Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana)

Science.gov (United States)

2013-01-01

Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205

Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana).

Science.gov (United States)

Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg

2013-05-16

The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.

Increased and Altered Fragrance of Tobacco Plants after Metabolic Engineering Using Three Monoterpene Synthases from Lemon

Science.gov (United States)

Lücker, Joost; Schwab, Wilfried; van Hautum, Bianca; Blaas, Jan; van der Plas, Linus H. W.; Bouwmeester, Harro J.; Verhoeven, Harrie A.

2004-01-01

Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one plant by crossings, we show that it is possible to increase the amount and alter the composition of the blend of monoterpenoids produced in tobacco plants. The transgenic tobacco plant line with the three introduced monoterpene synthases is emitting β-pinene, limonene, and γ-terpinene and a number of side products of the introduced monoterpene synthases, from its leaves and flowers, in addition to the terpenoids emitted by wild-type plants. The results show that there is a sufficiently high level of substrate accessible for the introduced enzymes. PMID:14718674

Cytosolic monoterpene biosynthesis is supported by plastid-generated geranyl diphosphate substrate in transgenic tomato fruits.

Science.gov (United States)

Gutensohn, Michael; Orlova, Irina; Nguyen, Thuong T H; Davidovich-Rikanati, Rachel; Ferruzzi, Mario G; Sitrit, Yaron; Lewinsohn, Efraim; Pichersky, Eran; Dudareva, Natalia

2013-08-01

Geranyl diphosphate (GPP), the precursor of most monoterpenes, is synthesized in plastids from dimethylallyl diphosphate and isopentenyl diphosphate by GPP synthases (GPPSs). In heterodimeric GPPSs, a non-catalytic small subunit (GPPS-SSU) interacts with a catalytic large subunit, such as geranylgeranyl diphosphate synthase, and determines its product specificity. Here, snapdragon (Antirrhinum majus) GPPS-SSU was over-expressed in tomato fruits under the control of the fruit ripening-specific polygalacturonase promoter to divert the metabolic flux from carotenoid formation towards GPP and monoterpene biosynthesis. Transgenic tomato fruits produced monoterpenes, including geraniol, geranial, neral, citronellol and citronellal, while exhibiting reduced carotenoid content. Co-expression of the Ocimum basilicum geraniol synthase (GES) gene with snapdragon GPPS-SSU led to a more than threefold increase in monoterpene formation in tomato fruits relative to the parental GES line, indicating that the produced GPP can be used by plastidic monoterpene synthases. Co-expression of snapdragon GPPS-SSU with the O. basilicum α-zingiberene synthase (ZIS) gene encoding a cytosolic terpene synthase that has been shown to possess both sesqui- and monoterpene synthase activities resulted in increased levels of ZIS-derived monoterpene products compared to fruits expressing ZIS alone. These results suggest that re-direction of the metabolic flux towards GPP in plastids also increases the cytosolic pool of GPP available for monoterpene synthesis in this compartment via GPP export from plastids. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Monoterpene engineering in a woody plant Eucalyptus camaldulensis using a limonene synthase cDNA.

Science.gov (United States)

Ohara, Kazuaki; Matsunaga, Etsuko; Nanto, Kazuya; Yamamoto, Kyoko; Sasaki, Kanako; Ebinuma, Hiroyasu; Yazaki, Kazufumi

2010-01-01

Metabolic engineering aimed at monoterpene production has become an intensive research topic in recent years, although most studies have been limited to herbal plants including model plants such as Arabidopsis. The genus Eucalyptus includes commercially important woody plants in terms of essential oil production and the pulp industry. This study attempted to modify the production of monoterpenes, which are major components of Eucalyptus essential oil, by introducing two expression constructs containing Perilla frutescens limonene synthase (PFLS) cDNA, whose gene products were designed to be localized in either the plastid or cytosol, into Eucalyptus camaldulensis. The expression of the plastid-type and cytosol-type PFLS cDNA in transgenic E. camaldulensis was confirmed by real-time polymerase chain reaction (PCR). Gas chromatography with a flame ionization detector analyses of leaf extracts revealed that the plastidic and cytosolic expression of PFLS yielded 2.6- and 4.5-times more limonene than that accumulated in wild-type E. camaldulensis, respectively, while the ectopic expression of PFLS had only a small effect on the emission of limonene from the leaves of E. camaldulensis. Surprisingly, the high level of PFLS in Eucalyptus was accompanied by a synergistic increase in the production of 1,8-cineole and alpha-pinene, two major components of Eucalyptus monoterpenes. This genetic engineering of monoterpenes demonstrated a new potential for molecular breeding in woody plants.

Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile

Directory of Open Access Journals (Sweden)

S. Saeidnia

2014-04-01

Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.

Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

Science.gov (United States)

Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan

2009-01-01

The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis FlowersW

NARCIS (Netherlands)

Ginglinger, J.F.; Boachon, B.; Hofer, R.; Paetz, C.; Kollner, T.G.; Miesch, L.; Lugan, R.; Baltenweck, R.; Mutterer, J.; Ullman, P.; Verstappen, F.W.A.; Bouwmeester, H.J.

2013-01-01

The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus

Monoterpenes in the glandular trichomes of tomato are synthesized from a neryl diphosphate precursor rather than geranyl diphosphate.

Science.gov (United States)

Schilmiller, Anthony L; Schauvinhold, Ines; Larson, Matthew; Xu, Richard; Charbonneau, Amanda L; Schmidt, Adam; Wilkerson, Curtis; Last, Robert L; Pichersky, Eran

2009-06-30

We identified a cis-prenyltransferase gene, neryl diphosphate synthase 1 (NDPS1), that is expressed in cultivated tomato (Solanum lycopersicum) cultivar M82 type VI glandular trichomes and encodes an enzyme that catalyzes the formation of neryl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. mRNA for a terpene synthase gene, phellandrene synthase 1 (PHS1), was also identified in these glands. It encodes an enzyme that uses neryl diphosphate to produce beta-phellandrene as the major product as well as a variety of other monoterpenes. The profile of monoterpenes produced by PHS1 is identical with the monoterpenes found in type VI glands. PHS1 and NDPS1 map to chromosome 8, and the presence of a segment of chromosome 8 derived from Solanum pennellii LA0716 causes conversion from the M82 gland monoterpene pattern to that characteristic of LA0716 plants. The data indicate that, contrary to the textbook view of geranyl diphosphate as the "universal" substrate of monoterpene synthases, in tomato glands neryl diphosphate serves as a precursor for the synthesis of monoterpenes.

Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.

Science.gov (United States)

Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G

2015-04-01

Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American

Characterization of two monoterpene synthases involved in floral scent formation in Hedychium coronarium.

Science.gov (United States)

Yue, Yuechong; Yu, Rangcai; Fan, Yanping

2014-10-01

Hedychium coronarium, a perennial herb belonging to the family Zingiberaceae, is cultivated as a garden plant or cut flower as well as for medicine and aromatic oil. Its flowers emit a fresh and inviting scent, which is mainly because of monoterpenes present in the profile of the floral volatiles. However, fragrance produced as a result of monoterpenes has not been well studied. In the present study, two novel terpene synthase (TPS) genes (HcTPS7 and HcTPS8) were isolated to study the biosynthesis of monoterpenes in H. coronarium. In vitro characterization showed that the recombinant HcTPS7 was capable of generating sabinene as its main product, in addition to nine sub-products from geranyl diphosphate (GPP). Recombinant HcTPS8 almost specifically catalyzed the formation of linalool from GPP, while it converted farnesyl diphosphate (FPP) to α-bergamotene, cis-α-bisabolene, β-farnesene and other ten sesquiterpenes. Subcellular localization experiments revealed that HcTPS7 and HcTPS8 were located in plastids. Real-time PCR analyses showed that HcTPS7 and HcTPS8 genes were highly expressed in petals and sepals, but were almost undetectable in vegetative organs. The changes of their expression levels in petals were positively correlated with the emission patterns of sabinene and linalool, respectively, during flower development. The results indicated that HcTPS7 and HcTPS8 were involved in the biosynthesis of sabinene and linalool in H. coronarium flowers. Results on these two TPSs first characterized from H. coronarium provide new insights into molecular mechanisms of terpene biosynthesis in this species and also lay the basis for biotechnological modification of floral scent profile in Hedychium.

The Tomato Terpene Synthase Gene Family1[W][OA

Science.gov (United States)

Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

2011-01-01

Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

Directory of Open Access Journals (Sweden)

Leila ePazouki

2015-03-01

Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors1

Science.gov (United States)

Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.

2015-01-01

Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633

A Dual Repeat Cis-Element Determines Expression of GERANYL DIPHOSPHATE SYNTHASE for Monoterpene Production in Phalaenopsis Orchids

Directory of Open Access Journals (Sweden)

Yu-Chen Chuang

2018-06-01

Full Text Available Phalaenopsis bellina is a scented orchid emitting large amount of monoterpenes. GERANYL DIPHOSPHATE SYNTHASE (PbGDPS is the key enzyme for monoterpene biosynthesis, and shows concomitant expression with the emission of monoterpenes during flower development in P. bellina. Here, we identified a dual repeat cis-element in the GDPS promoter that is critical for monoterpene biosynthesis in Phalaenopsis orchids. A strong correlation between the dual repeat and the monoterpene production was revealed by examination of the GDPS promoter fragments over 12 Phalaenopsis species. Serial-deletion of the 2-kb GDPS promoter fragments demonstrated that the integrity of the dual repeat was crucial for its promoter activities. By screening the Arabidopsis transcription factors (TFs cDNA library using yeast one-hybrid assay, AtbZIP18, a member of group I of bZIP TFs, was identified to be able to bind the dual repeat. We then identified PbbZIP4 in the transcriptome of P. bellina, showing 83% identity in the DNA binding region with that of AtbZIP18, and the expression level of PbbZIP4 was higher in the scented orchids. In addition, PbbZIP4 transactivated the GDPS promoter fragment containing the dual repeat in dual luciferase assay. Furthermore, transient ectopic expression of PbbZIP4 induced a 10-fold production of monoterpenoids in the scentless orchid. In conclusion, these results indicate that the dual repeat is a real TF-bound cis-element significant for GDPS gene expression, and thus subsequent monoterpene biosynthesis in the scented Phalaenopsis orchids.

Transcriptome profiling of the Australian arid-land plant Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) for the identification of monoterpene synthases.

Science.gov (United States)

Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert

2017-04-01

Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transcriptome Sequencing Analysis Reveals a Difference in Monoterpene Biosynthesis between Scented Lilium ‘Siberia’ and Unscented Lilium ‘Novano’

Directory of Open Access Journals (Sweden)

Zenghui Hu

2017-08-01

Full Text Available Lilium is a world famous fragrant bulb flower with high ornamental and economic values, and significant differences in fragrance are found among different Lilium genotypes. In order to explore the mechanism underlying the different fragrances, the floral scents of Lilium ‘Sibeia’, with a strong fragrance, and Lilium ‘Novano’, with a very faint fragrance, were collected in vivo using a dynamic headspace technique. These scents were identified using automated thermal desorption—gas chromatography/mass spectrometry (ATD-GC/MS at different flowering stages. We used RNA-Seq technique to determine the petal transcriptome at the full-bloom stage and analyzed differentially expressed genes (DEGs to investigate the molecular mechanism of floral scent biosynthesis. The results showed that a significantly higher amount of Lilium ‘Siberia’ floral scent was released compared with Lilium ‘Novano’. Moreover, monoterpenes played a dominant role in the floral scent of Lilium ‘Siberia’; therefore, it is believed that the different emissions of monoterpenes mainly contributed to the difference in the floral scent between the two Lilium genotypes. Transcriptome sequencing analysis indicated that ~29.24 Gb of raw data were generated and assembled into 124,233 unigenes, of which 35,749 unigenes were annotated. Through a comparison of gene expression between these two Lilium genotypes, 6,496 DEGs were identified. The genes in the terpenoid backbone biosynthesis pathway showed significantly different expression levels. The gene expressions of 1-deoxy-D-xylulose 5-phosphate synthase (DXS, 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR, 4-hydroxy-3-methylbut-2-enyl diphosphate synthase (HDS, 4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR, isopentenyl diphosphate isomerase (IDI, and geranyl diphosphate synthase (GPS/GGPS, were upregulated in Lilium ‘Siberia’ compared to Lilium ‘Novano’, and two monoterpene synthase genes

Improving monoterpene geraniol production through geranyl diphosphate synthesis regulation in Saccharomyces cerevisiae.

Science.gov (United States)

Zhao, Jianzhi; Bao, Xiaoming; Li, Chen; Shen, Yu; Hou, Jin

2016-05-01

Monoterpenes have wide applications in the food, cosmetics, and medicine industries and have recently received increased attention as advanced biofuels. However, compared with sesquiterpenes, monoterpene production is still lagging in Saccharomyces cerevisiae. In this study, geraniol, a valuable acyclic monoterpene alcohol, was synthesized in S. cerevisiae. We evaluated three geraniol synthases in S. cerevisiae, and the geraniol synthase Valeriana officinalis (tVoGES), which lacked a plastid-targeting peptide, yielded the highest geraniol production. To improve geraniol production, synthesis of the precursor geranyl diphosphate (GPP) was regulated by comparing three specific GPP synthase genes derived from different plants and the endogenous farnesyl diphosphate synthase gene variants ERG20 (G) (ERG20 (K197G) ) and ERG20 (WW) (ERG20 (F96W-N127W) ), and controlling endogenous ERG20 expression, coupled with increasing the expression of the mevalonate pathway by co-overexpressing IDI1, tHMG1, and UPC2-1. The results showed that overexpressing ERG20 (WW) and strengthening the mevalonate pathway significantly improved geraniol production, while expressing heterologous GPP synthase genes or down-regulating endogenous ERG20 expression did not show positive effect. In addition, we constructed an Erg20p(F96W-N127W)-tVoGES fusion protein, and geraniol production reached 66.2 mg/L after optimizing the amino acid linker and the order of the proteins. The best strain yielded 293 mg/L geraniol in a fed-batch cultivation, a sevenfold improvement over the highest titer previously reported in an engineered S. cerevisiae strain. Finally, we showed that the toxicity of geraniol limited its production. The platform developed here can be readily used to synthesize other monoterpenes.

The Biosynthetic Origin of Irregular Monoterpenes in Lavandula

Science.gov (United States)

Demissie, Zerihun A.; Erland, Lauren A. E.; Rheault, Mark R.; Mahmoud, Soheil S.

