WorldWideScience

Sample records for monophosphate response element

  1. Roles of p300 and cyclic adenosine monophosphate response element binding protein in high glucose-induced hypoxia-inducible factor 1α inactivation under hypoxic conditions.

    Science.gov (United States)

    Ding, Lingtao; Yang, Minlie; Zhao, Tianlan; Lv, Guozhong

    2017-05-01

    Given the high prevalence of diabetes and burn injuries worldwide, it is essential to dissect the underlying mechanism of delayed burn wound healing in diabetes patients, especially the high glucose-induced hypoxia-inducible factor 1 (HIF-1)-mediated transcription defects. Human umbilical vein endothelial cells were cultured with low or high concentrations of glucose. HIF-1α-induced vascular endothelial growth factor (VEGF) transcription was measured by luciferase assay. Immunofluorescence staining was carried out to visualize cyclic adenosine monophosphate response element binding protein (CREB) localization. Immunoprecipitation was carried out to characterize the association between HIF-1α/p300/CREB. To test whether p300, CREB or p300+CREB co-overexpression was sufficient to rescue the HIF-1-mediated transcription defect after high glucose exposure, p300, CREB or p300+CREB co-overexpression were engineered, and VEGF expression was quantified. Finally, in vitro angiogenesis assay was carried out to test whether the high glucose-induced angiogenesis defect is rescuable by p300 and CREB co-overexpression. Chronic high glucose treatment resulted in impaired HIF-1-induced VEGF transcription and CREB exclusion from the nucleus. P300 or CREB overexpression alone cannot rescue high glucose-induced HIF-1α transcription defects. In contrast, co-overexpression of p300 and CREB dramatically ameliorated high glucose-induced impairment of HIF-1-mediated VEGF transcription, as well as in vitro angiogenesis. Finally, we showed that co-overexpression of p300 and CREB rectifies the dissociation of HIF-1α-p300-CREB protein complex in chronic high glucose-treated cells. Both p300 and CREB are required for the function integrity of HIF-1α transcription machinery and subsequent angiogenesis, suggesting future studies to improve burn wound healing might be directed to optimization of the interaction between p300, CREB and HIF-1α. © 2016 The Authors. Journal of Diabetes

  2. The transcription factor cyclic adenosine 3',5'-monophosphate response element-binding protein enhances the odonto/osteogenic differentiation of stem cells from the apical papilla.

    Science.gov (United States)

    Su, S; Zhu, Y; Li, S; Liang, Y; Zhang, J

    2017-09-01

    To investigate the role of cAMP response element-binding protein (CREB) in the regulation of odonto/osteogenic differentiation of stem cells from the apical papilla (SCAPs). Stem cells from the apical papilla were obtained from human impacted third molars (n = 15). Isolated SCAPs were transfected with CREB overexpressing/silenced lentivirus. Transfected cells were stained with alizarin red to investigate mineralized nodule formation. The expression of the mineralization-related genes, alkaline phosphatase (ALP), collagen type I (Col I), runt-related transcription factor 2 (RUNX2), osterix (OSX) and osteocalcin (OCN), was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Protein expression of the odontogenic-related marker dentine sialoprotein (DSP) and the osteogenic-related marker RUNX2 was measured by Western blotting analysis. One-way analysis of variance (anova) and Student's t-test were used for statistical analysis (a = 0.05). The overexpression of CREB enhanced mineralized nodule formation and up-regulated (P odonto/osteogenic-related markers, including ALP, Col I, RUNX2, OSX and OCN, and also increased (P odonto/osteogenic-related markers. Up-regulation of CREB expression promoted odonto/osteogenic differentiation of SCAPs and provided a potential method for the regeneration of the dentine-pulp complex. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  3. Inhibition of Cyclic Adenosine Monophosphate (cAMP-response Element-binding Protein (CREB-binding Protein (CBP/β-Catenin Reduces Liver Fibrosis in Mice

    Directory of Open Access Journals (Sweden)

    Yosuke Osawa

    2015-11-01

    Full Text Available Wnt/β-catenin is involved in every aspect of embryonic development and in the pathogenesis of many human diseases, and is also implicated in organ fibrosis. However, the role of β-catenin-mediated signaling on liver fibrosis remains unclear. To explore this issue, the effects of PRI-724, a selective inhibitor of the cAMP-response element-binding protein-binding protein (CBP/β-catenin interaction, on liver fibrosis were examined using carbon tetrachloride (CCl4- or bile duct ligation (BDL-induced mouse liver fibrosis models. Following repetitive CCl4 administrations, the nuclear translocation of β-catenin was observed only in the non-parenchymal cells in the liver. PRI-724 treatment reduced the fibrosis induced by CCl4 or BDL. C-82, an active form of PRI-724, inhibited the activation of isolated primary mouse quiescent hepatic stellate cells (HSCs and promoted cell death in culture-activated HSCs. During the fibrosis resolution period, an increase in F4/80+ CD11b+ and Ly6Clow CD11b+ macrophages was induced by CCl4 and was sustained for two weeks thereafter, even after having stopped CCl4 treatment. PRI-724 accelerated the resolution of CCl4-induced liver fibrosis, and this was accompanied by increased matrix metalloproteinase (MMP-9, MMP-2, and MMP-8 expression in intrahepatic leukocytes. In conclusion, targeting the CBP/β-catenin interaction may become a new therapeutic strategy in treating liver fibrosis.

  4. Cyclic adenosine 3',5'-monophosphate (cAMP) enhances cAMP-responsive element binding (CREB) protein phosphorylation and phospho-CREB interaction with the mouse steroidogenic acute regulatory protein gene promoter.

    Science.gov (United States)

    Clem, Brian F; Hudson, Elizabeth A; Clark, Barbara J

    2005-03-01

    Steroidogenic acute regulatory protein (StAR) transcription is regulated through cAMP-protein kinase A-dependent mechanisms that involve multiple transcription factors including the cAMP-responsive element binding protein (CREB) family members. Classically, binding of phosphorylated CREB to cis-acting cAMP-responsive elements (5'-TGACGTCA-3') within target gene promoters leads to recruitment of the coactivator CREB binding protein (CBP). Herein we examined the extent of CREB family member phosphorylation on protein-DNA interactions and CBP recruitment with the StAR promoter. Immunoblot analysis revealed that CREB, cAMP-responsive element modulator (CREM), and activating transcription factor (ATF)-1 are expressed in MA-10 mouse Leydig tumor cells, yet only CREB and ATF-1 are phosphorylated. (Bu)2cAMP treatment of MA-10 cells increased CREB phosphorylation approximately 2.3-fold within 30 min but did not change total nuclear CREB expression levels. Using DNA-affinity chromatography, we now show that CREB and ATF-1, but not CREM, interact with the StAR promoter, and this interaction is dependent on the activator protein-1 (AP-1) cis-acting element within the cAMP-responsive region. In addition, (Bu)2cAMP-treatment increased phosphorylated CREB (P-CREB) association with the StAR promoter but did not influence total CREB interaction. In vivo chromatin immunoprecipitation assays demonstrated CREB binding to the StAR proximal promoter is independent of (Bu)2cAMP-treatment, confirming our in vitro analysis. However, (Bu)2cAMP-treatment increased P-CREB and CBP interaction with the StAR promoter, demonstrating for the first time the physical role of P-CREB:DNA interactions in CBP recruitment to the StAR proximal promoter.

  5. Induction of chinook salmon growth hormone promoter activity by the adenosine 3',5'-monophosphate (cAMP)-dependent pathway involves two cAMP-response elements with the CGTCA motif and the pituitary-specific transcription factor Pit-1.

    Science.gov (United States)

    Wong, A O; Le Drean, Y; Liu, D; Hu, Z Z; Du, S J; Hew, C L

    1996-05-01

    In this study, the functional role of two cAMP-response elements (CRE) in the promoter of the chinook salmon GH gene and their interactions with the transcription factor Pit-1 in regulating GH gene expression were examined. A chimeric construct of the chloramphenicol acetyltransferase (CAT) reporter gene with the CRE-containing GH promoter (pGH.CAT) was transiently transfected into primary cultures of rainbow trout pituitary cells. The expression of CAT activity was stimulated by an adenylate cyclase activator forskolin as well as a membrane-permeant cAMP analog 8-bromo-cAMP. Furthermore, these stimulatory responses were inhibited by a protein kinase A inhibitor H89, suggesting that these CREs are functionally coupled to the adenylate cyclase-cAMP-protein kinase A cascade. This hypothesis is supported by parallel studies using GH4ZR7 cells, a rat pituitary cell line stably transfected with dopamine D2 receptors. In this cell line, D2 receptor activation is known to inhibit adenylate cyclase activity and cAMP synthesis. Stimulation with a nonselective dopamine agonist, apomorphine, or a D2-specific agonist, Ly171555, suppressed the expression of pGH.CAT in GH4ZR7 cells, and this inhibition was blocked by simultaneous treatment with forskolin. These results indicate that inhibition of the cAMP-dependent pathway reduces the basal promoter activity of the CRE-containing pGH.CAT. The functionality of these CREs was further confirmed by deletion analysis and site-specific mutagenesis. In trout pituitary cells, the cAMP inducibility of pGH.CAT was inhibited after deleting the CRE-containing sequence from the GH promoter. When the CRE-containing sequence was cloned into a CAT construct with a viral thymidine kinase promoter, a significant elevation of cAMP inducibility was observed. This stimulatory response, however, was abolished by mutating the core sequence, CGTCA, in these CREs, suggesting that these cis-acting elements confer cAMP inducibility to the salmon GH gene

  6. Post-translational Analysis of Arabidopsis thaliana Proteins in Response to Cyclic Guanosine Monophosphate Treatment

    KAUST Repository

    Parrott, Brian

    2011-12-12

    The introduction of mass spectrometry techniques to the field of biology has made possible the exploration of the proteome as a whole system as opposed to prior techniques, such as anti-body based assays or yeast two-hybrid studies, which were strictly limited to the study of a few proteins at a time. This practice has allowed for a systems biology approach of exploring the proteome, with the possibility of viewing entire pathways over increments of time. In this study, the effect of treating Arabidopsis thaliana suspension culture cells with 3’,5’-cyclic guanosine monophosphate (cGMP), which is a native second messenger, was examined. Samples were collected at four time points and proteins were extracted and enriched for both oxidation and phosphorylation before analysis via mass spectrometry. Preliminary results suggest a tendency towards an increased number of phosphorylated proteins as a result of cGMP treatment. The data also showed a sharp increase in methionine oxidation in response to the treatment, occurring within the first ten minutes. This finding suggests that cGMP may utilize methionine oxidation as a mechanism of signal transduction. As such, this study corroborates a growing body of evidence supporting the inclusion of methionine oxidation in intracellular signaling pathways.

  7. Regulation of insulin-like growth factor I transcription by cyclic adenosine 3',5'-monophosphate (cAMP) in fetal rat bone cells through an element within exon 1: protein kinase A-dependent control without a consensus AMP response element

    Science.gov (United States)

    McCarthy, T. L.; Thomas, M. J.; Centrella, M.; Rotwein, P.

    1995-01-01

    Insulin-like growth factor I (IGF-I) is a locally synthesized anabolic growth factor for bone. IGF-I synthesis by primary fetal rat osteoblasts (Ob) is stimulated by agents that increase the intracellular cAMP concentration, including prostaglandin E2 (PGE2). Previous studies with Ob cultures demonstrated that PGE2 enhanced IGF-I transcription through selective use of IGF-I promoter 1, with little effect on IGF-I messenger RNA half-life. Transient transfection of Ob cultures with an array of promoter 1-luciferase reporter fusion constructs has now allowed localization of a potential cis-acting promoter element(s) responsible for cAMP-stimulated gene expression to the 5'-untranslated region (5'-UTR) of IGF-I exon 1, within a segment lacking a consensus cAMP response element. Our evidence derives from three principal observations: 1) a transfection construct containing only 122 nucleotides (nt) of promoter 1 and 328 nt of the 5'-UTR retained full PGE2-stimulated reporter expression; 2) maximal PGE2-driven reporter expression required the presence of nt 196 to 328 of exon 1 when tested within the context of IGF-I promoter 1; 3) cotransfection of IGF-I promoter-luciferase-reporter constructs with a plasmid encoding the alpha-isoform of the catalytic subunit of murine cAMP-dependent protein kinase (PKA) produced results comparable to those seen with PGE2 treatment, whereas cotransfection with a plasmid encoding a mutant regulatory subunit of PKA that cannot bind cAMP blocked PGE2-induced reporter expression. Deoxyribonuclease I footprinting of the 5'-UTR of exon 1 demonstrated protected sequences at HS3A, HS3B, and HS3D, three of six DNA-protein binding sites previously characterized with rat liver nuclear extracts. Of these three regions, only the HS3D binding site is located within the functionally identified hormonally responsive segment of IGF-I exon 1. These results directly implicate PKA in the control of IGF-I gene transcription by PGE2 and identify a segment of

  8. Bronchodilator responses after methacholine and adenosine 5'-monophosphate (AMP) challenges in children with asthma: their relationships with eosinophil markers.

    Science.gov (United States)

    Yoo, Young; Seo, Sung Chul; Kim, Young Il; Chung, Bo Hyun; Song, Dae Jin; Choung, Ji Tae

    2012-09-01

    Bronchodilator responsiveness (BDR) and eosinophilic inflammation are characteristic features of asthma. Objective. The aim of this study was to compare the relationships of BDR after methacholine challenge or adenosine 5'-monophosphate (AMP) challenge to blood eosinophil markers in children with asthma. Methacholine and AMP challenges were performed on 69 children with mild intermittent to moderate persistent asthma. BDR was calculated as the change in forced expiratory volume in 1 second, expressed as percentage change of the value immediately after the each challenge and the value after inhalation of salbutamol. Serum total IgE levels, blood eosinophil counts, and serum eosinophil cationic protein (ECP) levels were determined for each subject. A positive relationship between serum total IgE levels and BDR was found only after the AMP challenge (R(2) = 0.345, p = .001) rather than after the methacholine challenge (R(2) = 0.007, p = .495). Peripheral blood eosinophil counts correlated more significantly with BDR after AMP challenge (R(2) = 0.212, p = .001) than BDR after methacholine challenge (R(2) = 0.002, p = .724). Both BDR after methacholine challenge (R(2) = 0.063, p = .038) and BDR after AMP challenge (R(2) = 0.192, p = .001) were significantly correlated with serum ECP levels. BDR after AMP challenge may be more closely related to eosinophilic inflammation, compared with that after methacholine challenge.

  9. Methacholine and adenosine 5'-monophosphate (AMP) responsiveness, and the presence and degree of atopy in children with asthma.

