synthetic biology tools are applied to strain engineering. Finally, we discuss organism and host strain diversity and provide a future outlook in the field.

  13. SYNTHETIC SLING FAILURE - EVALUATIONS & RECOMMENDATIONS

    Energy Technology Data Exchange (ETDEWEB)

    MACKEY TC; HENDERSON CS

    2009-10-26

    The information and evaluations provided in this report were compiled to address the recurring problem of synthetic sling failure. As safety is the number one priority in all work aspects, a solution must be devised to prevent accidents from occurring. A total of thirteen cases regarding synthetic sling failure were evaluated in order to determine their causes, effects, and preventative measures. From the collected data, it was found that all cases in which the synthetic sling contacted the edge of its load resulted in sling failure. It is required that adequate synthetic sling protection devices be used to protect slings in any lift where the sling comes in direct contact with the edge or corner of its load. However, there are no consensus codes or standards stating the type, material, or purpose of the type of protective device used to protect the sling from being cut. Numerous industry standards and codes provide vague descriptions on how to protect synthetic slings. Without a clear, concise statement of how to protect synthetic slings, it is common for inadequate materials and sling protection devices to be used in an attempt to meet the intent of these requirements. The use of an inadequate sling protection device is the main cause of synthetic sling failure in all researched cases. Commercial sling protection devices come in many shapes and sizes, and have a variety of names, as well as advertised uses. 'Abrasion pads' and 'wear protectors' are two different names for products with the same intended purpose. There is no distinguishable way to determine the extent of sling protection which these devices will provide, or what specific scenarios they are made for. This creates room for error in a field where error is unacceptable. This report provides a recommended action for hoisting and rigging activities which require synthetic slings to contact a load, as well as recommended changes to industry standards which will benefit overall

  14. Biosynthesis of monoterpenes. Enantioselectivity in the enzymatic cyclization of (+)- and (-)-linalyl pyrophosphate to (+)- and (-)-pinene and (+)- and (-)-camphene

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.; Satterwhite, D.M.; Cane, D.E.; Chang, C.C.

    1988-07-25

    Cyclase I from Salvia officinalis leaf catalyzes the conversion of geranyl pyrophosphate to the stereo-chemically related bicyclic monoterpenes (+)-alpha-pinene and (+)-camphene and to lesser quantities of monocyclic and acyclic olefins, whereas cyclase II from this plant tissue converts the same acyclic precursor to (-)-alpha-pinene, (-)-beta-pinene and (-)-camphene as well as to lesser amounts of monocyclics and acyclics. These antipodal cyclizations are considered to proceed by the initial isomerization of the substrate to the respective bound tertiary allylic intermediates (-)-(3R)- and (+)-(3S)-linalyl pyrophosphate. ((3R)-8,9-14C,(3RS)-1E-3H)Linalyl pyrophosphate (3H:14C = 5.14) was tested as a substrate with both cyclases to determine the configuration of the cyclizing intermediate. This substrate with cyclase I yielded alpha-pinene and camphene with 3H:14C ratios of 3.1 and 4.2, respectively, indicating preferential, but not exclusive, utilization of the (3R)-enantiomer. With cyclase II, the doubly labeled substrate gave bicyclic olefins with 3H:14C ratios of from 13 to 20, indicating preferential, but not exclusive, utilization of the (3S)-enantiomer in this case. (3R)- and (3S)-(1Z-3H)linalyl pyrophosphate were separately compared to the achiral precursors (1-3H)geranyl pyrophosphate and (1-3H)neryl pyrophosphate (cis-isomer) as substrates for the cyclizations. With cyclase I, geranyl, neryl, and (3R)-linalyl pyrophosphate gave rise exclusively to (+)-alpha-pinene and (+)-camphene, whereas (3S)-linayl pyrophosphate produced, at relatively low rates, the (-)-isomers. With cyclase II, geranyl, neryl, and (3S)-linalyl pyrophosphate yielded exclusively the (-)-isomer series, whereas (3R)-linalyl pyrophosphate afforded the (+)-isomers at low rates.

  15. Impacts of soil moisture on de-novo monoterpene emissions from European beech, Holm oak, Scots pine, and Norway spruce

    Directory of Open Access Journals (Sweden)

    C. Wu

    2014-09-01

    Full Text Available Impacts of soil moisture on de-novo monoterpene (MT emissions from Holm oak, European beech, Scots pine, and Norway spruce were studied in laboratory experiments. The volumetric water content of the soil, Θ, was used as reference quantity to parameterize the dependency of MT emissions on soil moisture and to characterize the severity of the drought. When Θ dropped from 0.4 m3 m−3 to ~ 0.2 m3 m−3 slight increases of de-novo MT emissions were observed but with further progressing drought the emissions decreased to almost zero. The increases of MT emissions observed under conditions of mild drought were explainable by increases of leaf temperature due to lowered transpirational cooling. When Θ fell below certain thresholds, MT emissions decreased simultaneously with Θ and the relationship between Θ and MT emissions was approximately linear. The thresholds of Θ (0.044–0.19 m3 m−3 were determined as well other parameters required to describe the soil moisture dependence of de-novo MT emissions for application in the Model of Emissions of Gases and Aerosols from Nature, MEGAN. A factorial approach was found appropriate to describe the impacts of Θ, temperature, and light. Temperature and Θ influenced the emissions largely independent from each other, and, in a similar manner, light intensity and Θ acted independently on de-novo MT emissions. The use of Θ as reference quantity in a factorial approach was tenable in predicting constitutive de-novo MT emissions when Θ changed on a time scale of days. Only when soil moisture changed suddenly empirical parameterization with Θ as a reference was unsuccessful.

  16. Evaluation of two adsorbents for diffusive sampling and thermal desorption-gas chromatographic analysis of monoterpenes in air.

    Science.gov (United States)

    Sunesson, A L; Sundgren, M; Levin, J O; Eriksson, K; Carlson, R

    1999-02-01

    Tube type samplers with two different adsorbents, Chromosorb 106 and Tenax TA, were evaluated by laboratory experiments and field tests for simultaneous diffusive sampling of alpha-pinene, beta-pinene and delta 3-carene and subsequent thermal desorption-gas chromatographic analysis. No statistically significant effects of exposure time, concentrations of monoterpenes or relative humidity were found for samplers with Chromosorb 106 when running a factorial design, with the exception of the adsorption of delta 3-carene, for which some weak effects were noted. Samplers with Tenax TA were affected by the sampling time as well as the concentration for all terpenes, with a strong interaction effect between these two factors. The terpenes showed good storage stability on both adsorbents. No effect of back-diffusion was noted when using Chromosorb 106, while Tenax TA showed some back-diffusion effects. The uptake rates, in ml min-1, for the terpenes on Chromosorb 106 were 0.36 for alpha-pinene, 0.36 for beta-pinene and 0.40 for delta 3-carene. The corresponding average values on Tenax TA were 0.30 for alpha-pinene, 0.32 for beta-pinene and 0.38 for delta 3-carene. The field validation proved that diffusive sampling on Chromosorb 106 agreed well with pumped sampling on charcoal for stationary samples, while the personal samples indicated a discrepancy of 25% between Chromosorb 106 and charcoal samples. Tenax TA generally gave lower results than Chromosorb 106 in all field samples. Samplers packed with Chromosorb 106 could be used to monitor terpene levels in workplaces such as sawmills. The major advantages with this method are the sampling procedure, which is simple to perform compared to other techniques, the easily automated analysis procedure and the possibility to reuse the samplers.

  17. Enantioselective Enzymes by Computational Design and In Silico Screening

    NARCIS (Netherlands)

    Wijma, Hein J; Floor, Robert J; Bjelic, Sinisa; Marrink, Siewert J; Baker, David; Janssen, Dick B

    2015-01-01

    Computational enzyme design holds great promise for providing new biocatalysts for synthetic chemistry. A strategy to design small mutant libraries of complementary enantioselective epoxide hydrolase variants for the production of highly enantioenriched (S,S)-diols and (R,R)-diols is developed. Key

  18. Semisupervised Gaussian Process for Automated Enzyme Search.

    Science.gov (United States)

    Mellor, Joseph; Grigoras, Ioana; Carbonell, Pablo; Faulon, Jean-Loup

    2016-06-17

    Synthetic biology is today harnessing the design of novel and greener biosynthesis routes for the production of added-value chemicals and natural products. The design of novel pathways often requires a detailed selection of enzyme sequences to import into the chassis at each of the reaction steps. To address such design requirements in an automated way, we present here a tool for exploring the space of enzymatic reactions. Given a reaction and an enzyme the tool provides a probability estimate that the enzyme catalyzes the reaction. Our tool first considers the similarity of a reaction to known biochemical reactions with respect to signatures around their reaction centers. Signatures are defined based on chemical transformation rules by using extended connectivity fingerprint descriptors. A semisupervised Gaussian process model associated with the similar known reactions then provides the probability estimate. The Gaussian process model uses information about both the reaction and the enzyme in providing the estimate. These estimates were validated experimentally by the application of the Gaussian process model to a newly identified metabolite in Escherichia coli in order to search for the enzymes catalyzing its associated reactions. Furthermore, we show with several pathway design examples how such ability to assign probability estimates to enzymatic reactions provides the potential to assist in bioengineering applications, providing experimental validation to our proposed approach. To the best of our knowledge, the proposed approach is the first application of Gaussian processes dealing with biological sequences and chemicals, the use of a semisupervised Gaussian process framework is also novel in the context of machine learning applied to bioinformatics. However, the ability of an enzyme to catalyze a reaction depends on the affinity between the substrates of the reaction and the enzyme. This affinity is generally quantified by the Michaelis constant KM

  19. Freedom and Responsibility in Synthetic Genomics: The Synthetic Yeast Project.

    Science.gov (United States)

    Sliva, Anna; Yang, Huanming; Boeke, Jef D; Mathews, Debra J H

    2015-08-01

    First introduced in 2011, the Synthetic Yeast Genome (Sc2.0) PROJECT is a large international synthetic genomics project that will culminate in the first eukaryotic cell (Saccharomyces cerevisiae) with a fully synthetic genome. With collaborators from across the globe and from a range of institutions spanning from do-it-yourself biology (DIYbio) to commercial enterprises, it is important that all scientists working on this project are cognizant of the ethical and policy issues associated with this field of research and operate under a common set of principles. In this commentary, we survey the current ethics and regulatory landscape of synthetic biology and present the Sc2.0 Statement of Ethics and Governance to which all members of the project adhere. This statement focuses on four aspects of the Sc2.0 PROJECT: societal benefit, intellectual property, safety, and self-governance. We propose that such project-level agreements are an important, valuable, and flexible model of self-regulation for similar global, large-scale synthetic biology projects in order to maximize the benefits and minimize potential harms. Copyright © 2015 by the Genetics Society of America.

  20. Freedom and Responsibility in Synthetic Genomics: The Synthetic Yeast Project

    Science.gov (United States)

    Sliva, Anna; Yang, Huanming; Boeke, Jef D.; Mathews, Debra J. H.

    2015-01-01

    First introduced in 2011, the Synthetic Yeast Genome (Sc2.0) Project is a large international synthetic genomics project that will culminate in the first eukaryotic cell (Saccharomyces cerevisiae) with a fully synthetic genome. With collaborators from across the globe and from a range of institutions spanning from do-it-yourself biology (DIYbio) to commercial enterprises, it is important that all scientists working on this project are cognizant of the ethical and policy issues associated with this field of research and operate under a common set of principles. In this commentary, we survey the current ethics and regulatory landscape of synthetic biology and present the Sc2.0 Statement of Ethics and Governance to which all members of the project adhere. This statement focuses on four aspects of the Sc2.0 Project: societal benefit, intellectual property, safety, and self-governance. We propose that such project-level agreements are an important, valuable, and flexible model of self-regulation for similar global, large-scale synthetic biology projects in order to maximize the benefits and minimize potential harms. PMID:26272997

  1. Multi-enzyme catalyzed processes: Next generation biocatalysis

    DEFF Research Database (Denmark)

    Andrade Santacoloma, Paloma de Gracia; Sin, Gürkan; Gernaey, Krist

    2011-01-01

    considerations for mathematical modeling are discussed for the specific case where the synthetic reactions are carried out in a single reactor, the so-called multienzyme ‘in-pot’ process. In addition, options for multienzyme ‘in-pot’ process improvements via process engineering and enzyme immobilization...... technology are described. Finally, enzyme modification via protein engineering is also discussed, such that a better compatibility of the enzymes in the reactor is achieved as a means of assisting the implementation of multienzyme ‘in-pot’ processes....

  2. Enzyme kinetics of conjugating enzymes: PAPS sulfotransferase.

    Science.gov (United States)

    James, Margaret O

    2014-01-01

    The sulfotransferase (SULT) enzymes catalyze the formation of sulfate esters or sulfamates from substrates that contain hydroxy or amine groups, utilizing 3'-phosphoadenosyl-5'-phosphosulfate (PAPS) as the donor of the sulfonic group. The rate of product formation depends on the concentrations of PAPS and substrate as well as the sulfotransferase enzyme; thus, if PAPS is held constant while varying substrate concentration (or vice versa), the kinetic constants derived are apparent constants. When studied over a narrow range of substrate concentrations, classic Michaelis-Menten kinetics can be observed with many SULT enzymes and most substrates. Some SULT enzymes exhibit positive or negative cooperativity during conversion of substrate to product, and the kinetics fit the Hill plot. A characteristic feature of most sulfotransferase-catalyzed reactions is that, when studied over a wide range of substrate concentrations, the rate of product formation initially increases as substrate concentration increases, then decreases at high substrate concentrations, i.e., they exhibit substrate inhibition or partial substrate inhibition. This chapter gives an introduction to sulfotransferases, including a historical note, the nomenclature, a description of the function of SULTs with different types of substrates, presentation of examples of enzyme kinetics with SULTs, and a discussion of what is known about mechanisms of substrate inhibition in the sulfotransferases.