2013-01-01

Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s−1, respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering. PMID:23306202

Increased and altered fragrance of tobacco plants after metabolic engineering using three monoterpene synthases from lemon

NARCIS (Netherlands)

Lücker, J.; Schwab, W.; Hautum, van B.; Blaas, J.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

2004-01-01

Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one

Emission and Accumulation of Monoterpene and the Key Terpene Synthase (TPS) Associated with Monoterpene Biosynthesis in Osmanthus fragrans Lour

OpenAIRE

Zeng, Xiangling; Liu, Cai; Zheng, Riru; Cai, Xuan; Luo, Jing; Zou, Jingjing; Wang, Caiyun

2016-01-01

Osmanthus fragrans is an ornamental and economically important plant known for its magnificent aroma, and the most important aroma-active compounds in flowers are monoterpenes, mainly β-ocimene, linalool and linalool derivatives. To understand the molecular mechanism of monoterpene production, we analyzed the emission and accumulation patterns of these compounds and the transcript levels of the genes involved in their biosynthesis in two O. fragrans cultivars during flowering stages. The resu...

Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression.

Science.gov (United States)

1996-10-01

AD GRANT NUMBER DAMDI7-94-J-4041 TITLE: Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression PRINCIPAL...October 1996 Annual (1 Sep 95 - 31 Aug 96) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Cloning and Characterizing Genes Involved in Monoterpene Induced... Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method

Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

NARCIS (Netherlands)

Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

2002-01-01

Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

Long-term dynamics of monoterpene synthase activities, monoterpene storage pools and emissions in boreal Scots pine

OpenAIRE

Vanhatalo, Anni; Ghirardo, Andrea; Juurola, Eija; Schnitzler, Jörg-Peter; Zimmer, Ina; Hellén, Heidi; Hakola, Hannele; Bäck, Jaana

2018-01-01

Seasonal variations in monoterpene emissions from Scots pine (Pinus sylvestris) are well documented, and emissions are often shown to follow the incident temperatures due to effects on compound volatility. Recent studies have indicated a link between monoterpene emissions and physiological drivers such as photosynthetic capacity during needle development. The complex interplay between the dynamic changes in the biosynthetic capacity to produce monoterpenes and the temperature-dependent evapor...

Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

Science.gov (United States)

Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

2013-12-01

Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

Science.gov (United States)

Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

2018-03-06

Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Ca²⁺ signal contributing to the synthesis and emission of monoterpenes regulated by light intensity in Lilium 'siberia'.

Science.gov (United States)

Hu, Zenghui; Li, Tianjiao; Zheng, Jian; Yang, Kai; He, Xiangfeng; Leng, Pingsheng

2015-06-01

The floral scent is an important part of plant volatile compounds, and is influenced by environmental factors. The emission of monoterpenes of Lilium 'siberia' is regulated by light intensity, but the mechanism is large unknown. In this study, the expression of Li-mTPS, a monoterpene synthase gene in the tepals of Lilium 'siberia', and net Ca(2+) flux were investigated after exposure to different levels of light intensity (0, 100, 300, 600, 1000, and 1500 μmol m(-2) s(-1)). Moreover the effect of LaCl3 and ethylene glycol-bis-(2-aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA) on the Li-mTPS expression, monoterpene emission, and net Ca(2+) flux were examined at 600 μmol m(-2) s(-1). The results showed that along with the enhancement of light intensity, the expression level of Li-mTPS increased gradually, and the net Ca(2+) influx was also enhanced showing a similar pattern. It was found that LaCl3 and EGTA effectively inhibited the increase in expression of Li-mTPS and the net Ca(2+) influx induced by light treatment. Moreover, the release amounts of monoterpenes decreased significantly after treatment with LaCl3 and EGTA. So it can be concluded that Ca(2+) signal contributed to the biosynthesis and emission of monoterpenes regulated by light intensity in Lilium 'siberia' tepals. The increased light intensity firstly triggered the Ca(2+) influx to cytoplasm, and then the gene expression of monoterpene synthases downstream was activated to regulate the biosynthesis and emission of monoterpenes. But in the signaling pathway other mechanisms were thought to be involved in the emission of monoterpenes regulated by light intensity, which need to be investigated in future research. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

Science.gov (United States)

Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

2015-01-01

Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

Science.gov (United States)

Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

2017-05-01

Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

Cloning of a sesquiterpene synthase from Lavandula x intermedia glandular trichomes.

Science.gov (United States)

Sarker, Lukman S; Demissie, Zerihun A; Mahmoud, Soheil S

2013-11-01

The essential oil (EO) of Lavandula is dominated by monoterpenes, but can also contain small amounts of sesquiterpenes, depending on species and environmental conditions. For example, the sesquiterpene 9-epi-caryophyllene can make up to 8 % of the EO in a few species, including those commercially propagated for EO production. Here, we report the cloning and functional characterization of 9-epi-caryophyllene synthase (LiCPS) from the glandular trichomes of Lavandula x intermedia, cv. Grosso. The 1,617 bp open reading frame of LiCPS, which did not encode a transit peptide, was expressed in Escherichia coli and the recombinant protein purified by Ni-NTA agarose affinity chromatography. The ca. 60 kDa recombinant protein specifically converted farnesyl diphosphate to 9-epi-caryophyllene. LiCPS also produced a few monoterpenes when assayed with the monoterpene precursor geranyl diphosphate (GPP), but--unlike most monoterpene synthases--was not able to derive detectable amounts of any products from the cis isomer of GPP, neryl diphosphate. The LiCPS transcripts accumulated in developing L. x intermedia flowers and were highly enriched in glandular trichomes, but were not detected in leaves suggesting that the transcriptional expression of this gene is spatially and developmentally regulated.

A phycocyanin·phellandrene synthase fusion enhances recombinant protein expression and β-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria).

Science.gov (United States)

Formighieri, Cinzia; Melis, Anastasios

2015-11-01

Cyanobacteria can be exploited as photosynthetic platforms for heterologous generation of terpene hydrocarbons with industrial applications. Transformation of Synechocystis and heterologous expression of the β-phellandrene synthase (PHLS) gene alone is necessary and sufficient to confer to Synechocystis the ability to divert intermediate terpenoid metabolites and to generate the monoterpene β-phellandrene during photosynthesis. However, terpene synthases, including the PHLS, have a slow Kcat (low Vmax) necessitating high levels of enzyme concentration to enable meaningful rates and yield of product formation. Here, a novel approach was applied to increase the PHLS protein expression alleviating limitations in the rate and yield of β-phellandrene product generation. Different PHLS fusion constructs were generated with the Synechocystis endogenous cpcB sequence, encoding for the abundant in cyanobacteria phycocyanin β-subunit, expressed under the native cpc operon promoter. In one of these constructs, the CpcB·PHLS fusion protein accumulated to levels approaching 20% of the total cellular protein, i.e., substantially higher than expressing the PHLS protein alone under the same endogenous cpc promoter. The CpcB·PHLS fusion protein retained the activity of the PHLS enzyme and catalyzed β-phellandrene synthesis, yielding an average of 3.2 mg product g(-1) dry cell weight (dcw) versus the 0.03 mg g(-1)dcw measured with low-expressing constructs, i.e., a 100-fold yield improvement. In conclusion, the terpene synthase fusion-protein approach is promising, as, in this case, it substantially increased the amount of the PHLS in cyanobacteria, and commensurately improved rates and yield of β-phellandrene hydrocarbons production in these photosynthetic microorganisms. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis Flowers[W][OPEN

Science.gov (United States)

Ginglinger, Jean-François; Boachon, Benoit; Höfer, René; Paetz, Christian; Köllner, Tobias G.; Miesch, Laurence; Lugan, Raphael; Baltenweck, Raymonde; Mutterer, Jérôme; Ullmann, Pascaline; Beran, Franziska; Claudel, Patricia; Verstappen, Francel; Fischer, Marc J.C.; Karst, Francis; Bouwmeester, Harro; Miesch, Michel; Schneider, Bernd; Gershenzon, Jonathan; Ehlting, Jürgen; Werck-Reichhart, Danièle

2013-01-01

The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus predicted to be involved in monoterpenoid metabolism. We show that all four selected genes, the two terpene synthases (TPS10 and TPS14) and the two cytochrome P450s (CYP71B31 and CYP76C3), are simultaneously expressed at anthesis, mainly in upper anther filaments and in petals. Upon transient expression in Nicotiana benthamiana, the TPS enzymes colocalize in vesicular structures associated with the plastid surface, whereas the P450 proteins were detected in the endoplasmic reticulum. Whether they were expressed in Saccharomyces cerevisiae or in N. benthamiana, the TPS enzymes formed two different enantiomers of linalool: (−)-(R)-linalool for TPS10 and (+)-(S)-linalool for TPS14. Both P450 enzymes metabolize the two linalool enantiomers to form different but overlapping sets of hydroxylated or epoxidized products. These oxygenated products are not emitted into the floral headspace, but accumulate in floral tissues as further converted or conjugated metabolites. This work reveals complex linalool metabolism in Arabidopsis flowers, the ecological role of which remains to be determined. PMID:24285789

Monoterpene biosynthesis potential of plant subcellular compartments

NARCIS (Netherlands)

Dong, L.; Jongedijk, E.J.; Bouwmeester, H.J.; Krol, van der A.R.

2016-01-01

Subcellular monoterpene biosynthesis capacity based on local geranyl diphosphate (GDP) availability or locally boosted GDP production was determined for plastids, cytosol and mitochondria. A geraniol synthase (GES) was targeted to plastids, cytosol, or mitochondria. Transient expression in Nicotiana

PLANT VOLATILES. Biosynthesis of monoterpene scent compounds in roses.

Science.gov (United States)

Magnard, Jean-Louis; Roccia, Aymeric; Caissard, Jean-Claude; Vergne, Philippe; Sun, Pulu; Hecquet, Romain; Dubois, Annick; Hibrand-Saint Oyant, Laurence; Jullien, Frédéric; Nicolè, Florence; Raymond, Olivier; Huguet, Stéphanie; Baltenweck, Raymonde; Meyer, Sophie; Claudel, Patricia; Jeauffre, Julien; Rohmer, Michel; Foucher, Fabrice; Hugueney, Philippe; Bendahmane, Mohammed; Baudino, Sylvie

2015-07-03

The scent of roses (Rosa x hybrida) is composed of hundreds of volatile molecules. Monoterpenes represent up to 70% percent of the scent content in some cultivars, such as the Papa Meilland rose. Monoterpene biosynthesis in plants relies on plastid-localized terpene synthases. Combining transcriptomic and genetic approaches, we show that the Nudix hydrolase RhNUDX1, localized in the cytoplasm, is part of a pathway for the biosynthesis of free monoterpene alcohols that contribute to fragrance in roses. The RhNUDX1 protein shows geranyl diphosphate diphosphohydrolase activity in vitro and supports geraniol biosynthesis in planta. Copyright © 2015, American Association for the Advancement of Science.

Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

Science.gov (United States)

Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

2015-01-01

Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

Directory of Open Access Journals (Sweden)

Leila Shabani

2015-03-01

Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

Susceptibility to Verticillium longisporum is linked to monoterpene production by TPS23/27 in Arabidopsis.

Science.gov (United States)

Roos, Jonas; Bejai, Sarosh; Mozūraitis, Raimondas; Dixelius, Christina

2015-02-01

The fungus Verticillium longisporum is a soil-borne plant pathogen of increasing economic importance, and information on plant responses to it is limited. To identify the genes and components involved in the early stages of infection, transcripts in roots of V. longisporum-challenged Arabidopsis Col-0 and the susceptible NON-RACE SPECIFIC DISEASE RESISTANCE 1 (ndr1-1) mutant were compared using ATH1 gene chips. The analysis revealed altered transcript levels of several terpene biosynthesis genes, including the monoterpene synthase TPS23/27. When transgenic 35S:TPS23/27 and TPS23/27-amiRNA plants were monitored the over-expresser line showed enhanced fungal colonization whereas the silenced genotype was indistinguishable from Col-0. Transcript analysis of terpene biosynthesis genes suggested that only the TPS23/27 pathway is affected in the two transgenic genotypes. To confirm changes in monoterpene production, emitted volatiles were determined using solid-phase microextraction and gas chromatography-mass spectrometry. Levels of all identified TPS23/27 monoterpene products were significantly altered in the transgenic plants. A stimulatory effect on conidial germination and hyphal growth of V. longisporum was also seen in co-cultivation with 35S:TPS23/27 plants and upon exposure to 1,8-cineole, the main product of TPS23/27. Methyl jasmonate treatments of myc2-1 and myc2-2 mutants and analysis of TPS23/27:uidA in the myc2-2 background suggested a dependence on jasmonic acid mediated by the transcription factor MYC2. Taken together, our results show that TPS23/27-produced monoterpenes stimulate germination and subsequent invasion of V. longisporum in Arabidopsis roots. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

Directory of Open Access Journals (Sweden)

Dullat Harpreet K

2011-03-01

Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

Capturing of the monoterpene olefin limonene produced in Saccharomyces cerevisiae

NARCIS (Netherlands)

Jongedijk, E.J.; Cankar, K.; Ranzijn, J.; Krol, van der A.R.; Bouwmeester, H.J.; Beekwilder, M.J.

2015-01-01

Monoterpene olefins such as limonene are plant compounds with applications as flavouring and fragrance agents, as solvents and potentially also in polymer and fuel chemistry. We engineered baker's yeast Saccharomyces cerevisiae to express a (-)-limonene synthase from Perilla frutescens and a

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Anaerobic Degradation of Bicyclic Monoterpenes in Castellaniella defragrans

Directory of Open Access Journals (Sweden)

Edinson Puentes-Cala

2018-02-01

Full Text Available The microbial degradation pathways of bicyclic monoterpenes contain unknown enzymes for carbon–carbon cleavages. Such enzymes may also be present in the betaproteobacterium Castellaniella defragrans, a model organism to study the anaerobic monoterpene degradation. In this study, a deletion mutant strain missing the first enzyme of the monocyclic monoterpene pathway transformed cometabolically the bicyclics sabinene, 3-carene and α-pinene into several monocyclic monoterpenes and traces of cyclic monoterpene alcohols. Proteomes of cells grown on bicyclic monoterpenes resembled the proteomes of cells grown on monocyclic monoterpenes. Many transposon mutants unable to grow on bicyclic monoterpenes contained inactivated genes of the monocyclic monoterpene pathway. These observations suggest that the monocyclic degradation pathway is used to metabolize bicyclic monoterpenes. The initial step in the degradation is a decyclization (ring-opening reaction yielding monocyclic monoterpenes, which can be considered as a reverse reaction of the olefin cyclization of polyenes.

Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia).

Science.gov (United States)

Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried

2007-09-15

The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.

Rice terpene synthase 24 (OsTPS24) encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen.