    Science.gov (United States)

    Suh, Dong I; Lee, Ju K; Kim, Chang K; Koh, Young Y

    2011-02-01

    The relationship between atopy and bronchial hyperresponsiveness (BHR), both key features of asthma, remains to be clarified. BHR is commonly evaluated by bronchial challenges using direct and indirect stimuli. The aim of this study was to investigate the degree of BHR to methacholine (direct stimulus) and adenosine 5'-monophosphate (AMP) (indirect stimulus) according to the presence and degree of atopy in children with asthma. We performed a retrospective analysis of data from 120 children presenting with a diagnosis of asthma. These children were characterized by skin-prick tests (SPTs), spirometry and bronchial challenges with methacholine and AMP. Atopy was defined by at least one positive reaction to SPTs, and its degree was measured using serum total IgE levels, number of positive SPTs and atopic scores (sum of graded wheal size). A provocative concentration causing a 20% decline in FEV(1) (PC(20) ) was determined for each challenge. Patients with atopy(n=94) had a significantly lower AMP PC(20) than non-atopic patients (n=26), whereas methacholine PC(20) was not different between the two groups. Among the patients with atopy, there was no association between methacholine PC(20) and any atopy parameter. In contrast, a significant association was found between AMP PC(20) and the degree of atopy reflected in serum total IgE, number of positive SPTs and atopic scores (anova trend test, p=0.002, 0.001, 0.003, respectively). AMP responsiveness was associated with the presence and degree of atopy, whereas such a relationship was not observed for methacholine responsiveness. These findings suggest that atopic status may be better reflected by bronchial responsiveness assessed by AMP than by methacholine. © 2011 John Wiley & Sons A/S.

  10. Post-translational Analysis of Arabidopsis thaliana Proteins in Response to Cyclic Guanosine Monophosphate Treatment

    KAUST Repository

    Parrott, Brian

    2011-01-01

    and phosphorylation before analysis via mass spectrometry. Preliminary results suggest a tendency towards an increased number of phosphorylated proteins as a result of cGMP treatment. The data also showed a sharp increase in methionine oxidation in response

  11. Molecular characterization of adenosine 5'-monophosphate deaminase--the key enzyme responsible for the umami taste of nori (Porphyra yezoensis Ueda, Rhodophyta).

    Science.gov (United States)

    Minami, Seiko; Sato, Minoru; Shiraiwa, Yoshihiro; Iwamoto, Koji

    2011-12-01

    The enzyme adenosine 5'-monophosphate deaminase (AMPD, EC 3.5.4.6) catalyzes the conversion of adenosine 5'-monophosphate to inosine 5'-mononucleotide (IMP). IMP is generally known as the compound responsible for the umami taste of the edible red alga Porphyra yezoensis Ueda that is known in Japan as nori. Therefore, we suspect that AMPD plays a key role in providing a favorable nori taste. In this study, we undertake the molecular characterization of nori-derived AMPD. The nori AMPD protein has a molecular mass of 55 kDa as estimated from both gel filtration and sodium dodecyl sulfate polyacrylamide gel electrophoresis. The calculated molecular mass from the amino acid sequence deduced from cDNA is 57.1 kDa. The isoelectric point is 5.71. The coding region of AMPD consists of 1,566 bp encoding 522 amino acids and possesses a transmembrane domain and two N-glycosylation sites. The sequence identity of nori AMPD in human and yeast AMPDs was found to be less than 50% and 20% in DNA and amino acid sequences, respectively. Proline in the conserved motif of [SA]-[LIVM]-[NGS]-[STA]-D-D-P was found to be converted to glutamate. These results indicate that nori AMPD is a novel type of AMPD.

  12. Bronchial responsiveness to adenosine-5 '-monophosphate and methacholine as predictors for nasal symptoms due to newly introduced allergens. A follow-up study among laboratory animal workers and bakery apprentices

    NARCIS (Netherlands)

    de Meer, G; Postma, DS; Heederik, D

    Background In asthma patients, bronchial hyper-responsiveness (BHR) to adenosine-5'-monophosphate (AMP) reflects bronchial inflammation more closely than BHR to methacholine. In this follow-up study we studied bronchial responsiveness to both stimuli as predictors of new-onset airway symptoms.

  13. Relationships of methacholine and adenosine 5'-monophosphate (AMP) responsiveness to the postbronchodilator FEV₁/FVC ratio in children with asthma.

    Science.gov (United States)

    Suh, Dong In; Choi, Sun Hee; Lee, Ju Kyung; Kim, Jin-Tack; Koh, Young Yull

    2011-05-01

    Airway remodeling has been assumed to cause bronchial hyperresponsiveness (BHR). A low postbronchodilator FEV₁/FVC ratio has been suggested to be a functional surrogate marker of airway remodeling in asthma. BHR is commonly assessed by bronchial challenges using direct or indirect stimuli. The aim of this study was to compare BHR to methacholine and adenosine 5'-monophosphate (AMP) with regard to their relationship with a marker of airway remodeling in children with asthma. Methacholine and AMP challenge tests were performed in 129 children with asthma, aged 12 years, and a provocative concentration causing a 20% fall in FEV₁ (PC₂₀) was calculated for each challenge. All subjects also underwent pre- and postbronchodilator spirometry. A postbronchodilator FEV₁/FVC ratio below the lower limits of normal was used as a marker of airway remodeling. A low postbronchodilator FEV₁/FVC ratio was found in 17 subjects (13.2%). These subjects had a significantly lower methacholine PC₂₀ (geometric mean: 0.63 mg/mL, range of 1 SD: 0.17-2.29) than those (n = 112) with a normal postbronchodilator FEV₁/FVC ratio (2.42 mg/mL, 0.57-10.32, p = .000), whereas AMP PC₂₀ was similar between the two groups (22.1 mg/mL, 3.9-125.9 vs. 27.7 mg/mL, 4.2-183.5, p = .231). In the whole group of subjects, methacholine PC₂₀, but not AMP PC₂₀, correlated significantly with the postbronchodilator FEV₁/FVC ratio (r = 0.340, p = .000, and r = 0.056, p = .526, respectively). Our results provide evidence, though indirect, that BHR to methacholine is related to airway remodeling in children with asthma and suggest that BHR to methacholine may be a better marker of airway remodeling than BHR to AMP.

  14. Application and optimization of the tenderization of pig Longissimus dorsi muscle by adenosine 5'-monophosphate (AMP) using the response surface methodology.

    Science.gov (United States)

    Deng, Shaoying; Wang, Daoying; Zhang, Muhan; Geng, Zhiming; Sun, Chong; Bian, Huan; Xu, Weimin; Zhu, Yongzhi; Liu, Fang; Wu, Haihong

    2016-03-01

    Based on single factor experiments, NaCl concentration, adenosine 5'-monophosphate (AMP) concentration and temperature were selected as independent variables for a three-level Box-Behnken experimental design, and the shear force and cooking loss were response values for regression analysis. According to the statistical models, it showed that all independent variables had significant effects on shear force and cooking loss, and optimal values were at the NaCl concentration of 4.15%, AMP concentration of 22.27 mmol/L and temperature of 16.70°C, which was determined with three-dimensional response surface diagrams and contour plots. Under this condition, the observed shear force and cooking loss were 0.625 kg and 8.07%, respectively, exhibiting a good agreement with their predicted values, showing the good applicability and feasibility of response surface methodology (RSM) for improving pork tenderness. Compared with control pig muscles, AMP combined with NaCl treatment demonstrated significant effects on improvement of meat tenderness and reduction of cooking loss. Therefore, AMP could be regarded as an effective tenderization agent for pork. © 2015 Japanese Society of Animal Science.

  15. Overexpression of cyclic adenosine monophosphate effluent protein MRP4 induces an altered response to β-adrenergic stimulation in the senescent rat heart.

    Science.gov (United States)

    Carillion, Aude; Feldman, Sarah; Jiang, Cheng; Atassi, Fabrice; Na, Na; Mougenot, Nathalie; Besse, Sophie; Hulot, Jean-Sébastien; Riou, Bruno; Amour, Julien

    2015-02-01

    In the senescent heart, the positive inotropic response to β-adrenoceptor stimulation is reduced, partly by dysregulation of β1- and β3-adrenoceptors. The multidrug resistance protein 4 (MRP4) takes part in the control of intracellular cyclic adenosine monophosphate concentration by controlling its efflux but the role of MRP4 in the β-adrenergic dysfunction of the senescent heart remains unknown. The β-adrenergic responses to isoproterenol were investigated in vivo (stress echocardiography) and in vitro (isolated cardiomyocyte by Ionoptix with sarcomere shortening and calcium transient) in young (3 months old) and senescent (24 months old) rats pretreated or not with MK571, a specific MRP4 inhibitor. MRP4 was quantified in left ventricular homogenates by Western blotting. Data are mean ± SD expressed as percent of baseline value. The positive inotropic effect of isoproterenol was reduced in senescent rats in vivo (left ventricular shortening fraction 120 ± 16% vs. 158 ± 20%, P < 0.001, n = 16 rats) and in vitro (sarcomere shortening 129 ± 37% vs. 148 ± 35%, P = 0.004, n = 41 or 43 cells) as compared to young rats. MRP4 expression increased 3.6-fold in senescent compared to young rat myocardium (P = 0.012, n = 8 rats per group). In senescent rats, inhibition of MRP4 by MK571 restored the positive inotropic effect of isoproterenol in vivo (143 ± 11%, n = 8 rats). In vitro in senescent cardiomyocytes pretreated with MK571, both sarcomere shortening (161 ± 45% vs. 129 ± 37%, P = 0.007, n = 41 cells per group) and calcium transient amplitude (132 ± 25% vs. 113 ± 27%, P = 0.007) increased significantly. MRP4 overexpression contributes to the reduction of the positive inotropic response to β-adrenoceptor stimulation in the senescent heart.

  16. Dietary effects of adenosine monophosphate to enhance growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream, Pagrus major.

    Science.gov (United States)

    Hossain, Md Sakhawat; Koshio, Shunsuke; Ishikawa, Manabu; Yokoyama, Saichiro; Sony, Nadia Mahjabin

    2016-09-01

    Our study explored the dietary effects of adenosine monophosphate (AMP) to enhance growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream. A semi-purified basal diet supplemented with 0% (Control), 0.1% (AMP-0.1), 0.2% (AMP-0.2), 0.4% (AMP-0.4) and 0.8% (AMP-0.8) purified AMP to formulate five experimental diets. Each diet was randomly allocated to triplicate groups of fish (mean initial weight 3.4 g) for 56 days. The results indicated that dietary AMP supplements tended to improve growth performances. One of the best ones was found in diet group AMP-0.2, followed by diet groups AMP-0.1, AMP-0.4 and AMP-0.8. The Apparent digestibility coefficients (dry matter, protein and lipid) also improved by AMP supplementation and the significantly highest dry matter digestibility was observed in diet group AMP-0.2. Fish fed diet groups AMP-0.2 and AMP-0.4 had significantly higher peroxidase and bactericidal activities than fish fed the control diet. Nitro-blue-tetrazolium (NBT) activity was found to be significantly (P  0.05) by dietary supplementation. In contrast, catalase activity decreased with AMP supplementation. Moreover, the fish fed AMP supplemented diets had better improvement (P red sea bream. The regression analysis revealed that a dietary AMP supplementation between 0.2 and 0.4% supported weight gain and lysozyme activity as a marker of immune functions for red sea bream, which is also inline with the most of the growth and health performance parameters of fish under present experimental conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Effects of dietary administration of guanosine monophosphate on the growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream, Pagrus major.

    Science.gov (United States)

    Hossain, Md Sakhawat; Koshio, Shunsuke; Ishikawa, Manabu; Yokoyama, Saichiro; Sony, Nadia Mahjabin

    2016-10-01

    The present study explored the dietary administration effects of guanosine monophosphate (GMP) on growth, digestibility, innate immune responses and stress resistance of juvenile red sea bream, Pagrus major. A semi-purified basal diet supplemented with 0% (Control), 0.1% (GMP-0.1), 0.2% (GMP-0.2), 0.4% (GMP-0.4) and 0.8% (GMP-0.8) purified GMP to formulate five experimental diets. Each diet was randomly allocated to triplicate groups of fish (mean initial weight 3.4 g) for 56 days. The obtained results clearly indicated that, growth performance of red sea bream enhanced by dietary GMP supplementation compared to control and significantly higher final weight was found in fish fed diet group GMP-0.4. Specific growth rate (SGR) and percent weight gain (%WG) also significantly higher in diet group GMP-0.4 in compared to control and it was not differed (P > 0.05) with diet group GMP-0.8. Feed intake significantly increased with the supplementation of GMP. Feed conversion efficiency (FCE) and protein efficiency ratio (PER) also improved (P  0.05) by GMP supplementation. In contrast, catalase activity decreased with GMP supplementation. In terms of oxidative stress GMP-0.2 showed best condition with low oxidative stress and high antioxidant level. Moreover, the fish fed GMP supplemented diets had better improvement (P red sea bream, which is also in line with the most of the growth performance and health parameters of the fish. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  19. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  20. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  1. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  2. Modulation of growth performance, immunological responses and disease resistance of juvenile Nile tilapia (Oreochromis niloticus (Linnaeus, 1758 by supplementing dietary inosine monophosphate

    Directory of Open Access Journals (Sweden)

    Md. Abdul Kader

    2018-05-01

    Full Text Available This study was investigated to examine supplemental effects of dietary inosine monophosphate (IMP on growth performance, feed utilization, biochemical, hematological and immunological parameters of juvenile Nile tilapia Oreochromis niloticus. Disease resistance to experimental infection with Streptococcus agalactiae was also assessed. A semi-purified basal diet was supplemented with 0 (IMP0, Control, 1 (IMP1, 2 (IMP2, 4 (IMP4 and 8 (IMP8 g purified IMP kg−1 diet to formulate five experimental diets. Each diet was randomly allocated to triplicate groups of fish (0.59 g for 60 days. The results indicated that supplementation of IMP significantly (P  0.05. Among whole body proximate composition and somatic parameters, condition factor was significantly influenced by dietary supplementation of IMP. A wide variation in hematological parameters were observed and dietary supplementation increased the hematocrit content (P  0.05. Total serum protein (TSP, lysozyme activity (LA, superoxide dismutase activity (SOD and bactericidal activity (BA tended to increase with the supplementation of dietary IMP. TSP and SOD were significantly improved with ≥4 g kg−1 supplementation, while LA with 8 g kg−1 and BA with ≥1 g kg−1 supplementations. IMP supplemented groups showed higher (P > 0.05 cumulative survival compared to that of supplementation free control group. IMP supplemented diet groups also showed significantly higher BA in the post challenge test. Based on the overall performances, the results of the current study indicated that the inclusion of IMP in Nile tilapia diet can improve growth performance, feed utilization, haematological and immunological parameters; and disease resistance of juvenile Nile tilapia. Keywords: Nucleotides, Inosine monophosphate, Growth, Immunity, Disease resistance, Nile tilapia, Streptococcus agalactiae

  3. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  4. Plasma concentrations of the cyclic nucleotides, adenosine 3',5'-monophosphate and guanosine 3'.5'-monophosphate, in healthy adults treated with theophylline

    DEFF Research Database (Denmark)

    Fenger, M; Eriksen, P B; Andersen, O

    1982-01-01

    Plasma concentrations of cyclic adenosine monophosphate and cyclic guanosine monophosphate were measured in 10 health adults before, during and after periods of theophylline administration. Cyclic adenosine monophosphate concentrations did not change significantly, but cyclic guanosine monophosph...