  3. In-situ ambient quantification of monoterpenes, sesquiterpenes, and related oxygenated compounds during BEARPEX 2007 – implications for gas- and particle-phase chemistry

    Directory of Open Access Journals (Sweden)

    N. C. Bouvier-Brown

    2009-04-01

    Full Text Available We quantified ambient mixing ratios of 9 monoterpenes, 6 sesquiterpenes, methyl chavicol, the oxygenated terpene linalool, and nopinone using an in-situ gas chromatograph with a quadrupole mass spectrometer (GC-MS. These measurements were a part of the 2007 Biosphere Effects on AeRosols and Photochemistry EXperiment (BEARPEX at Blodgett Forest, a ponderosa pine forest in the Sierra Nevada Mountains of California. To our knowledge, these observations represent the first direct in-situ ambient quantification of the sesquiterpenes α-bergamotene, longifolene, α-farnesene, and β-farnesene. From average diurnal mixing ratio profiles, we show that α-farnesene emissions are dependent mainly on temperature whereas α-bergamotene and β-farnesene emissions are temperature- and light-dependent. The amount of sesquiterpene mass quantified above the canopy was small (averaging a total of 3.3 ppt during the day, but nevertheless these compounds contributed 8.5% to the overall ozone reactivity above the canopy. Assuming that the monoterpene-to-sesquiterpene emission rate in the canopy is similar to that observed in branch enclosure studies at the site during comparable weather conditions, and the average yield of aerosol mass from these sesquiterpenes is 10–50%, the amount of sesquiterpene mass reacted within the Blodgett Forest canopy alone accounts for 8–38% of the total organic aerosol mass measured during BEARPEX. The oxygenated monoterpene linalool was also quantified for the first time at Blodgett Forest. The linalool mass contribution was small (9.9 ppt and 0.74 ppt within and above the canopy, respectively, but it contributed 1.2% to the total ozone reactivity above the canopy. Reactive and semi-volatile compounds, especially sesquiterpenes, significantly impact the gas- and particle-phase chemistry of the atmosphere at Blodgett Forest and should be included in both biogenic volatile organic carbon emission and atmospheric chemistry models.

  4. In-situ ambient quantification of monoterpenes, sesquiterpenes, and related oxygenated compounds during BEARPEX 2007: implications for gas- and particle-phase chemistry

    Directory of Open Access Journals (Sweden)

    N. C. Bouvier-Brown

    2009-08-01

    Full Text Available We quantified ambient mixing ratios of 9 monoterpenes, 6 sesquiterpenes, methyl chavicol, the oxygenated terpene linalool, and nopinone using an in-situ gas chromatograph with a quadrupole mass spectrometer (GC-MS. These measurements were a part of the 2007 Biosphere Effects on AeRosols and Photochemistry EXperiment (BEARPEX at Blodgett Forest, a ponderosa pine forest in the Sierra Nevada Mountains of California. To our knowledge, these observations represent the first direct in-situ ambient quantification of the sesquiterpenes α-bergamotene, longifolene, α-farnesene, and β-farnesene. From average diurnal mixing ratio profiles, we show that α-farnesene emissions are dependent mainly on temperature whereas α-bergamotene and β-farnesene emissions are temperature- and light-dependent. The amount of sesquiterpene mass quantified above the canopy was small (averaging a total of 3.3 ppt during the day, but nevertheless these compounds contributed 7.6% to the overall ozone-olefin loss rate above the canopy. Assuming that the monoterpene-to-sesquiterpene emission rate in the canopy is similar to that observed in branch enclosure studies at the site during comparable weather conditions, and the average yield of aerosol mass from these sesquiterpenes is 10–50%, the amount of sesquiterpene mass reacted within the Blodgett Forest canopy alone accounts for 6–32% of the total organic aerosol mass measured during BEARPEX. The oxygenated monoterpene linalool was also quantified for the first time at Blodgett Forest. The linalool mass contribution was small (9.9 ppt and 0.74 ppt within and above the canopy, respectively, but it contributed 1.1% to the total ozone-olefin loss rate above the canopy. Reactive and semi-volatile compounds, especially sesquiterpenes, significantly impact the gas- and particle-phase chemistry of the atmosphere at Blodgett Forest and should be included in both biogenic volatile organic carbon emission and atmospheric chemistry

  5. Presence of monoterpene synthase in four Labiatae species and Solid-Phase Microextraction- Gas chromatography-Mass Spectroscopy analysis of their aroma profiles

    Directory of Open Access Journals (Sweden)

    Soodabeh Saeidnia

    2014-01-01

    Full Text Available Background: The family Lamiaceae (Labiatae has included some medicinal plants. some monoterpene synthases, including linalool and limonene synthases, have been cloned and functionally characterized from several plants of Labiatae family. Materials and Methods: In this study, presence of linalool and limonene synthases, in four species of Labiatae family including Nepeta cataria, Lavandula angustifolia, Hyssopus officinalis and Salvia sclarea has been determined by molecular biological techniques together with the Head space SPME - GC-MS analysis of the aroma profile of these species. Results: Indicated that none of the plant species produced distinguishable bands with primer pairs related to d-limonene synthase. Distinguishable bands around 1800 bp in cDNA samples of L. angustifolia, H. officinalis and S. sclarea were observed regarding to the presence of linalool synthase. Head space SPME-GC-MS analysis of the aroma profiles of the above-mentioned plants showed that linalool (31.0%, linalyl acetate (18.2%, were found as the major compounds of L. angustifolia, while geraniol (5.5%, nerol (34.0% and α- citral (52.0% were identified as the main compounds of the N. cataria. The major components of H. officinalis and S. sclarea oils were determined as cis-pinocamphone (57.3%, and linalool (19.0%, linalyl acetate (51.5%, respectively. Conclusion: H. officinalis was rich of cyclic monoterpenes, L. angustifolia, N. cataria and S. sclarea showed considerable amount of linear monoterpenes. The aroma profile of the above-mentioned plants contained low concentration of sesquiterpenes except N. cataria, which indicated no sesquiterpene. The profiles of the main components of these plants are in agreement with molecular assays.

  6. METABOLIC MODELLING IN THE DEVELOPMENT OF CELL FACTORIES BY SYNTHETIC BIOLOGY

    Directory of Open Access Journals (Sweden)

    Paula Jouhten

    2012-10-01

    Full Text Available Cell factories are commonly microbial organisms utilized for bioconversion of renewable resources to bulk or high value chemicals. Introduction of novel production pathways in chassis strains is the core of the development of cell factories by synthetic biology. Synthetic biology aims to create novel biological functions and systems not found in nature by combining biology with engineering. The workflow of the development of novel cell factories with synthetic biology is ideally linear which will be attainable with the quantitative engineering approach, high-quality predictive models, and libraries of well-characterized parts. Different types of metabolic models, mathematical representations of metabolism and its components, enzymes and metabolites, are useful in particular phases of the synthetic biology workflow. In this minireview, the role of metabolic modelling in synthetic biology will be discussed with a review of current status of compatible methods and models for the in silico design and quantitative evaluation of a cell factory.

  7. Every plant for himself; the effect of a phenolic monoterpene on germination and biomass of Thymus pulegioides and T. serpyllum.

    DEFF Research Database (Denmark)

    Jensen, Catrine Grønberg; Ehlers, Bodil

    2009-01-01

    by thyme plants is found both within and among species. In Denmark two thyme species (Thymus pulegioides and T. serpyllum) are naturally occurring. The essential oil of T. pulegioides in Denmark is mainly dominated by one monoterpene; 'carvacrol'. In contrast, the essential oil of T. serpyllum constitutes......Thyme plants are known for their production of aromatic oils, whose main component is terpenes. The plants leach terpenes to their surroundings and thereby affect the seed germination and biomass of associated plants, but also potentially themselves. A variation in the dominant terpenes produced...

  8. Meeting Report: Synthetic Biology Jamboree for Undergraduates

    Science.gov (United States)

    Campbell, A. Malcolm

    2005-01-01

    The field of synthetic biology (the name is derived from an analogy to synthetic chemistry) has recognized itself as a "field" only since about 2002. Synthetic biology has gotten some high-profile attention recently, but most people are not aware the field even exists. Synthetic biologists apply engineering principles to genomic circuits to…

  9. Meeting Report: Synthetic Biology Jamboree for Undergraduates

    Science.gov (United States)

    Campbell, A. Malcolm

    2005-01-01

    The field of synthetic biology (the name is derived from an analogy to synthetic chemistry) has recognized itself as a "field" only since about 2002. Synthetic biology has gotten some high-profile attention recently, but most people are not aware the field even exists. Synthetic biologists apply engineering principles to genomic circuits to…

  10. Control theory meets synthetic biology.

    Science.gov (United States)

    Del Vecchio, Domitilla; Dy, Aaron J; Qian, Yili

    2016-07-01

    The past several years have witnessed an increased presence of control theoretic concepts in synthetic biology. This review presents an organized summary of how these control design concepts have been applied to tackle a variety of problems faced when building synthetic biomolecular circuits in living cells. In particular, we describe success stories that demonstrate how simple or more elaborate control design methods can be used to make the behaviour of synthetic genetic circuits within a single cell or across a cell population more reliable, predictable and robust to perturbations. The description especially highlights technical challenges that uniquely arise from the need to implement control designs within a new hardware setting, along with implemented or proposed solutions. Some engineering solutions employing complex feedback control schemes are also described, which, however, still require a deeper theoretical analysis of stability, performance and robustness properties. Overall, this paper should help synthetic biologists become familiar with feedback control concepts as they can be used in their application area. At the same time, it should provide some domain knowledge to control theorists who wish to enter the rising and exciting field of synthetic biology.

  11. Control theory meets synthetic biology

    Science.gov (United States)

    2016-01-01

    The past several years have witnessed an increased presence of control theoretic concepts in synthetic biology. This review presents an organized summary of how these control design concepts have been applied to tackle a variety of problems faced when building synthetic biomolecular circuits in living cells. In particular, we describe success stories that demonstrate how simple or more elaborate control design methods can be used to make the behaviour of synthetic genetic circuits within a single cell or across a cell population more reliable, predictable and robust to perturbations. The description especially highlights technical challenges that uniquely arise from the need to implement control designs within a new hardware setting, along with implemented or proposed solutions. Some engineering solutions employing complex feedback control schemes are also described, which, however, still require a deeper theoretical analysis of stability, performance and robustness properties. Overall, this paper should help synthetic biologists become familiar with feedback control concepts as they can be used in their application area. At the same time, it should provide some domain knowledge to control theorists who wish to enter the rising and exciting field of synthetic biology. PMID:27440256

  12. Enzymes for improved biomass conversion

    Science.gov (United States)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  13. Enzymes for improved biomass conversion

    Energy Technology Data Exchange (ETDEWEB)

    Brunecky, Roman; Himmel, Michael E.

    2016-02-02

    Disclosed herein are enzymes and combinations of the enzymes useful for the hydrolysis of cellulose and the conversion of biomass. Methods of degrading cellulose and biomass using enzymes and cocktails of enzymes are also disclosed.

  14. Profiling the orphan enzymes

    Science.gov (United States)

    2014-01-01

    The emergence of Next Generation Sequencing generates an incredible amount of sequence and great potential for new enzyme discovery. Despite this huge amount of data and the profusion of bioinformatic methods for function prediction, a large part of known enzyme activities is still lacking an associated protein sequence. These particular activities are called “orphan enzymes”. The present review proposes an update of previous surveys on orphan enzymes by mining the current content of public databases. While the percentage of orphan enzyme activities has decreased from 38% to 22% in ten years, there are still more than 1,000 orphans among the 5,000 entries of the Enzyme Commission (EC) classification. Taking into account all the reactions present in metabolic databases, this proportion dramatically increases to reach nearly 50% of orphans and many of them are not associated to a known pathway. We extended our survey to “local orphan enzymes” that are activities which have no representative sequence in a given clade, but have at least one in organisms belonging to other clades. We observe an important bias in Archaea and find that in general more than 30% of the EC activities have incomplete sequence information in at least one superkingdom. To estimate if candidate proteins for local orphans could be retrieved by homology search, we applied a simple strategy based on the PRIAM software and noticed that candidates may be proposed for an important fraction of local orphan enzymes. Finally, by studying relation between protein domains and catalyzed activities, it appears that newly discovered enzymes are mostly associated with already known enzyme domains. Thus, the exploration of the promiscuity and the multifunctional aspect of known enzyme families may solve part of the orphan enzyme issue. We conclude this review with a presentation of recent initiatives in finding proteins for orphan enzymes and in extending the enzyme world by the discovery of new

  15. Unhairing with enzymes

    OpenAIRE

    Crispim, A.; Mota, M.

    2003-01-01

    The use of enzymes in the leather industry is increasing and their application is being widened to include operations such as de-greasing, unhairing and other wet-end operations. Enzymes can also be used to assist with recycling leather wastes as well as to avoid pollution. The present work is devoted to illustrate the potential application of enzymes in unhairing without hair destruction. Enzymatic unhairing is based upon the weakening of the epidermis basal layer to which the hair is at...

  16. Adenylate-forming enzymes

    Science.gov (United States)

    Schmelz, Stefan; Naismith, James H.