Science.gov (United States)

Yoshitomi, Kayo; Taniguchi, Shiduku; Tanaka, Keiichiro; Uji, Yuya; Akimitsu, Kazuya; Gomi, Kenji

2016-02-01

Rice is one of the most important crops worldwide and is widely used as a model plant for molecular studies of monocotyledonous species. The plant hormone jasmonic acid (JA) is involved in rice-pathogen interactions. In addition, volatile compounds, including terpenes, whose production is induced by JA, are known to be involved in the rice defense system. In this study, we analyzed the JA-induced terpene synthase OsTPS24 in rice. We found that OsTPS24 was localized in chloroplasts and produced a monoterpene, γ-terpinene. The amount of γ-terpinene increased after JA treatment. γ-Terpinene had significant antibacterial activity against Xanthomonas oryzae pv. oryzae (Xoo); however, it did not show significant antifungal activity against Magnaporthe oryzae. The antibacterial activity of the γ-terpinene against Xoo was caused by damage to bacterial cell membranes. These results suggest that γ-terpinene plays an important role in JA-induced resistance against Xoo, and that it functions as an antibacterial compound in rice. Copyright © 2015 Elsevier GmbH. All rights reserved.

Metabolic engineering of monoterpene biosynthesis in tomato fruits via introduction of the non-canonical substrate neryl diphosphate.

Science.gov (United States)

Gutensohn, Michael; Nguyen, Thuong T H; McMahon, Richard D; Kaplan, Ian; Pichersky, Eran; Dudareva, Natalia

2014-07-01

Recently it was shown that monoterpenes in tomato trichomes (Solanum lycopersicum) are synthesized by phellandrene synthase 1 (PHS1) from the non-canonical substrate neryl diphosphate (NPP), the cis-isomer of geranyl diphosphate (GPP). As PHS1 accepts both NPP and GPP substrates forming different monoterpenes, it was overexpressed in tomato fruits to test if NPP is also available in a tissue highly active in carotenoid production. However, transgenic fruits overexpressing PHS1 produced only small amounts of GPP-derived PHS1 monoterpene products, indicating the absence of endogenous NPP. Therefore, NPP formation was achieved by diverting the metabolic flux from carotenoids via expression of tomato neryl diphosphate synthase 1 (NDPS1). NDPS1 transgenic fruits produced NPP-derived monoterpenes, including nerol, neral and geranial, while displaying reduced lycopene content. NDPS1 co-expression with PHS1 resulted in a monoterpene blend, including β-phellandrene, similar to that produced from NPP by PHS1 in vitro and in trichomes. Unexpectedly, PHS1×NDPS1 fruits showed recovery of lycopene levels compared to NDPS1 fruits, suggesting that redirection of metabolic flux is only partially responsible for the reduction in carotenoids. In vitro assays demonstrated that NPP serves as an inhibitor of geranylgeranyl diphosphate synthase, thus its consumption by PHS1 leads to recovery of lycopene levels. Monoterpenes produced in PHS1×NDPS1 fruits contributed to direct plant defense negatively affecting feeding behavior of the herbivore Helicoverpa zea and displaying antifungal activity against Botrytis cinerea. These results show that NPP-derived terpenoids can be produced in plant tissues; however, NPP has to be consumed to avoid negative impacts on plant metabolism. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Induction of senescence and identification of differentially expressed genes in tomato in response to monoterpene.

Directory of Open Access Journals (Sweden)

Sumit Ghosh

Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.

Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

Science.gov (United States)

Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis

2013-01-01

Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Heteromeric and homomeric geranyl diphosphate synthases from Catharanthus roseus and their role in monoterpene indole alkaloid biosynthesis.

Science.gov (United States)

Rai, Avanish; Smita, Shachi S; Singh, Anup Kumar; Shanker, Karuna; Nagegowda, Dinesh A

2013-09-01

Catharanthus roseus is the sole source of two most important monoterpene indole alkaloid (MIA) anti-cancer agents: vinblastine and vincristine. MIAs possess a terpene and an indole moiety derived from terpenoid and shikimate pathways, respectively. Geranyl diphosphate (GPP), the entry point to the formation of terpene moiety, is a product of the condensation of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) by GPP synthase (GPPS). Here, we report three genes encoding proteins with sequence similarity to large subunit (CrGPPS.LSU) and small subunit (CrGPPS.SSU) of heteromeric GPPSs, and a homomeric GPPSs. CrGPPS.LSU is a bifunctional enzyme producing both GPP and geranyl geranyl diphosphate (GGPP), CrGPPS.SSU is inactive, whereas CrGPPS is a homomeric enzyme forming GPP. Co-expression of both subunits in Escherichia coli resulted in heteromeric enzyme with enhanced activity producing only GPP. While CrGPPS.LSU and CrGPPS showed higher expression in older and younger leaves, respectively, CrGPPS.SSU showed an increasing trend and decreased gradually. Methyl jasmonate (MeJA) treatment of leaves significantly induced the expression of only CrGPPS.SSU. GFP localization indicated that CrGPPS.SSU is plastidial whereas CrGPPS is mitochondrial. Transient overexpression of AmGPPS.SSU in C. roseus leaves resulted in increased vindoline, immediate monomeric precursor of vinblastine and vincristine. Although C. roseus has both heteromeric and homomeric GPPS enzymes, our results implicate the involvement of only heteromeric GPPS with CrGPPS.SSU regulating the GPP flux for MIA biosynthesis.

Sequence analysis of cereal sucrose synthase genes and isolation ...

African Journals Online (AJOL)

SERVER

2007-10-18

Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

Direct suppression of a rice bacterial blight (Xanthomonas oryzae pv. oryzae) by monoterpene (S)-limonene.

Science.gov (United States)

Lee, Gun Woong; Chung, Moon-Soo; Kang, Mihyung; Chung, Byung Yeoup; Lee, Sungbeom

2016-05-01

Rice bacterial blight, caused by Xanthomonas oryzae pv. oryzae (Xoo), is a severe disease of rice plants. Upon pathogen infection, rice biosynthesizes phytoalexins, including diterpenoids such as momilactones, phytocassanes, and oryzalexins. However, information on headspace volatiles in response to Xoo infection is limited. We have examined headspace volatile terpenes, induced by the infection of Xoo, and investigated their biological roles in the rice plant. Monoterpenes α-thujene, α-pinene, sabinene, myrcene, α-terpene, and (S)-limonene and sesquiterpenes cyclosativene, α-copaene, and β-elemene were detected from 1-week-old Xoo-infected rice seedlings, by solid-phase microextraction-gas chromatography-mass spectrometry. All monoterpenes were constitutively released from rice seedlings before Xoo infection. However, (S)-limonene emission was further elicited after exposure of the seedlings to Xoo in coincidence with upregulation of limonene synthase gene (OsTPS20) transcripts. Only the stereospecific (S)-limonene [and not (R)-limonene or other monoterpenes] severely inhibited Xoo growth, as confirmed by disc diffusion and liquid culture assays. Rice seedlings showed suppressed pathogenic symptoms suggestive of resistance to Xoo infection after foliar treatment with (S)-limonene. Collectively, our findings suggest that (S)-limonene is a volatile phytoanticipin, which plays a significant role in suppressing Xoo growth in rice seedlings.

Profiling of the Terpene Metabolome in Carrot Fruits of Wild ( Daucus carota L. ssp. carota) Accessions and Characterization of a Geraniol Synthase.

Science.gov (United States)

Yahyaa, Mosaab; Ibdah, Muhammad; Marzouk, Sally; Ibdah, Mwafaq

2018-03-14

Fruits from wild carrot ( Daucus carota L. ssp. carota) have been used for medicinal purposes since ancient times. The oil of its seeds, with their abundant monoterpenes and sesquiterpenes, has drawn attention in recent years because of its potential pharmaceutical application. A combined chemical, biochemical, and molecular study was conducted to evaluate the differential accumulation of terpene volatiles in carrot fruits of wild accessions. This work reports a similarity-based cloning strategy identification and functional characterization of one carrot monoterpene terpene synthase, WtDcTPS1. Recombinant WtDcTPS1 protein produces mainly geraniol, the predominant monoterpene in carrot seeds of wild accession 23727. The results suggest a role for the WtDcTPS1 gene in the biosynthesis of carrot fruit aroma and flavor compounds.

Capturing of the monoterpene olefin limonene produced in Saccharomyces cerevisiae.

Science.gov (United States)

Jongedijk, Esmer; Cankar, Katarina; Ranzijn, Jorn; van der Krol, Sander; Bouwmeester, Harro; Beekwilder, Jules

2015-01-01

Monoterpene olefins such as limonene are plant compounds with applications as flavouring and fragrance agents, as solvents and potentially also in polymer and fuel chemistry. We engineered baker's yeast Saccharomyces cerevisiae to express a (-)-limonene synthase from Perilla frutescens and a (+)-limonene synthase from Citrus limon. Both proteins were expressed either with their native plastid targeting signal or in a truncated form in which the plastidial sorting signal was removed. The yeast host strain for expression was AE9 K197G, which expresses a mutant Erg20 enzyme. This enzyme catalyses the formation of geranyl diphosphate, which is the precursor for monoterpenes. Several methods were tested to capture limonene produced by the yeast. Extraction from the culture medium by pentane, or by the addition of CaCl2 followed by solid-phase micro-extraction, did not lead to detectable limonene, indicating that limonene is rapidly lost from the culture medium. Volatile terpenes such as limonene may also be trapped in a dodecane phase added to the medium during fermentation. This method resulted in recovery of 0.028 mg/l (+)-limonene and 0.060 mg/l (-)-limonene in strains using the truncated Citrus and Perilla synthases, respectively. Trapping the headspace during culture of the limonene synthase-expressing strains resulted in higher titres, at 0.12 mg/l (+)-limonene and 0.49 mg/l (-)-limonene. These results show that the volatile properties of the olefins produced require specific methods for efficient recovery of these molecules from biotechnological production systems. Copyright © 2014 John Wiley & Sons, Ltd.

[BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

Science.gov (United States)

Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

2015-01-01

A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Microbial monoterpene transformations – A review

Directory of Open Access Journals (Sweden)

Robert eMarmulla

2014-07-01

Full Text Available Isoprene and monoterpenes constitute a significant fraction of new plant biomass. Emission rates into the atmosphere alone are estimated to be over 500 Tg per year. These natural hydrocarbons are mineralized annually in similar quantities. In the atmosphere, abiotic photochemical processes cause lifetimes of minutes to hours. Microorganisms encounter isoprene, monoterpenes and other volatiles of plant origin while living in and on plants, in the soil and in aquatic habitats. Below toxic concentrations, the compounds can serve as carbon and energy source for aerobic and anaerobic microorganisms. Besides these catabolic reactions, transformations may occur as part of detoxification processes. Initial transformations of monoterpenes involve the introduction of functional groups, oxidation reactions and molecular rearrangements catalyzed by various enzymes. Pseudomonas and Rhodococcus strains and members of the genera Castellaniella and Thauera have become model organisms for the elucidation of biochemical pathways. We review here the enzymes and their genes together with microorganisms known for a monoterpene metabolism, with a strong focus on microorganisms that are taxonomically validly described and currently available from culture collections. Metagenomes of microbiomes with a monoterpene-rich diet confirmed the ecological relevance of monoterpene metabolism and raised concerns on the quality of our insights based on the limited biochemical knowledge.

Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

Science.gov (United States)

Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

2013-01-01

Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

Isolation and functional characterization of a methyl jasmonate-responsive 3-carene synthase from Lavandula x intermedia.

Science.gov (United States)

Adal, Ayelign M; Sarker, Lukman S; Lemke, Ashley D; Mahmoud, Soheil S

2017-04-01

A methyl jasmonate responsive 3-carene synthase (Li3CARS) gene was isolated from Lavandula x intermedia and functionally characterized in vitro. Lavenders produce essential oils consisting mainly of monoterpenes, including the potent antimicrobial and insecticidal monoterpene 3-carene. In this study we isolated and functionally characterized a leaf-specific, methyl jasmonate (MeJA)-responsive monoterpene synthase (Li3CARS) from Lavandula x intermedia. The ORF excluding transit peptides encoded a 64.9 kDa protein that was expressed in E. coli, and purified with Ni-NTA agarose affinity chromatography. The recombinant Li3CARS converted GPP into 3-carene as the major product, with K m and k cat of 3.69 ± 1.17 µM and 2.01 s -1 respectively. Li3CARS also accepted NPP as a substrate to produce multiple products including a small amount of 3-carene. The catalytic efficiency of Li3CARS to produce 3-carene was over ten fold higher for GPP (k cat /K m = 0.56 µM -1 s -1 ) than NPP (k cat /K m = 0.044 µM -1 s -1 ). Production of distinct end product profiles from different substrates (GPP versus NPP) by Li3CARS indicates that monoterpene metabolism may be controlled in part through substrate availability. Li3CARS transcripts were found to be highly abundant in leaves (16-fold) as compared to flower tissues. The transcriptional activity of Li3CARS correlated with 3-carene production, and was up-regulated (1.18- to 3.8-fold) with MeJA 8-72 h post-treatment. The results suggest that Li3CARS may have a defensive role in Lavandula.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

STORAGESEVER

2010-05-24

May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

Monoterpenes Support Systemic Acquired Resistance within and between Plants.

Science.gov (United States)

Riedlmeier, Marlies; Ghirardo, Andrea; Wenig, Marion; Knappe, Claudia; Koch, Kerstin; Georgii, Elisabeth; Dey, Sanjukta; Parker, Jane E; Schnitzler, Jörg-Peter; Vlot, A Corina

2017-06-01

This study investigates the role of volatile organic compounds in systemic acquired resistance (SAR), a salicylic acid (SA)-associated, broad-spectrum immune response in systemic, healthy tissues of locally infected plants. Gas chromatography coupled to mass spectrometry analyses of SAR-related emissions of wild-type and non-SAR-signal-producing mutant plants associated SAR with monoterpene emissions. Headspace exposure of Arabidopsis thaliana to a mixture of the bicyclic monoterpenes α-pinene and β-pinene induced defense, accumulation of reactive oxygen species, and expression of SA- and SAR-related genes, including the SAR regulatory AZELAIC ACID INDUCED1 ( AZI1 ) gene and three of its paralogs. Pinene-induced resistance was dependent on SA biosynthesis and signaling and on AZI1 Arabidopsis geranylgeranyl reductase1 mutants with reduced monoterpene biosynthesis were SAR-defective but mounted normal local resistance and methyl salicylate-induced defense responses, suggesting that monoterpenes act in parallel with SA The volatile emissions from SAR signal-emitting plants induced defense in neighboring plants, and this was associated with the presence of α-pinene, β-pinene, and camphene in the emissions of the "sender" plants. Our data suggest that monoterpenes, particularly pinenes, promote SAR, acting through ROS and AZI1 , and likely function as infochemicals in plant-to-plant signaling, thus allowing defense signal propagation between neighboring plants. © 2017 American Society of Plant Biologists. All rights reserved.

PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

International Nuclear Information System (INIS)

Enan, M. R.; Bashandy, S.A.

2006-01-01

Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

Jasmonate induction of the monoterpene linalool confers resistance to rice bacterial blight and its biosynthesis is regulated by JAZ protein in rice.

Science.gov (United States)

Taniguchi, Shiduku; Hosokawa-Shinonaga, Yumi; Tamaoki, Daisuke; Yamada, Shoko; Akimitsu, Kazuya; Gomi, Kenji

2014-02-01

Jasmonic acid (JA) is involved in the regulation of host immunity in plants. Recently, we demonstrated that JA signalling has an important role in resistance to rice bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo) in rice. Here, we report that many volatile compounds accumulate in response to exogenous application of JA, including the monoterpene linalool. Expression of linalool synthase was up-regulated by JA. Vapour treatment with linalool induced resistance to Xoo, and transgenic rice plants overexpressing linalool synthase were more resistance to Xoo, presumably due to the up-regulation of defence-related genes in the absence of any treatment. JA-induced accumulation of linalool was regulated by OsJAZ8, a rice jasmonate ZIM-domain protein involving the JA signalling pathway at the transcriptional level, suggesting that linalool plays an important role in JA-induced resistance to Xoo in rice. © 2013 John Wiley & Sons Ltd.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

Directory of Open Access Journals (Sweden)

Mirian Perez Maluf

2009-01-01

Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

Terpene synthases from Cannabis sativa.

Science.gov (United States)

Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg

2017-01-01

Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

Science.gov (United States)

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Cyclic monoterpene mediated modulations of Arabidopsis thaliana phenotype

Science.gov (United States)

Kriegs, Bettina; Jansen, Marcus; Hahn, Katrin; Peisker, Helga; Šamajová, Olga; Beck, Martina; Braun, Silvia; Ulbrich, Andreas; Baluška, František

2010-01-01

Monoterpenes at high atmospheric concentrations are strong growth inhibitors in allelopathic interactions. Effects depend on dose, molecular structure of the monoterpene and on the species of the receiver plant. Stomata are among the first targets affected by camphor and menthol. Previously, it could be demonstrated that the compounds induce swelling of the protoplasts, prevent stomatal closure and enhance transpiration. In this study, we show that the block of stomatal closure is accompanied by changes to the cytoskeleton, which has a direct role in stomatal movements. Although MPK3 (MAP3 kinase) and ABF4 gene expressions are induced within six hours, stomatal closure is prevented. In contrast to ABF4, ABF2 (both transcription factors) is not induced. MPK3 and ABF4 both encode for proteins involved in the process of stomatal closure. The expression of PEPCase, an enzyme important for stomatal opening, is downregulated. The leaves develop stress symptoms, mirrored by transient changes in the expression profile of additional genes: lipoxygenase 2 (LOX2), CER5, CER6 (both important for wax production) and RD29B (an ABA inducible stress protein). Non-invasive methods showed a fast response of the plant to camphor fumigations both in a rapid decrease of the quantum yield and in the relative growth rate. Repeated exposures to the monoterpenes resulted finally in growth reduction and a stress related change in the phenotype. It is proposed that high concentrations or repeated exposure to monoterpenes led to irreversible damages, whereas low concentrations or short-term fumigations may have the potential to strengthen the plant fitness. PMID:20484979

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

Directory of Open Access Journals (Sweden)

Fei eZhou

2015-04-01

Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

Science.gov (United States)

Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

2017-05-01

S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

Science.gov (United States)

Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

2017-10-01

Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Rapid Discovery and Functional Characterization of Terpene Synthases from Four Endophytic Xylariaceae.

Directory of Open Access Journals (Sweden)

Weihua Wu

Full Text Available Endophytic fungi are ubiquitous plant endosymbionts that establish complex and poorly understood relationships with their host organisms. Many endophytic fungi are known to produce a wide spectrum of volatile organic compounds (VOCs with potential energy applications, which have been described as "mycodiesel". Many of these mycodiesel hydrocarbons are terpenes, a chemically diverse class of compounds produced by many plants, fungi, and bacteria. Due to their high energy densities, terpenes, such as pinene and bisabolene, are actively being investigated as potential "drop-in" biofuels for replacing diesel and aviation fuel. In this study, we rapidly discovered and characterized 26 terpene synthases (TPSs derived from four endophytic fungi known to produce mycodiesel hydrocarbons. The TPS genes were expressed in an E. coli strain harboring a heterologous mevalonate pathway designed to enhance terpene production, and their product profiles were determined using Solid Phase Micro-Extraction (SPME and GC-MS. Out of the 26 TPS's profiled, 12 TPS's were functional, with the majority of them exhibiting both monoterpene and sesquiterpene synthase activity.

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

Science.gov (United States)

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

Terpene synthases from Cannabis sativa.

Directory of Open Access Journals (Sweden)

Judith K Booth

Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Comparative glandular trichome transcriptome-based gene characterization reveals reasons for differential (-)-menthol biosynthesis in Mentha species.

Science.gov (United States)

Akhtar, Md Qussen; Qamar, Nida; Yadav, Pallavi; Kulkarni, Pallavi; Kumar, Ajay; Shasany, Ajit Kumar

2017-06-01

The genes involved in menthol biosynthesis are reported earlier in Mentha × piperita. But the information on these genes is not available in Mentha arvensis. To bridge the gap in knowledge on differential biosynthesis of monoterpenes leading to compositional variation in the essential oil of these species, a comparative transcriptome analysis of the glandular trichome (GT) was carried out. In addition to the mevalonic acid (MVA) and methylerythritol phosphate (MEP) pathway genes, about 210 and 196 different terpene synthases (TPSs) transcripts were identified from annotation in M. arvensis and M. × piperita, respectively, and correlated to several monoterpenes present in the essential oil. Six isoforms of (-)-menthol dehydrogenases (MD), the last enzyme of the menthol biosynthetic pathway, were identified, cloned and characterized from the transcriptome data (three from each species). Varied expression levels and differential enzyme kinetics of these isoforms indicated the nature and composition of the product, as these isoforms generate both (-)-menthol and (+)-neomenthol from (-)-menthone and converts (-)-menthol to (-)-menthone in the reverse reaction, and hence together determine the quantity of (-)-menthol in the essential oil in these two species. Several genes for high value minor monoterpenes could also be identified from the transcriptome data. © 2017 Scandinavian Plant Physiology Society.

Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

Directory of Open Access Journals (Sweden)

Kattina Zavala

Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

Science.gov (United States)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

DEFF Research Database (Denmark)

von Wettstein, Penny

2017-01-01

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

Nitric oxide synthase gene G298 allele

International Nuclear Information System (INIS)

Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

2004-01-01

Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

Spearmint R2R3-MYB transcription factor MsMYB negatively regulates monoterpene production and suppresses the expression of geranyl diphosphate synthase large subunit (MsGPPS.LSU).

Science.gov (United States)

Reddy, Vaishnavi Amarr; Wang, Qian; Dhar, Niha; Kumar, Nadimuthu; Venkatesh, Prasanna Nori; Rajan, Chakravarthy; Panicker, Deepa; Sridhar, Vishweshwaran; Mao, Hui-Zhu; Sarojam, Rajani

2017-09-01

Many aromatic plants, such as spearmint, produce valuable essential oils in specialized structures called peltate glandular trichomes (PGTs). Understanding the regulatory mechanisms behind the production of these important secondary metabolites will help design new approaches to engineer them. Here, we identified a PGT-specific R2R3-MYB gene, MsMYB, from comparative RNA-Seq data of spearmint and functionally characterized it. Analysis of MsMYB-RNAi transgenic lines showed increased levels of monoterpenes, and MsMYB-overexpressing lines exhibited decreased levels of monoterpenes. These results suggest that MsMYB is a novel negative regulator of monoterpene biosynthesis. Ectopic expression of MsMYB, in sweet basil and tobacco, perturbed sesquiterpene- and diterpene-derived metabolite production. In addition, we found that MsMYB binds to cis-elements of MsGPPS.LSU and suppresses its expression. Phylogenetic analysis placed MsMYB in subgroup 7 of R2R3-MYBs whose members govern phenylpropanoid pathway and are regulated by miR858. Analysis of transgenic lines showed that MsMYB is more specific to terpene biosynthesis as it did not affect metabolites derived from phenylpropanoid pathway. Further, our results indicate that MsMYB is probably not regulated by miR858, like other members of subgroup 7. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Chromosomal localization of the human and mouse hyaluronan synthase genes

Energy Technology Data Exchange (ETDEWEB)

Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

1997-05-01

We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

A comparison of new measurements of total monoterpene flux with improved measurements of speciated monoterpene flux

Directory of Open Access Journals (Sweden)

A. Lee

2005-01-01

Full Text Available Many monoterpenes have been identified in forest emissions using gas chromatography (GC. Until now, it has been impossible to determine whether all monoterpenes are appropriately measured using GC techniques. We used a proton transfer reaction mass spectrometer (PTR-MS coupled with the eddy covariance (EC technique to measure mixing ratios and fluxes of total monoterpenes above a ponderosa pine plantation. We compared PTR-MS-EC results with simultaneous measurements of eight speciated monoterpenes, β-pinene, α-pinene, 3-carene, d-limonene, β-phellandrene, α-terpinene, camphene, and terpinolene, made with an automated, in situ gas chromatograph with flame ionization detectors (GC-FID, coupled to a relaxed eddy accumulation system (REA. Monoterpene mixing ratios and fluxes measured by PTR-MS averaged 30±2.3% and 31±9.2% larger than by GC-FID, with larger mixing ratio discrepancies between the two techniques at night than during the day. Two unidentified peaks that correlated with β-pinene were resolved in the chromatograms and completely accounted for the daytime difference and reduced the nighttime mixing ratio difference to 20±2.9%. Measurements of total monoterpenes by PTR-MS-EC indicated that GC-FID-REA measured the common, longer-lived monoterpenes well, but that additional terpenes were emitted from the ecosystem that represented an important contribution to the total mixing ratio above the forest at night.

The Eucalyptus terpene synthase gene family.

Science.gov (United States)

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

Science.gov (United States)

von Wettstein-Knowles, Penny

2017-07-10

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

Monoterpene biosynthesis potential of plant subcellular compartments.

Science.gov (United States)

Dong, Lemeng; Jongedijk, Esmer; Bouwmeester, Harro; Van Der Krol, Alexander

2016-01-01

Subcellular monoterpene biosynthesis capacity based on local geranyl diphosphate (GDP) availability or locally boosted GDP production was determined for plastids, cytosol and mitochondria. A geraniol synthase (GES) was targeted to plastids, cytosol, or mitochondria. Transient expression in Nicotiana benthamiana indicated local GDP availability for each compartment but resulted in different product levels. A GDP synthase from Picea abies (PaGDPS1) was shown to boost GDP production. PaGDPS1 was also targeted to plastids, cytosol or mitochondria and PaGDPS1 and GES were coexpressed in all possible combinations. Geraniol and geraniol-derived products were analyzed by GC-MS and LC-MS, respectively. GES product levels were highest for plastid-targeted GES, followed by mitochondrial- and then cytosolic-targeted GES. For each compartment local boosting of GDP biosynthesis increased GES product levels. GDP exchange between compartments is not equal: while no GDP is exchanged from the cytosol to the plastids, 100% of GDP in mitochondria can be exchanged to plastids, while only 7% of GDP from plastids is available for mitochondria. This suggests a direct exchange mechanism for GDP between plastids and mitochondria. Cytosolic PaGDPS1 competes with plastidial GES activity, suggesting an effective drain of isopentenyl diphosphate from the plastids to the cytosol. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

Functional identification of a Lippia dulcis bornyl diphosphate synthase that contains a duplicated, inhibitory arginine-rich motif.

Science.gov (United States)

Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun

2017-08-26

Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

Energy Technology Data Exchange (ETDEWEB)

Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

2014-03-07

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

International Nuclear Information System (INIS)

Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

2014-01-01

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

Highly reactive light-dependent monoterpenes in the Amazon

Science.gov (United States)

Jardine, A. B.; Jardine, K. J.; Fuentes, J. D.; Martin, S. T.; Martins, G.; Durgante, F.; Carneiro, V.; Higuchi, N.; Manzi, A. O.; Chambers, J. Q.

2015-03-01

Despite orders of magnitude difference in atmospheric reactivity and great diversity in biological functioning, little is known about monoterpene speciation in tropical forests. Here we report vertically resolved ambient air mixing ratios for 12 monoterpenes in a central Amazon rainforest including observations of the highly reactive cis-β-ocimene (160 ppt), trans-β-ocimene (79 ppt), and terpinolene (32 ppt) which accounted for an estimated 21% of total monoterpene composition yet 55% of the upper canopy monoterpene ozonolysis rate. All 12 monoterpenes showed a mixing ratio peak in the upper canopy, with three demonstrating subcanopy peaks in 7 of 11 profiles. Leaf level emissions of highly reactive monoterpenes accounted for up to 1.9% of photosynthesis confirming light-dependent emissions across several Amazon tree genera. These results suggest that highly reactive monoterpenes play important antioxidant roles during photosynthesis in plants and serve as near-canopy sources of secondary organic aerosol precursors through atmospheric photooxidation via ozonolysis.

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

Science.gov (United States)

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

Conifer-Derived Monoterpenes and Forest Walking

OpenAIRE

Sumitomo, Kazuhiro; Akutsu, Hiroaki; Fukuyama, Syusei; Minoshima, Akiho; Kukita, Shin; Yamamura, Yuji; Sato, Yoshiaki; Hayasaka, Taiki; Osanai, Shinobu; Funakoshi, Hiroshi; Hasebe, Naoyuki; Nakamura, Masao

2015-01-01

Conifer and broadleaf trees emit volatile organic compounds in the summer. The major components of these emissions are volatile monoterpenes. Using solid phase microextraction fiber as the adsorbant, monoterpenes were successfully detected and identified in forest air samples. Gas chromatography/mass chromatogram of monoterpenes in the atmosphere of a conifer forest and that of serum from subjects who were walking in a forest were found to be similar each other. The amounts of α-pinene in the...