  5. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  6. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  7. 5' adenosine monophosphate-activated protein kinase, metabolism and exercise.

    Science.gov (United States)

    Aschenbach, William G; Sakamoto, Kei; Goodyear, Laurie J

    2004-01-01

    The 5' adenosine monophosphate-activated protein kinase (AMPK) is a member of a metabolite-sensing protein kinase family that functions as a metabolic 'fuel gauge' in skeletal muscle. AMPK is a ubiquitous heterotrimeric protein, consisting of an alpha catalytic, and beta and gamma regulatory subunits that exist in multiple isoforms and are all required for full enzymatic activity. During exercise, AMPK becomes activated in skeletal muscle in response to changes in cellular energy status (e.g. increased adenosine monophosphate [AMP]/adenosine triphosphate [ATP] and creatine/phosphocreatine ratios) in an intensity-dependent manner, and serves to inhibit ATP-consuming pathways, and activate pathways involved in carbohydrate and fatty-acid metabolism to restore ATP levels. Recent evidence shows that although AMPK plays this key metabolic role during acute bouts of exercise, it is also an important component of the adaptive response of skeletal muscles to endurance exercise training because of its ability to alter muscle fuel reserves and expression of several exercise-responsive genes. This review discusses the putative roles of AMPK in acute and chronic exercise responses, and suggests avenues for future AMPK research in exercise physiology and biochemistry.

  8. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  9. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  10. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  11. Primary adenosine monophosphate (AMP) deaminase deficiency in a hypotonic infant.

    Science.gov (United States)

    Castro-Gago, Manuel; Gómez-Lado, Carmen; Pérez-Gay, Laura; Eirís-Puñal, Jesús; Martínez, Elena Pintos; García-Consuegra, Inés; Martín, Miguel Angel

    2011-06-01

    The spectrum of the adenosine monophosphate (AMP) deaminase deficiency ranges from asymptomatic carriers to patients who manifest exercise-induced muscle pain, occasionally rhabdomyolysis, and idiopathic hyperCKemia. However, previous to the introduction of molecular techniques, rare cases with congenital weakness and hypotonia have also been reported. We report a 6-month-old girl with the association of congenital muscle weakness and hypotonia, muscle deficiency of adenosine monophosphate deaminase, and the homozygous C to T mutation at nucleotide 34 of the adenosine monophosphate deaminase-1 gene. This observation indicates the possible existence of a primary adenosine monophosphate deaminase deficiency manifested by congenital muscle weakness and hypotonia.

  12. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  13. Adenosine 5'-Monophosphate Aerosol Challenge Does Not Provoke Airflow Limitation in Healthy Cats

    Directory of Open Access Journals (Sweden)

    K. Vondráková

    2006-01-01

    Full Text Available The purpose of our study was to investigate the effects of nebulized adenosine 5'- monophosphate on airflow limitation in healthy cats determined by barometric whole body plethysmography (BWBP, in comparison to the effects of carbachol. Ten healthy 4- to 6-year-old domestic shorthair cats were included in the study. Each cat was placed in a BWBP plexiglass chamber (volume 38 l. Changes in box pressure were measured at baseline and after nebulization of vehicle and increasing concentrations of carbachol and adenosine 5'- monophosphate. Airway responsiveness was monitored as increases in enhanced pause (PENH, a unitless variable derived from dose-response curves estimating airflow limitation. The chosen endpoint was the agonist concentration which increased PENH to 300% of the value obtained after saline nebulization (PCPENH 300. Inter-day repeatability of measurements was assessed by repeated bronchoprovocations with both agonists 2-3 days apart. For carbachol, PCPENH300 was reached in all cats and correlated significantly between days (mean ± SD; 0.54 ± 0.42 mg/ml and 0.64 ± 0.45 mg/ml respectively; r = 0.58, p < 0.05 In contrast, we found no reaction to adenosine 5'- monophosphate even with the highest concentration nebulized during both measurements. At baseline, mean ± SD PENH was 0.47 ± 0.18 and 0.58 ± 0.24 (measurements 1 and 2, whereas PENH after 500 mg/ml adenosine 5'- monophosphate was 0.46 ± 0.20 and 0.71 ± 0.37. All bronchoprovocation tests were well tolerated by the cats. We conclude that healthy airways in cats do not demonstrate airway responsiveness to inhaled adenosine 5'- monophosphate. This is in agreement with observations in humans as well as our previous findings in dogs, where adenosine 5'- monophosphate had no effect on healthy canine airways, but caused significant airflow limitation after induction of acute bronchitis. To define the value of bronchoprovocation testing with adenosine 5'- monophosphate in the feline

  14. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  15. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  16. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  17. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  19. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  20. Rapid synthesis of triazine inhibitors of inosine monophosphate dehydrogenase.

    Science.gov (United States)

    Pitts, William J; Guo, Junqing; Dhar, T G Murali; Shen, Zhongqi; Gu, Henry H; Watterson, Scott H; Bednarz, Mark S; Chen, Bang Chi; Barrish, Joel C; Bassolino, Donna; Cheney, Daniel; Fleener, Catherine A; Rouleau, Katherine A; Hollenbaugh, Diane L; Iwanowicz, Edwin J

    2002-08-19

    A series of novel triazine-based small molecule inhibitors (IV) of inosine monophosphate dehydrogenase was prepared. The synthesis and the structure-activity relationships (SAR) derived from in vitro studies are described.

  1. Novel amide-based inhibitors of inosine 5'-monophosphate dehydrogenase.

    Science.gov (United States)

    Watterson, Scott H; Liu, Chunjian; Dhar, T G Murali; Gu, Henry H; Pitts, William J; Barrish, Joel C; Fleener, Catherine A; Rouleau, Katherine; Sherbina, N Z; Hollenbaugh, Diane L; Iwanowicz, Edwin J

    2002-10-21

    A series of novel amide-based small molecule inhibitors of inosine monophosphate dehydrogenase (IMPDH) was explored. The synthesis and the structure-activity relationships (SARs) derived from in vitro studies are described.

  2. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  3. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  4. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  5. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  6. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  7. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  8. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  9. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  10. Charge-density-wave instabilities expected in monophosphate tungsten bronzes

    International Nuclear Information System (INIS)

    Canadell, E.; Whangbo, M.

    1991-01-01

    On the basis of tight-binding band calculations, we examined the electronic structures of the tungsten oxide layers found in the monophosphate tungsten bronze (MPTB) phases. The Fermi surfaces of these MPTB phases consist of five well-nested one- and two-dimensional pieces. We calculated the nesting vectors of these Fermi surfaces and discussed the expected charge-density-wave instabilities

  11. Metabolism of inositol 4-monophosphate in rat mammalian tissues

    International Nuclear Information System (INIS)

    Delvaux, A.; Dumont, J.E.; Erneux, C.

    1987-01-01

    Rat brain soluble fraction contains an enzymatic activity that dephosphorylates inositol 1,4-bisphosphate (Ins(1,4)P2). We have used anion exchange h.p.l.c. in order to identify the inositol monophosphate product of Ins(1,4)P2 hydrolysis (i.e. Ins(1)P1, Ins(4)P1 or both). When [ 3 H]Ins(1,4)P2 was used as substrate, we obtained an inositol monophosphate isomer that was separated from the co-injected standard [ 3 H]Ins(1)P1. This suggested an Ins(1,4)P21-phosphatase pathway leading to the production of the inositol 4-monophosphate isomer. The dephosphorylation of [ 32 P]Ins(4)P1 was measured in rat brain, liver and heart soluble fraction and was Li+-sensitive. Chromatography of the soluble fraction of a rat brain homogenate on DEAE-cellulose resolved a monophosphate phosphatase activity that hydrolyzed both [ 3 H]Ins(1)P1 and [4- 32 P]Ins(4)P1 isomers

  12. Novel guanidine-based inhibitors of inosine monophosphate dehydrogenase.

    Science.gov (United States)

    Iwanowicz, Edwin J; Watterson, Scott H; Liu, Chunjian; Gu, Henry H; Mitt, Toomas; Leftheris, Katerina; Barrish, Joel C; Fleener, Catherine A; Rouleau, Katherine; Sherbina, N Z; Hollenbaugh, Diane L

    2002-10-21

    A series of novel guanidine-based small molecule inhibitors of inosine monophosphate dehydrogenase (IMPDH) was explored. IMPDH catalyzes the rate determining step in guanine nucleotide biosynthesis and is a target for anticancer, immunosuppressive and antiviral therapy. The synthesis and the structure-activity relationships (SARs), derived from in vitro studies, for this new series of inhibitors is given.

  13. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  14. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  15. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  17. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  18. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  19. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  20. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  1. Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency

    OpenAIRE

    Garone, Caterina; Garc??a-D??az, Beatriz; Emmanuele, Valentina; L??pez Garc??a, Luis Carlos; Tadesse, Saba; Akman, Hasan O.; Tanji, Kurenai; Quinzii, Catarina M.; Hirano, Michio

    2014-01-01

    Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2 −/− ) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-...

  2. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  3. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  4. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  5. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  6. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  7. Inosine monophosphate dehydrogenase messenger RNA expression is correlated to clinical outcomes in mycophenolate mofetil-treated kidney transplant patients, whereas inosine monophosphate dehydrogenase activity is not

    NARCIS (Netherlands)

    Sombogaard, Ferdi; Peeters, Annemiek M. A.; Baan, Carla C.; Mathot, Ron A. A.; Quaedackers, Monique E.; Vulto, Arnold G.; Weimar, Willem; van Gelder, Teun

    2009-01-01

    Measurement of the pharmacodynamic biomarker inosine monophosphate dehydrogenase (IMPDH) activity in renal transplant recipients has been proposed to reflect the biological effect better than using pharmacokinetic parameters to monitor mycophenolate mofetil therapy. The IMPDH assays are however

  8. A continuous spectrophotometric assay for monitoring adenosine 5'-monophosphate production.

    Science.gov (United States)

    First, Eric A

    2015-08-15

    A number of biologically important enzymes release adenosine 5'-monophosphate (AMP) as a product, including aminoacyl-tRNA synthetases, cyclic AMP (cAMP) phosphodiesterases, ubiquitin and ubiquitin-like ligases, DNA ligases, coenzyme A (CoA) ligases, polyA deadenylases, and ribonucleases. In contrast to the abundance of assays available for monitoring the conversion of adenosine 5'-triphosphate (ATP) to ADP, there are relatively few assays for monitoring the conversion of ATP (or cAMP) to AMP. In this article, we describe a homogeneous assay that continuously monitors the production of AMP. Specifically, we have coupled the conversion of AMP to inosine 5'-monophosphate (IMP) (by AMP deaminase) to the oxidation of IMP (by IMP dehydrogenase). This results in the reduction of oxidized nicotine adenine dinucleotide (NAD(+)) to reduced nicotine adenine dinucleotide (NADH), allowing AMP formation to be monitored by the change in the absorbance at 340 nm. Changes in AMP concentrations of 5 μM or more can be reliably detected. The ease of use and relatively low expense make the AMP assay suitable for both high-throughput screening and kinetic analyses. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Specific Interactions of Antitumor Metallocenes with Deoxydinucleoside Monophosphates

    Science.gov (United States)

    Eberle, Rahel P.; Hari, Yvonne; Schürch, Stefan

    2017-09-01

    Bent metallocenes Cp2MCl2 (M = Ti, V, Nb, Mo) are known to exhibit cytotoxic activity against a variety of cancer types. Though the mechanism of action is not fully understood yet, the accumulation of the metal ions in the nucleus points towards DNA as one of the primary targets. A set of eight deoxydinucleoside monophosphates was used to study the adduct yields with metallocenes and cisplatin. The binding affinities are reflected by the relative intensities of the adducts and were found to follow the order of Pt > V > Ti > Mo (no adducts were detected with Nb). High-resolution tandem mass spectrometry was applied to locate the binding patterns in the deoxydinucleoside monophosphates. Whereas cisplatin binds to the soft nitrogen atoms in the purine nucleobases, the metallocenes additionally interact with the hard phosphate oxygen, which is in good agreement with the hard and soft (Lewis) acids and bases (HSAB) concept. However, the binding specificities were found to be unique for each metallocene. The hard Lewis acids titanium and vanadium predominantly bind to the deprotonated phosphate oxygen, whereas molybdenum, an intermediate Lewis acid, preferentially interacts with the nucleobases. Nucleobases comprise alternative binding sites for titanium and vanadium, presumably oxygen atoms for the first and nitrogen atoms for the latter. In summary, the intrinsic binding behavior of the different metallodrugs is reflected by the gas-phase dissociation of the adducts. Consequently, MS/MS can provide insights into therapeutically relevant interactions between metallodrugs and their cellular targets. [Figure not available: see fulltext.

  10. Monophosphate end groups produced in radiation induced strand breakage in DNA

    International Nuclear Information System (INIS)

    Kay, E.; Ward, J.F.

    1976-01-01

    A solution of DNA was gamma-irradiated and treated with monophosphatase for studies on the amount of inorganic phosphate released as a function of time. Studies were also conducted on: effect of alkali on yield of monophosphate end groups; induction of DNA strand breaks by treatment with DNAase; initial G values for monophosphate termini; and effect of alkali on radioinduced DNA damage

  11. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  12. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  13. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  14. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  15. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  16. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  17. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  18. Inhibition of Cyclic Adenosine Monophosphate-Specific Phosphodiesterase by Various Food Plant-Derived Phytotherapeutic Agents.