    2012-01-01

    Thioesters, amides and esters are common chemical building blocks in a wide array of natural products. The formation of these bonds can be catalyzed in a variety of ways. For chemists, the use of an activating group is a common strategy and adenylate enzymes are exemplars of this approach. Adenylating enzymes activate the otherwise unreactive carboxylic acid by transforming the normal hydroxyl leaving group into adenosine monophosphate. Recently there have been a number of studies of such enzymes and in this review we suggest a new classification scheme. The review highlights the diversity in enzyme fold, active site architecture and metal coordination that has evolved to catalyze this particular reaction. PMID:19836944

  17. Food and feed enzymes.

    Science.gov (United States)

    Fraatz, Marco Alexander; Rühl, Martin; Zorn, Holger

    2014-01-01

    Humans have benefited from the unique catalytic properties of enzymes, in particular for food production, for thousands of years. Prominent examples include the production of fermented alcoholic beverages, such as beer and wine, as well as bakery and dairy products. The chapter reviews the historic background of the development of modern enzyme technology and provides an overview of the industrial food and feed enzymes currently available on the world market. The chapter highlights enzyme applications for the improvement of resource efficiency, the biopreservation of food, and the treatment of food intolerances. Further topics address the improvement of food safety and food quality.

  18. Microbial amylolytic enzymes.

    Science.gov (United States)

    Vihinen, M; Mäntsälä, P

    1989-01-01

    Starch-degrading, amylolytic enzymes are widely distributed among microbes. Several activities are required to hydrolyze starch to its glucose units. These enzymes include alpha-amylase, beta-amylase, glucoamylase, alpha-glucosidase, pullulan-degrading enzymes, exoacting enzymes yielding alpha-type endproducts, and cyclodextrin glycosyltransferase. Properties of these enzymes vary and are somewhat linked to the environmental circumstances of the producing organisms. Features of the enzymes, their action patterns, physicochemical properties, occurrence, genetics, and results obtained from cloning of the genes are described. Among all the amylolytic enzymes, the genetics of alpha-amylase in Bacillus subtilis are best known. Alpha-Amylase production in B. subtilis is regulated by several genetic elements, many of which have synergistic effects. Genes encoding enzymes from all the amylolytic enzyme groups dealt with here have been cloned, and the sequences have been found to contain some highly conserved regions thought to be essential for their action and/or structure. Glucoamylase appears usually in several forms, which seem to be the results of a variety of mechanisms, including heterogeneous glycosylation, limited proteolysis, multiple modes of mRNA splicing, and the presence of several structural genes.

  19. Designer Drugs: A Synthetic Catastrophe

    Directory of Open Access Journals (Sweden)

    James Fratantonio

    2015-08-01

    Full Text Available Synthetic stimulants can cause hallucinations, aggressive behaviors, death and are sometimes legal. These substances are sold as plant food and bath salts that are "Not for Human Consumption", therefore skirting the 1986 Federal Analogue Act and giving a false pretense of safety. Studies have proved that these substances are toxic, have a high abuse potential, and are becoming extremely prevalent in the United States. This creates a dilemma for law enforcement agents, hospitals, and substance use disorder treatment centers. Urine Drug Testing is utilized as a clinical diagnostic tool in substance use disorder treatment centers, and the furious pace at which new synthetic stimulants are introduced to the black market are making the detection via urine increasingly difficult. This article will discuss the prevalence, pharmacology and difficulty developing laboratory assays to detect synthetic stimulants.

  20. Synthetic neurosteroids on brain protection

    Directory of Open Access Journals (Sweden)

    Mariana Rey

    2015-01-01

    Full Text Available Neurosteroids, like allopregnanolone and pregnanolone, are endogenous regulators of neuronal excitability. Inside the brain, they are highly selective and potent modulators of GABA A receptor activity. Their anticonvulsant, anesthetics and anxiolytic properties are useful for the treatments of several neurological and psychiatric disorders via reducing the risks of side effects obtained with the commercial drugs. The principal disadvantages of endogenous neurosteroids administration are their rapid metabolism and their low oral bioavailability. Synthetic steroids analogues with major stability or endogenous neurosteroids stimulation synthesis might constitute promising novel strategies for the treatment of several disorders. Numerous studies indicate that the 3α-hydroxyl configuration is the key for binding and activity, but modifications in the steroid nucleus may emphasize different pharmacophores. So far, several synthetic steroids have been developed with successful neurosteroid-like effects. In this work, we summarize the properties of various synthetic steroids probed in trials throughout the analysis of several neurosteroids-like actions.

  1. Synthetic neurosteroids on brain protection

    Institute of Scientific and Technical Information of China (English)

    Mariana Rey; Hctor Coirini

    2015-01-01

    Neurosteroids, like allopregnanolone and pregnanolone, are endogenous regulators of neuronal excitability. Inside the brain, they are highly selective and potent modulators of GABAA receptor activity. Their anticonvulsant, anesthetics and anxiolytic properties are useful for the treatments of several neurological and psychiatric disordersvia reducing the risks of side effects obtained with the commercial drugs. The principal disadvantages of endogenous neurosteroids adminis-tration are their rapid metabolism and their low oral bioavailability. Synthetic steroids analogues with major stability or endogenous neurosteroids stimulation synthesis might constitute prom-ising novel strategies for the treatment of several disorders. Numerous studies indicate that the 3α-hydroxyl conifguration is the key for binding and activity, but modiifcations in the steroid nucleus may emphasize different pharmacophores. So far, several synthetic steroids have been developed with successful neurosteroid-like effects. In this work, we summarize the properties of various synthetic steroids probed in trials throughout the analysis of several neurosteroids-like actions.

  2. Microfluidic Technologies for Synthetic Biology

    Directory of Open Access Journals (Sweden)

    Sung Kuk Lee

    2011-06-01

    Full Text Available Microfluidic technologies have shown powerful abilities for reducing cost, time, and labor, and at the same time, for increasing accuracy, throughput, and performance in the analysis of biological and biochemical samples compared with the conventional, macroscale instruments. Synthetic biology is an emerging field of biology and has drawn much attraction due to its potential to create novel, functional biological parts and systems for special purposes. Since it is believed that the development of synthetic biology can be accelerated through the use of microfluidic technology, in this review work we focus our discussion on the latest microfluidic technologies that can provide unprecedented means in synthetic biology for dynamic profiling of gene expression/regulation with high resolution, highly sensitive on-chip and off-chip detection of metabolites, and whole-cell analysis.

  3. Synthetic Melanin E-Ink.

    Science.gov (United States)

    Chang, Lingqian; Chen, Feng; Zhang, Xiaokang; Kuang, Tairong; Li, Mi; Hu, Jiaming; Shi, Junfeng; Lee, Ly James; Cheng, Huanyu; Li, Yiwen

    2017-05-17

    Extensive efforts have been devoted to the development of surfactant-free electronic ink (E-ink) with excellent display resolution for high-definition resolution display. Herein, we report the use of polydopamine-based synthetic melanin, a class of functional nanoparticles with similar chemical compositions and physical properties to those of naturally occurring melanin, as a new E-ink material. It was found that such E-ink displays could achieve ultrahigh resolution (>10 000 ppi) and low power consumption (operation voltage of only 1 V) in aqueous solutions. Interestingly, simple oxidation of synthetic melanin nanoparticles enables the generation of intrinsic fluorescence, allowing further development of fluorescent E-ink displays with nanoscale resolution. We describe these bioinspired materials in an initial proof-of-concept study and propose that synthetic melanin nanoparticles will be suitable for electronic nanoinks with a potential wide range of applications in molecular patterning and fluorescence bioimaging.

  4. Designer Drugs: A Synthetic Catastrophe.

    Science.gov (United States)

    Fratantonio, James; Andrade, Lawrence; Febo, Marcelo

    Synthetic stimulants can cause hallucinations, aggressive behaviors, death and are sometimes legal. These substances are sold as plant food and bath salts that are "Not for Human Consumption", therefore skirting the 1986 Federal Analogue Act and giving a false pretense of safety. Studies have proved that these substances are toxic, have a high abuse potential, and are becoming extremely prevalent in the United States. This creates a dilemma for law enforcement agents, hospitals, and substance use disorder treatment centers. Urine Drug Testing is utilized as a clinical diagnostic tool in substance use disorder treatment centers, and the furious pace at which new synthetic stimulants are introduced to the black market are making the detection via urine increasingly difficult. This article will discuss the prevalence, pharmacology and difficulty developing laboratory assays to detect synthetic stimulants.

  5. Selection platforms for directed evolution in synthetic biology.

    Science.gov (United States)

    Tizei, Pedro A G; Csibra, Eszter; Torres, Leticia; Pinheiro, Vitor B

    2016-08-15

    Life on Earth is incredibly diverse. Yet, underneath that diversity, there are a number of constants and highly conserved processes: all life is based on DNA and RNA; the genetic code is universal; biology is limited to a small subset of potential chemistries. A vast amount of knowledge has been accrued through describing and characterizing enzymes, biological processes and organisms. Nevertheless, much remains to be understood about the natural world. One of the goals in Synthetic Biology is to recapitulate biological complexity from simple systems made from biological molecules-gaining a deeper understanding of life in the process. Directed evolution is a powerful tool in Synthetic Biology, able to bypass gaps in knowledge and capable of engineering even the most highly conserved biological processes. It encompasses a range of methodologies to create variation in a population and to select individual variants with the desired function-be it a ligand, enzyme, pathway or even whole organisms. Here, we present some of the basic frameworks that underpin all evolution platforms and review some of the recent contributions from directed evolution to synthetic biology, in particular methods that have been used to engineer the Central Dogma and the genetic code. © 2016 The Author(s).

  6. US Competitiveness in Synthetic Biology

    Science.gov (United States)

    2015-01-01

    Synthetic biology is an emerging technical field that aims to make biology easier to engineer; the field has applications in strategically important sectors for the US economy. While the United States currently leads in synthetic biology R&D, other nations are heavily investing in order to boost their economies, which will inevitably diminish the US leadership position. This outcome is not entirely negative—additional investments will expand markets—but it is critical that the US government take steps to remain competitive: There are applications from which the US population and economy may benefit; there are specific applications with importance for national defense; and US technical leadership will ensure that US experts have a leading role in synthetic biology governance, regulation, and oversight. Measures to increase competitiveness in S&T generally are broadly applicable for synthetic biology and should be pursued. However, the US government will also need to take action on fundamental issues that will affect the field's development, such as countering anti-GMO (genetically modified organism) sentiments and anti-GMO legislation. The United States should maintain its regulatory approach so that it is the product that is regulated, not the method used to create a product. At the same time, the United States needs to ensure that the regulatory framework is updated so that synthetic biology products do not fall into regulatory gaps. Finally, the United States needs to pay close attention to how synthetic biology applications may be governed internationally, such as through the Nagoya Protocol of the Convention on Biological Diversity, so that beneficial applications may be realized. PMID:26690379

  7. Synthetic biology as red herring.

    Science.gov (United States)

    Preston, Beth

    2013-12-01

    It has become commonplace to say that with the advent of technologies like synthetic biology the line between artifacts and living organisms, policed by metaphysicians since antiquity, is beginning to blur. But that line began to blur 10,000 years ago when plants and animals were first domesticated; and has been thoroughly blurred at least since agriculture became the dominant human subsistence pattern many millennia ago. Synthetic biology is ultimately only a late and unexceptional offshoot of this prehistoric development. From this perspective, then, synthetic biology is a red herring, distracting us from more thorough philosophical consideration of the most truly revolutionary human practice-agriculture. In the first section of this paper I will make this case with regard to ontology, arguing that synthetic biology crosses no ontological lines that were not crossed already in the Neolithic. In the second section I will construct a parallel case with regard to cognition, arguing that synthetic biology as biological engineering represents no cognitive advance over what was required for domestication and the new agricultural subsistence pattern it grounds. In the final section I will make the case with regard to human existence, arguing that synthetic biology, even if wildly successful, is not in a position to cause significant existential change in what it is to be human over and above the massive existential change caused by the transition to agriculture. I conclude that a longer historical perspective casts new light on some important issues in philosophy of technology and environmental philosophy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. US Competitiveness in Synthetic Biology.

    Science.gov (United States)

    Gronvall, Gigi Kwik

    2015-01-01

    Synthetic biology is an emerging technical field that aims to make biology easier to engineer; the field has applications in strategically important sectors for the US economy. While the United States currently leads in synthetic biology R&D, other nations are heavily investing in order to boost their economies, which will inevitably diminish the US leadership position. This outcome is not entirely negative--additional investments will expand markets--but it is critical that the US government take steps to remain competitive: There are applications from which the US population and economy may benefit; there are specific applications with importance for national defense; and US technical leadership will ensure that US experts have a leading role in synthetic biology governance, regulation, and oversight. Measures to increase competitiveness in S&T generally are broadly applicable for synthetic biology and should be pursued. However, the US government will also need to take action on fundamental issues that will affect the field's development, such as countering anti-GMO (genetically modified organism) sentiments and anti-GMO legislation. The United States should maintain its regulatory approach so that it is the product that is regulated, not the method used to create a product. At the same time, the United States needs to ensure that the regulatory framework is updated so that synthetic biology products do not fall into regulatory gaps. Finally, the United States needs to pay close attention to how synthetic biology applications may be governed internationally, such as through the Nagoya Protocol of the Convention on Biological Diversity, so that beneficial applications may be realized.

  9. Sequential Beamforming Synthetic Aperture Imaging

    DEFF Research Database (Denmark)

    Kortbek, Jacob; Jensen, Jørgen Arendt; Gammelmark, Kim Løkke

    2013-01-01

    Synthetic aperture sequential beamforming (SASB) is a novel technique which allows to implement synthetic aperture beamforming on a system with a restricted complexity, and without storing RF-data. The objective is to improve lateral resolution and obtain a more depth independent resolution...... and a range independent lateral resolution is obtained. The SASB method has been investigated using simulations in Field II and by off-line processing of data acquired with a commercial scanner. The lateral resolution increases with a decreasing F#. Grating lobes appear if F# 6 2 for a linear array with k-pitch...

  10. Design Automation in Synthetic Biology.

    Science.gov (United States)

    Appleton, Evan; Madsen, Curtis; Roehner, Nicholas; Densmore, Douglas

    2017-04-03

    Design automation refers to a category of software tools for designing systems that work together in a workflow for designing, building, testing, and analyzing systems with a target behavior. In synthetic biology, these tools are called bio-design automation (BDA) tools. In this review, we discuss the BDA tools areas-specify, design, build, test, and learn-and introduce the existing software tools designed to solve problems in these areas. We then detail the functionality of some of these tools and show how they can be used together to create the desired behavior of two types of modern synthetic genetic regulatory networks.