Identification and Characterization of the Iridoid Synthase Involved in Oleuropein Biosynthesis in Olive (Olea europaea) Fruits*

Science.gov (United States)

Kries, Hajo; Panara, Francesco; Baldoni, Luciana; O'Connor, Sarah E.; Osbourn, Anne

2016-01-01

The secoiridoids are the main class of specialized metabolites present in olive (Olea europaea L.) fruit. In particular, the secoiridoid oleuropein strongly influences olive oil quality because of its bitterness, which is a desirable trait. In addition, oleuropein possesses a wide range of pharmacological properties, including antioxidant, anti-inflammatory, and anti-cancer activities. In accordance, obtaining high oleuropein varieties is a main goal of molecular breeding programs. Here we use a transcriptomic approach to identify candidate genes belonging to the secoiridoid pathway in olive. From these candidates, we have functionally characterized the olive homologue of iridoid synthase (OeISY), an unusual terpene cyclase that couples an NAD (P)H-dependent 1,4-reduction step with a subsequent cyclization, and we provide evidence that OeISY likely generates the monoterpene scaffold of oleuropein in olive fruits. OeISY, the first pathway gene characterized for this type of secoiridoid, is a potential target for breeding programs in a high value secoiridoid-accumulating species. PMID:26709230

Identification and characterization of the iridoid synthase involved in oleuropein biosynthesis in olive (Olea europaea) fruits

DEFF Research Database (Denmark)

Alagna, Fiammetta; Geu-Flores, Fernando; Kries, Hajo

2016-01-01

The secoiridoids are the main class of specialized metabolites present in olive (Olea europaea L.) fruit. In particular, the secoiridoid oleuropein strongly influences olive oil quality because of its bitterness, which is a desirable trait. In addition, oleuropein possesses a wide range...... of pharmacological properties, including antioxidant, anti-inflammatory, and anti-cancer activities. In accordance, obtaining high oleuropein varieties is a main goal of molecular breeding programs. Here we use a transcriptomic approach to identify candidate genes belonging to the secoiridoid pathway in olive. From...... these candidates, we have functionally characterized the olive homologue of iridoid synthase (OeISY), an unusual terpene cyclase that couples an NAD (P)H-dependent 1,4-reduction step with a subsequent cyclization, and we provide evidence that OeISY likely generates the monoterpene scaffold of oleuropein in olive...

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Oil production at different stages of leaf development in Lippia alba

OpenAIRE

Diego Pandeló; Talita D. Melo; Júnya L. Singulani; Fernanda A. F. Guedes; Marco A. Machado; Cíntia M. Coelho; Lyderson F. Viccini; Marcelo O. Santos

2012-01-01

The aim of this work was to analyze terpene oil production and terpene synthases (TPS) gene expression from leaves at different developmental stages of different chemotypes of Lippia alba (Mill.) N.E. Br. ex Britton & P. Wilson, Verbenaceae. Hydro-distilled essential oil were used for chemical analysis and gene expression of three monoterpene synthase genes called LaTPS12, LaTPS23 and LaTPS25 were used for analyses of gene expression associated to oil production. The putative genes were a...

Cloning and characterization of ATP synthase CF1 α gene from ...

African Journals Online (AJOL)

ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

Cardiovascular effects of monoterpenes: a review

Directory of Open Access Journals (Sweden)

Márcio R. V. Santos

2011-07-01

Full Text Available The monoterpenes are secondary metabolites of plants. They have various pharmacological properties including antifungal, antibacterial, antioxidant, anticancer, anti-spasmodic, hypotensive, and vasorelaxant. The purpose of this research was to review the cardiovascular effects of monoterpenes. The data in this resarch were collected using the Internet portals Pubmed, Scopus, and ISI Web of Knowledge between the years 1987 and 2010. In the study 33 monoterpenes were included, which were related to each of the thirteen individual words: artery, cardiovascular, heart, myocyte, vasorelaxant, vessel, hypotension, hypotensive, cardiomyocyte, ventricular, vasodilatory, aorta, and aortic. The research utilized 22 articles published mainly in the journals Phytomedicine, Fundamental Clinical Pharmacology, Planta Medica, Life Science, European Journal of Pharmacology, and Brazilian Journal of Medical and Biological Research. Of the 33 monoterpenes studied surveyed, sixteen of them had already been studied for their effects on the cardiovascular system: carvacrol, citronellol, p-cymene, eucalyptol (1,8-cineole, linalool, menthol, myrtenal, myrtenol, α-pinene, rotundifolone (piperitenone oxide, sobrerol, thymol, α-limonene, α-terpinen-4-ol, α-terpineol, and perillyl alcohol. The main effects observed were vasorelaxation, decreased heart rate and blood pressure. This review showed that the monoterpenes may be considered promising agents for prevention or treatment of diseases of the cardiovascular system.

Cardiovascular effects of monoterpenes: a review

Directory of Open Access Journals (Sweden)

Márcio R. V. Santos

2011-08-01

Full Text Available The monoterpenes are secondary metabolites of plants. They have various pharmacological properties including antifungal, antibacterial, antioxidant, anticancer, anti-spasmodic, hypotensive, and vasorelaxant. The purpose of this research was to review the cardiovascular effects of monoterpenes. The data in this resarch were collected using the Internet portals Pubmed, Scopus, and ISI Web of Knowledge between the years 1987 and 2010. In the study 33 monoterpenes were included, which were related to each of the thirteen individual words: artery, cardiovascular, heart, myocyte, vasorelaxant, vessel, hypotension, hypotensive, cardiomyocyte, ventricular, vasodilatory, aorta, and aortic. The research utilized 22 articles published mainly in the journals Phytomedicine, Fundamental Clinical Pharmacology, Planta Medica, Life Science, European Journal of Pharmacology, and Brazilian Journal of Medical and Biological Research. Of the 33 monoterpenes studied surveyed, sixteen of them had already been studied for their effects on the cardiovascular system: carvacrol, citronellol, p-cymene, eucalyptol (1,8-cineole, linalool, menthol, myrtenal, myrtenol, α-pinene, rotundifolone (piperitenone oxide, sobrerol, thymol, α-limonene, α-terpinen-4-ol, α-terpineol, and perillyl alcohol. The main effects observed were vasorelaxation, decreased heart rate and blood pressure. This review showed that the monoterpenes may be considered promising agents for prevention or treatment of diseases of the cardiovascular system.

Monoterpene emissions from an understory species, Pteridium aquilinum

Science.gov (United States)

Madronich, Monica B.; Greenberg, James P.; Wessman, Carol A.; Guenther, Alex B.

2012-07-01

Monoterpene emissions from the dominant understory species Pteridium aquilinum (Bracken fern) in a mixed temperate forest were measured in the field during the summers of 2006, 2007 and 2008. The results showed that Bracken fern emitted monoterpenes at different rates depending if the plants were located in the understory or in open areas. Understory plants emitted monoterpene levels ranging from 0.002 to 13 μgC gdw-1 h-1. Open area plants emitted monoterpene levels ranging from 0.005 to 2.21 μgC gdw-1 h-1. During the summer of 2008 greenhouse studies were performed to complement the field studies. Only 3% of the greenhouse Bracken fern plants emitted substantial amounts of monoterpenes. The average emission, 0.15 μgC gdw-1 h-1 ± 0.9 μgC gdw-1 h-1, was much lower than that observed in the field. The factors controlling monoterpene emissions are not clear, but this study provides evidence of the potential importance of understory vegetation to ecosystem total hydrocarbon emissions and emphasizes the need for longer-term field studies.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

OpenAIRE

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

International Nuclear Information System (INIS)

Rothenberg, M.; Hanson, M.R.

1988-01-01

A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

Directory of Open Access Journals (Sweden)

Yanjing Su

2012-06-01

Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

Aroma Quality of Fruits of Wild and Cultivated Strawberry (FRAGARIA SPP. in Relation to the Flavour-Related Gene Expression

Directory of Open Access Journals (Sweden)

Bianchi Giulia

2014-09-01

Full Text Available Expression profiles of flavour-related genes and the aroma quality of fruit headspace were investigated in the four strawberry genotypes ‘Reine des Vallées’ (Fragaria vesca, ‘Profumata di Tortona’ (F mos-chata, ‘Onda’ and VR 177 selection (F” x ananassa. Differences in the expression level of genes coding of strawberry alcohol acyltransferase (SAAT, F. x ananassa nerolidol synthase 1 (FaNESl and F vesca monoterpene and sesquiterpene synthases (FvPINS and PINS1, respectively were detected among these genotypes. In fruits of F. x ananassa the terpenoid profile was dominated by nerolidol, whereas wild spe–cies produced mainly monoterpenes. It was correlated with the higher induction of FaNES1 in cultivated and PINS gene in the wild Fragaria species. The flavour biogenesis in ripening fruits was determined by the expression of SAAT gene, especially visible for ‘Profumata di Tortona’ and ‘Onda’ strawberries. The fruit solid-phase microextraction (SPME headspace was analysed using the Gas Chromatography-Olfac–tometry (GC-O, that allows for the chromatographic separation of volatiles together with their olfactomet-ric evaluation. ‘Reine des Vallées’ fruits have a peculiar profile characterized by high concentrations of limonene, linalool and mesifurane that resulted in “spiced”, “citrus, floral” and “sweet, baked” descriptors. The character impact compound in ‘Profumata di Tortona’ fruits was ethyl butanoate, responsible for “sweet” and “fruity, strawberry” descriptors. However, it was detected in lower amount in comparison to the data obtained for F. x ananassa strawberries. The sesquiterpene nerolidol was identified in both culti–vated strawberry genotypes.

Microbial monoterpene transformations—a review

OpenAIRE

Marmulla, Robert; Harder, Jens

2014-01-01

Isoprene and monoterpenes constitute a significant fraction of new plant biomass. Emission rates into the atmosphere alone are estimated to be over 500 Tg per year. These natural hydrocarbons are mineralized annually in similar quantities. In the atmosphere, abiotic photochemical processes cause lifetimes of minutes to hours. Microorganisms encounter isoprene, monoterpenes, and other volatiles of plant origin while living in and on plants, in the soil and in aquatic habitats. Below toxic conc...

Enantiospecific (+)- and (-)-germacrene D synthases, cloned from goldenrod, reveal a functionally active variant of the universal isoprenoid-biosynthesis aspartate-rich motif.

Science.gov (United States)

Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H

2004-12-15

The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.

Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

Science.gov (United States)

Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

2017-08-01

Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification and Characterization of the Iridoid Synthase Involved in Oleuropein Biosynthesis in Olive (Olea europaea) Fruits.

Science.gov (United States)

Alagna, Fiammetta; Geu-Flores, Fernando; Kries, Hajo; Panara, Francesco; Baldoni, Luciana; O'Connor, Sarah E; Osbourn, Anne

2016-03-11

The secoiridoids are the main class of specialized metabolites present in olive (Olea europaea L.) fruit. In particular, the secoiridoid oleuropein strongly influences olive oil quality because of its bitterness, which is a desirable trait. In addition, oleuropein possesses a wide range of pharmacological properties, including antioxidant, anti-inflammatory, and anti-cancer activities. In accordance, obtaining high oleuropein varieties is a main goal of molecular breeding programs. Here we use a transcriptomic approach to identify candidate genes belonging to the secoiridoid pathway in olive. From these candidates, we have functionally characterized the olive homologue of iridoid synthase (OeISY), an unusual terpene cyclase that couples an NAD (P)H-dependent 1,4-reduction step with a subsequent cyclization, and we provide evidence that OeISY likely generates the monoterpene scaffold of oleuropein in olive fruits. OeISY, the first pathway gene characterized for this type of secoiridoid, is a potential target for breeding programs in a high value secoiridoid-accumulating species. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

Science.gov (United States)

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

Cloning, functional characterization and genomic organization of 1,8-cineole synthases from Lavandula.

Science.gov (United States)

Demissie, Zerihun A; Cella, Monica A; Sarker, Lukman S; Thompson, Travis J; Rheault, Mark R; Mahmoud, Soheil S

2012-07-01

Several members of the genus Lavandula produce valuable essential oils (EOs) that are primarily constituted of the low molecular weight isoprenoids, particularly monoterpenes. We isolated over 8,000 ESTs from the glandular trichomes of L. x intermedia flowers (where bulk of the EO is synthesized) to facilitate the discovery of genes that control the biosynthesis of EO constituents. The expression profile of these ESTs in L. x intermedia and its parents L. angustifolia and L. latifolia was established using microarrays. The resulting data highlighted a differentially expressed, previously uncharacterized cDNA with strong homology to known 1,8-cineole synthase (CINS) genes. The ORF, excluding the transit peptide, of this cDNA was expressed in E. coli, purified by Ni-NTA agarose affinity chromatography and functionally characterized in vitro. The ca. 63 kDa bacterially produced recombinant protein, designated L. x intermedia CINS (LiCINS), converted geranyl diphosphate (the linear monoterpene precursor) primarily to 1,8-cineole with K ( m ) and k ( cat ) values of 5.75 μM and 8.8 × 10(-3) s(-1), respectively. The genomic DNA of CINS in the studied Lavandula species had identical exon-intron architecture and coding sequences, except for a single polymorphic nucleotide in the L. angustifolia ortholog which did not alter protein function. Additional nucleotide variations restricted to L. angustifolia introns were also observed, suggesting that LiCINS was most likely inherited from L. latifolia. The LiCINS mRNA levels paralleled the 1,8-cineole content in mature flowers of the three lavender species, and in developmental stages of L. x intermedia inflorescence indicating that the production of 1,8 cineole in Lavandula is most likely controlled through transcriptional regulation of LiCINS.

Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation

Science.gov (United States)

Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella

2011-01-01

Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399

Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

DEFF Research Database (Denmark)

Vestergaard, H; Lund, S; Bjørbaek, C

1995-01-01

We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

Directory of Open Access Journals (Sweden)

Xiudao Yu

2013-10-01

Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

Science.gov (United States)

Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

2013-03-01

Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

[Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

Science.gov (United States)

Boris, K V; Kochieva, E Z; Kudryavtsev, A M

2014-12-01

The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

Directory of Open Access Journals (Sweden)

Mariateresa eVolpicella

2016-03-01

Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

Identification of a Plastid-Localized Bifunctional Nerolidol/Linalool Synthase in Relation to Linalool Biosynthesis in Young Grape Berries

Directory of Open Access Journals (Sweden)

Bao-Qing Zhu

2014-12-01

Full Text Available Monoterpenoids are a diverse class of natural products and contribute to the important varietal aroma of certain Vitis vinifera grape cultivars. Among the typical monoterpenoids, linalool exists in almost all grape varieties. A gene coding for a nerolidol/linalool (NES/LINS synthase was evaluated in the role of linalool biosynthesis in grape berries. Enzyme activity assay of this recombinant protein revealed that it could convert geranyl diphosphate and farnesyl diphosphate into linalool and nerolidol in vitro, respectively, and thus it was named VvRILinNer. However, localization experiment showed that this enzyme was only localized to chloroplasts, which indicates that VvRILinNer functions in the linalool production in vivo. The patterns of gene expression and linalool accumulation were analyzed in the berries of three grape cultivars (“Riesling”, “Cabernet Sauvignon”, “Gewurztraminer” with significantly different levels of monoterpenoids. The VvRILinNer was considered to be mainly responsible for the synthesis of linalool at the early developmental stage. This finding has provided us with new knowledge to uncover the complex monoterpene biosynthesis in grapes.