    Science.gov (United States)

    Röhrig, Teresa; Pacjuk, Olga; Hernández-Huguet, Silvia; Körner, Johanna; Scherer, Katharina; Richling, Elke

    2017-11-04

    Background: Phosphodiesterases (PDEs) play a major role in the regulation of cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-mediated pathways. Their inhibitors exhibit anti-inflammatory, vasodilatory and antithrombotic effects. Therefore, consumption of foods with PDE-inhibiting potential may possess beneficial influence on the risk of cardiovascular diseases. Methods: Four plant extracts ( Arbutus unedo , Camellia sinensis , Cynara scolymus , Zingiber officinale ) with promising ingredient profiles and physiological effects were tested for their ability to inhibit cAMP-specific PDE in vitro in a radioactive assay. Results: Strawberry tree fruit ( Arbutus unedo ) and tea ( Camellia sinensis ) extracts did not inhibit PDE markedly. Alternatively, artichoke ( Cynara scolymus ) extract had a significant inhibitory influence on PDE activity (IC 50 = 0.9 ± 0.1 mg/mL) as well as its flavone luteolin (IC 50 = 41 ± 10 μM) and 3,4-dicaffeoylquinic acid (IC 50 > 1.0 mM). Additionally, the ginger ( Zingiber officinale ) extract and one of its constituents, [6]-gingerol, significantly inhibited PDE (IC 50 = 1.7 ± 0.2 mg/mL and IC 50 > 1.7 mM, respectively). Crude fractionation of ginger extract showed that substances responsible for PDE inhibition were in the lipoid fraction (IC 50 = 455 ± 19 μg/mL). Conclusions: A PDE-inhibitory effect was shown for artichoke and ginger extract. Whether PDE inhibition in vivo can be achieved through ingestion of artichoke or ginger extracts leading to physiological effects concerning cardiovascular health should be addressed in future research.

  19. Inhibition of Cyclic Adenosine Monophosphate-Specific Phosphodiesterase by Various Food Plant-Derived Phytotherapeutic Agents

    Directory of Open Access Journals (Sweden)

    Teresa Röhrig

    2017-11-01

    Full Text Available Background: Phosphodiesterases (PDEs play a major role in the regulation of cyclic adenosine monophosphate (cAMP- and cyclic guanosine monophosphate (cGMP-mediated pathways. Their inhibitors exhibit anti-inflammatory, vasodilatory and antithrombotic effects. Therefore, consumption of foods with PDE-inhibiting potential may possess beneficial influence on the risk of cardiovascular diseases. Methods: Four plant extracts (Arbutus unedo, Camellia sinensis, Cynara scolymus, Zingiber officinale with promising ingredient profiles and physiological effects were tested for their ability to inhibit cAMP-specific PDE in vitro in a radioactive assay. Results: Strawberry tree fruit (Arbutus unedo and tea (Camellia sinensis extracts did not inhibit PDE markedly. Alternatively, artichoke (Cynara scolymus extract had a significant inhibitory influence on PDE activity (IC50 = 0.9 ± 0.1 mg/mL as well as its flavone luteolin (IC50 = 41 ± 10 μM and 3,4-dicaffeoylquinic acid (IC50 > 1.0 mM. Additionally, the ginger (Zingiber officinale extract and one of its constituents, [6]-gingerol, significantly inhibited PDE (IC50 = 1.7 ± 0.2 mg/mL and IC50 > 1.7 mM, respectively. Crude fractionation of ginger extract showed that substances responsible for PDE inhibition were in the lipoid fraction (IC50 = 455 ± 19 μg/mL. Conclusions: A PDE-inhibitory effect was shown for artichoke and ginger extract. Whether PDE inhibition in vivo can be achieved through ingestion of artichoke or ginger extracts leading to physiological effects concerning cardiovascular health should be addressed in future research.

  20. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  1. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  2. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  3. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  4. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  5. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  6. A simplified radioimmunoassay of adenosine-3':5'-monophosphate

    International Nuclear Information System (INIS)

    Katoh, Yoshiki; Takezawa, Junichi; Suzuki, Morio; Kuninaka, Akira; Yoshino, Hiroshi

    1975-01-01

    Dextran-coated charcoal was proved to be able to separate free adenosine-3':5'monophosphate (cAMP) from antibody-bound cAMP. Only free cAMO was adsorbed on dextran-coated charcoal within 1 min after contacting the charcoal. In a reaction mixture of cAMP and anti-cAMP-plasma, most of antibody-bound cAMP had not been adsorbed 4 min after contacting. The data obtained were found to be almost the same as the data of another experiment using cellulose ester filter separation technique. Thus, dextran-coated charcoal could be employed to simplify the radioimmunoassay of cAMP. (author)

  7. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  9. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  10. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  11. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  12. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  13. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  14. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  15. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  16. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  17. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  19. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  20. Cyclic adenosine 3:5-monophosphate binding proteins in Hartmannella culbertsoni

    International Nuclear Information System (INIS)

    Verma, A.K.; Krishna Murti, C.R.

    1976-01-01

    When 100, 000 g supernatant fractions of homogenates of Hartmannella culbertsoni were incubated with ('- 3 H)-cyclic adenosine 3 : 5 monophosphate and passed through a sephadex G-100 column, radioactivity appeared with protein fractions eluted after the void colume. About 75% radioactivity bound to these fractions was recovered as cyclic adenosine 3 : 5 monophosphate. Unlabelled cAMP diluted the amount of radioactivity bound. Adenosine, deoxyadenosine, 5-AMP, 3-AMP, ADP and ATP did not inhibit binding. (author)

  1. Method of preparing tritium-labelled thymidine-5'-monophosphates of high specific activity

    International Nuclear Information System (INIS)

    Filip, J.; Vesely, J.; Cihak, A.

    1976-01-01

    A method is described of preparing thymidine-5'-monophosphates labelled with tritium of high specific activity based on enzyme synthesis in vitro. Phosphorylation was carried out using the catalytic effect of an enzyme contained in the supernatant fraction prepared from Yoshida ascites carcinoma in rats. The course of the enzyme reaction can be controlled by the concentration of the individual reaction mixture components. The method described allows obtaining thymidine-5'-monophosphate of radiochemical purity better than 95%. (J.B.)

  2. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  3. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  4. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  5. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  6. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  7. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  8. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  9. Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency.

    Science.gov (United States)

    Garone, Caterina; Garcia-Diaz, Beatriz; Emmanuele, Valentina; Lopez, Luis C; Tadesse, Saba; Akman, Hasan O; Tanji, Kurenai; Quinzii, Catarina M; Hirano, Michio

    2014-08-01

    Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2(-/-)) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-old Tk2(-/-) mice treated with dCMP+dTMP 200 mg/kg/day each (Tk2(-/-200dCMP/) (dTMP)) demonstrated that in mutant animals, the compounds raise dTTP concentrations, increase levels of mtDNA, ameliorate defects of mitochondrial respiratory chain enzymes, and significantly prolong their lifespan (34 days with treatment versus 13 days untreated). A second trial of dCMP+dTMP each at 400 mg/kg/day showed even greater phenotypic and biochemical improvements. In conclusion, dCMP/dTMP supplementation is the first effective pharmacologic treatment for Tk2 deficiency. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  10. The fate of H atom adducts to 3'-uridine monophosphate.

    Science.gov (United States)

    Wang, Ran; Zhang, Ru Bo; Eriksson, Leif A

    2010-07-29

    The stabilities of the adducts deriving from H free radical addition to the O2, O4, and C5 positions of 3'-uridine monophosphate (3'UMP) are studied by the hybrid density functional B3LYP approach. Upon H atom addition at the O2 position, a concerted low-barrier proton-transfer process will initially occur, followed by the potential ruptures of the N-glycosidic or beta-phosphate bonds. The rupture barriers are strongly influenced by the rotational configuration of the phosphate group at the 3' terminal, and are influenced by bulk solvation effects. The O4-H adduct has the highest thermal stability, as the localization of the unpaired electron does not enable cleavage of either the C1'-N1 or the C3'-O(P) bonds. For the most stable adduct, with H atom added to the C5 position, the rate-controlled step is the H2'a abstraction by the C6 radical site, after which the subsequent strand rupture reactions proceed with low barriers. The main unpaired electron densities are presented for the transient species. Combined with previous results, it is concluded that the H atom adducts are more facile to drive the strand scission rather than N-glycosidic bond ruptures within the nucleic acid bases.

  11. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  12. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  13. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  14. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  15. cAMP response element binding protein1 is essential for activation of steroyl co-enzyme a desaturase 1 (Scd1 in mouse lung type II epithelial cells.

    Directory of Open Access Journals (Sweden)

    Nisha Antony

    Full Text Available Cyclic AMP Response Element-Binding Protein 1 (Creb1 is a transcription factor that mediates cyclic adenosine 3', 5'-monophosphate (cAMP signalling in many tissues. Creb1(-/- mice die at birth due to respiratory failure and previous genome-wide microarray analysis of E17.5 Creb1(-/- fetal mouse lung identified important Creb1-regulated gene targets during lung development. The lipogenic enzymes stearoyl-CoA desaturase 1 (Scd1 and fatty acid synthase (Fasn showed highly reduced gene expression in Creb1(-/- lungs. We therefore hypothesized that Creb1 plays a crucial role in the transcriptional regulation of genes involved in pulmonary lipid biosynthetic pathways during lung development. In this study we confirmed that Scd1 and Fasn mRNA levels were down regulated in the E17.5 Creb1(-/- mouse lung while the lipogenic-associated transcription factors SrebpF1, C/ebpα and Pparγ were increased. In vivo studies using germline (Creb1(-/- and lung epithelial-specific (Creb1(EpiΔ/Δ Creb1 knockout mice showed strongly reduced Scd1, but not Fasn gene expression and protein levels in lung epithelial cells. In vitro studies using mouse MLE-15 epithelial cells showed that forskolin-mediated activation of Creb1 increased both Scd1 gene expression and protein synthesis. Additionally, MLE15 cells transfected with a dominant-negative ACreb vector blocked forskolin-mediated stimulation of Scd1 gene expression. Lipid profiling in MLE15 cells showed that dominant-negative ACreb suppressed forskolin-induced desaturation of ether linked lipids to produce plasmalogens, as well as levels of phosphatidylethanolamine, ceramide and lysophosphatidylcholine. Taken together these results demonstrate that Creb1 is essential for the induction and maintenance of Scd1 in developing fetal mouse lung epithelial cells.

  16. Application of graphene-ionic liquid-chitosan composite-modified carbon molecular wire electrode for the sensitive determination of adenosine-5′-monophosphate

    International Nuclear Information System (INIS)

    Shi, Fan; Gong, Shixing; Xu, Li; Zhu, Huanhuan; Sun, Zhenfan; Sun, Wei

    2013-01-01

    In this paper, a graphene (GR) ionic liquid (IL) 1-octyl-3-methylimidazolium hexafluorophosphate and chitosan composite-modified carbon molecular wire electrode (CMWE) was fabricated by a drop-casting method and further applied to the sensitive electrochemical detection of adenosine-5′-monophosphate (AMP). CMWE was prepared with diphenylacetylene (DPA) as the modifier and the binder. The properties of modified electrode were examined by scanning electron microscopy, cyclic voltammetry and electrochemical impedance spectroscopy. Electrochemical behaviors of AMP was carefully investigated with enhanced responses appeared, which was due to the presence of GR-IL composite on the electrode surface with excellent electrocatalytic ability. A well-defined oxidation peak of AMP appeared at 1.314 V and the electrochemical parameters were calculated by electrochemical methods. Under the selected conditions, the oxidation peak current of AMP was proportional to its concentration in the range from 0.01 μM to 80.0 μM with the detection limit as 3.42 nM (3σ) by differential pulse voltammetry. The proposed method exhibited good selectivity and was applied to the detection of vidarabine monophosphate injection samples with satisfactory results. - Highlights: • A graphene, ionic liquid 1-octyl-3-methylimidazolium hexafluorophosphate and chitosan composite were prepared. • Composite-modified carbon molecular wire electrode was fabricated and characterized. • A sensitive electrochemical method for the detection of adenosine-5′-monophosphate was established

  17. Application of graphene-ionic liquid-chitosan composite-modified carbon molecular wire electrode for the sensitive determination of adenosine-5′-monophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Fan [Key Laboratory of Tropical Medicinal Plant Chemistry of Ministry of Education, College of Chemistry and Chemical Engineering, Hainan Normal University, Haikou 571158 (China); Gong, Shixing; Xu, Li; Zhu, Huanhuan [College of Chemistry and Molecular Engineering, Qingdao University of Science and Technology, Qingdao 266042 (China); Sun, Zhenfan [Key Laboratory of Tropical Medicinal Plant Chemistry of Ministry of Education, College of Chemistry and Chemical Engineering, Hainan Normal University, Haikou 571158 (China); Sun, Wei, E-mail: swyy26@hotmail.com [Key Laboratory of Tropical Medicinal Plant Chemistry of Ministry of Education, College of Chemistry and Chemical Engineering, Hainan Normal University, Haikou 571158 (China)

    2013-12-01

    In this paper, a graphene (GR) ionic liquid (IL) 1-octyl-3-methylimidazolium hexafluorophosphate and chitosan composite-modified carbon molecular wire electrode (CMWE) was fabricated by a drop-casting method and further applied to the sensitive electrochemical detection of adenosine-5′-monophosphate (AMP). CMWE was prepared with diphenylacetylene (DPA) as the modifier and the binder. The properties of modified electrode were examined by scanning electron microscopy, cyclic voltammetry and electrochemical impedance spectroscopy. Electrochemical behaviors of AMP was carefully investigated with enhanced responses appeared, which was due to the presence of GR-IL composite on the electrode surface with excellent electrocatalytic ability. A well-defined oxidation peak of AMP appeared at 1.314 V and the electrochemical parameters were calculated by electrochemical methods. Under the selected conditions, the oxidation peak current of AMP was proportional to its concentration in the range from 0.01 μM to 80.0 μM with the detection limit as 3.42 nM (3σ) by differential pulse voltammetry. The proposed method exhibited good selectivity and was applied to the detection of vidarabine monophosphate injection samples with satisfactory results. - Highlights: • A graphene, ionic liquid 1-octyl-3-methylimidazolium hexafluorophosphate and chitosan composite were prepared. • Composite-modified carbon molecular wire electrode was fabricated and characterized. • A sensitive electrochemical method for the detection of adenosine-5′-monophosphate was established.

  18. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  19. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  20. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  1. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  2. Characterization of a monoclonal antibody to thymidine glycol monophosphate

    International Nuclear Information System (INIS)

    Chen, B.X.; Hubbard, K.; Ide, H.; Wallace, S.S.; Erlanger, B.F.

    1990-01-01

    A monoclonal antibody specific for thymine glycol (TG) in irradiated or OsO4-treated DNA was obtained by immunizing with thymidine glycol monophosphate (TMP-glycol) conjugated to bovine serum albumin by a carbodiimide procedure. Screening by dot-immunobinding and enzyme-linked immunosorbant assay (ELISA) procedures gave eight clones that bound OsO4- treated DNA. One of them, 2.6F.6B.6C, an IgG2a kappa, was characterized further. Hapten inhibition studies with OsO4-treated DNA showed that the antibody was specific for TMP-glycol. Among the various inhibitors tested, inhibition was in the order TMP-glycol greater than 5,6-dihydrothymidine phosphate greater than TMP greater than thymidine glycol greater than TG. Inhibition by 5,6-dihydrothymidine, thymidine, thymine, AMP, and CMP was negligible. In OsO4-treated DNA, as few as 0.5 TG per 10,000 bp were detectable by direct ELISA. Inhibition assays could detect as few as 1.5 TG per 10,000 bp. The antibody was equally reactive with native or denatured DNA containing TG. Among the X-irradiated homopolymers dC, dA, dG, and dT, only dT reacted with the antibody. Using an ELISA, the antibody could detect damage in irradiated DNA at the level of 20 Gy. Thus the antibody is of potential use in assays for DNA damage caused by X rays or other agents that damage DNA by free radical interactions

  3. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  5. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  6. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  7. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  8. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  9. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  10. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  11. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  12. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  13. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  14. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  15. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  16. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  17. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  18. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  19. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  20. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  1. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  3. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  4. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  5. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  6. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  7. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  8. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  9. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  10. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  11. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  12. Adenosine monophosphate-activated protein kinase modulates the activated phenotype of hepatic stellate cells.