  11. Synthetic Phage for Tissue Regeneration

    Directory of Open Access Journals (Sweden)

    So Young Yoo

    2014-01-01

    Full Text Available Controlling structural organization and signaling motif display is of great importance to design the functional tissue regenerating materials. Synthetic phage, genetically engineered M13 bacteriophage has been recently introduced as novel tissue regeneration materials to display a high density of cell-signaling peptides on their major coat proteins for tissue regeneration purposes. Structural advantages of their long-rod shape and monodispersity can be taken together to construct nanofibrous scaffolds which support cell proliferation and differentiation as well as direct orientation of their growth in two or three dimensions. This review demonstrated how functional synthetic phage is designed and subsequently utilized for tissue regeneration that offers potential cell therapy.

  12. Synthetic biology and its promises

    Directory of Open Access Journals (Sweden)

    José Manuel De Cózar Escalante

    2016-12-01

    Full Text Available Synthetic biology is a new science and emerging technology, or rather a technoscience, which converges with others such as nanotechnology, information technology, robotics, artificial intelligence and neuroscience. All have common features that could have highly concerning social and environmental impacts. With its ambitious goals of controlling complexity, redesigning and creating new living entities, synthetic biology perfectly exemplifies the new bioeconomic reality. This requires expanding the focus of the discussion beyond the limited comparative analysis of risks and benefits, to address uncertainties, reassign responsibilities and initiate a thorough social assessment of what is at stake.

  13. Thymol, a dietary monoterpene phenol abrogates mitochondrial dysfunction in β-adrenergic agonist induced myocardial infarcted rats by inhibiting oxidative stress.

    Science.gov (United States)

    Nagoor Meeran, M F; Jagadeesh, G S; Selvaraj, P

    2016-01-25

    Mitochondrial dysfunction has been suggested to be one of the important pathological events in isoproterenol (ISO), a synthetic catecholamine and β-adrenergic agonist induced myocardial infarction (MI). In this context, we have evaluated the impact of thymol against ISO induced oxidative stress and calcium uniporter malfunction involved in the pathology of mitochondrial dysfunction in rats. Male albino Wistar rats were pre and co-treated with thymol (7.5 mg/kg body weight) daily for 7 days. Isoproterenol (100 mg/kg body weight) was subcutaneously injected into rats on 6th and 7th day to induce MI. To explore the extent of cardiac mitochondrial damage, the activities/levels of cardiac marker enzymes, mitochondrial lipid peroxidation products, antioxidants, lipids, calcium, adenosine triphosphate and multi marker enzymes were evaluated. Isoproterenol induced myocardial infarcted rats showed a significant increase in the activities of cardiac diagnostic markers, heart mitochondrial lipid peroxidation, lipids, calcium, and a significant decrease in the activities/levels of heart mitochondrial superoxide dismutase, catalase, glutathione peroxidase, reduced glutathione, isocitrate, malate, α-ketoglutarate and NADH-dehydrogenases, cytochrome-C-oxidase, and adenosine triphosphate. Thymol pre and co-treatment showed near normalized effects on all the biochemical parameters studied. Transmission electron microscopic findings and mitochondrial swelling studies confirmed our biochemical findings. The in vitro study also revealed the potent free-radical scavenging activity of thymol. Thus, thymol attenuates the involvement of ISO against oxidative stress and calcium uniporter malfunction associated with mitochondrial dysfunction in rats.

  14. Synthetic control of a fitness tradeoff in yeast nitrogen metabolism

    Directory of Open Access Journals (Sweden)

    Lee Jack J

    2009-01-01

    Full Text Available Abstract Background Microbial communities are involved in many processes relevant to industrial and medical biotechnology, such as the formation of biofilms, lignocellulosic degradation, and hydrogen production. The manipulation of synthetic and natural microbial communities and their underlying ecological parameters, such as fitness, evolvability, and variation, is an increasingly important area of research for synthetic biology. Results Here, we explored how synthetic control of an endogenous circuit can be used to regulate a tradeoff between fitness in resource abundant and resource limited environments in a population of Saccharomyces cerevisiae. We found that noise in the expression of a key enzyme in ammonia assimilation, Gdh1p, mediated a tradeoff between growth in low nitrogen environments and stress resistance in high ammonia environments. We implemented synthetic control of an endogenous Gdh1p regulatory network to construct an engineered strain in which the fitness of the population was tunable in response to an exogenously-added small molecule across a range of ammonia environments. Conclusion The ability to tune fitness and biological tradeoffs will be important components of future efforts to engineer microbial communities.

  15. Magnetically responsive enzyme powders

    Energy Technology Data Exchange (ETDEWEB)

    Pospiskova, Kristyna, E-mail: kristyna.pospiskova@upol.cz [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Safarik, Ivo, E-mail: ivosaf@yahoo.com [Regional Centre of Advanced Technologies and Materials, Palacky University, Slechtitelu 11, 783 71 Olomouc (Czech Republic); Department of Nanobiotechnology, Institute of Nanobiology and Structural Biology of GCRC, Na Sadkach 7, 370 05 Ceske Budejovice (Czech Republic)

    2015-04-15

    Powdered enzymes were transformed into their insoluble magnetic derivatives retaining their catalytic activity. Enzyme powders (e.g., trypsin and lipase) were suspended in various liquid media not allowing their solubilization (e.g., saturated ammonium sulfate and highly concentrated polyethylene glycol solutions, ethanol, methanol, 2-propanol) and subsequently cross-linked with glutaraldehyde. Magnetic modification was successfully performed at low temperature in a freezer (−20 °C) using magnetic iron oxides nano- and microparticles prepared by microwave-assisted synthesis from ferrous sulfate. Magnetized cross-linked enzyme powders were stable at least for two months in water suspension without leakage of fixed magnetic particles. Operational stability of magnetically responsive enzymes during eight repeated reaction cycles was generally without loss of enzyme activity. Separation of magnetically modified cross-linked powdered enzymes from reaction mixtures was significantly simplified due to their magnetic properties. - Highlights: • Cross-linked enzyme powders were prepared in various liquid media. • Insoluble enzymes were magnetized using iron oxides particles. • Magnetic iron oxides particles were prepared by microwave-assisted synthesis. • Magnetic modification was performed under low (freezing) temperature. • Cross-linked powdered trypsin and lipase can be used repeatedly for reaction.

  16. Artificial Enzymes, "Chemzymes"

    DEFF Research Database (Denmark)

    Bjerre, Jeannette; Rousseau, Cyril Andre Raphaël; Pedersen, Lavinia Georgeta M

    2008-01-01

    Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models that successf......Enzymes have fascinated scientists since their discovery and, over some decades, one aim in organic chemistry has been the creation of molecules that mimic the active sites of enzymes and promote catalysis. Nevertheless, even today, there are relatively few examples of enzyme models...... that successfully perform Michaelis-Menten catalysis under enzymatic conditions (i.e., aqueous medium, neutral pH, ambient temperature) and for those that do, very high rate accelerations are seldomly seen. This review will provide a brief summary of the recent developments in artificial enzymes, so called...... "Chemzymes", based on cyclodextrins and other molecules. Only the chemzymes that have shown enzyme-like activity that has been quantified by different methods will be mentioned. This review will summarize the work done in the field of artificial glycosidases, oxidases, epoxidases, and esterases, as well...

  17. Enzymes in Fermented Fish.

    Science.gov (United States)

    Giyatmi; Irianto, H E

    Fermented fish products are very popular particularly in Southeast Asian countries. These products have unique characteristics, especially in terms of aroma, flavor, and texture developing during fermentation process. Proteolytic enzymes have a main role in hydrolyzing protein into simpler compounds. Fermentation process of fish relies both on naturally occurring enzymes (in the muscle or the intestinal tract) as well as bacteria. Fermented fish products processed using the whole fish show a different characteristic compared to those prepared from headed and gutted fish. Endogenous enzymes like trypsin, chymotrypsin, elastase, and aminopeptidase are the most involved in the fermentation process. Muscle tissue enzymes like cathepsins, peptidases, transaminases, amidases, amino acid decarboxylases, glutamic dehydrogenases, and related enzymes may also play a role in fish fermentation. Due to the decreased bacterial number during fermentation, contribution of microbial enzymes to proteolysis may be expected prior to salting of fish. Commercial enzymes are supplemented during processing for specific purposes, such as quality improvement and process acceleration. In the case of fish sauce, efforts to accelerate fermentation process and to improve product quality have been studied by addition of enzymes such as papain, bromelain, trypsin, pepsin, and chymotrypsin. © 2017 Elsevier Inc. All rights reserved.

  18. Ultraviolet-B and photosynthetically active radiation interactively affect yield and pattern of monoterpenes in leaves of peppermint (Mentha x piperita L.).

    Science.gov (United States)

    Behn, Helen; Albert, Andreas; Marx, Friedhelm; Noga, Georg; Ulbrich, Andreas

    2010-06-23

    Solar radiation is a key environmental signal in regulation of plant secondary metabolism. Since metabolic responses to light and ultraviolet (UV) radiation exposure are known to depend on the ratio of spectral ranges (e.g., UV-B/PAR), we examined effects of different UV-B radiation (280-315 nm) and photosynthetically active radiation (PAR, 400-700 nm) levels and ratios on yield and pattern of monoterpenoid essential oil of peppermint. Experiments were performed in exposure chambers, technically equipped for realistic simulation of natural climate and radiation. The experimental design comprised four irradiation regimes created by the combination of two PAR levels including or excluding UV-B radiation. During flowering, the highest essential oil yield was achieved at high PAR (1150 micromol m(-2) s(-1)) and approximate ambient UV-B radiation (0.6 W m(-2)). Regarding the monoterpene pattern, low PAR (550 micromol m(-2) s(-1)) and the absence of UV-B radiation led to reduced menthol and increased menthone contents and thereby to a substantial decrease in oil quality. Essential oil yield could not be correlated with density or diameter of peltate glandular trichomes, the epidermal structures specialized on biosynthesis, and the accumulation of monoterpenes. The present results lead to the conclusion that production of high quality oils (fulfilling the requirements of the Pharmacopoeia Europaea) requires high levels of natural sunlight. In protected cultivation, the use of UV-B transmitting covering materials is therefore highly recommended.

  19. The monoterpene terpinolene from the oil of Pinus mugo L. in concert with alpha-tocopherol and beta-carotene effectively prevents oxidation of LDL.

    Science.gov (United States)

    Grassmann, J; Hippeli, S; Spitzenberger, R; Elstner, E F

    2005-06-01

    Antioxidants from several nutrients, e.g. vitamin E, beta-carotene, or flavonoids, inhibit the oxidative modification of low-density lipoproteins. This protective effect could possibly retard atherogenesis and in consequence avoid coronary heart diseases. Some studies have shown a positive effect of those antioxidants on cardiovascular disease. Another class of naturally occurring antioxidants are terpenoids, which are found in essential oils. The essential oil of Pinus mugo and the contained monoterpene terpinolene effectively prevent low-density lipoprotein (LDL)-oxidation. In order to test the mechanism by which terpinolene protects LDL from oxidation, LDL from human blood plasma enriched in terpinolene was isolated. In this preparation not only the lipid part of LDL is protected against copper-induced oxidation--as proven by following the formation of conjugated dienes, but also the oxidation of the protein part is inhibited, since loss of tryptophan fluorescence is strongly delayed. This inhibition is due to a retarded oxidation of intrinsic carotenoids of LDL, and not, as in the case of some flavonoids, attributable to a protection of intrinsic alpha-tocopherol. These results are in agreement with our previous results, which showed the same effects for a monoterpene from lemon oil, i.e. gamma-terpinene.

  20. Recent Advances on Perillyl Alcohol of a Natural and Active Monoterpene%天然活性单萜-紫苏醇研究进展

    Institute of Scientific and Technical Information of China (English)

    马娟

    2014-01-01

    紫苏醇为天然存在的单萜类物质,性质稳定,耐热耐酸,不易挥发,存在于柑桔、樱桃、薄荷、香柠檬、姜草、杂薰衣草等多种植物中,用途十分广泛,在医药、日化及食品等行业均有应用,有较大的研究价值和应用前景。文章综述了紫苏醇的性质及获得方法、作用及应用、衍生物合成及常用剂型发展,为紫苏醇及类似物的进一步研究提供参考。%Perillyl alcohol, a natural and active monoterpene , is stable, heat and acid resistant , not easy to volatilize.This natural monoterpene exists in citrus , cherry, mint, bergamot, ginger, lavender and many other plants , and is widely used in pharmaceutical , daily chemical and food industry .It has great research value and future application . The properties and obtaining method , function and application of perillyl alcohol , synthesis of the derivatives and common dosage form development were studied , which provided reference for further research on perillyl alcohol and analogues .

  1. The legacy of attack: implications of high phloem resin monoterpene levels in lodgepole pines following mass attack by mountain pine beetle, Dendroctonus ponderosae Hopkins.

    Science.gov (United States)

    Clark, E L; Huber, D P W; Carroll, A L

    2012-04-01

    The mountain pine beetle (Dendroctonus ponderosae Hopkins) is the most serious pest of pines (Pinus) in western North America. Host pines protect themselves from attack by producing a complex mixture of terpenes in their resin. We sampled lodgepole pine (Pinus contorta variety latifolia) phloem resin at four widely separated locations in the interior of British Columbia, Canada, both just before (beginning of July) and substantially after (end of August) the mountain pine beetle dispersal period. The sampled trees then were observed the next spring for evidence of survival, and the levels of seven resin monoterpenes were compared between July and August samples. Trees that did not survive consistently had significantly higher phloem resin monoterpene levels at the end of August compared with levels in July. Trees that did survive mainly did not exhibit a significant difference between the two sample dates. The accumulation of copious defense-related secondary metabolites in the resin of mountain pine beetle-killed lodgepole pine has important implications for describing the environmental niche that the beetle offspring survive in as well as that of parasitoids, predators, and other associates.