Identification of a Plastid-Localized Bifunctional Nerolidol/Linalool Synthase in Relation to Linalool Biosynthesis in Young Grape Berries

Science.gov (United States)

Zhu, Bao-Qing; Cai, Jian; Wang, Zhi-Qun; Xu, Xiao-Qing; Duan, Chang-Qing; Pan, Qiu-Hong

2014-01-01

Monoterpenoids are a diverse class of natural products and contribute to the important varietal aroma of certain Vitis vinifera grape cultivars. Among the typical monoterpenoids, linalool exists in almost all grape varieties. A gene coding for a nerolidol/linalool (NES/LINS) synthase was evaluated in the role of linalool biosynthesis in grape berries. Enzyme activity assay of this recombinant protein revealed that it could convert geranyl diphosphate and farnesyl diphosphate into linalool and nerolidol in vitro, respectively, and thus it was named VvRILinNer. However, localization experiment showed that this enzyme was only localized to chloroplasts, which indicates that VvRILinNer functions in the linalool production in vivo. The patterns of gene expression and linalool accumulation were analyzed in the berries of three grape cultivars (“Riesling”, “Cabernet Sauvignon”, “Gewurztraminer”) with significantly different levels of monoterpenoids. The VvRILinNer was considered to be mainly responsible for the synthesis of linalool at the early developmental stage. This finding has provided us with new knowledge to uncover the complex monoterpene biosynthesis in grapes. PMID:25470020

[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

Science.gov (United States)

Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

2014-01-01

Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

2004-01-01

The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

Science.gov (United States)

Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

2012-06-01

Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

2008-01-01

A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

DEFF Research Database (Denmark)

Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

2016-01-01

identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

Science.gov (United States)

Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

2016-02-10

In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

Directory of Open Access Journals (Sweden)

Mariela V Catone

Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

Science.gov (United States)

Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

2016-03-01

Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Metabolism of monoterpenes in cell cultures of common sage (Salvia officinalis)

International Nuclear Information System (INIS)

Falk, K.L.; Gershenzon, J.; Croteau, R.

1990-01-01

Leaves of common sage (Salvia officinalis) accumulate monoterpenes in glandular trichomes at levels exceeding 15 milligrams per gram fresh weight at maturity, whereas sage cells in suspension culture did not accumulate detectable levels of monoterpenes ( 14 C]sucrose was also virtually undetectable in this cell culture system. In vitro assay of each of the enzymes required for the sequential conversion of the ubiquitous isoprenoid precursor geranyl pyrophosphate to (+)-camphor (a major monoterpene product of sage) in soluble extracts of the cells revealed the presence of activity sufficient to produce (+)-camphor at a readily detectable level (>0.3 micrograms per gram fresh weight) at the late log phase of growth. Other monoterpene synthetic enzymes were present as well. In vivo measurement of the ability to catabolize (+)-camphor in these cells indicated that degradative capability exceeded biosynthetic capacity by at least 1,000-fold. Therefore, the lack of monoterpene accumulation in undifferentiated sage cultures could be attributed to a low level of biosynthetic activity (relative to the intact plant) coupled to a pronounced capacity for monoterpene catabolism

Structural relationships and vasorelaxant activity of monoterpenes

Directory of Open Access Journals (Sweden)

Cardoso Lima Tamires

2012-09-01

Full Text Available Abstract Background and purpose of the study The hypotensive activity of the essential oil of Mentha x villosa and its main constituent, the monoterpene rotundifolone, have been reported. Therefore, our objective was to evaluate the vasorelaxant effect of monoterpenes found in medicinal plants and establish the structure-activity relationship of rotundifolone and its structural analogues on the rat superior mesenteric artery. Methods Contractions of the vessels were induced with 10 μM of phenylephine (Phe in rings with endothelium. During the tonic phase of the contraction, the monoterpenes (10-8 - 10-3, cumulatively were added to the organ bath. The extent of relaxation was expressed as the percentage of Phe-induced contraction. Results The results from the present study showed that both oxygenated terpenes (rotundifolone, (+-limonene epoxide, pulegone epoxide, carvone epoxide, and (+-pulegone and non-oxygenated terpene ((+-limonene exhibit relaxation activity. The absence of an oxygenated molecular structure was not a critical requirement for the molecule to be bioactive. Also it was found that the position of ketone and epoxide groups in the monoterpene structures influence the vasorelaxant potency and efficacy. Major conclusion The results suggest that the presence of functional groups in the chemical structure of rotundifolone is not essential for its vasorelaxant activity.

Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

Science.gov (United States)

Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

2017-08-09

Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

Effects of salicylic acid on monoterpene production and antioxidant ...

African Journals Online (AJOL)

Salicylic acid (SA) plays important roles in plant defense responses. However, little is available about its effects on monoterpene responses. Therefore, monoterpene contents and antioxidant systems were measured three days after foliar application of SA with different concentrations in Houttuynia cordata. SA at low ...

Is forest management a significant source of monoterpenes into the boreal atmosphere?

Science.gov (United States)

Haapanala, S.; Hakola, H.; Hellén, H.; Vestenius, M.; Levula, J.; Rinne, J.

2012-04-01

Volatile organic compounds (VOCs) including terpenoids are emitted into the atmosphere from various natural sources. Damaging the plant tissue is known to strongly increase their monoterpene release. We measured the terpenoid emissions caused by timber felling, i.e. those from stumps and logging residue. The emissions from stumps were studied using enclosures and those from the whole felling area using an ecosystem-scale micrometeorological method, disjunct eddy accumulation (DEA). The compounds analyzed were isoprene, monoterpenes and sesquiterpenes. Strong emissions of monoterpenes were measured from both the stumps and from the whole felling area. The emission rate decreased rapidly within a few months after the logging. In addition to fresh logging residue, the results suggest also other strong monoterpene sources may be present in the felling area. These could include pre-existing litter, increased microbial activity and remaining undergrowth. In order to evaluate the possible importance of monoterpenes emitted annually from cut Scots pine forests in Finland, we conducted a rough upscaling calculation. The resulting monoterpene release was approximated to be on the order of 15 kilotonnes per year, which corresponds to about one tenth of the monoterpene release from intact forests in Finland.

Is forest management a significant source of monoterpenes into the boreal atmosphere?

Directory of Open Access Journals (Sweden)

S. Haapanala

2012-04-01

Full Text Available Volatile organic compounds (VOCs including terpenoids are emitted into the atmosphere from various natural sources. Damaging the plant tissue is known to strongly increase their monoterpene release. We measured the terpenoid emissions caused by timber felling, i.e. those from stumps and logging residue. The emissions from stumps were studied using enclosures and those from the whole felling area using an ecosystem-scale micrometeorological method, disjunct eddy accumulation (DEA. The compounds analyzed were isoprene, monoterpenes and sesquiterpenes. Strong emissions of monoterpenes were measured from both the stumps and from the whole felling area. The emission rate decreased rapidly within a few months after the logging. In addition to fresh logging residue, the results suggest also other strong monoterpene sources may be present in the felling area. These could include pre-existing litter, increased microbial activity and remaining undergrowth. In order to evaluate the possible importance of monoterpenes emitted annually from cut Scots pine forests in Finland, we conducted a rough upscaling calculation. The resulting monoterpene release was approximated to be on the order of 15 kilotonnes per year, which corresponds to about one tenth of the monoterpene release from intact forests in Finland.

Analysis of monoterpene hydrocarbons in rural atmospheres

International Nuclear Information System (INIS)

Holdren, M.W.; Westberg, H.H.; Zimmerman, P.R.

1979-01-01

Gas chromatographic/mass spectrometric analysis of monoterpenes from a rural forested site in the northwestern United States is described. Use of a glass capillary column provided excellent resolution of the hydrocarbons. Increased sensitivity and specificity of the mass spectrometer detector over the flame ionization detector were demonstrated for trace (parts per trillion) atmospheric hydrocarbons. As little as 10 ppt of compound was detectable in 100-cc air samples. Two analytical methods (cryogenic and solid adsorbent--Tenax-GC) were used in the collection of ambient air. Analytical results from the two techniques compared very well. Rural concentrations of the monoterpenes varied considerably depending upon location within the forest canopy. The concentration of individual species never exceeded 1 ppb of compound during a 10-month sampling period. The monoterpene total for all samples fell in the range of 0.5- to 16-ppb compound for C 10 terpene

Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

Science.gov (United States)

Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

2011-10-01

Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

Predictors of monoterpene exposure in the Danish furniture industry.

Science.gov (United States)

Hagström, Katja; Jacobsen, Gitte; Sigsgaard, Torben; Schaumburg, Inger; Erlandsen, Mogens; Schlunssen, Vivi

2012-04-01

Individuals who work with pine in the furniture industry may be exposed to monoterpenes, the most abundant of which are α-pinene, β-pinene, and Δ(3)-carene. Monoterpenes are suspected to cause dermatitis and to harm the respiratory system. An understanding of the predictors of monoterpene exposure is therefore important in preventing these adverse effects. These predictors may include general characteristics of the work environment and specific work operations. We sought to assess the extent to which workers are exposed to monoterpenes and to identify possible predictors of monoterpene exposure in the pine furniture industry in Denmark. Passive measurements of the levels of selected monoterpenes (α-pinene, β-pinene, and Δ(3)-carene) were performed on 161 subjects from 17 pine furniture factories in Viborg County, Denmark; one sample was acquired from each worker. Additionally, wood dust samples were collected from 145 workers. Data on potential predictors of exposure were acquired over the course of the day on which the exposure measurements were recorded and could be assigned to one of four hierarchic ordered levels: worker, machine, department, and factory. In addition to univariate analyses, a mixed model was used to account for imbalances within the data and random variation with each of the hierarchically ordered levels. The geometric mean (GM) monoterpene content observed over the 161 measurements was 7.8 mg m(-3) [geometric standard deviation (GSD): 2.4]; the GM wood dust level over 145 measurements was 0.58 mg m(-3) (GSD: 1.49). None of the measured samples exceeded the occupational exposure limit for terpenes in Denmark (25 ppm, 150 mg m(-3)). In the univariate analyses, half of the predictors tested were found to be significant; the multivariate model indicated that only three of the potential predictors were significant. These were the recirculation of air in rooms used for the processing of wood (a factory level predictor), the presence of a

Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

DEFF Research Database (Denmark)

Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

2007-01-01

from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Gnanasambandan Ramanathan

2017-01-01

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

Science.gov (United States)

Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

2016-06-01

Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

Science.gov (United States)

Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

2016-11-18

Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

OpenAIRE

Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

2012-01-01

The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

Functional and Structural Characterization of a (+)-Limonene Synthase from Citrus sinensis.

Science.gov (United States)

Morehouse, Benjamin R; Kumar, Ramasamy P; Matos, Jason O; Olsen, Sarah Naomi; Entova, Sonya; Oprian, Daniel D

2017-03-28

Terpenes make up the largest and most diverse class of natural compounds and have important commercial and medical applications. Limonene is a cyclic monoterpene (C 10 ) present in nature as two enantiomers, (+) and (-), which are produced by different enzymes. The mechanism of production of the (-)-enantiomer has been studied in great detail, but to understand how enantiomeric selectivity is achieved in this class of enzymes, it is important to develop a thorough biochemical description of enzymes that generate (+)-limonene, as well. Here we report the first cloning and biochemical characterization of a (+)-limonene synthase from navel orange (Citrus sinensis). The enzyme obeys classical Michaelis-Menten kinetics and produces exclusively the (+)-enantiomer. We have determined the crystal structure of the apoprotein in an "open" conformation at 2.3 Å resolution. Comparison with the structure of (-)-limonene synthase (Mentha spicata), which is representative of a fully closed conformation (Protein Data Bank entry 2ONG ), reveals that the short H-α1 helix moves nearly 5 Å inward upon substrate binding, and a conserved Tyr flips to point its hydroxyl group into the active site.

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

Directory of Open Access Journals (Sweden)

Bin Wang

2010-07-01

Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

2018-04-01

Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

Thermodynamic study of selected monoterpenes

Czech Academy of Sciences Publication Activity Database

Štejfa, V.; Fulem, Michal; Růžička, K.; Červinka, C.; Rocha, M.A.A.; Santos, L.M.N.B.F.; Schröder, B.

2013-01-01

Roč. 60, MAY (2013), 117-125 ISSN 0021-9614 Institutional support: RVO:68378271 Keywords : monoterpenes * pinene * vapor pressure * heat capacity * vaporization and sublimation enthalpy * ideal - gas thermodynamic Subject RIV: BJ - Thermodynamics Impact factor: 2.423, year: 2013

Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

Directory of Open Access Journals (Sweden)

Meng eWang

2013-05-01

Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

New zwitterionic monoterpene indole alkaloids from Uncaria rhynchophylla.