    Science.gov (United States)

    Caligiuri, Alessandra; Bertolani, Cristiana; Guerra, Cristina Tosti; Aleffi, Sara; Galastri, Sara; Trappoliere, Marco; Vizzutti, Francesco; Gelmini, Stefania; Laffi, Giacomo; Pinzani, Massimo; Marra, Fabio

    2008-02-01

    Adiponectin limits the development of liver fibrosis and activates adenosine monophosphate-activated protein kinase (AMPK). AMPK is a sensor of the cellular energy status, but its possible modulation of the fibrogenic properties of hepatic stellate cells (HSCs) has not been established. In this study, we investigated the role of AMPK activation in the biology of activated human HSCs. A time-dependent activation of AMPK was observed in response to a number of stimuli, including globular adiponectin, 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside (AICAR), or metformin. All these compounds significantly inhibited platelet-derived growth factor (PDGF)-stimulated proliferation and migration of human HSCs and reduced the secretion of monocyte chemoattractant protein-1. In addition, AICAR limited the secretion of type I procollagen. Knockdown of AMPK by gene silencing increased the mitogenic effects of PDGF, confirming the negative modulation exerted by this pathway on HSCs. AMPK activation did not reduce PDGF-dependent activation of extracellular signal-regulated kinase (ERK) or Akt at early time points, whereas a marked inhibition was observed 24 hours after addition of PDGF, reflecting a block in cell cycle progression. In contrast, AICAR blocked short-term phosphorylation of ribosomal S6 kinase (p70(S6K)) and 4E binding protein-1 (4EBP1), 2 downstream effectors of the mammalian target of rapamycin (mTOR) pathway, by PDGF. The ability of interleukin-a (IL-1) to activate nuclear factor kappa B (NF-kappaB) was also reduced by AICAR. Activation of AMPK negatively modulates the activated phenotype of HSCs.

  13. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  14. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  15. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  16. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  17. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  18. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  19. Gold Core Mesoporous Organosilica Shell Degradable Nanoparticles for Two-Photon Imaging and Gemcitabine Monophosphate Delivery

    KAUST Repository

    Rhamani, Saher; Chaix, Arnaud; Aggad, Dina; Hoang, Phuong Mai; Moosa, Basem; Garcia, Marcel; Gary-Bobo, Magali; Charnay, Clarence; Almalik, Abdulaziz; Durand, Jean-Olivier; Khashab, Niveen M.

    2017-01-01

    The synthesis of gold core degradable mesoporous organosilica shell nanoparticles is described. The nanopaticles were very efficient for two-photon luminescence imaging of cancer cells and for in vitro gemcitabine monophosphate delivery, allowing promising theranostic applications in the nanomedicine field.

  20. Gold Core Mesoporous Organosilica Shell Degradable Nanoparticles for Two-Photon Imaging and Gemcitabine Monophosphate Delivery

    KAUST Repository

    Rhamani, Saher

    2017-09-12

    The synthesis of gold core degradable mesoporous organosilica shell nanoparticles is described. The nanopaticles were very efficient for two-photon luminescence imaging of cancer cells and for in vitro gemcitabine monophosphate delivery, allowing promising theranostic applications in the nanomedicine field.

  1. Short-term treatment with budesonide does not improve hyperresponsiveness to adenosine 5 '-monophosphate in COPD

    NARCIS (Netherlands)

    Rutgers, [No Value; Koeter, GH; van der Mark, TW; Postma, DS

    The role of inhaled corticosteroids in the treatment of chronic obstructive pulmonary disease (COPD) is unclear. We investigated the effects of budesonide on airway hyperresponsiveness (AHR) to methacholine (MCh) and adenosine 5'-monophosphate (AMP), to which we hypothesized the existence of greater

  2. 3-cyanoindole-based inhibitors of inosine monophosphate dehydrogenase: synthesis and initial structure-activity relationships.

    Science.gov (United States)

    Dhar, T G Murali; Shen, Zhongqi; Gu, Henry H; Chen, Ping; Norris, Derek; Watterson, Scott H; Ballentine, Shelley K; Fleener, Catherine A; Rouleau, Katherine A; Barrish, Joel C; Townsend, Robert; Hollenbaugh, Diane L; Iwanowicz, Edwin J

    2003-10-20

    A series of novel small molecule inhibitors of inosine monophosphate dehydrogenase (IMPDH), based upon a 3-cyanoindole core, were explored. IMPDH catalyzes the rate determining step in guanine nucleotide biosynthesis and is a target for anticancer, immunosuppressive and antiviral therapy. The synthesis and the structure-activity relationships (SAR), derived from in vitro studies, for this new series of inhibitors is given.

  3. A survey of cyclic replacements for the central diamide moiety of inhibitors of inosine monophosphate dehydrogenase.

    Science.gov (United States)

    Dhar, T G Murali; Liu, Chunjian; Pitts, William J; Guo, Junquing; Watterson, Scott H; Gu, Henry; Fleener, Catherine A; Rouleau, Katherine; Sherbina, N Z; Barrish, Joel C; Hollenbaugh, Diane; Iwanowicz, Edwin J

    2002-11-04

    A series of heterocyclic replacements for the central diamide moiety of 1, a potent small molecule inhibitor of inosine monophosphate dehydrogenase (IMPDH) were explored The synthesis and the structure-activity relationships (SARs), derived from in vitro studies, for these new series of inhibitors is given.

  4. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  5. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  6. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  7. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  8. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  9. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  10. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  11. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  12. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  13. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  14. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  15. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  16. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  17. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  18. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  19. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  20. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  1. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  2. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  3. Adenosine monophosphate-activated protein kinase from the mud ...

    Indian Academy of Sciences (India)

    CHENCUI HUANG

    would lead to disturbance of aerobic metabolism and reduc- tion of ATP ... the effects of heat temperature stress on the expression of. AMPK have ..... both a respiratory and osmoregulation organ, gill directly in ..... response to salinity stress.

  4. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  5. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  6. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  7. Cyclic adenosine monophosphate-dependent phosphorylation of mammalian mitochondrial proteins: enzyme and substrate characterization and functional role

    Czech Academy of Sciences Publication Activity Database

    Dobrová, Zuzana; Sardanelli, A. M.; Speranza, F.; Scacco, S.; Signorile, A.; Lorusso, V.; Papa, S.

    2001-01-01

    Roč. 40, - (2001), s. 13941-13947 ISSN 0006-2960 Institutional research plan: CEZ:AV0Z5020903 Keywords : cAMP * cyclic adenosine monophosphate Subject RIV: CE - Biochemistry Impact factor: 4.114, year: 2001

  8. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  9. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. A conjugate of decyltriphenylphosphonium with plastoquinone can carry cyclic adenosine monophosphate, but not cyclic guanosine monophosphate, across artificial and natural membranes.

    Science.gov (United States)

    Firsov, Alexander M; Rybalkina, Irina G; Kotova, Elena A; Rokitskaya, Tatyana I; Tashlitsky, Vadim N; Korshunova, Galina A; Rybalkin, Sergei D; Antonenko, Yuri N

    2018-02-01

    The present study demonstrated for the first time the interaction between adenosine 3',5'-cyclic monophosphate (cAMP), one of the most important signaling compounds in living organisms, and the mitochondria-targeted antioxidant plastoquinonyl-decyltriphenylphosphonium (SkQ1). The data obtained on model liquid membranes and human platelets revealed the ability of SkQ1 to selectively transport cAMP, but not guanosine 3',5'-cyclic monophosphate (cGMP), across both artificial and natural membranes. In particular, SkQ1 elicited translocation of cAMP from the source to the receiving phase of a Pressman-type cell, while showing low activity with cGMP. Importantly, only conjugate with plastoquinone, but not dodecyl-triphenylphosphonium, was effective in carrying cAMP. In human platelets, SkQ1 also appeared to serve as a carrier of cAMP, but not cGMP, from outside to inside the cell, as measured by phosphorylation of the vasodilator stimulated phosphoprotein. The SkQ1-induced transfer of cAMP across the plasma membrane found here can be tentatively suggested to interfere with cAMP signaling pathways in living cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Kinetics of hydrogen-deuterium exchange in guanosine 5'-monophosphate and guanosine 3':5'-monophosphate determined by laser-Raman spectroscopy.

    Science.gov (United States)

    Lane, M J; Thomas, G J

    1979-09-04

    Pseudo-first-order rate constants governing the deuterium exchange of 8-CH groups in guanosine 5'-monophosphate (5'-rGMP) and guanosine 3':5'-monophosphate (cGMP) were determined as a function of temperature in the range 30-80 degrees C by means of laser-Raman spectroscopy. For each guanine nucleotide the logarithm of the rate constant exhibits a strictly linear dependence on reciprocal temperature: i.e., k psi = Ae-Ea/RT with A = 8.84 X 10(14) h-1 and Ea = 24.6 kcal/mol for 5'-rGMP and A = 3.33 X 10(13) h-1 and Ea = 22.2 kcal/mol for cGMP. Exchange of the 8-CH groups in guanine nucleotides is generally 2-3 times more rapid than in adenine nucleotides [cf. g. j. thomas, Jr., & J. Livramento (1975) Biochemistry 14, 5210-5218]. As in the case of adenine nucleotides, cyclic and 5' nucleotides of guanine exchange at markedly different rates at lower temperatures, with exchange in the cyclic nucleotide being the more facile. Each of the guanine nucleotides was prepared in four different isotopic modifications for Raman spectral analysis. The Raman frequency shifts resulting from the various isotopic substitutions have been tabulated, and assignments have been given for most of the observed vibrational frequencies.

  12. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  13. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  14. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  15. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  16. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  17. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  18. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  19. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  20. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  1. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  3. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  5. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  6. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  7. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  8. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  9. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  10. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  11. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  12. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  13. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  14. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  15. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  16. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  17. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  18. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  19. Differential Sensitivities of Fast- and Slow-Cycling Cancer Cells to Inosine Monophosphate Dehydrogenase 2 Inhibition by Mycophenolic Acid

    Science.gov (United States)

    Chen, Kan; Cao, Wanlu; Li, Juan; Sprengers, Dave; Hernanda, Pratika Y; Kong, Xiangdong; van der Laan, Luc JW; Man, Kwan; Kwekkeboom, Jaap; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei

    2015-01-01

    As uncontrolled cell proliferation requires nucleotide biosynthesis, inhibiting enzymes that mediate nucleotide biosynthesis constitutes a rational approach to the management of oncological diseases. In practice, however, results of this strategy are mixed and thus elucidation of the mechanisms by which cancer cells evade the effect of nucleotide biosynthesis restriction is urgently needed. Here we explored the notion that intrinsic differences in cancer cell cycle velocity are important in the resistance toward inhibition of inosine monophosphate dehydrogenase (IMPDH) by mycophenolic acid (MPA). In short-term experiments, MPA treatment of fast-growing cancer cells effectively elicited G0/G1 arrest and provoked apoptosis, thus inhibiting cell proliferation and colony formation. Forced expression of a mutated IMPDH2, lacking a binding site for MPA but retaining enzymatic activity, resulted in complete resistance of cancer cells to MPA. In nude mice subcutaneously engrafted with HeLa cells, MPA moderately delayed tumor formation by inhibiting cell proliferation and inducing apoptosis. Importantly, we developed a lentiviral vector–based Tet-on label-retaining system that enables to identify, isolate and functionally characterize slow-cycling or so-called label-retaining cells (LRCs) in vitro and in vivo. We surprisingly found the presence of LRCs in fast-growing tumors. LRCs were superior in colony formation, tumor initiation and resistance to MPA as compared with fast-cycling cells. Thus, the slow-cycling compartment of cancer seems predominantly responsible for resistance to MPA. PMID:26467706

  20. Cyclic guanosine monophosphate in the regulation of the cell function

    Directory of Open Access Journals (Sweden)

    Małgorzata Zbrojkiewicz

    2016-12-01

    Full Text Available Intracellular concentration of cGMP depends on the activity of guanylate cyclase, responsible for its synthesis, on the activity of cyclic nucleotide degrading enzymes - phosphodiesterases (PDEs. There are two forms of guanylate cyclase: the membrane-bound cyclase and the soluble form. The physiological activators of the membrane guanylate cyclase are natriuretic peptides (NPs, and of the cytosolic guanylate cyclase - nitric oxide (NO and carbon monoxide (CO. Intracellular cGMP signaling pathways arise from its direct effect on the activity of G protein kinases, phosphodiesterases and cyclic nucleotide dependent cation channels. It has been shown in recent years that cGMP can also affect other signal pathways in cell signaling activity involving Wnt proteins and sex hormones. The increased interest in the research on the role of cGMP, resulted also in the discovery of its role in the regulation of phototransduction in the eye, neurotransmission, calcium homeostasis, platelet aggregation, heartbeat, bone remodeling, lipid metabolism and the activity of the cation channels. Better understanding of the mechanisms of action of cGMP in the regulation of cell function can create new opportunities for the cGMP affecting drugs use in the pharmacotherapy.

  1. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  2. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  3. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  4. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  5. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  6. Alteration of sodium, potassium-adenosine triphosphatase activity in rabbit ciliary processes by cyclic adenosine monophosphate-dependent protein kinase

    International Nuclear Information System (INIS)

    Delamere, N.A.; Socci, R.R.; King, K.L.