  2. Investigation of a Quantitative Method for the Analysis of Chiral Monoterpenes in White Wine by HS-SPME-MDGC-MS of Different Wine Matrices.

    Science.gov (United States)

    Song, Mei; Xia, Ying; Tomasino, Elizabeth

    2015-04-22

    A valid quantitative method for the analysis of chiral monoterpenes in white wine using head-space solid phase micro-extraction-MDGC-MS (HS-SPME-MDGC-MS) with stable isotope dilution analysis was established. Fifteen compounds: (S)-(-)-limonene, (R)-(+)-limonene, (+)-(2R,4S)-cis-rose oxide, (-)-(2S,4R)-cis-rose oxide, (-)-(2R,4R)-trans-rose oxide, (+)-(2S,4S)-cis-rose oxide, furanoid (+)-trans-linalool oxide, furanoid (-)-cis-linalool oxide, furanoid (-)-trans-linalool oxide, furanoid (+)-cis-linalool oxide, (-)-linalool, (+)-linalool, (-)-α-terpineol, (+)-α-terpineol and (R)-(+)-β-citronellol were quantified. Two calibration curves were plotted for different wine bases, with varying residual sugar content, and three calibration curves for each wine base were investigated during a single fiber's lifetime. This was needed as both sugar content and fiber life impacted the quantification of the chiral terpenes. The chiral monoterpene content of six Pinot Gris wines and six Riesling wines was then analyzed using the verified method. ANOVA with Tukey multiple comparisons showed significant differences for each of the detected chiral compounds in all 12 wines. PCA score plots showed a clear separation between the Riesling and Pinot Gris wines. Riesling wines had greater number of chiral terpenes in comparison to Pinot Gris wines. Beyond total terpene content it is possible that the differences in chiral terpene content may be driving the aromatic differences in white wines.

  3. Optimizing Synthetic Aperture Compound Imaging

    DEFF Research Database (Denmark)

    Hansen, Jens Munk; Jensen, Jørgen Arendt

    2012-01-01

    Spatial compound images are constructed from synthetic aperture data acquired using a linear phased-array transducer. Compound images of wires, tissue, and cysts are created using a method, which allows both transmit and receive compounding without any loss in temporal resolution. Similarly to co...

  4. Stereoscopy in cinematographic synthetic imagery

    Science.gov (United States)

    Eisenmann, Jonathan; Parent, Rick

    2009-02-01

    In this paper we present experiments and results pertaining to the perception of depth in stereoscopic viewing of synthetic imagery. In computer animation, typical synthetic imagery is highly textured and uses stylized illumination of abstracted material models by abstracted light source models. While there have been numerous studies concerning stereoscopic capabilities, conventions for staging and cinematography in stereoscopic movies have not yet been well-established. Our long-term goal is to measure the effectiveness of various cinematography techniques on the human visual system in a theatrical viewing environment. We would like to identify the elements of stereoscopic cinema that are important in terms of enhancing the viewer's understanding of a scene as well as providing guidelines for the cinematographer relating to storytelling. In these experiments we isolated stereoscopic effects by eliminating as many other visual cues as is reasonable. In particular, we aim to empirically determine what types of movement in synthetic imagery affect the perceptual depth sensing capabilities of our viewers. Using synthetic imagery, we created several viewing scenarios in which the viewer is asked to locate a target object's depth in a simple environment. The scenarios were specifically designed to compare the effectiveness of stereo viewing, camera movement, and object motion in aiding depth perception. Data were collected showing the error between the choice of the user and the actual depth value, and patterns were identified that relate the test variables to the viewer's perceptual depth accuracy in our theatrical viewing environment.

  5. Synthetic Biological Engineering of Photosynthesis

    Science.gov (United States)

    2015-11-16

    photosynthesis into artificial metabolic pathways. During the course of the granting period, we also made significant progress on understanding the...compartmentalization of carbon fixation and flux in relationship to photosynthesis and obtained 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE...2014 Approved for Public Release; Distribution Unlimited Final Report: Synthetic Biological Engineering of Photosynthesis The views, opinions and/or

  6. Digital 'faces' of synthetic biology.

    Science.gov (United States)

    Friedrich, Kathrin

    2013-06-01

    In silicio design plays a fundamental role in the endeavour to synthesise biological systems. In particular, computer-aided design software enables users to manage the complexity of biological entities that is connected to their construction and reconfiguration. The software's graphical user interface bridges the gap between the machine-readable data on the algorithmic subface of the computer and its human-amenable surface represented by standardised diagrammatic elements. Notations like the Systems Biology Graphical Notation (SBGN), together with interactive operations such as drag & drop, allow the user to visually design and simulate synthetic systems as 'bio-algorithmic signs'. Finally, the digital programming process should be extended to the wet lab to manufacture the designed synthetic biological systems. By exploring the different 'faces' of synthetic biology, I argue that in particular computer-aided design (CAD) is pushing the idea to automatically produce de novo objects. Multifaceted software processes serve mutually aesthetic, epistemic and performative purposes by simultaneously black-boxing and bridging different data sources, experimental operations and community-wide standards. So far, synthetic biology is mainly a product of digital media technologies that structurally mimic the epistemological challenge to take both qualitative as well as quantitative aspects of biological systems into account in order to understand and produce new and functional entities.

  7. Forthcoming Oversupply for Synthetic Ammonia

    Institute of Scientific and Technical Information of China (English)

    Zhang Zhantong

    2007-01-01

    @@ Stable output increase The total capacity of synthetic ammonia in China is 52.0 million t/a today.There are around 540 producers mainly located in Shandong, Shanxi, Hebei,Henan, Jiangsu and Sichuan provinces.The cumulative capacity in Shandong province ranks the highest, accounting for 14.6% of the national total.

  8. Broadband Synthetic Ground Motion Records

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The dataset contains broadband synthetic ground motion records for three events: 1) 1994 M6.7 Northridge, CA, 2) 1989 M7.0 Loma Prieta, CA, and 3) 1999 M7.5 Izmit,...

  9. Where Synthetic Biology Meets ET

    Science.gov (United States)

    Rothschild, Lynn J.

    2016-01-01

    Synthetic biology - the design and construction of new biological parts and systems and the redesign of existing ones for useful purposes - has the potential to transform fields from pharmaceuticals to fuels. Our lab has focused on the potential of synthetic biology to revolutionize all three major parts of astrobiology: Where do we come from? Where are we going? and Are we alone? For the first and third, synthetic biology is allowing us to answer whether the evolutionary narrative that has played out on planet earth is likely to have been unique or universal. For example, in our lab we are re-evolving the biosynthetic pathways of amino acids in order to understand potential capabilities of an early organism with a limited repertoire of amino acids and developing techniques for the recovery of metals from spent electronics on other planetary bodies. And what about the limits for life? Can we create organisms that expand the envelope for life? In the future synthetic biology will play an increasing role in human activities both on earth, in fields as diverse as human health and the industrial production of novel bio-composites. Beyond earth, we will rely increasingly on biologically-provided life support, as we have throughout our evolutionary history. In order to do this, the field will build on two of the great contributions of astrobiology: studies of the origin of life and life in extreme environments.

  10. Synthetic biology meets tissue engineering.

    Science.gov (United States)

    Davies, Jamie A; Cachat, Elise

    2016-06-15

    Classical tissue engineering is aimed mainly at producing anatomically and physiologically realistic replacements for normal human tissues. It is done either by encouraging cellular colonization of manufactured matrices or cellular recolonization of decellularized natural extracellular matrices from donor organs, or by allowing cells to self-organize into organs as they do during fetal life. For repair of normal bodies, this will be adequate but there are reasons for making unusual, non-evolved tissues (repair of unusual bodies, interface to electromechanical prostheses, incorporating living cells into life-support machines). Synthetic biology is aimed mainly at engineering cells so that they can perform custom functions: applying synthetic biological approaches to tissue engineering may be one way of engineering custom structures. In this article, we outline the 'embryological cycle' of patterning, differentiation and morphogenesis and review progress that has been made in constructing synthetic biological systems to reproduce these processes in new ways. The state-of-the-art remains a long way from making truly synthetic tissues, but there are now at least foundations for future work. © 2016 Authors; published by Portland Press Limited.

  11. The synthetic biology open language.

    Science.gov (United States)

    Myers, Chris; Clancy, Kevin; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Quinn, Jacqueline; Roehner, Nicholas; Sauro, Herbert M

    2015-01-01

    The design and construction of engineered organisms is an emerging new discipline called synthetic biology and holds considerable promise as a new technological platform. The design of biologically engineered systems is however nontrivial, requiring contributions from a wide array of disciplines. One particular issue that confronts synthetic biologists is the ability to unambiguously describe novel designs such that they can be reengineered by a third-party. For this reason, the synthetic biology open language (SBOL) was developed as a community wide standard for formally representing biological designs. A design created by one engineering team can be transmitted electronically to another who can then use this design to reproduce the experimental results. The development and the community of the SBOL standard started in 2008 and has since grown in use with now over 80 participants, including international, academic, and industrial interests. SBOL has stimulated the development of repositories and software tools to help synthetic biologists in their design efforts. This chapter summarizes the latest developments and future of the SBOL standard and its supporting infrastructure.

  12. utilisation of synthetic amino acids

    African Journals Online (AJOL)

    student

    intake, bodyweight gain, egg weight or efficiency of lysine utilisation, but ... When modelling the amino acid requirements of broiler breeder ... Two hundred and forty Cobb broiler breeder hens aged 27 weeks were housed in individual cages. ..... feeds with synthetic amino acids is of importance not only on nutritional and.

  13. Synthetic Aperture Radar - Hardware Development

    Directory of Open Access Journals (Sweden)

    V. Rosner

    2009-06-01

    Full Text Available Experimental real and synthetic aperture radar are developed from the base-band digital unit to the analogue RF parts, based on solid state units, using pulse compression for radar imaging. Proper QPSK code is found for matched filter.

  14. Synthetic metabolism: engineering biology at the protein and pathway scales.

    Science.gov (United States)

    Martin, Collin H; Nielsen, David R; Solomon, Kevin V; Prather, Kristala L Jones

    2009-03-27

    Biocatalysis has become a powerful tool for the synthesis of high-value compounds, particularly so in the case of highly functionalized and/or stereoactive products. Nature has supplied thousands of enzymes and assembled them into numerous metabolic pathways. Although these native pathways can be use to produce natural bioproducts, there are many valuable and useful compounds that have no known natural biochemical route. Consequently, there is a need for both unnatural metabolic pathways and novel enzymatic activities upon which these pathways can be built. Here, we review the theoretical and experimental strategies for engineering synthetic metabolic pathways at the protein and pathway scales, and highlight the challenges that this subfield of synthetic biology currently faces.

  15. Enzyme stabilization by linear chain polymers in ultrafiltration membrane reactors

    Energy Technology Data Exchange (ETDEWEB)

    Greco, G.; Gianfreda, L.

    1981-10-01

    The experimental results discussed in this article concern pi-nitrophenylphosphate hydrolysis by acid phosphatase in an ultrafiltration membrane reactor. The basic conclusions drawn are : 1) Linking the enzyme to a soluble support does not give rise to an increase in its stability while the chemical manipulations involved result in marked reductions in enzymic activity. 2) Enzyme entrapment within a proteic gel produces a considerable increase in its thermal stability as compared to the diluted native enzyme; this presumably stems from drastic reductions in enzyme mobility. 3) Correspondingly, considerable reductions occur in enzyme activity that depend on substrate mass transfer resistances within the gel layer. 4) Small amounts of linear chain water-soluble synthetic polymers (polyacrylamides) give rise to high macromolecular concentration levels in the reactor region where the enzyme is dynamically immobilized and produce the same enzyme stabilization as gel entrapment. 5) Only minor substrate mass transfer limitations take place in this region and hence enzyme activity is virtually unaffected. 6) Both effects (stabilization and slight activity reduction) seem not to depend strongly on the characteristics of the soluble polymer (molecular weight and ionic character). (Refs. 16).

  16. Cotton cellulose: enzyme adsorption and enzymic hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Beltrame, P.L.; Carniti, P.; Focher, B.; Marzetti, A.; Cattaneo, M.

    1982-01-01

    The adsorption of a crude cellulase complex from Trichoderma viride on variously pretreated cotton cellulose samples was studied in the framework of the Langmuir approach at 2-8 degrees. The saturation amount of adsorbed enzyme was related to the susceptibility of the substrates to hydrolysis. In every case the adsorption process was faster by 2-3 orders of magnitude than the hydrolysis step to give end products. For ZnCl/sub 2/-treated cotton cellulose the Langmuir parameters correlated fairly well with the value of the Michaelis constant, measured for its enzymic hydrolysis, and the adsorptive complex was indistinguishable from the complex of the Michaelis-Menten model for the hydrolysis.