Science.gov (United States)

Guo, Qiang; Yang, Hongshuai; Liu, Xinyu; Si, Xiali; Liang, Hong; Tu, Pengfei; Zhang, Qingying

2018-01-31

Four new zwitterionic monoterpene indole alkaloids, rhynchophyllioniums A-D (1-4), together with eight known alkaloids (5-12), were isolated from the hook-bearing stems of Uncaria rhynchophylla. Their structures were elucidated by extensive spectroscopic data analysis of MS, 1D and 2D NMR, and ECD, and the zwitterionic forms and absolute configurations of 1 and 2 were unambiguously confirmed by single crystal X-ray diffraction analysis. All the isolates, including the monoterpene indole alkaloids with free C-22 carboxyl group and those with C-22 carboxyl methyl ester, were proved to be naturally coexisting in the herb by LC-MS analysis. This is the first report of monoterpene indole alkaloids that exist in the form of zwitterion. Additionally, the cytotoxic activities of all isolates against A549, HepG2, and MCF-7 cell lines are reported. Copyright © 2018 Elsevier B.V. All rights reserved.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

Airborne measurements of isoprene and monoterpene emissions from southeastern U.S. forests

Energy Technology Data Exchange (ETDEWEB)

Yu, Haofei; Guenther, Alex; Gu, Dasa; Warneke, Carsten; Geron, Chris; Goldstein, Allen; Graus, Martin; Karl, Thomas; Kaser, Lisa; Misztal, Pawel; Yuan, Bin

2017-10-01

Isoprene and monoterpene emission rates are essential inputs for atmospheric chemistry models that simulate atmospheric oxidant and particle distributions. Process studies of the biochemical and physiological mechanisms controlling these emissions are advancing our understanding and the accuracy of model predictions but efforts to quantify regional emissions have been limited by a lack of constraints on regional distributions of ecosystem emission capacities. We used an airborne wavelet-based eddy covariance measurement technique to characterize isoprene and monoterpene fluxes with high spatial resolution during the 2013 SAS (Southeast Atmosphere Study) in the southeastern United States. The fluxes measured by direct eddy covariance were comparable to emissions independently estimated using an indirect inverse modeling approach. Isoprene emission factors based on the aircraft wavelet flux estimates for high isoprene chemotypes (e.g., oaks) were similar to the MEGAN2.1 biogenic emission model estimates for landscapes dominated by oaks. Aircraft flux measurement estimates for landscapes with fewer isoprene emitting trees (e.g., pine plantations), were about a factor of two lower than MEGAN2.1 model estimates. The tendency for high isoprene emitters in these landscapes to occur in the shaded understory, where light dependent isoprene emissions are diminished, may explain the lower than expected emissions. This result demonstrates the importance of accurately representing the vertical profile of isoprene emitting biomass in biogenic emission models. Airborne measurement-based emission factors for high monoterpene chemotypes agreed with MEGAN2.1 in landscapes dominated by pine (high monoterpene chemotype) trees but were more than a factor of three higher than model estimates for landscapes dominated by oak (relatively low monoterpene emitting) trees. This results suggests that unaccounted processes, such as floral emissions or light dependent monoterpene emissions, or

Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

Directory of Open Access Journals (Sweden)

Resnanti Utami Handayani

2014-07-01

Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

Antitumor Activity of Monoterpenes Found in Essential Oils

Directory of Open Access Journals (Sweden)

Marianna Vieira Sobral

2014-01-01

Full Text Available Cancer is a complex genetic disease that is a major public health problem worldwide, accounting for about 7 million deaths each year. Many anticancer drugs currently used clinically have been isolated from plant species or are based on such substances. Accumulating data has revealed anticancer activity in plant-derived monoterpenes. In this review the antitumor activity of 37 monoterpenes found in essential oils is discussed. Chemical structures, experimental models, and mechanisms of action for bioactive substances are presented.

De novo assembly of Eugenia uniflora L. transcriptome and identification of genes from the terpenoid biosynthesis pathway.

Science.gov (United States)

Guzman, Frank; Kulcheski, Franceli Rodrigues; Turchetto-Zolet, Andreia Carina; Margis, Rogerio

2014-12-01

Pitanga (Eugenia uniflora L.) is a member of the Myrtaceae family and is of particular interest due to its medicinal properties that are attributed to specialized metabolites with known biological activities. Among these molecules, terpenoids are the most abundant in essential oils that are found in the leaves and represent compounds with potential pharmacological benefits. The terpene diversity observed in Myrtaceae is determined by the activity of different members of the terpene synthase and oxidosqualene cyclase families. Therefore, the aim of this study was to perform a de novo assembly of transcripts from E. uniflora leaves and to annotation to identify the genes potentially involved in the terpenoid biosynthesis pathway and terpene diversity. In total, 72,742 unigenes with a mean length of 1048bp were identified. Of these, 43,631 and 36,289 were annotated with the NCBI non-redundant protein and Swiss-Prot databases, respectively. The gene ontology categorized the sequences into 53 functional groups. A metabolic pathway analysis with KEGG revealed 8,625 unigenes assigned to 141 metabolic pathways and 40 unigenes predicted to be associated with the biosynthesis of terpenoids. Furthermore, we identified four putative full-length terpene synthase genes involved in sesquiterpenes and monoterpenes biosynthesis, and three putative full-length oxidosqualene cyclase genes involved in the triterpenes biosynthesis. The expression of these genes was validated in different E. uniflora tissues. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

Science.gov (United States)

Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

2014-10-01

Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

Do monoterpenes released from feverfew (Tanacetum parthenium) plants cause airborne Compositae dermatitis?

DEFF Research Database (Denmark)

Paulsen, E.; Christensen, Lars Porskjær; Andersen, K.E.

2002-01-01

The Compositae plant feverfew (Tanacetum parthenium) is an important sensitizer in Europe and has been suspected of causing airborne Compositae dermatitis. A previous investigation of substances emitted from feverfew plants detected no sesquiterpene lactones, however, but mainly monoterpenes...... airborne dermatitis, mimicking photosensitivity, and the disappearance of symptoms upon removal of feverfew plants suggest monoterpenes as a possible contributing factor. Similar associations between doubtful positive monoterpene reactions and clinical patterns, fragrance/colophonium allergy and relevance...

Synthesis of monoterpene piperidines from the iridoid glucoside antirrhinoside

DEFF Research Database (Denmark)

Franzyk, Henrik; Frederiksen, Signe Maria; Jensen, Søren Rosendal

1997-01-01

Synthesis of five novel piperidine monoterpene alkaloids using the iridoid glucoside antirrhinoside as a synthon is described. Two strategies for their preparation were investigated: the first possible pathway involved an intermediate diol from which the piperidine ring was expected to be constru......Synthesis of five novel piperidine monoterpene alkaloids using the iridoid glucoside antirrhinoside as a synthon is described. Two strategies for their preparation were investigated: the first possible pathway involved an intermediate diol from which the piperidine ring was expected...... to be constructed via reaction of its ditosylate with an amine; the second strategy involved a double reductive amination as the key step to the piperidine ring, which proved successful. The stereochemistry of C-5 and C-9 in the obtained piperidine monoterpenes was the same as that reported for alfa...

Dynamics of Monoterpene Formation in Spike Lavender Plants

Directory of Open Access Journals (Sweden)

Isabel Mendoza-Poudereux

2017-12-01

Full Text Available The metabolic cross-talk between the mevalonate (MVA and the methylerythritol phosphate (MEP pathways was analyzed in spike lavender (Lavandula latifolia Med on the basis of 13CO2-labelling experiments using wildtype and transgenic plants overexpressing the 3-hydroxy-3-methylglutaryl CoA reductase (HMGR, the first and key enzyme of the MVA pathway. The plants were labelled in the presence of 13CO2 in a gas chamber for controlled pulse and chase periods of time. GC/MS and NMR analysis of 1,8-cineole and camphor, the major monoterpenes present in their essential oil, indicated that the C5-precursors, isopentenyl diphosphate (IPP and dimethylallyl diphosphate (DMAPP of both monoterpenes are predominantly biosynthesized via the MEP pathway. Surprisingly, overexpression of HMGR did not have significant impact upon the crosstalk between the MVA and MEP pathways indicating that the MEP route is the preferred pathway for the synthesis of C5 monoterpene precursors in spike lavender.

Changes in monoterpene mixing ratios during summer storms in rural New Hampshire (USA)

Science.gov (United States)

Haase, K.B.; Jordan, C.; Mentis, E.; Cottrell, L.; Mayne, H.R.; Talbot, R.; Sive, B.C.

2011-01-01

Monoterpenes are an important class of biogenic hydrocarbons that influence ambient air quality and are a principle source of secondary organic aerosol (SOA). Emitted from vegetation, monoterpenes are a product of photosynthesis and act as a response to a variety of environmental factors. Most parameterizations of monoterpene emissions are based on clear weather models that do not take into account episodic conditions that can drastically change production and release rates into the atmosphere. Here, the ongoing monoterpene dataset from the rural Thompson Farm measurement site in Durham, New Hampshire is examined in the context of a set of known severe storm events. While some storm systems had a negligible influence on ambient monoterpene mixing ratios, the average storm event increased mixing ratios by 0.59 ?? 0.21 ppbv, a factor of 93 % above pre-storm levels. In some events, mixing ratios reached the 10's of ppbv range and persisted overnight. These mixing ratios correspond to increases in the monoterpene emission rate, ranging from 120 to 1240 g km-2 h -1 compared to an estimated clear weather rate of 116 to 193 g km-2 h-1. Considering the regularity of storm events over most forested areas, this could be an important factor to consider when modeling global monoterpene emissions and their resulting influence on the formation of organic aerosols. ?? 2011 Author(s).

Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

Science.gov (United States)

Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

2017-12-01

An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

Potential contribution of exposed resin to ecosystem emissions of monoterpenes

Science.gov (United States)

Eller, Allyson S. D.; Harley, Peter; Monson, Russell K.

2013-10-01

Conifers, especially pines, produce and store under pressure monoterpene-laden resin in canals located throughout the plant. When the plants are damaged and resin canals punctured, the resin is exuded and the monoterpenes are released into the atmosphere, a process that has been shown to influence ecosystem-level monoterpene emissions. Less attention has been paid to the small amounts of resin that are exuded from branches, expanding needles, developing pollen cones, and terminal buds in the absence of any damage. The goal of this study was to provide the first estimate of the potential of this naturally-exposed resin to influence emissions of monoterpenes from ponderosa pine (Pinus ponderosa) ecosystems. When resin is first exuded as small spherical beads from undamaged tissues it emits monoterpenes to the atmosphere at a rate that is four orders of magnitude greater than needle tissue with an equivalent exposed surface area and the emissions from exuded beads decline exponentially as the resin dries. We made measurements of resin beads on the branches of ponderosa pine trees in the middle of the growing season and found, on average, 0.15 cm2 of exposed resin bead surface area and 1250 cm2 of total needle surface area per branch tip. If the resin emerged over the course of 10 days, resin emissions would make up 10% of the ecosystem emissions each day. Since we only accounted for exposed resin at a single point in time, this is probably an underestimate of how much total resin is exuded from undamaged pine tissues over the course of a growing season. Our observations, however, reveal the importance of this previously unrecognized source of monoterpenes emitted from pine forests and its potential to influence regional atmospheric chemistry dynamics.

The Antigerminative Activity of Twenty-Seven Monoterpenes

Directory of Open Access Journals (Sweden)

Laura De Martino

2010-09-01

Full Text Available Monoterpenes, the main constituents of essential oils, are known for their many biological activities. The present work studied the potential biological activity of twenty-seven monoterpenes, including monoterpene hydrocarbons and oxygenated ones, against seed germination and subsequent primary radicle growth of Raphanus sativus L. (radish and Lepidium sativum L. (garden cress, under laboratory conditions. The compounds, belonging to different chemical classes, showed different potency in affecting both parameters evaluated. The assayed compounds demonstrated a good inhibitory activity in a dose-dependent way. In general, radish seed is more sensitive than garden cress and its germination appeares more inhibited by alcohols; at the highest concentration tested, the more active substances were geraniol, borneol, (±-β-citronellol and α-terpineol. Geraniol and carvone inhibited, in a significant way, the germination of garden cress, at the highest concentration tested. Radicle elongation of two test species was inhibited mainly by alcohols and ketones. Carvone inhibited the radicle elongation of both seeds, at almost all concentrations assayed, while 1,8-cineole inhibited their radicle elongation at the lowest concentrations (10−5 M, 10−6 M.

Airborne measurements of isoprene and monoterpene emissions from southeastern U.S. forests.

Science.gov (United States)

Yu, Haofei; Guenther, Alex; Gu, Dasa; Warneke, Carsten; Geron, Chris; Goldstein, Allen; Graus, Martin; Karl, Thomas; Kaser, Lisa; Misztal, Pawel; Yuan, Bin

2017-10-01

Isoprene and monoterpene emission rates are essential inputs for atmospheric chemistry models that simulate atmospheric oxidant and particle distributions. Process studies of the biochemical and physiological mechanisms controlling these emissions are advancing our understanding and the accuracy of model predictions but efforts to quantify regional emissions have been limited by a lack of constraints on regional distributions of ecosystem emission capacities. We used an airborne wavelet-based eddy covariance measurement technique to characterize isoprene and monoterpene fluxes with high spatial resolution during the 2013 SAS (Southeast Atmosphere Study) in the southeastern United States. The fluxes measured by direct eddy covariance were comparable to emissions independently estimated using an indirect inverse modeling approach. Isoprene emission factors based on the aircraft wavelet flux estimates for high isoprene chemotypes (e.g., oaks) were similar to the MEGAN2.1 biogenic emission model estimates for landscapes dominated by oaks. Aircraft flux measurement estimates for landscapes with fewer isoprene emitting trees (e.g., pine plantations), were about a factor of two lower than MEGAN2.1 model estimates. The tendency for high isoprene emitters in these landscapes to occur in the shaded understory, where light dependent isoprene emissions are diminished, may explain the lower than expected emissions. This result demonstrates the importance of accurately representing the vertical profile of isoprene emitting biomass in biogenic emission models. Airborne measurement-based emission factors for high monoterpene chemotypes agreed with MEGAN2.1 in landscapes dominated by pine (high monoterpene chemotype) trees but were more than a factor of three higher than model estimates for landscapes dominated by oak (relatively low monoterpene emitting) trees. This results suggests that unaccounted processes, such as floral emissions or light dependent monoterpene emissions, or

Changes in monoterpene mixing ratios during summer storms in rural New Hampshire (USA

Directory of Open Access Journals (Sweden)

K. B. Haase

2011-11-01

Full Text Available Monoterpenes are an important class of biogenic hydrocarbons that influence ambient air quality and are a principle source of secondary organic aerosol (SOA. Emitted from vegetation, monoterpenes are a product of photosynthesis and act as a response to a variety of environmental factors. Most parameterizations of monoterpene emissions are based on clear weather models that do not take into account episodic conditions that can drastically change production and release rates into the atmosphere. Here, the monoterpene dataset from the rural Thompson Farm measurement site in Durham, New Hampshire is examined in the context of a set of known severe storm events. While some storm systems had a negligible influence on ambient monoterpene mixing ratios, the average storm event increased mixing ratios by 0.59 ± 0.21 ppbv, a factor of 93% above pre-storm levels. In some events, mixing ratios reached the 10's of ppbv range and persisted overnight. These mixing ratios correspond to increases in the monoterpene emission rate, ranging from 120 to 1240 g km⁻² h⁻¹ compared to an estimated clear weather rate of 116 to 193 g km⁻² h⁻¹. Considering the regularity of storm events over most forested areas, this could be an important factor to consider when modeling global monoterpene emissions and their resulting influence on the formation of organic aerosols.

Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

International Nuclear Information System (INIS)

Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

2008-01-01

Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

Antifungal activity and mechanism of action of monoterpenes against dermatophytes and yeasts

Directory of Open Access Journals (Sweden)

Diogo Miron

Full Text Available Dermatomycosis causes highly frequent dermal lesions, and volatile oils have been proven to be promising as antifungal agents. The antifungal activity of geraniol, nerol, citral, neral and geranial (monoterpenes, and terbinafine and anidulafungin (control drugs against seven opportunistic pathogenic yeasts and four dermatophyte species was evaluated by the Clinical and Laboratory Standards Institute microdilution tests. Monoterpenes were more active against dermatophytes than yeasts (geometric mean of minimal inhibitory concentration (GMIC of 34.5 and 100.4 µg.ml-1, respectively. Trichophyton rubrum was the fungal species most sensitive to monoterpenes (GMIC of 22.9 µg.ml-1. The trans isomers showed higher antifungal activity than the cis. The mechanism of action was investigated evaluating damage in the fungal cell wall (Sorbitol Protection Assay and in the cell membrane (Ergosterol Affinity Assay. No changes were observed in the MIC of monoterpenes in the sorbitol protection assay.The MIC of citral and geraniol was increased from 32 to 160 µg.ml-1 when the exogenous ergosterol concentrations was zero and 250 µg.ml-1, respectively. The monoterpenes showed an affinity for ergosterol relating their mechanism of action to cell membrane destabilization.

Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

NARCIS (Netherlands)

Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

2000-01-01

The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

Challenges in modelling isoprene and monoterpene emission dynamics of Arctic plants

DEFF Research Database (Denmark)

Tang, Jing; Schurgers, Guy; Valolahti, Hanna Maritta

2016-01-01

test. The model showed reasonable agreement to the observed vegetation CO2 fluxes in the main growing season as well as day-to-day variability of isoprene and monoterpene emissions. The observed relatively high WRs were better captured by the adjusted T response curve than by the common one. During...... 1999-2012, the modelled annual mean isoprene and monoterpene emissions were 20 and 8 mg C mg-2 yrg-1, with an increase by 55 and 57 % for 2 °C summertime warming, respectively. Warming by 4 and 8 °C for the same period further elevated isoprene emission for all years, but the impacts on monoterpene...

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

Science.gov (United States)

Ober, Dietrich; Hartmann, Thomas

1999-01-01

Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

Monoterpenes as inhibitors of digestive enzymes and counter-adaptations in a specialist avian herbivore.

Science.gov (United States)

Kohl, Kevin D; Pitman, Elizabeth; Robb, Brecken C; Connelly, John W; Dearing, M Denise; Forbey, Jennifer Sorensen

2015-05-01

Many plants produce plant secondary metabolites (PSM) that inhibit digestive enzymes of herbivores, thus limiting nutrient availability. In response, some specialist herbivores have evolved digestive enzymes that are resistant to inhibition. Monoterpenes, a class of PSMs, have not been investigated with respect to the interference of specific digestive enzymes, nor have such interactions been studied in avian herbivores. We investigated this interaction in the Greater Sage-Grouse (Phasianidae: Centrocercus urophasianus), which specializes on monoterpene-rich sagebrush species (Artemisia spp.). We first measured the monoterpene concentrations in gut contents of free-ranging sage-grouse. Next, we compared the ability of seven individual monoterpenes present in sagebrush to inhibit a protein-digesting enzyme, aminopeptidase-N. We also measured the inhibitory effects of PSM extracts from two sagebrush species. Inhibition of aminopeptidase-N in sage-grouse was compared to inhibition in chickens (Gallus gallus). We predicted that sage-grouse enzymes would retain higher activity when incubated with isolated monoterpenes or sagebrush extracts than chicken enzymes. We detected unchanged monoterpenes in the gut contents of free-ranging sage-grouse. We found that three isolated oxygenated monoterpenes (borneol, camphor, and 1,8-cineole) inhibited digestive enzymes of both bird species. Camphor and 1,8-cineole inhibited enzymes from chickens more than from sage-grouse. Extracts from both species of sagebrush had similar inhibition of chicken enzymes, but did not inhibit sage-grouse enzymes. These results suggest that specific monoterpenes may limit the protein digestibility of plant material by avian herbivores. Further, this work presents additional evidence that adaptations of digestive enzymes to plant defensive compounds may be a trait of specialist herbivores.

A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

Science.gov (United States)

Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

2016-12-28

The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

Thermodynamic study of selected monoterpenes II

Czech Academy of Sciences Publication Activity Database

Štejfa, V.; Fulem, Michal; Růžička, K.; Červinka, C.

2014-01-01

Roč. 79, Dec (2014), 272-279 ISSN 0021-9614 Institutional support: RVO:68378271 Keywords : monoterpenes * vapor pressure * heat capacity * ideal - gas thermodynamic properties * vaporization and sublimation enthalpy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.679, year: 2014

Thermodynamic study of selected monoterpenes III

Czech Academy of Sciences Publication Activity Database

Štejfa, V.; Fulem, Michal; Růžička, K.; Červinka, C.

2014-01-01

Roč. 79, Dec (2014), 280-289 ISSN 0021-9614 Institutional support: RVO:68378271 Keywords : monoterpenes * vapor pressure * heat capacity * ideal - gas thermodynamic properties * vaporization and sublimation enthalpy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.679, year: 2014

Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

International Nuclear Information System (INIS)

Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

2006-01-01

The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

Science.gov (United States)

Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

2016-12-01

Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Rinker, Torri E.; Baker, Scott E.

2007-01-29

Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

DEFF Research Database (Denmark)

Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

2008-01-01

of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

OpenAIRE

Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

2013-01-01

Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-02-01

Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

DEFF Research Database (Denmark)

Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

2014-01-01

BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Process-based modelling of biogenic monoterpene emissions combining production and release from storage

NARCIS (Netherlands)

Schurgers, G.; Arneth, A.; Holzinger, R.|info:eu-repo/dai/nl/337989338; Goldstein, A.H.

2009-01-01

Monoterpenes, primarily emitted by terrestrial vegetation, can influence atmospheric ozone chemistry, and can form precursors for secondary organic aerosol. The short-term emissions of monoterpenes have been well studied and understood, but their long-term variability, which is particularly

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

Science.gov (United States)

Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

2016-03-09

Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

In vitro analysis of radioprotective effect of monoterpenes

International Nuclear Information System (INIS)

Ken-ichi Kudo; Tadashi Hanafusa; Toshiro Ono

2017-01-01

Monoterpenes are naturally occurring hydrocarbons composed of two units of isoprenes. They exhibit antioxidant activity to scavenge reactive oxygen species, such as hydroxyl radicals. We investigated the potential of monoterpenes such as thymol, linalool, and menthol to act as radioprotectants. The proliferation of EL4 cells, a mouse lymphoma cell line, treated with linalool at a concentration of 500 μM or more was not affected by X-ray irradiation. Plasmid-nicking assay performed using formamidopyrimidine-DNA glycosylase showed that linalool prevented single strand breaks and oxidized purines on pUC19 plasmid DNA. These findings indicate that linalool has the ability to scavenge reactive oxygen species and is a potential radioprotector. (author)

Simple proxies for estimating the concentrations of monoterpenes and their oxidation products at a boreal forest site

Directory of Open Access Journals (Sweden)

J. Kontkanen

2016-10-01

Full Text Available The oxidation products of monoterpenes likely have a crucial role in the formation and growth of aerosol particles in boreal forests. However, the continuous measurements of monoterpene concentrations are usually not available on decadal timescales, and the direct measurements of the concentrations of monoterpene oxidation product have so far been scarce. In this study we developed proxies for the concentrations of monoterpenes and their oxidation products at a boreal forest site in Hyytiälä, southern Finland. For deriving the proxies we used the monoterpene concentration measured with a proton transfer reaction mass spectrometer (PTR-MS during 2006–2013. Our proxies for the monoterpene concentration take into account the temperature-controlled emissions from the forest ecosystem, the dilution caused by the mixing within the boundary layer and different oxidation processes. All the versions of our proxies captured the seasonal variation of the monoterpene concentration, the typical proxy-to-measurements ratios being between 0.8 and 1.3 in summer and between 0.6 and 2.6 in winter. In addition, the proxies were able to describe the diurnal variation of the monoterpene concentration rather well, especially in summer months. By utilizing one of the proxies, we calculated the concentration of oxidation products of monoterpenes by considering their production in the oxidation and their loss due to condensation on aerosol particles. The concentration of oxidation products was found to have a clear seasonal cycle, with a maximum in summer and a minimum in winter. The concentration of oxidation products was lowest in the morning or around noon and highest in the evening. In the future, our proxies for the monoterpene concentration and their oxidation products can be used, for example, in the analysis of new particle formation and growth in boreal environments.

Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

Science.gov (United States)

Xiang, Lin; Zhao, Kaige; Chen, Longqing

2010-01-01

Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Effects of soil water content and elevated CO2 concentration on the monoterpene emission rate of Cryptomeria japonica.

Science.gov (United States)

Mochizuki, Tomoki; Amagai, Takashi; Tani, Akira

2018-04-11

Monoterpenes emitted from plants contribute to the formation of secondary pollution and affect the climate system. Monoterpene emission rates may be affected by environmental changes such as increasing CO 2 concentration caused by fossil fuel burning and drought stress induced by climate change. We measured monoterpene emissions from Cryptomeria japonica clone saplings grown under different CO 2 concentrations (control: ambient CO 2 level, elevated CO 2 : 1000μmolmol -1 ). The saplings were planted in the ground and we did not artificially control the SWC. The relationship between the monoterpene emissions and naturally varying SWC was investigated. The dominant monoterpene was α-pinene, followed by sabinene. The monoterpene emission rates were exponentially correlated with temperature for all measurements and normalized (35°C) for each measurement day. The daily normalized monoterpene emission rates (E s0.10 ) were positively and linearly correlated with SWC under both control and elevated CO 2 conditions (control: r 2 =0.55, elevated CO 2 : r 2 =0.89). The slope of the regression line of E s0.10 against SWC was significantly higher under elevated CO 2 than under control conditions (ANCOVA: P<0.01), indicating that the effect of CO 2 concentration on monoterpene emission rates differed by soil water status. The monoterpene emission rates estimated by considering temperature and SWC (Improved G93 algorithm) better agreed with the measured monoterpene emission rates, when compared with the emission rates estimated by considering temperature alone (G93 algorithm). Our results demonstrated that the combined effects of SWC and CO 2 concentration are important for controlling the monoterpene emissions from C. japonica clone saplings. If these relationships can be applied to the other coniferous tree species, our results may be useful to improve accuracy of monoterpene emission estimates from the coniferous forests as affected by climate change in the present and

The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

Science.gov (United States)

Schindler, Daniel; Nowrousian, Minou

2014-07-01

Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

Monoterpene ‘thermometer’ of tropical forest-atmosphere response to climate warming

OpenAIRE

Jardine, KJ; Jardine, AB; Holm, JA; Lombardozzi, DL; Negron-Juarez, RI; Martin, ST; Beller, HR; Gimenez, BO; Higuchi, N; Chambers, JQ

2017-01-01

© 2016 John Wiley & Sons Ltd Tropical forests absorb large amounts of atmospheric CO 2 through photosynthesis but elevated temperatures suppress this absorption and promote monoterpene emissions. Using 13 CO 2 labeling, here we show that monoterpene emissions from tropical leaves derive from recent photosynthesis and demonstrate distinct temperature optima for five groups (Groups 1–5), potentially corresponding to different enzymatic temperature-dependent reaction mechanisms within β-ocimen...

Local and regional variation in the monoterpenes of ponderosa pine wood oleoresin

Science.gov (United States)

R.H. Smith; R.L. Peloquin; P.C. Passof

1969-01-01

A gas chromatographic analysis of the mono-terpenes of 927 ponderosa pines, representing to some degree a major portion of the species' range, showed considerable local and regional diversity in composition. Five major monoterpenes— α-pinene, β-pinene, 3-carene, myrcene, and limonene—were analyzed. There is some evidence to support the...

Inhibition of the NorA multi-drug transporter by oxygenated monoterpenes.

Science.gov (United States)

Coêlho, Mayara Ladeira; Ferreira, Josie Haydée Lima; de Siqueira Júnior, José Pinto; Kaatz, Glenn W; Barreto, Humberto Medeiros; de Carvalho Melo Cavalcante, Ana Amélia

2016-10-01

The aim of this study was to investigate intrinsic antimicrobial activity of three monoterpenes nerol, dimethyl octanol and estragole, against bacteria and yeast strains, as well as, investigate if these compounds are able to inhibit the NorA efflux pump related to fluoroquinolone resistance in Staphylococcus aureus. Minimal inhibitory concentrations (MICs) of the monoterpenes against Staphylococcus aureus, Escherichia coli and Candida albicans strains were determined by micro-dilution assay. MICs of the norfloxacin against a S. aureus strain overexpressing the NorA protein were determined in the absence or in the presence of the monoterpenes at subinhibitory concentrations, aiming to verify the ability of this compounds act as efflux pump inhibitors. The monoterpenes were inactive against S. aureus however the nerol was active against E. coli and C. albicans. The addition of the compounds to growth media at sub-inhibitory concentrations enhanced the activity of norfloxacin against S. aureus SA1199-B. This result shows that bioactives tested, especially the nerol, are able to inhibit NorA efflux pump indicating a potential use as adjuvants of norfloxacin for therapy of infections caused by multi-drug resistant S. aureus strains. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

Global isoprene and monoterpene emissions under changing climate, vegetation, CO2 and land use

DEFF Research Database (Denmark)

Hantson, Stijn; Knorr, Wolfgang; Schurgers, Guy

2017-01-01

Plants emit large quantities of isoprene and monoterpenes, the main components of global biogenic volatile organic compound (BVOC) emissions. BVOCs have an important impact on the atmospheric composition of methane, and of short-lived radiative forcing agents (e.g. ozone, aerosols etc.). It is th......Plants emit large quantities of isoprene and monoterpenes, the main components of global biogenic volatile organic compound (BVOC) emissions. BVOCs have an important impact on the atmospheric composition of methane, and of short-lived radiative forcing agents (e.g. ozone, aerosols etc.......). It is therefore necessary to know how isoprene and monoterpene emissions have changed over the past and how future changes in climate, land-use and other factors will impact them. Here we present emission estimates of isoprene and monoterpenes over the period 1901–2 100 based on the dynamic global vegetation...... model LPJ-GUESS, including the effects of all known important drivers. We find that both isoprene and monoterpene emissions at the beginning of the 20th century were higher than at present. While anthropogenic land-use change largely drives the global decreasing trend for isoprene over the 20th century...

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

Science.gov (United States)

Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

DEFF Research Database (Denmark)

Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

1999-01-01

Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

Metabolic engineering of monoterpene biosynthesis in plants

NARCIS (Netherlands)

Lücker, J.

2002-01-01

Monoterpenes are a large group of compounds that belong to the terpenoid family of natural compounds in plants. They are small, volatile, lipophilic substances of which around one thousand different structures have been