    1990-01-01

    The response of sodium, potassium-adenosine triphosphatase (Na,K-ATPase) to cyclic adenosine monophosphate (cAMP)-dependent protein kinase was examined in membranes obtained from rabbit iris-ciliary body. In the presence of the protein kinase together with 10(-5) M cAMP, Na,K-ATPase activity was reduced. No change in Na,K-ATPase activity was detected in response to the protein kinase without added cAMP. Likewise cAMP alone did not alter Na,K-ATPase activity. Reduction of Na,K-ATPase activity was also observed in the presence of the cAMP-dependent protein kinase catalytic subunit. The response of the enzyme to the kinase catalytic subunit was also examined in membranes obtained from rabbit ciliary processes. In the presence of 8 micrograms/ml of the catalytic subunit, ciliary process Na,K-ATPase activity was reduced by more than 50%. To examine whether other ATPases were suppressed by the protein kinase, calcium-stimulated ATPase activity was examined; its activity was stimulated by the catalytic subunit. To test whether the response of the ciliary process Na,K-ATPase is unique, experiments were also performed using membrane preparations from rabbit lens epithelium or rabbit kidney; the catalytic subunit significantly reduced the activity of Na,K-ATPase from the kidney but not the lens. These Na,K-ATPase studies suggest that in the iris-ciliary body, cAMP may alter sodium pump activity. In parallel 86Rb uptake studies, we observed that ouabain-inhibitable potassium uptake by intact pieces of iris-ciliary body was reduced by exogenous dibutryl cAMP or by forskolin

  7. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  8. Structural Characterization of the Molecular Events during a Slow Substrate-Product Transition in Orotidine 5'-Monophosphate Decarboxylase

    Energy Technology Data Exchange (ETDEWEB)

    Fujihashi, Masahiro; Wei, Lianhu; Kotra, Lakshmi P; Pai, Emil F; (TGRI); (Toronto); (Kyoto)

    2009-04-06

    Crystal structures of substrate-product complexes of Methanobacterium thermoautotrophicum orotidine 5'-monophosphate decarboxylase, obtained at various steps in its catalysis of the unusual transformation of 6-cyano-uridine 5'-monophosphate (UMP) into barbituric acid ribosyl monophosphate, show that the cyano substituent of the substrate, when bound to the active site, is first bent significantly from the plane of the pyrimidine ring and then replaced by an oxygen atom. Although the K72A and D70A/K72A mutants are either catalytically impaired or even completely inactive, they still display bending of the C6 substituent. Interestingly, high-resolution structures of the D70A and D75N mutants revealed a covalent bond between C6 of UMP and the Lys72 side chain after the -CN moiety's release. The same covalent bond was observed when the native enzyme was incubated with 6-azido-UMP and 6-iodo-UMP; in contrast, the K72A mutant transformed 6-iodo-UMP to barbituric acid ribosyl 5'-monophosphate. These results demonstrate that, given a suitable environment, native orotidine 5'-monophosphate decarboxylase and several of its mutants are not restricted to the physiologically relevant decarboxylation; they are able to catalyze even nucleophilic substitution reactions but consistently maintain distortion on the C6 substituent as an important feature of catalysis.

  9. Investigations of structural, dielectric and optical properties on silicon ion irradiated glycine monophosphate single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Kanagasekaran, T. [Department of Physics, Anna University, Chennai 600 025 (India); Department of Physics and Astrophysics, University of Delhi, New Delhi 110 007 (India); Mythili, P. [Department of Physics, Anna University, Chennai 600 025 (India); Bhagavannarayana, G. [Materials Characterization Division, National Physical Laboratory, New Delhi 110012 (India); Kanjilal, D. [Inter University Accelerator Centre, New Delhi 110 067 (India); Gopalakrishnan, R. [Department of Physics, Anna University, Chennai 600 025 (India)], E-mail: krgkrishnan@annauniv.edu

    2009-08-01

    The 50 MeV silicon ion irradiation induced modifications on structural, optical and dielectric properties of solution grown glycine monophosphate (GMP) crystals were studied. The high-resolution X-ray diffraction study shows the unaltered value of integrated intensity on irradiation. The dielectric constant as a function of frequency and temperature was studied. UV-visible studies reveal the decrease in bandgap values on irradiation and presence of F-centers. The fluorescence spectrum shows the existence of some energy levels, which remains unaffected after irradiation. The scanning electron micrographs reveal the defects formed on irradiation.

  10. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  11. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  12. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  13. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  15. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  16. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  17. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  18. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  19. Method of preparing thymidine-5'-monophosphate specifically or nonspecifically labelled with 14C or with 3H

    International Nuclear Information System (INIS)

    Nejedly, Z.; Filip, J.; Ekl, J.; Kolina, J.; Votruba, I.; Skoda, J.

    1977-01-01

    The invention claims a method for labelled thymidine-5'-monophosphate preparation by cultivating a special thymine-dependent Escherichia coli SPT - strain in the optimum synthetic culture medium containing 0.8 to 1.2 g/ml of labelled thymine. Practically the whole amount of labelled thymine is utilized for cellular deoxyribonucleic acid synthesis. The radioactive biomass obtained is processed using such chemical and enzymatic decomposition procedures as to allow separating the labelled thymidine-5'-monophosphate as the only thymine reaction product. Experiments conducted showed that the radiochemical purity of the thymidine-5'-monophosphate obtained was better than 98%. The absence of other nonactive substances was confirmed by spectrophotometric analysis. The overall product activity was 92.3% of the activity of thymine-2- 14 C introduced in the reaction. (Ha)

  20. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  1. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  2. Evolution of coherent collective modes through consecutive charge-density-wave transitions in the (PO2)4(WO3)12 monophosphate tungsten bronze

    Science.gov (United States)

    Stojchevska, L.; Borovšak, M.; Foury-Leylekian, P.; Pouget, J.-P.; Mertelj, T.; Mihailovic, D.

    2017-07-01

    All-optical femtosecond relaxation dynamics in a single crystal of monophosphate tungsten bronze (PO2)4(WO3)2m with alternate stacking m =6 of WO3 layers was studied through the three consequent charge-density-wave (CDW) transitions. Several transient coherent collective modes associated with the different CDW transitions were observed and analyzed in the framework of the time-dependent Ginzburg-Landau theory. Remarkably, the interference of the modes leads to an apparent rectification effect in the transient reflectivity response. A saturation of the coherent-mode amplitudes with increasing pump fluence well below the CDWs destruction threshold fluence indicates a decoupling of the electronic and lattice parts of the order parameter on the femtosecond timescale.

  3. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  4. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  5. Direct Determination of Six Cytokinin Nucleotide Monophosphates in Coconut Flesh by Reversed-Phase Liquid Chromatography-Tandem Mass Spectrometry.

    Science.gov (United States)

    Cao, Zhao-Yun; Ma, You-Ning; Sun, Li-Hua; Mou, Ren-Xiang; Zhu, Zhi-Wei; Chen, Ming-Xue

    2017-11-15

    Coconut contains many uncharacterized cytokinins that have important physiological effects in plants and humans. In this work, a method based on liquid chromatography-tandem mass spectrometry was developed for identification and quantification of six cytokinin nucleotide monophosphates in coconut flesh. Excellent separation was achieved using a low-coverage C18 bonded-phase column with an acidic mobile phase, which greatly improved the retention of target compounds. To enable high-throughput analysis, a single-step solid-phase extraction using mixed-mode anion-exchange cartridges was employed for sample preparation. This proved to be an effective method to minimize matrix effects and ensure high selectivity. The limits of detection varied from 0.06 to 0.3 ng/mL, and the limits of quantification ranged from 0.2 to 1.0 ng/mL. The linearity was statistically verified over 2 orders of magnitude, giving a coefficient of determination (R 2 ) greater than 0.9981. The mean recoveries were from 81 to 108%; the intraday precision (n = 6) was less than 11%; and the interday precision (n = 11) was within 14%. The developed method was applied to the determination of cytokinin nucleotide monophosphates in coconut flesh samples, and four of them were successfully identified and quantified. The results showed that trans-zeatin riboside-5'-monophosphate was the dominant cytokinin, with a concentration of 2.7-34.2 ng/g, followed by N 6 -isopentenyladenosine-5'-monophosphate (≤12.9 ng/g), while the concentrations of cis-zeatin riboside-5'-monophosphate and dihydrozeatin riboside-5'-monophosphate were less than 2.2 and 4.9 ng/g, respectively.

  6. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  7. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  8. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  9. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  10. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  11. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  12. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  13. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  14. Adenosine Monophosphate (AMP)-Activated Protein Kinase: A New Target for Nutraceutical Compounds.

    Science.gov (United States)

    Marín-Aguilar, Fabiola; Pavillard, Luis E; Giampieri, Francesca; Bullón, Pedro; Cordero, Mario D

    2017-01-29

    Adenosine monophosphate-activated protein kinase (AMPK) is an important energy sensor which is activated by increases in adenosine monophosphate (AMP)/adenosine triphosphate (ATP) ratio and/or adenosine diphosphate (ADP)/ATP ratio, and increases different metabolic pathways such as fatty acid oxidation, glucose transport and mitochondrial biogenesis. In this sense, AMPK maintains cellular energy homeostasis by induction of catabolism and inhibition of ATP-consuming biosynthetic pathways to preserve ATP levels. Several studies indicate a reduction of AMPK sensitivity to cellular stress during aging and this could impair the downstream signaling and the maintenance of the cellular energy balance and the stress resistance. However, several diseases have been related with an AMPK dysfunction. Alterations in AMPK signaling decrease mitochondrial biogenesis, increase cellular stress and induce inflammation, which are typical events of the aging process and have been associated to several pathological processes. In this sense, in the last few years AMPK has been identified as a very interesting target and different nutraceutical compounds are being studied for an interesting potential effect on AMPK induction. In this review, we will evaluate the interaction of the different nutraceutical compounds to induce the AMPK phosphorylation and the applications in diseases such as cancer, type II diabetes, neurodegenerative diseases or cardiovascular diseases.

  15. Kinetics of hydrogen-deuterium exchange in adenosine 5'-monophosphate, adenosine 3':5'-monophosphate, and poly(riboadenylic acid) determined by laser-Raman spectroscopy.

    Science.gov (United States)

    Thomas, G J; Livramento, J

    1975-11-18

    Pseudo-first-order rate constants governing the deuterium exchange of 8-CH groups in adenosine 5'-monophosphate, adenosine 3':5'-monophosphate, and poly(riboadenylic acid) (poly(rA)) were determined as a function of temperature in the range 20-90 degrees C by means of laser-Raman spectroscopy. For 5'-rAMP, the logarithm of the rate constant exhibits a strictly linear dependence on reciprocal temperature, i.e., kpsi = Ae-Ea/RT, with A = 2.3 X 10(14) hr-1 and Ea = 24.2 +/- 0.6 kcal/mol. For cAMP, above 50 degrees C, kpsi is nearly identical in magnitude and temperature dependence to that of 5'-rAMP. However, below 50 degrees C, isotope exchange in cAMP is much more rapid than in 5'-rAMP, characterized by a lower activation energy (17.7 kcal/mol) and frequency factor (9.6 X 10(9) hr-1). Exchange in poly(rA) is considerably slower than in 5'-rAMP at all temperatures, but like cAMP the in k vs. 1/T plot may be divided into high temperature and low temperature domains, each characterized by different Arrhenius parameters. Above 60 degrees C, poly(rA) gives Ea = 22.0 kcal/mol and A = 3.2 X 10(12) hr-1, while below 60 degrees C, Ea = 27.7 kcal/mol and A = 1.8 X 10(16) hr-1. Thus, increasing the temperature above 60 degrees C does not diminish the retardation of exchange in poly(rA) vis a vis 5'-rAMP. These results indicate that the distribution of electrons in the adenine ring of cAMP is altered by lowering the temperature below 50 degrees C, although no similar perturbation occurs for 5'-rAMP. Retardation of exchange in poly(rA) is most probably due to base stacking at lower temperatures and to steric hindrance from the ribopolymer backbone at higher temperatures. We also report the spectral effects of deuterium exchange on the vibrational Raman frequencies of 5'-rAMP, cAMP, and poly(rA) and suggest a number of new assignments for the 5' and cyclic ribosyl phosphate groups.

  16. Therapeutic effects of the joint administration of magnesium aspartate and adenosine monophosphate in gamma-irradiated mice

    International Nuclear Information System (INIS)

    Pospisil, M.; Netikova, J.; Pipalova, I.; Kozubik, A.

    1990-01-01

    The joint administration of magnesium aspartate and adenosine monophosphate, injected on days 1 to 4 post radiation, has been found to exert stimulatory effects on the recovery of hemopoietic functions in sublethally gamma-irradiated mice. These therapeutical effects were enhanced in animals protected by peroral administration of cystamine. The treatment scheme used did not modify survival of lethally irradiated mice. The therapeutic effects of magnesium aspartate and adenosine monophosphate in sublethally irradiated mice are explained by the stimulatory action of these drugs on the cell adenylate cyclase system, which influences the erythropoietic functions. (author)

  17. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  18. Effects of exogenous inosine monophosphate on growth performance, flavor compounds, enzyme activity, and gene expression of muscle tissues in chicken.

    Science.gov (United States)

    Yan, Junshu; Liu, Peifeng; Xu, Liangmei; Huan, Hailin; Zhou, Weiren; Xu, Xiaoming; Shi, Zhendan

    2018-04-01

    The goal of this experiment was to examine effects of diets supplemented with exogenous inosine monophosphate (IMP) on the growth performance, flavor compounds, enzyme activity and gene expression of chicken. A total of 1,500 healthy, 1-day-old male 3-yellow chickens were used for a 52-d experimental period. Individuals were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates per group, and fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, and 0.3% IMP, respectively. There was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast and thigh muscle showed an exponential and linear response to the increasing dietary IMP level (P exogenous IMP was fed. There were significant effects of IMP level in diet on free amino acids (FAA) (exponential, linear and quadratic effect, P exogenous IMP was fed. Dietary IMP supplementation had a quadratic effect on 5΄-NT and the alkaline phosphatase (ALP) enzyme activity in the breast muscle (P exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle. These results indicate that dietary IMP did not affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken.

  19. Proteomic signatures implicate cAMP in light and temperature responses in Arabidopsis thaliana

    KAUST Repository

    Thomas, Ludivine; Marondedze, Claudius; Ederli, Luisa; Pasqualini, Stefania; Gehring, Christoph A

    2013-01-01

    The second messenger 3'-5'-cyclic adenosine monophosphate (cAMP) and adenylyl cyclases (ACs), enzymes that catalyse the formation of cAMP from ATP, are increasingly recognized as important signaling molecules in a number of physiological responses

  20. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  1. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  2. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  3. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  4. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  5. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  6. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  7. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  8. The Arabidopsis thiamin-deficient mutant pale green1 lacks thiamin monophosphate phosphatase of the vitamin B1 biosynthesis pathway.