  17. Protease-sensitive synthetic prions.

    Directory of Open Access Journals (Sweden)

    David W Colby

    2010-01-01

    Full Text Available Prions arise when the cellular prion protein (PrP(C undergoes a self-propagating conformational change; the resulting infectious conformer is designated PrP(Sc. Frequently, PrP(Sc is protease-resistant but protease-sensitive (s prions have been isolated in humans and other animals. We report here that protease-sensitive, synthetic prions were generated in vitro during polymerization of recombinant (rec PrP into amyloid fibers. In 22 independent experiments, recPrP amyloid preparations, but not recPrP monomers or oligomers, transmitted disease to transgenic mice (n = 164, denoted Tg9949 mice, that overexpress N-terminally truncated PrP. Tg9949 control mice (n = 174 did not spontaneously generate prions although they were prone to late-onset spontaneous neurological dysfunction. When synthetic prion isolates from infected Tg9949 mice were serially transmitted in the same line of mice, they exhibited sPrP(Sc and caused neurodegeneration. Interestingly, these protease-sensitive prions did not shorten the life span of Tg9949 mice despite causing extensive neurodegeneration. We inoculated three synthetic prion isolates into Tg4053 mice that overexpress full-length PrP; Tg4053 mice are not prone to developing spontaneous neurological dysfunction. The synthetic prion isolates caused disease in 600-750 days in Tg4053 mice, which exhibited sPrP(Sc. These novel synthetic prions demonstrate that conformational changes in wild-type PrP can produce mouse prions composed exclusively of sPrP(Sc.

  18. The EBI enzyme portal.

    Science.gov (United States)

    Alcántara, Rafael; Onwubiko, Joseph; Cao, Hong; Matos, Paula de; Cham, Jennifer A; Jacobsen, Jules; Holliday, Gemma L; Fischer, Julia D; Rahman, Syed Asad; Jassal, Bijay; Goujon, Mikael; Rowland, Francis; Velankar, Sameer; López, Rodrigo; Overington, John P; Kleywegt, Gerard J; Hermjakob, Henning; O'Donovan, Claire; Martín, María Jesús; Thornton, Janet M; Steinbeck, Christoph

    2013-01-01

    The availability of comprehensive information about enzymes plays an important role in answering questions relevant to interdisciplinary fields such as biochemistry, enzymology, biofuels, bioengineering and drug discovery. At the EMBL European Bioinformatics Institute, we have developed an enzyme portal (http://www.ebi.ac.uk/enzymeportal) to provide this wealth of information on enzymes from multiple in-house resources addressing particular data classes: protein sequence and structure, reactions, pathways and small molecules. The fact that these data reside in separate databases makes information discovery cumbersome. The main goal of the portal is to simplify this process for end users.

  19. Enzyme molecules as nanomotors.

    Science.gov (United States)

    Sengupta, Samudra; Dey, Krishna K; Muddana, Hari S; Tabouillot, Tristan; Ibele, Michael E; Butler, Peter J; Sen, Ayusman

    2013-01-30

    Using fluorescence correlation spectroscopy, we show that the diffusive movements of catalase enzyme molecules increase in the presence of the substrate, hydrogen peroxide, in a concentration-dependent manner. Employing a microfluidic device to generate a substrate concentration gradient, we show that both catalase and urease enzyme molecules spread toward areas of higher substrate concentration, a form of chemotaxis at the molecular scale. Using glucose oxidase and glucose to generate a hydrogen peroxide gradient, we induce the migration of catalase toward glucose oxidase, thereby showing that chemically interconnected enzymes can be drawn together.

  20. Synthetic methyl hexagalacturonate hapten inhibitors of antihomogalacturonan monoclonal antibodies LM7, JIM5 and JIM7

    DEFF Research Database (Denmark)

    Clausen, Mads Hartvig; Willats, William George Tycho; Knox, J. Paul

    2003-01-01

    A range of synthetic methyl hexagalacturonates were used as potential hapten inhibitors in competitive-inhibition enzyme-linked immunosorbent assays (ELISAs) with anti-homogalacturonan monoclonal antibodies LM7, JIM5 and JIM7. The selective inhibition of these antibodies by different haptens prov...

  1. [Industrial hygiene in the modern manufacture of synthetic detergents].

    Science.gov (United States)

    Akinfieva, T A; Kuchma, V R; Lashnev, M P; Moiseev, Iu V; Strongina, O M

    1992-01-01

    Work conditions in the synthetic detergents production according to the new technology created by Sumitomo (Japan) were evaluated from hygienic point of view. The main unfavourable factor is the contamination of air by initial products (aerosols of sodium tripoli phosphate, carboxy methylcellulose, optic bleacher, enzymes et al.) and dust of the final product. Sulphur oxides appear in the air of the sulphating unit. Levels of noise and vibration are surpassed. At the same time the studied technology is more profitable than the current ones. Parameters of the cardiovascular, central nervous and neuromuscular systems do not indicate the physical and neuropsychic fatigue.

  2. Enzymes in Analytical Chemistry.

    Science.gov (United States)

    Fishman, Myer M.

    1980-01-01

    Presents tabular information concerning recent research in the field of enzymes in analytic chemistry, with methods, substrate or reaction catalyzed, assay, comments and references listed. The table refers to 128 references. Also listed are 13 general citations. (CS)

  3. Enzymic lactose hydrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.J.; Brand, J.C.

    1980-01-01

    Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).

  4. Membrane Assisted Enzyme Fractionation

    DEFF Research Database (Denmark)

    Yuan, Linfeng

    . In this thesis, separations using crossflow elecro-membrane filtration (EMF) of amino acids, bovine serum albumin (BSA) and industrial enzymes from Novozymes were performed. The main objective of this study was to investigate the technological feasibility of EMF in the application of industrial enzyme...... fractionation, such as removal of a side activity from the main enzyme activity. As a proof-of-concept, amino acids were used as model solution to test the feasibility of EMF in the application of amphoteric molecule separation. A single amino acid was used to illustrate the effect of an electric field...... on the separation performance were very small in the investigated range. The mass transport of each enzyme can be well explained by the Extended-Nernst-Planck equation. Better separation was observed at lower feed concentration, higher solution pH in the investigated range and with a polysulfone (PS) MF membrane...

  5. Indicators: Sediment Enzymes

    Science.gov (United States)

    Sediment enzymes are proteins that are produced by microorganisms living in the sediment or soil. They are indicators of key ecosystem processes and can help determine which nutrients are affecting the biological community of a waterbody.

  6. Starch Biorefinery Enzymes.

    Science.gov (United States)

    Läufer, Albrecht

    2017-03-07

    Nature uses enzymes to build and convert biomass; mankind uses the same enzymes and produces them on a large scale to make optimum use of biomass in biorefineries. Bacterial α-amylases and fungal glucoamylases have been the workhorses of starch biorefineries for many decades. Pullulanases were introduced in the 1980s. Proteases, cellulases, hemicellulases, and phytases have been on the market for a few years as process aids, improving yields, performance, and costs. Detailed studies of the complex chemical structures of biomass and of the physicochemical limitations of industrial biorefineries have led enzyme developers to produce novel tailor-made solutions for improving yield and profitability in the industry. This chapter reviews the development of enzyme applications in the major starch biorefining processes.

  7. Membrane Assisted Enzyme Fractionation

    DEFF Research Database (Denmark)

    Yuan, Linfeng

    . In this thesis, separations using crossflow elecro-membrane filtration (EMF) of amino acids, bovine serum albumin (BSA) and industrial enzymes from Novozymes were performed. The main objective of this study was to investigate the technological feasibility of EMF in the application of industrial enzyme...... fractionation, such as removal of a side activity from the main enzyme activity. As a proof-of-concept, amino acids were used as model solution to test the feasibility of EMF in the application of amphoteric molecule separation. A single amino acid was used to illustrate the effect of an electric field...... on the separation performance were very small in the investigated range. The mass transport of each enzyme can be well explained by the Extended-Nernst-Planck equation. Better separation was observed at lower feed concentration, higher solution pH in the investigated range and with a polysulfone (PS) MF membrane...

  8. Effects of monoterpenes and mevinolin on murine colon tumor CT-26 in vitro and its hepatic "metastases" in vivo.

    Science.gov (United States)

    Broitman, S A; Wilkinson, J; Cerda, S; Branch, S K

    1996-01-01

    Tumors derived from the colonic epithelium exhibit cholesterol metabolism which is clearly different from that in fibroblasts, hepatocytes, adrenals, and ovaries. In hepatocytes and fibroblasts MEV inhibition of the rate limiting step in cholesterol synthesis HMG Co A reductase can be overcome by the uptake of LDL. Colon cancer cells however do not overcome MEV inhibition by LDL uptake but rather exhibit further growth suppression Mevinolin (Mevacor), a drug used to lower serum cholesterol levels has the advantage of accumulating in the liver to approximately 95% with the first pass. A small but variable percentage of non-sterol precursors may escape inhibition and be utilized for other pathways in the isoprenylation of certain proteins, among them members of the ras family. Mutated ras, an oncogene, is found in 40-50% of colon tumors and the expression of a functional gene product is dependent on isoprenylation for anchorage to the tumor cell membrane. d-Limonene, a relatively non-toxic monoterpene found in orange skin oil, selectively inhibits isoprenylation and also accumulates to some extent in the liver. It was hypothesized that the differences in mevalonate metabolism between hepatocytes and colon tumor cells could provide a chemotherapeutic advantage in which MEV and/or d-limonene could effectively inhibit cholesterol synthesis and post-translational modification of proteins with non-sterol cholesterol precursors in colon tumor derived hepatic metastases and thus inhibit their growth. Since each drug affects aspects of mevalonate synthesis at different points, the effects of the combination of their agents on inhibiting tumor metastases was investigated to ascertain if these could be additive. In tissue culture, MEV and d-limonene significantly inhibited the growth of CT-26, a murine transplantable colon tumor. Cholesterol synthesis assessed in these cells indicated that in lipid deficient media the following additions-25-hydroxycholesterol, and LDL

  9. RNA-modifying enzymes.

    Science.gov (United States)

    Ferré-D'Amaré, Adrian R

    2003-02-01

    A bewildering number of post-transcriptional modifications are introduced into cellular RNAs by enzymes that are often conserved among archaea, bacteria and eukaryotes. The modifications range from those with well-understood functions, such as tRNA aminoacylation, to widespread but more mysterious ones, such as pseudouridylation. Recent structure determinations have included two types of RNA nucleobase modifying enzyme: pseudouridine synthases and tRNA guanine transglycosylases.

  10. Overproduction of ligninolytic enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  11. Synthetic biology character and impact

    CERN Document Server

    Pade, Christian; Wigger, Henning; Gleich, Arnim

    2015-01-01

    Synthetic Biology is already an object of intensive debate. However, to a great extent the discussion to date has been concerned with fundamental ethical, religious and philosophical questions. By contrast, based on an investigation of the field’s scientific and technological character, this book focuses on new functionalities provided by synthetic biology and explores the associated opportunities and risks. Following an introduction to the subject and a discussion of the most central paradigms and methodologies, the book provides an overview of the structure of this field of science and technology. It informs the reader about the current stage of development, as well as topical problems and potential opportunities in important fields of application. But not only the science itself is in focus. In order to investigate its broader impact, ecological as well as ethical implications will be considered, paving the way for a discussion of responsibilities in the context of a field at a transitional crossroads be...

  12. Synthetic cannabinoids: analysis and metabolites.

    Science.gov (United States)

    Elsohly, Mahmoud A; Gul, Waseem; Wanas, Amira S; Radwan, Mohamed M

    2014-02-27

    Cannabimimetics (commonly referred to as synthetic cannabinoids), a group of compounds encompassing a wide range of chemical structures, have been developed by scientists with the hope of achieving selectivity toward one or the other of the cannabinoid receptors CB1 and CB2. The goal was to have compounds that could possess high therapeutic activity without many side effects. However, underground laboratories have used the information generated by the scientific community to develop these compounds for illicit use as marijuana substitutes. This chapter reviews the different classes of these "synthetic cannabinoids" with particular emphasis on the methods used for their identification in the herbal products with which they are mixed and identification of their metabolites in biological specimens.

  13. Synthetic microbial ecosystems for biotechnology.

    Science.gov (United States)

    Pandhal, Jagroop; Noirel, Josselin

    2014-06-01

    Most highly controlled and specific applications of microorganisms in biotechnology involve pure cultures. Maintaining single strain cultures is important for industry as contaminants can reduce productivity and lead to longer "down-times" during sterilisation. However, microbes working together provide distinct advantages over pure cultures. They can undertake more metabolically complex tasks, improve efficiency and even expand applications to open systems. By combining rapidly advancing technologies with ecological theory, the use of microbial ecosystems in biotechnology will inevitably increase. This review provides insight into the use of synthetic microbial communities in biotechnology by applying the engineering paradigm of measure, model, manipulate and manufacture, and illustrate the emerging wider potential of the synthetic ecology field. Systems to improve biofuel production using microalgae are also discussed.

  14. DNA recognition by synthetic constructs.

    Science.gov (United States)

    Pazos, Elena; Mosquera, Jesús; Vázquez, M Eugenio; Mascareñas, José L

    2011-09-05

    The interaction of transcription factors with specific DNA sites is key for the regulation of gene expression. Despite the availability of a large body of structural data on protein-DNA complexes, we are still far from fully understanding the molecular and biophysical bases underlying such interactions. Therefore, the development of non-natural agents that can reproduce the DNA-recognition properties of natural transcription factors remains a major and challenging goal in chemical biology. In this review we summarize the basics of double-stranded DNA recognition by transcription factors, and describe recent developments in the design and preparation of synthetic DNA binders. We mainly focus on synthetic peptides that have been designed by following the DNA interaction of natural proteins, and we discuss how the tools of organic synthesis can be used to make artificial constructs equipped with functionalities that introduce additional properties to the recognition process, such as sensing and controllability.

  15. Synthetic LDL as targeted drug delivery vehicle

    Science.gov (United States)

    Forte, Trudy M.; Nikanjam, Mina

    2012-08-28

    The present invention provides a synthetic LDL nanoparticle comprising a lipid moiety and a synthetic chimeric peptide so as to be capable of binding the LDL receptor. The synthetic LDL nanoparticle of the present invention is capable of incorporating and targeting therapeutics to cells expressing the LDL receptor for diseases associated with the expression of the LDL receptor such as central nervous system diseases. The invention further provides methods of using such synthetic LDL nanoparticles.

  16. Designer Drugs: A Synthetic Catastrophe

    OpenAIRE

    James Fratantonio; Lawrence Andrade; Marcelo Febo

    2015-01-01

    Synthetic stimulants can cause hallucinations, aggressive behaviors, death and are sometimes legal. These substances are sold as plant food and bath salts that are "Not for Human Consumption", therefore skirting the 1986 Federal Analogue Act and giving a false pretense of safety. Studies have proved that these substances are toxic, have a high abuse potential, and are becoming extremely prevalent in the United States. This creates a dilemma for law enforcement agents, hospitals, and substance...

  17. Chemical constituents of monoterpenes in fruits of Gardenia jasminoides%栀子果实中单萜类化学成分研究

    Institute of Scientific and Technical Information of China (English)

    左月明; 张忠立; 杨雅琴; 罗光明; 王彦彦

    2013-01-01

    目的 研究栀子Gardenia jasminoides的干燥成熟果实中单萜类化学成分.方法 采用多种柱色谱方法分离纯化,通过理化常数测定和光谱分析鉴定化合物的结构.结果 从栀子果实80%乙醇提取物中分离得到了12个单萜类化合物,分别鉴定为jasminosideB(1)、jasminosideG(2)、jasminodiol (3)、(7R)-6-羟甲基-1,1,5-三甲基环己-3-烯酮(4)、(7S)-6-羟甲基-1,1,5-三甲基环己-3-烯酮(5)、bomyl-6-O-β-D-xylopyranosyl-β-D-glucopyranoside (6)、(10R,11R)-栀子二醇(7)、(10S,11S)-栀子二醇(8)、(5S,9S)-gardenateA(9)、(5R,9R)-gardenateA(10)、jasminosideE(11)、5,6-二羟甲基-1,1-二甲基环己-4-烯酮(12).结论 化合物5、6、8、10和12为首次从栀子中分离得到.%Objective To investigate the chemical constituents of monoterpenes in the fruits of Gardenia jasminoides.Methods Various column chromatographies were used in the isolation and purification,and the physicochemical constant determination and spectral analysis were adopted to identify the chemical structures of monoterpenes.Results Twelve monoterpenes were isolated from G.jasminoides,such as jasminoside B (1),jasminoside G (2),jasminodiol (3),crocusatin-C (4),(7S)-6-(hydroxymethyl)-1,1,5-trimethylcyclohex-3-enone (5),bornyl-6-O-β-D-xylopyranosyl-β-D-glucopyranoside (6),(10R,11R)-gardendiol (7),(10S,11S)-gardendiol (8),(5S,9S)-gardenate A (9),(5R,9R)-gardenate A (10),jasminoside E (11),and 5,6-dihydroxymethyl-1,1-dimethylcyclohex-4-enone (12).Conclusion Compounds 5,6,8,10,and 12 are first isolated from this plant.

  18. Antimicrobial activity and potential use of monoterpenes as tropical fruits preservatives Atividade antimicrobiana e uso potencial de monoterpenos como preservantes de furtas tropicais

    Directory of Open Access Journals (Sweden)

    Roxana Garcia

    2008-03-01

    Full Text Available Banana, papaya and pineapple are the most consumed tropical fruits in the world, being Brazil one of the main producers. Fungi Colletotrichum musae, Colletotrichum gloeosporioides and Fusarium subglutinans f.sp. ananas cause severe post harvest diseases and losses in fruits quality. The aim of this work was to evaluate the effectiveness of five monoterpenes to inhibit the mycelial growth and conidia germination of these three phytopathogens. The monoterpenes citral, citronellal, L-carvone, isopullegol and a-pinene were diluted in ethanol to final concentrations from 0.2 to 1%. All monoterpenes were found to inhibit the growth of the three studies fungi in a dose-dependent manner. Citral was the most effective of the oils tested and showed potent fungicidal activity at concentrations above 0.5%. Also, in vivo evaluation with these tropical fruits demonstrated the efficiency of citral to inhibit fungal growth. These results indicate the potential use of citral as a natural pesticide control of post-harvest fruit diseases.Banana, mamão e abacaxi são as frutas tropicais mais consumidas no mundo, sendo o Brasil um dos principais produtores. Os fungos Colletotrichum musae, Colletotrichum gloeosporioides e Fusarium subglutinans f.sp ananas são os principais causadores de doenças e perdas em pós-colheita de frutas. A proposta deste estudo foi avaliar a eficácia de cinco monoterpenos em inibir o crescimento micelial e a germinação dos conídios destes três fitopatógenos. Os monoterpenos citral, citronelal, L-carvona, isopulegol e a-pineno foram diluídos em etanol à concentração final de 0,2 a 1%. Todos os monoterpenos testados inibiram os três fungos estudados de maneira dose-dependente. Citral foi o mais efetivo dos óleos testados e apresentou uma potente atividade fungicida em concentrações acima de 0,5%. Mais ainda, avaliação in vivo com estas frutas tropicais demonstrou a eficácia de citral como inibidor do crescimento f

  19. Cell microencapsulation with synthetic polymers.

    Science.gov (United States)

    Olabisi, Ronke M

    2015-02-01

    The encapsulation of cells into polymeric microspheres or microcapsules has permitted the transplantation of cells into human and animal subjects without the need for immunosuppressants. Cell-based therapies use donor cells to provide sustained release of a therapeutic product, such as insulin, and have shown promise in treating a variety of diseases. Immunoisolation of these cells via microencapsulation is a hotly investigated field, and the preferred material of choice has been alginate, a natural polymer derived from seaweed due to its gelling conditions. Although many natural polymers tend to gel in conditions favorable to mammalian cell encapsulation, there remain challenges such as batch to batch variability and residual components from the original source that can lead to an immune response when implanted into a recipient. Synthetic materials have the potential to avoid these issues; however, historically they have required harsh polymerization conditions that are not favorable to mammalian cells. As research into microencapsulation grows, more investigators are exploring methods to microencapsulate cells into synthetic polymers. This review describes a variety of synthetic polymers used to microencapsulate cells. © 2014 The Authors. Journal of Biomedical Materials Research Part A Published by Wiley Periodicals, Inc.

  20. Functional analysis of (4S)-limonene synthase mutants reveals determinants of catalytic outcome in a model monoterpene synthase.

    Science.gov (United States)

    Srividya, Narayanan; Davis, Edward M; Croteau, Rodney B; Lange, B Markus

    2015-03-17

    Crystal structural data for (4S)-limonene synthase [(4S)-LS] of spearmint (Mentha spicata L.) were used to infer which amino acid residues are in close proximity to the substrate and carbocation intermediates of the enzymatic reaction. Alanine-scanning mutagenesis of 48 amino acids combined with enzyme fidelity analysis [percentage of (-)-limonene produced] indicated which residues are most likely to constitute the active site. Mutation of residues W324 and H579 caused a significant drop in enzyme activity and formation of products (myrcene, linalool, and terpineol) characteristic of a premature termination of the reaction. A double mutant (W324A/H579A) had no detectable enzyme activity, indicating that either substrate binding or the terminating reaction was impaired. Exchanges to other aromatic residues (W324H, W324F, W324Y, H579F, H579Y, and H579W) resulted in enzyme catalysts with significantly reduced activity. Sequence comparisons across the angiosperm lineage provided evidence that W324 is a conserved residue, whereas the position equivalent to H579 is occupied by aromatic residues (H, F, or Y). These results are consistent with a critical role of W324 and H579 in the stabilization of carbocation intermediates. The potential of these residues to serve as the catalytic base facilitating the terminal deprotonation reaction is discussed.

  1. Coherence Studies for Synthetic Aperture Sonar

    Science.gov (United States)

    2014-09-30

    TITLE AND SUBTITLE Coherence Studies for Synthetic Aperture Sonar 5a. CONTRACT NUMBER 5b. GRANT NUMBER N00014-13-1-0020 5c. PROGRAM...systematic look at, coherence. 15. SUBJECT TERMS Synthetic; Aperture Sonar , Coherence, Seafloor Scatter, Propagation Variability 16. SECURITY...reconstruction of the document. Coherence Studies for Synthetic Aperture Sonar Anthony P. Lyons The Pennsylvania State University Applied Research

  2. 21 CFR 178.3500 - Glycerin, synthetic.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Glycerin, synthetic. 178.3500 Section 178.3500 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Certain Adjuvants and Production Aids § 178.3500 Glycerin, synthetic. Synthetic glycerin may be...

  3. Synthetic thermoelectric materials comprising phononic crystals

    Science.gov (United States)

    El-Kady, Ihab F; Olsson, Roy H; Hopkins, Patrick; Reinke, Charles; Kim, Bongsang

    2013-08-13

    Synthetic thermoelectric materials comprising phononic crystals can simultaneously have a large Seebeck coefficient, high electrical conductivity, and low thermal conductivity. Such synthetic thermoelectric materials can enable improved thermoelectric devices, such as thermoelectric generators and coolers, with improved performance. Such synthetic thermoelectric materials and devices can be fabricated using techniques that are compatible with standard microelectronics.

  4. Penicillium digitatum metabolites on synthetic media and citrus fruits

    DEFF Research Database (Denmark)

    Ariza, M.R.; Larsen, Thomas Ostenfeld; Petersen, Bent O.

    2002-01-01

    fruits.Their structural elucidation is described on the basis of their spectroscopic data, including those from 2D NMR experiments. The analysis of the biomass sterols led to the identification of 8-12. Fungal infection on the natural substrates induced the release of citrus monoterpenes together...

  5. Accessing Nature’s diversity through metabolic engineering and synthetic biology [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Jason R. King

    2016-03-01

    Full Text Available In this perspective, we highlight recent examples and trends in metabolic engineering and synthetic biology that demonstrate the synthetic potential of enzyme and pathway engineering for natural product discovery. In doing so, we introduce natural paradigms of secondary metabolism whereby simple carbon substrates are combined into complex molecules through “scaffold diversification”, and subsequent “derivatization” of these scaffolds is used to synthesize distinct complex natural products. We provide examples in which modern pathway engineering efforts including combinatorial biosynthesis and biological retrosynthesis can be coupled to directed enzyme evolution and rational enzyme engineering to allow access to the “privileged” chemical space of natural products in industry-proven microbes. Finally, we forecast the potential to produce natural product-like discovery platforms in biological systems that are amenable to single-step discovery, validation, and synthesis for streamlined discovery and production of biologically active agents.

  6. A synthetic pathway for the fixation of carbon dioxide in vitro.

    Science.gov (United States)

    Schwander, Thomas; Schada von Borzyskowski, Lennart; Burgener, Simon; Cortina, Niña Socorro; Erb, Tobias J

    2016-11-18

    Carbon dioxide (CO2) is an important carbon feedstock for a future green economy. This requires the development of efficient strategies for its conversion into multicarbon compounds. We describe a synthetic cycle for the continuous fixation of CO2 in vitro. The crotonyl-coenzyme A (CoA)/ethylmalonyl-CoA/hydroxybutyryl-CoA (CETCH) cycle is a reaction network of 17 enzymes that converts CO2 into organic molecules at a rate of 5 nanomoles of CO2 per minute per milligram of protein. The CETCH cycle was drafted by metabolic retrosynthesis, established with enzymes originating from nine different organisms of all three domains of life, and optimized in several rounds by enzyme engineering and metabolic proofreading. The CETCH cycle adds a seventh, synthetic alternative to the six naturally evolved CO2 fixation pathways, thereby opening the way for in vitro and in vivo applications. Copyright © 2016, American Association for the Advancement of Science.

  7. Decoding and reprogramming complex polyketide assembly lines: prospects for synthetic biology.

    Science.gov (United States)

    Hertweck, Christian

    2015-04-01

    Bacterial modular type I polyketide synthases (PKSs) represent giant megasynthases that produce a vast number of complex polyketides, many of which are pharmaceutically relevant. This review highlights recent advances in elucidating the mechanism of bacterial type I PKSs and associated enzymes, and outlines the ramifications of this knowledge for synthetic biology approaches to expand structural diversity. New insights into biosynthetic codes and structures of thiotemplate systems pave the way to rational bioengineering strategies. Through advances in genome mining, DNA recombination technologies, and biochemical analyses, the toolbox of non-canonical polyketide-modifying enzymes has been greatly enlarged. In addition to various chain-branching and chain-fusing enzymes, an increasing set of scaffold modifying biocatalysts is now available for synthetically hard-to-emulate reactions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Enzymes for Enhanced Oil Recovery (EOR)

    Energy Technology Data Exchange (ETDEWEB)

    Nasiri, Hamidreza

    2011-04-15

    enzymes on interactions in the oil/brine/solid system was studied. It was found that enzymes can change the adhesion behavior of the crude oil on glass surfaces from adhesion to non-adhesion when they are added to the brine solution. This was confirmed by contact angle measurements, which showed that contact angles became more water-wet (i.e. decreased) after exposure to enzyme solutions. Possible mechanisms giving rise to these observations, including catalysis of ester hydrolysis and enzyme adsorption, were discussed and tested. An experimental study of changes in oil-water interfacial properties by addition of enzymes and proteins, including measurements of interfacial tension and electrophoretic mobility, has been performed. It was found that the effect of enzymes on oil-water properties is minor compared to their effect on oil-water-solid properties. Their contribution to change interfacial tension between oil and water is not significant while they affect the electrophoretic mobility of emulsified oil in enzyme-brine solution to some extent. Attempts were also made to study changes in both oil and water phase composition after equilibration with enzymes. However, since the chemical composition of crude oil is highly complex, a model oil was used in some of the experiments. The model oil was chosen to be a water insoluble ester (ethyl decanoate) solved in mineral oil in an effort to verify the possible role of catalysis of ester hydrolysis. Dynamic core displacements using sandstone and carbonate rocks were conducted to show the potential of improved oil recovery by enzyme- and combined enzyme-surfactant flooding. Most of the core flooding experiments commenced with water flooding from initial water saturation, Swi, (established with synthetic sea water) which will be referred to as secondary mode displacements. Accordingly, tertiary oil recovery processes were used to describe injection of enzyme and/or enzyme-surfactant solutions from residual oil saturation, Sor

  9. Monoterpene indole alkaloid hydrazone derivatives with apoptosis inducing activity in human HCT116 colon and HepG2 liver carcinoma cells.