    Science.gov (United States)

    Hsieh, Wei-Yu; Liao, Jo-Chien; Wang, Hsin-Tzu; Hung, Tzu-Huan; Tseng, Ching-Chih; Chung, Tsui-Yun; Hsieh, Ming-Hsiun

    2017-07-01

    Thiamin diphosphate (TPP, vitamin B 1 ) is an essential coenzyme present in all organisms. Animals obtain TPP from their diets, but plants synthesize TPPde novo. We isolated and characterized an Arabidopsis pale green1 (pale1) mutant that contained higher concentrations of thiamin monophosphate (TMP) and less thiamin and TPP than the wild type. Supplementation with thiamin, but not the thiazole and pyrimidine precursors, rescued the mutant phenotype, indicating that the pale1 mutant is a thiamin-deficient mutant. Map-based cloning and whole-genome sequencing revealed that the pale1 mutant has a mutation in At5g32470 encoding a TMP phosphatase of the TPP biosynthesis pathway. We further confirmed that the mutation of At5g32470 is responsible for the mutant phenotypes by complementing the pale1 mutant with constructs overexpressing full-length At5g32470. Most plant TPP biosynthetic enzymes are located in the chloroplasts and cytosol, but At5g32470-GFP localized to the mitochondrion of the root, hypocotyl, mesophyll and guard cells of the 35S:At5g32470-GFP complemented plants. The subcellular localization of a functional TMP phosphatase suggests that the complete vitamin B1 biosynthesis pathway may involve the chloroplasts, mitochondria and cytosol in plants. Analysis of PALE1 promoter-uidA activity revealed that PALE1 is mainly expressed in vascular tissues of Arabidopsis seedlings. Quantitative RT-PCR analysis of TPP biosynthesis genes and genes encoding the TPP-dependent enzymes pyruvate dehydrogenase, α-ketoglutarate dehydrogenase and transketolase revealed that the transcript levels of these genes were upregulated in the pale1 mutant. These results suggest that endogenous levels of TPP may affect the expression of genes involved in TPP biosynthesis and TPP-dependent enzymes. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  9. Adenosine monophosphate is not superior to histamine for bronchial provocation test for assessment of asthma control and symptoms.

    Science.gov (United States)

    Wu, Fan; Guan, Wei-Jie; Gao, Yi; An, Jia-Ying; Xie, Yan-Qing; Liu, Wen-Ting; Yu, Xin-Xin; Zheng, Jin-Ping

    2017-07-01

    Adenosine monophosphate (AMP) may reflect airway inflammation and hyperresponsiveness, but relationship between AMP and histamine (His, a conventional stimulus) bronchial provocation test (BPT) in asthma is not fully elucidated. To compare both BPTs and determine their utility in reflecting changes of asthmatic symptoms. BPTs were performed in a cross-over fashion, at 2-4 day intervals. Cumulative doses eliciting 20% FEV 1 fall (PD 20 FEV 1 ), diagnostic performance and adverse events (AEs) were compared. Patients with PD 20 FEV 1 lower than geometric mean were defined as responders, otherwise poor responders. Patients with uncontrolled and partly controlled asthma, who maintained their original inhaled corticosteroids therapy, underwent reassessment of airway responsiveness and asthmatic symptoms 3 and 6 months after. Nineteen uncontrolled, 22 partly controlled and 19 controlled asthmatic patients and 24 healthy subjects were recruited. Lower PD 20 FEV 1 geometric means were associated with poorer asthma control in His-BPT (0.424 μmol vs 1.684 μmol vs 3.757 μmol), but not AMP-BPT (11.810 μmol vs 7.781 μmol vs 10.220 μmol). Both BPTs yielded similar overall diagnostic performance in asthma (area under curve: 0.842 in AMP-BPT vs 0.850 in His-BPT). AEs, including wheezing and tachypnea, were similar and mild. Ten patients with uncontrolled and 10 partly controlled asthma were followed-up. At months 3 and 6, we documented an increase in PD 20 FEV 1 -AMP and PD 20 FEV 1 -His, which did not correlate with reduction asthmatic symptom scores. This overall applied in responders and poor responders of AMP-BPT and His-BPT. Despite higher screening capacity of well-controlled asthma, AMP-BPT confers similar diagnostic performance and safety with His-BPT. AMP-BPT might not preferentially reflect changes asthmatic symptoms. © 2015 John Wiley & Sons Ltd.

  10. Protective effect of oral terfenadine and not inhaled ipratropium on adenosine 5 '-monophosphate-induced bronchoconstriction in patients with COPD

    NARCIS (Netherlands)

    Rutgers, [No Value; Koeter, GH; Van der Mark, TW; Postma, DS

    Background Inhalation of adenosine 5'-monophosphate (AMP) causes bronchoconstriction in patients with asthma and in many patients with chronic obstructive pulmonary disease (COPD). In asthma, AMP-induced bronchoconstriction has been shown to be determined mainly by release of mast cell mediators,

  11. The solvent effect on the enthalpy of hydrolysis of cyclic adenosine 3',5'-monophosphate : a quantum chemical study

    NARCIS (Netherlands)

    Scheffers - Sap, Miek; Buck, H.M.

    1978-01-01

    The solvent effect on the enthalpy of hydrolysis has been studied by the Extended-Hückel method for the hydrolysis reactions of cyclic adenosine 3',5'-monophosphate (cyclic 3',5'-AMP) and related cyclic phosphate diesters. The results show that the difference in enthalpy of hydrolysis between cyclic

  12. Inhibitors of inosine monophosphate dehydrogenase: SARs about the N-[3-Methoxy-4-(5-oxazolyl)phenyl moiety.

    Science.gov (United States)

    Iwanowicz, Edwin J; Watterson, Scott H; Guo, Junqing; Pitts, William J; Murali Dhar, T G; Shen, Zhongqi; Chen, Ping; Gu, Henry H; Fleener, Catherine A; Rouleau, Katherine A; Cheney, Daniel L; Townsend, Robert M; Hollenbaugh, Diane L

    2003-06-16

    The first reported structure-activity relationships (SARs) about the N-[3-methoxy-4-(5-oxazolyl)phenyl moiety for a series of recently disclosed inosine monophosphate dehydrogenase (IMPDH) inhibitors are described. The syntheses and in vitro inhibitory values for IMPDH II, and T-cell proliferation (for select analogues) are given.

  13. Hydrogels Based on Ag+ -Modulated Assembly of 5'-Adenosine Monophosphate for Enriching Biomolecules.

    Science.gov (United States)

    Hu, Yuanyuan; Xie, Dong; Wu, Yang; Lin, Nangui; Song, Aixin; Hao, Jingcheng

    2017-11-07

    Supramolecular hydrogels obtained by combining 5'-adenosine monophosphate (AMP) with Ag + were fabricated in this work. Their gelation capability was enhanced by increasing the concentration of Ag + or decreasing the pH. The gels are very sensitive to light, which endows them with potential applications as visible-light photosensitive materials. Coordination between the nucleobase of AMP and Ag + , as well as π-π stacking of nucleobases, are considered to be the main driving forces for self-assembly. The hydrogels successfully achieved the encapsulation and enrichment of biomolecules. Hydrogen bonding between the amino group of guest molecules and silver nanoparticles along the nanofibers drives the enrichment and is considered to be a crucial interaction. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Erythrocytic Adenosine Monophosphate as an Alternative Purine Source in Plasmodium falciparum*

    Science.gov (United States)

    Cassera, María B.; Hazleton, Keith Z.; Riegelhaupt, Paul M.; Merino, Emilio F.; Luo, Minkui; Akabas, Myles H.; Schramm, Vern L.

    2008-01-01

    Plasmodium falciparum is a purine auxotroph, salvaging purines from erythrocytes for synthesis of RNA and DNA. Hypoxanthine is the key precursor for purine metabolism in Plasmodium. Inhibition of hypoxanthine-forming reactions in both erythrocytes and parasites is lethal to cultured P. falciparum. We observed that high concentrations of adenosine can rescue cultured parasites from purine nucleoside phosphorylase and adenosine deaminase blockade but not when erythrocyte adenosine kinase is also inhibited. P. falciparum lacks adenosine kinase but can salvage AMP synthesized in the erythrocyte cytoplasm to provide purines when both human and Plasmodium purine nucleoside phosphorylases and adenosine deaminases are inhibited. Transport studies in Xenopus laevis oocytes expressing the P. falciparum nucleoside transporter PfNT1 established that this transporter does not transport AMP. These metabolic patterns establish the existence of a novel nucleoside monophosphate transport pathway in P. falciparum. PMID:18799466

  15. DNA-specific labelling by deoxyribonucleoside 5'-monophosphates in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Brendel, M.; Faeth, W.W.; Toper, R.

    1975-01-01

    Growth of 5'-dTMP low-requiring strains is inhibited by exogenous 5'-dGMP and 5'-GMP at concentrations higher than 5 x 10 -4 M. Synthesis of nucleic acids ceases and cells remain fixed in their respective place in the cell cycle. At concentrations lower than 10 -5 M deoxyribonucleoside 5'-monophosphates may be employed for radioactive labelling, the label being preferentially used for DNA synthesis. Affinity to DNA of the 5'-dNMPs is in the order of 5'-dAMPS > 5'-dGMP > 5'-dCMP > 5'-dUMP. DNA-specific label is achieved with 5'-dAMP when the medium is supplemented with adenine and deoxyadenosine. (orig.) [de

  16. Diphtheria toxin can simultaneously bind to its receptor and adenylyl-(3',5')-uridine 3'-monophosphate

    International Nuclear Information System (INIS)

    Barbieri, J.T.; Collins, C.M.; Collier, R.J.

    1986-01-01

    Diphtheria toxin (DT) that was bound to receptors on BS-C-1 cells was able to bind approximately 1 molar equiv of adenylyl-(3',5')-uridine 3'-monophosphate (ApUp). In contrast, receptor-bound CRM197, a mutant form of toxin with greatly diminished affinity for dinucleotides, did not bind ApUp. Affinity of the dinucleotide for receptor-bound toxin differed from that for free toxin by less than an order of magnitude. These results indicate that the receptor site and the ApUp site on the toxin do not significantly overlap. BS-C-1 cells were incubated with or without 125 I-DT or CRM 197. They were then incubated with [ 32 P]ApUp, and assayed

  17. Enhancement of radioprotective effectiveness of adenosine monophosphate by magnesium aspartate in mice

    International Nuclear Information System (INIS)

    Pospisil, M.; Netikova, J.; Kozubik, A.; Chertkov, K.S.; Ministry of Health, Moscow

    1988-01-01

    The enhancing effect of magnesium aspartate on the radioprotective effectiveness of adenosine monophosphate (AMP) administered to whole-body gamma-irradiated mice was studied. Male (CBA x C57BL/10)F 1 hybrid mice of a mean body weight of 32 g were used. 5 mg AMP per mouse was injected i.p. 15 min before and 15 min after irradiation; magnesium aspartate (13.3 mg per mouse) was administered s.c. 35 min before irradiation. The benefical effect of the drug combination used was manifested when investigating hematological indices at the recovery phase of sublethally irradiated animals, as well as when observing the survival of lethally irradiated mice. The synergistic radioprotective effects of AMP and magnesium aspartate are explained by the stimulatory action of both these compounds on the cell adenylate cyclase system. (author)

  18. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  19. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  1. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  2. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  3. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  4. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  5. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  6. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  7. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  9. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  10. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  11. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  12. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  13. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  14. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  15. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  16. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  18. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  19. Interaction of renin-angiotensin system and adenosine monophosphate-activated protein kinase signaling pathway in renal carcinogenesis of uninephrectomized rats.

    Science.gov (United States)

    Yang, Ke-Ke; Sui, Yi; Zhou, Hui-Rong; Zhao, Hai-Lu

    2017-05-01

    Renin-angiotensin system and adenosine monophosphate-activated protein kinase signaling pathway both play important roles in carcinogenesis, but the interplay of renin-angiotensin system and adenosine monophosphate-activated protein kinase in carcinogenesis is not clear. In this study, we researched the interaction of renin-angiotensin system and adenosine monophosphate-activated protein kinase in renal carcinogenesis of uninephrectomized rats. A total of 96 rats were stratified into four groups: sham, uninephrectomized, and uninephrectomized treated with angiotensin-converting enzyme inhibitor or angiotensin receptor blocker. Renal adenosine monophosphate-activated protein kinase and its downstream molecule acetyl coenzyme A carboxylase were detected by immunohistochemistry and western blot at 10 months after uninephrectomy. Meanwhile, we examined renal carcinogenesis by histological transformation and expressions of Ki67 and mutant p53. During the study, fasting lipid profiles were detected dynamically at 3, 6, 8, and 10 months. The results indicated that adenosine monophosphate-activated protein kinase expression in uninephrectomized rats showed 36.8% reduction by immunohistochemistry and 89.73% reduction by western blot. Inversely, acetyl coenzyme A carboxylase expression increased 83.3% and 19.07% in parallel to hyperlipidemia at 6, 8, and 10 months. The histopathology of carcinogenesis in remnant kidneys was manifested by atypical proliferation and carcinoma in situ, as well as increased expressions of Ki67 and mutant p53. Intervention with angiotensin-converting enzyme inhibitor or angiotensin receptor blocker significantly prevented the inhibition of adenosine monophosphate-activated protein kinase signaling pathway and renal carcinogenesis in uninephrectomized rats. In conclusion, the novel findings suggest that uninephrectomy-induced disturbance in adenosine monophosphate-activated protein kinase signaling pathway resulted in hyperlipidemia and

  20. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  1. Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

    International Nuclear Information System (INIS)

    Krungkrai, Sudaratana R.; Tokuoka, Keiji; Kusakari, Yukiko; Inoue, Tsuyoshi; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Mori, Yusuke; Kai, Yasushi; Krungkrai, Jerapan; Horii, Toshihiro

    2006-01-01

    Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V M = 2.3 Å 3 Da −1 )

  2. Adenosine Monophosphate Binding Stabilizes the KTN Domain of the Shewanella denitrificans Kef Potassium Efflux System.

    Science.gov (United States)

    Pliotas, Christos; Grayer, Samuel C; Ekkerman, Silvia; Chan, Anthony K N; Healy, Jess; Marius, Phedra; Bartlett, Wendy; Khan, Amjad; Cortopassi, Wilian A; Chandler, Shane A; Rasmussen, Tim; Benesch, Justin L P; Paton, Robert S; Claridge, Timothy D W; Miller, Samantha; Booth, Ian R; Naismith, James H; Conway, Stuart J

    2017-08-15

    Ligand binding is one of the most fundamental properties of proteins. Ligand functions fall into three basic types: substrates, regulatory molecules, and cofactors essential to protein stability, reactivity, or enzyme-substrate complex formation. The regulation of potassium ion movement in bacteria is predominantly under the control of regulatory ligands that gate the relevant channels and transporters, which possess subunits or domains that contain Rossmann folds (RFs). Here we demonstrate that adenosine monophosphate (AMP) is bound to both RFs of the dimeric bacterial Kef potassium efflux system (Kef), where it plays a structural role. We conclude that AMP binds with high affinity, ensuring that the site is fully occupied at all times in the cell. Loss of the ability to bind AMP, we demonstrate, causes protein, and likely dimer, instability and consequent loss of function. Kef system function is regulated via the reversible binding of comparatively low-affinity glutathione-based ligands at the interface between the dimer subunits. We propose this interfacial binding site is itself stabilized, at least in part, by AMP binding.