    Science.gov (United States)

    Paterna, Angela; Borralho, Pedro M; Gomes, Sofia E; Mulhovo, Silva; Rodrigues, Cecília M P; Ferreira, Maria-José U

    2015-09-01

    The derivatization of dregamine (1) and tabernaemontanine (2), two epimeric monoterpene indole alkaloids isolated from the methanol extract of the roots of Tabernaemontana elegans, with several hydrazines and hydroxylamine gave rise to ten new derivatives (3-12). Their structures were assigned by spectroscopic methods, including 2D NMR experiments. The compounds were tested for their ability to induce apoptosis in HCT116 colon and HepG2 liver cancer cells. Firstly, the cytotoxicity of all compounds (1-12) was evaluated in both cell lines by the MTS assay. The most active compounds (6, 9, 10) along with 1 and 2 were further investigated for their apoptosis induction capability by Guava ViaCount flow cytometry assays, nuclear morphology evaluation by Hoechst staining, and caspase-3/7 activity assays. Compounds 9 and 10 showed promising apoptosis induction profile, displaying higher activities than 5-fluorouracil, the mainstay in colon cancer treatment.

  10. Binding of Natural and Synthetic Polyphenols to Human Dihydrofolate Reductase

    Directory of Open Access Journals (Sweden)

    José Neptuno Rodríguez-López

    2009-12-01

    Full Text Available Dihydrofolate reductase (DHFR is the subject of intensive investigation since it appears to be the primary target enzyme for antifolate drugs. Fluorescence quenching experiments show that the ester bond-containing tea polyphenols (--epigallocatechin gallate (EGCG and (--epicatechin gallate (ECG are potent inhibitors of DHFR with dissociation constants (KD of 0.9 and 1.8 μM, respectively, while polyphenols lacking the ester bound gallate moiety [e.g., (--epigallocatechin (EGC and (--epicatechin (EC] did not bind to this enzyme. To avoid stability and bioavailability problems associated with tea catechins we synthesized a methylated derivative of ECG (3-O-(3,4,5-trimethoxybenzoyl-(--epicatechin; TMECG, which effectively binds to DHFR (KD = 2.1 μM. In alkaline solution, TMECG generates a stable quinone methide product that strongly binds to the enzyme with a KD of 8.2 nM. Quercetin glucuronides also bind to DHFR but its effective binding was highly dependent of the sugar residue, with quercetin-3-xyloside being the stronger inhibitor of the enzyme with a KD of 0.6 μM. The finding that natural polyphenols are good inhibitors of human DHFR could explain the epidemiological data on their prophylactic effects for certain forms of cancer and open a possibility for the use of natural and synthetic polyphenols in cancer chemotherapy.

  11. Random-walk enzymes.

    Science.gov (United States)

    Mak, Chi H; Pham, Phuong; Afif, Samir A; Goodman, Myron F

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C→U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  12. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-09-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C →U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics.

  13. Random-walk enzymes

    Science.gov (United States)

    Mak, Chi H.; Pham, Phuong; Afif, Samir A.; Goodman, Myron F.

    2015-01-01

    Enzymes that rely on random walk to search for substrate targets in a heterogeneously dispersed medium can leave behind complex spatial profiles of their catalyzed conversions. The catalytic signatures of these random-walk enzymes are the result of two coupled stochastic processes: scanning and catalysis. Here we develop analytical models to understand the conversion profiles produced by these enzymes, comparing an intrusive model, in which scanning and catalysis are tightly coupled, against a loosely coupled passive model. Diagrammatic theory and path-integral solutions of these models revealed clearly distinct predictions. Comparison to experimental data from catalyzed deaminations deposited on single-stranded DNA by the enzyme activation-induced deoxycytidine deaminase (AID) demonstrates that catalysis and diffusion are strongly intertwined, where the chemical conversions give rise to new stochastic trajectories that were absent if the substrate DNA was homogeneous. The C → U deamination profiles in both analytical predictions and experiments exhibit a strong contextual dependence, where the conversion rate of each target site is strongly contingent on the identities of other surrounding targets, with the intrusive model showing an excellent fit to the data. These methods can be applied to deduce sequence-dependent catalytic signatures of other DNA modification enzymes, with potential applications to cancer, gene regulation, and epigenetics. PMID:26465508

  14. The essential oil of bergamot enhances the levels of amino acid neurotransmitters in the hippocampus of rat: implication of monoterpene hydrocarbons.

    Science.gov (United States)

    Morrone, Luigi A; Rombolà, Laura; Pelle, Cinzia; Corasaniti, Maria T; Zappettini, Simona; Paudice, Paolo; Bonanno, Giambattista; Bagetta, Giacinto

    2007-04-01

    The effects of bergamot essential oil (BEO) on the release of amino acid neurotransmitters in rat hippocampus have been studied by in vivo microdialysis and by in vitro superfusion of isolated nerve terminals. Intraperitoneal administration of BEO (100microl/kg) significantly elevated the extracellular concentration of aspartate, glycine and taurine in a Ca(2+)-dependent manner. A dose-relation study generated a bell-shaped curve. When perfused into the hippocampus via the dialysis probe (20microl/20min), BEO produced a significant increase of extracellular aspartate, glycine, taurine as well as of GABA and glutamate. The augmentation of all amino acids was Ca(2+)-independent. Focally injected 1:1 diluted BEO preferentially caused extracellular increase of glutamate. Interestingly, this release appeared to be strictly Ca(2+)-dependent. BEO concentration-dependently enhanced the release of [(3)H]D-aspartate from superfused hippocampal synaptosomes. Similar results were obtained by monitoring the BEO-evoked release of endogenous glutamate. At relatively high concentrations, the BEO-induced [(3)H]d-aspartate release was almost entirely prevented by the glutamate transporter blocker dl-threo-beta-benzyloxyaspartic acid (DL-TBOA) and was Ca(2+)-independent. At relatively low concentrations the release of [(3)H]D-aspartate was only in part ( approximately 50%) DL-TBOA-sensitive and Ca(2+)-independent; the remaining portion of release was dependent on extracellular Ca(2+). Interestingly, the monoterpene hydrocarbon-free fraction of the essential oil appeared to be inactive while the bergapten-free fraction superimposed the releasing effect of BEO supporting the deduction that psoralens may not be implicated. To conclude, BEO contains into its volatile fraction still unidentified monoterpene hydrocarbons able to stimulate glutamate release by transporter reversal and/or by exocytosis, depending on the dose administered.

  15. Housefly (Musca domestica L.) control potential of Cymbopogon citratus Stapf. (Poales: Poaceae) essential oil and monoterpenes (citral and 1,8-cineole).

    Science.gov (United States)

    Kumar, Peeyush; Mishra, Sapna; Malik, Anushree; Satya, Santosh

    2013-01-01

    In spite of being a major vector for several domestic, medical, and veterinary pests, the control aspect of the common housefly, Musca domestica L. (Diptera: Muscidae) is often neglected. In the present study, the essential oil of Cymbopogon citratus and its major components were evaluated for control of housefly. The chemical composition analysis of C. citratus oil by gas chromatographic mass spectrometry (GC-MS) revealed citral (47 %) and 1,8-cineole (7.5 %) as principal components. The analysis of oil vapor by solid phase microextraction (SPME/GC-MS) showed increase in citral (74.9 %) and 1,8-cineole (8.6 %) content. Assay of oil against housefly larvae and pupae through contact toxicity assay showed lethal concentration (LC)(50) value of 0.41 μl/cm(2) and of percentage inhibition rate (PIR) of 77.3 %, respectively. Fumigation assay was comparatively more effective with LC(50) of 48.6 μl/L against housefly larvae, and a PIR value of 100 % against housefly pupae. The monoterpenes, citral, and 1,8-cineole, when assessed for their insecticidal activity against housefly larvae, showed LC(50) of 0.002 and 0.01 μl/cm(2) (contact toxicity assay) and LC(50) of 3.3 and 2.4 μl/L (fumigation assay). For pupicidal assay, both citral and 1,8-cineole had a PIR value of 100 %. High efficacy of citral and 1,8-cineole against housefly, established them to be an active insecticidal agent of C. citratus oil. The study demonstrates potentiality of C. citratus oil as an excellent insecticide for housefly control, and the results open up the opportunity of oil/monoterpenes being developed into an eco-friendly, economical, and acceptable product.

  16. Investigation of a Quantitative Method for the Analysis of Chiral Monoterpenes in White Wine by HS-SPME-MDGC-MS of Different Wine Matrices

    Directory of Open Access Journals (Sweden)

    Mei Song

    2015-04-01

    Full Text Available A valid quantitative method for the analysis of chiral monoterpenes in white wine using head-space solid phase micro-extraction-MDGC-MS (HS-SPME-MDGC-MS with stable isotope dilution analysis was established. Fifteen compounds: (S-(−-limonene, (R-(+-limonene, (+-(2R,4S-cis-rose oxide, (−-(2S,4R-cis-rose oxide, (−-(2R,4R-trans-rose oxide, (+-(2S,4S-cis-rose oxide, furanoid (+-trans-linalool oxide, furanoid (−-cis-linalool oxide, furanoid (−-trans-linalool oxide, furanoid (+-cis-linalool oxide, (−-linalool, (+-linalool, (−-α-terpineol, (+-α-terpineol and (R-(+-β-citronellol were quantified. Two calibration curves were plotted for different wine bases, with varying residual sugar content, and three calibration curves for each wine base were investigated during a single fiber’s lifetime. This was needed as both sugar content and fiber life impacted the quantification of the chiral terpenes. The chiral monoterpene content of six Pinot Gris wines and six Riesling wines was then analyzed using the verified method. ANOVA with Tukey multiple comparisons showed significant differences for each of the detected chiral compounds in all 12 wines. PCA score plots showed a clear separation between the Riesling and Pinot Gris wines. Riesling wines had greater number of chiral terpenes in comparison to Pinot Gris wines. Beyond total terpene content it is possible that the differences in chiral terpene content may be driving the aromatic differences in white wines.

  17. Enzyme recycling in lignocellulosic biorefineries

    DEFF Research Database (Denmark)

    Jørgensen, Henning; Pinelo, Manuel

    2017-01-01

    platform. Cellulases are the most important enzymes required in this process, but the complex nature of lignocellulose requires several other enzymes (hemicellulases and auxiliary enzymes) for efficient hydrolysis. Enzyme recycling increases the catalytic productivity of the enzymes by reusing them...... upscaled and tested in industrial settings, mainly because of many difficulties with recycling of enzymes from the complex lignocellulose hydrolyzate at industrially relevant conditions, i.e., high solids loadings. The challenges are associated with the large number of different enzymes required...... for efficient hydrolysis, enzyme stability, and the detrimental interaction between enzyme and lignin. This review provides a comprehensive overview of the various methods for enzyme recovery and recycling, for example recycling of free enzymes, readsorption to fresh material, recycling of solids, membrane...

  18. Printability of Synthetic Papers by Electrophotography

    Directory of Open Access Journals (Sweden)

    Rozália Szentgyörgyvölgyi

    2010-04-01

    Full Text Available This paper deals with the printability of synthetic papers by the electrophotography technique. Prints of cmyk colour fields from 20% to 100% raster tone values were printed on three types of synthetic papers (one film synthetic paper and two fiber synthetic papers. The investigation of the appearance included densitometric measurement of the cmyk prints. The results have shown differences in the optical density and optical tone value between cmyk prints made on various synthetic papers. The highest optical density and the increase of the optical tone value were observed on the film synthetic paper, where cmyk prints were more saturated. The highest abrasion resistance of cmyk prints was obtained from the fibre synthetic paper.

  19. Synthetic biology: Emerging bioengineering in Indonesia

    Science.gov (United States)

    Suhandono, Sony

    2017-05-01

    The development of synthetic biology will shape the new era of science and technology. It is an emerging bioengineering technique involving genetic engineering which can alter the phenotype and behavior of the cell or the new product. Synthetic biology may produce biomaterials, drugs, vaccines, biosensors, and even a recombinant secondary metabolite used in herbal and complementary medicine, such as artemisinin, a malaria drug which is usually extracted from the plant Artemisia annua. The power of synthetic biology has encouraged scientists in Indonesia, and is still in early development. This paper also covers some research from an Indonesian research institute in synthetic biology such as observing the production of bio surfactants and the enhanced production of artemisinin using a transient expression system. Synthetic biology development in Indonesia may also be related to the iGEM competition, a large synthetic biology research competition which was attended by several universities in Indonesia. The application of synthetic biology for drug discovery will be discussed.

  20. Formate Assimilation: The Metabolic Architecture of Natural and Synthetic Pathways.

    Science.gov (United States)

    Bar-Even, Arren

    2016-07-19

    Formate may become an ideal mediator between the physicochemical and biological realms, as it can be produced efficiently from multiple available sources, such as electricity and biomass, and serve as one of the simplest organic compounds for providing both carbon and energy to living cells. However, limiting the realization of formate as a microbial feedstock is the low diversity of formate-fixing enzymes and thereby the small number of naturally occurring formate-assimilation pathways. Here, the natural enzymes and pathways supporting formate assimilation are presented and discussed together with proposed synthetic routes that could permit growth on formate via existing as well as novel formate-fixing reactions. By considering such synthetic routes, the diversity of metabolic solutions for formate assimilation can be expanded dramatically, such that different host organisms, cultivation conditions, and desired products could be matched with the most suitable pathway. Astute application of old and new formate-assimilation pathways may thus become a cornerstone in the development of sustainable strategies for microbial production of value-added chemicals.