  3. The clinical correlation of regulatory T cells and cyclic adenosine monophosphate in enterovirus 71 infection.

    Directory of Open Access Journals (Sweden)

    Shih-Min Wang

    Full Text Available Brainstem encephalitis (BE and pulmonary edema (PE are notable complications of enterovirus 71 (EV71 infection.This study investigated the immunoregulatory characterizations of EV71 neurological complications by disease severity and milrinone treatment.Patients <18 years with virologically confirmed EV71 infections were enrolled and divided into 2 groups: the hand, foot, and mouth disease (HFMD or BE group, and the autonomic nervous system (ANS dysregulation or PE group. Cytokine and cyclic adenosine monophosphate (cAMP levels, and the regulatory T cell (Tregs profiles of the patients were determined.Patients with ANS dysregulation or PE exhibited significantly low frequency of CD4(+CD25(+Foxp3+ and CD4(+Foxp3(+ T cells compared with patients with HFMD or BE. The expression frequency of CD4-CD8- was also significantly decreased in patients with ANS dysregulation or PE. Among patients with ANS dysregulation or PE, the expression frequency of CD4+Foxp3+ increased markedly after milrinone treatment, and was associated with reduction of plasma levels IL-6, IL-8 and IL-10. Plasma concentrations of cAMP were significantly decreased in patients with ANS dysregulation or PE compared with patients with HFMD or BE; however, cAMP levels increased after milrinone treatment.These findings suggested decreased different regulatory T populations and cAMP expression correlate with increased EV71 disease severity. Improved outcome after milrinone treatment may associate with increased regulatory T populations, cAMP expression and modulation of cytokines levels.

  4. Identification of the orotidine-5'-monophosphate decarboxylase gene of the oleaginous yeast Rhodosporidium toruloides.

    Science.gov (United States)

    Yang, Fan; Zhang, Sufang; Tang, Wei; Zhao, Zongbao K

    2008-09-01

    Oleaginous yeast Rhodosporidium toruloides is an excellent microbial lipid producer of great industrial potential, yet there is no effective genetic tool for rationally engineering this microorganism. To develop a marker recycling system, the orotidine-5'-monophosphate (OMP) decarboxylase gene of R. toruloides (RtURA3) was isolated using methods of degenerate polymerase chain reaction (PCR) together with rapid amplification of cDNA ends. The results showed that RtURA3 contains four extrons and three introns, and that the encoded polypeptide holds a sequence of 279 amino acid residues with significant homology to those of OMP decarboxylases from other yeasts. A shuttle vector pYES2/CT-RtURA3 was constructed via site-specific insertion of RtURA3 into the commercial vector pYES2/CT. Transformation of the shuttle vector into Saccharomyces cerevisiae BY4741, a URA3-deficient yeast strain, ensured the viability of the strain on synthetic dextrose agar plate without uracil, suggesting that the isolated RtURA3 was functionally equivalent to the URA3 gene from S. cerevisiae.

  5. Inosine-5'-monophosphate is a candidate agent to resolve rigor mortis of skeletal muscle.

    Science.gov (United States)

    Matsuishi, Masanori; Tsuji, Mariko; Yamaguchi, Megumi; Kitamura, Natsumi; Tanaka, Sachi; Nakamura, Yukinobu; Okitani, Akihiro

    2016-11-01

    The object of the present study was to reveal the action of inosine-5'-monophosphate (IMP) toward myofibrils in postmortem muscles. IMP solubilized isolated actomyosin within a narrow range of KCl concentration, 0.19-0.20 mol/L, because of the dissociation of actomyosin into actin and myosin, but it did not solubilize the proteins in myofibrils with 0.2 mol/L KCl. However, IMP could solubilize both proteins in myofibrils with 0.2 mol/L KCl in the presence of 1 m mol/L pyrophosphate or 1.0-3.3 m mol/L adenosine-5'-diphosphate (ADP). Thus, we presumed that pyrophosphate and ADP released thin filaments composed of actin, and thick filaments composed of myosin from restraints of myofibrils, and then both filaments were solubilized through the IMP-induced dissociation of actomyosin. Thus, we concluded that IMP is a candidate agent to resolve rigor mortis because of its ability to break the association between thick and thin filaments. © 2016 Japanese Society of Animal Science.

  6. A Mixed-Valent Molybdenum Monophosphate with a Layer Structure: KMo 3P 2O 14

    Science.gov (United States)

    Guesdon, A.; Borel, M. M.; Leclaire, A.; Grandin, A.; Raveau, B.

    1994-03-01

    A new mixed-valent molybdenum monophosphate with a layer structure KMo 3P 2O 14 has been isolated. It crystallizes in the space group P2 1/ m with a = 8.599(2) Å, b = 6.392(2) Å, c = 10.602(1) Å, and β = 111.65(2)°. The layers [Mo 3P 2O 14] ∞ are parallel to (100) and consist of [MoPO 8] ∞ chains running along limitb→ , in which one MoO 6 octahedron alternates with one PO 4 tetrahedron. In fact, four [MoPO 8] ∞ chains share the corners of their polyhedra and the edges of their octahedra, forming [Mo 4P 4O 24] ∞ columns which are linked through MoO 5 bipyramids along limitc→. The K + ions interleaved between these layers are surrounded by eight oxygens, forming bicapped trigonal prisms KO 8. Besides the unusual trigonal bipyramids MoO 5, this structure is also characterized by a tendency to the localization of the electrons, since one octahedral site is occupied by Mo(V), whereas the other octahedral site and the trigonal bipyramid are occupied by Mo(VI). The similarity of this structure with pure octahedral layer structures suggests the possibility of generating various derivatives, and of ion exchange properties.

  7. Controlled supramolecular structure of guanosine monophosphate in the interlayer space of layered double hydroxide

    Directory of Open Access Journals (Sweden)

    Gyeong-Hyeon Gwak

    2016-12-01

    Full Text Available Guanosine monophosphates (GMPs were intercalated into the interlayer space of layered double hydroxides (LDHs and the molecular arrangement of GMP was controlled in LDHs. The intercalation conditions such as GMP/LDH molar ratio and reaction temperature were systematically adjusted. When the GMP/LDH molar ratio was 1:2, which corresponds to the charge balance between positive LDH sheets and GMP anions, GMP molecules were well-intercalated to LDH. At high temperature (100 and 80 °C, a single GMP molecule existed separately in the LDH interlayer. On the other hand, at lower temperature (20, 40 and 60 °C, GMPs tended to form ribbon-type supramolecular assemblies. Differential scanning calorimetry showed that the ribbon-type GMP assembly had an intermolecular interaction energy of ≈101 kJ/mol, which corresponds to a double hydrogen bond between guanosine molecules. Once stabilized, the interlayer GMP orientations, single molecular and ribbon phase, were successfully converted to the other phase by adjusting the external environment by stoichiometry or temperature control.

  8. Uridine 5'-Monophosphate Synthase Is Transcriptionally Regulated by Pyrimidine Levels in Nicotiana plumbaginifolia

    Science.gov (United States)

    Santoso; Thornburg

    1998-02-01

    To understand the regulation and expression of pyrimidine biosynthesis in plants, we have examined the effect of the metabolic inhibitor 5-fluoroorotic acid (FOA) on uridine-5'-monophosphate synthase (UMPSase) expression in cell cultures of Nicotiana plumbaginifolia. UMPSase is the rate-limiting step of pyrimidine biosynthesis in plants. Addition of FOA causes an up-regulation of UMPSase enzyme activity in cell cultures after a lag phase of several days. Western-blot analysis demonstrated that the up-regulation in enzyme activity was caused by increased expression of the UMPSase protein. Northern-blot analysis demonstrated a higher level of UMPSase mRNA in the FOA-induced tissues than in control tissues. Run-on transcriptional assays showed that the UMPSase gene was transcriptionally activated after FOA treatment. The mechanism of toxicity of FOA is through thymine starvation. We found that addition of thymine abrogated the FOA-mediated up-regulation of UMPSase. In addition, methotrexate and aminopterin, which affect thymine levels by inhibiting dihydrofolate reductase, also up-regulate UMPSase in N. plumbaginifolia cells.

  9. Uridine 5′-Monophosphate Synthase Is Transcriptionally Regulated by Pyrimidine Levels in Nicotiana plumbaginifolia1

    Science.gov (United States)

    Santoso, Djoko; Thornburg, Robert

    1998-01-01

    To understand the regulation and expression of pyrimidine biosynthesis in plants, we have examined the effect of the metabolic inhibitor 5-fluoroorotic acid (FOA) on uridine-5′-monophosphate synthase (UMPSase) expression in cell cultures of Nicotiana plumbaginifolia. UMPSase is the rate-limiting step of pyrimidine biosynthesis in plants. Addition of FOA causes an up-regulation of UMPSase enzyme activity in cell cultures after a lag phase of several days. Western-blot analysis demonstrated that the up-regulation in enzyme activity was caused by increased expression of the UMPSase protein. Northern-blot analysis demonstrated a higher level of UMPSase mRNA in the FOA-induced tissues than in control tissues. Run-on transcriptional assays showed that the UMPSase gene was transcriptionally activated after FOA treatment. The mechanism of toxicity of FOA is through thymine starvation. We found that addition of thymine abrogated the FOA-mediated up-regulation of UMPSase. In addition, methotrexate and aminopterin, which affect thymine levels by inhibiting dihydrofolate reductase, also up-regulate UMPSase in N. plumbaginifolia cells. PMID:9490773

  10. Hit discovery of Mycobacterium tuberculosis inosine 5'-monophosphate dehydrogenase, GuaB2, inhibitors.

    Science.gov (United States)

    Sahu, Niteshkumar U; Singh, Vinayak; Ferraris, Davide M; Rizzi, Menico; Kharkar, Prashant S

    2018-04-18

    Tuberculosis remains a global concern. There is an urgent need of newer antitubercular drugs due to the development of resistant forms of Mycobacterium tuberculosis (Mtb). Inosine 5'-monophosphate dehydrogenase (IMPDH), guaB2, of Mtb, required for guanine nucleotide biosynthesis, is an attractive target for drug development. In this study, we screened a focused library of 73 drug-like molecules with desirable calculated/predicted physicochemical properties, for growth inhibitory activity against drug-sensitive MtbH37Rv. The eight hits and mycophenolic acid, a prototype IMPDH inhibitor, were further evaluated for activity on purified Mtb-GuaB2 enzyme, target selectivity using a conditional knockdown mutant of guaB2 in Mtb, followed by cross-resistance to IMPDH inhibitor-resistant SRMV2.6 strain of Mtb, and activity on human IMPDH2 isoform. One of the hits, 13, a 5-amidophthalide derivative, has shown growth inhibitory potential and target specificity against the Mtb-GuaB2 enzyme. The hit, 13, is a promising molecule with potential for further development as an antitubercular agent. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Cyclic 3',5'-adenosine monophosphate (cAMP) signaling in the anterior pituitary gland in health and disease.

    Science.gov (United States)

    Hernández-Ramírez, Laura C; Trivellin, Giampaolo; Stratakis, Constantine A

    2018-03-05

    The cyclic 3',5'-adenosine monophosphate (cAMP) was the first among the so-called "second messengers" to be described. It is conserved in most organisms and functions as a signal transducer by mediating the intracellular effects of multiple hormones and neurotransmitters. In this review, we first delineate how different members of the cAMP pathway ensure its correct compartmentalization and activity, mediate the terminal intracellular effects, and allow the crosstalk with other signaling pathways. We then focus on the pituitary gland, where cAMP exerts a crucial function by controlling the responsiveness of the cells to hypothalamic hormones, neurotransmitters and peripheral factors. We discuss the most relevant physiological functions mediated by cAMP in the different pituitary cell types, and summarize the defects affecting this pathway that have been reported in the literature. We finally discuss how a deregulated cAMP pathway is involved in the pathogenesis of pituitary disorders and how it affects the response to therapy. Copyright © 2017. Published by Elsevier B.V.

  12. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  13. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  14. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  15. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  16. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  17. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  18. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  19. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  20. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  1. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  2. Uridine monophosphate synthetase enables eukaryotic de novo NAD+ biosynthesis from quinolinic acid.

    Science.gov (United States)

    McReynolds, Melanie R; Wang, Wenqing; Holleran, Lauren M; Hanna-Rose, Wendy

    2017-07-07

    NAD + biosynthesis is an attractive and promising therapeutic target for influencing health span and obesity-related phenotypes as well as tumor growth. Full and effective use of this target for therapeutic benefit requires a complete understanding of NAD + biosynthetic pathways. Here, we report a previously unrecognized role for a conserved phosphoribosyltransferase in NAD + biosynthesis. Because a required quinolinic acid phosphoribosyltransferase (QPRTase) is not encoded in its genome, Caenorhabditis elegans are reported to lack a de novo NAD + biosynthetic pathway. However, all the genes of the kynurenine pathway required for quinolinic acid (QA) production from tryptophan are present. Thus, we investigated the presence of de novo NAD + biosynthesis in this organism. By combining isotope-tracing and genetic experiments, we have demonstrated the presence of an intact de novo biosynthesis pathway for NAD + from tryptophan via QA, highlighting the functional conservation of this important biosynthetic activity. Supplementation with kynurenine pathway intermediates also boosted NAD + levels and partially reversed NAD + -dependent phenotypes caused by mutation of pnc-1 , which encodes a nicotinamidase required for NAD + salvage biosynthesis, demonstrating contribution of de novo synthesis to NAD + homeostasis. By investigating candidate phosphoribosyltransferase genes in the genome, we determined that the conserved uridine monophosphate phosphoribosyltransferase (UMPS), which acts in pyrimidine biosynthesis, is required for NAD + biosynthesis in place of the missing QPRTase. We suggest that similar underground metabolic activity of UMPS may function in other organisms. This mechanism for NAD + biosynthesis creates novel possibilities for manipulating NAD + biosynthetic pathways, which is key for the future of therapeutics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Novel adenosine 3',5'-cyclic monophosphate dependent protein kinases in a marine diatom

    International Nuclear Information System (INIS)

    Lin, P.P.C.; Volcani, B.E.

    1989-01-01

    Two novel adenosine 3',5'-cyclic monophosphate (cAMP) dependent protein kinases have been isolated from the diatom Cylindrotheca fusiformis. The kinases, designated I and II, are eluted from DEAE-Sephacel at 0.10 and 0.15 M NaCl. They have a high affinity for cAMP and are activated by micromolar cAMP. They exhibit maximal activity at 5 mM Mg 2+ and pH 8 with the preferred phosphate donor ATP and phosphate acceptor histone H1. They phosphorylate sea urchin sperm histone H1 on a single serine site in the sequence Arg-Lys-Gly-Ser( 32 P)-Ser-Asn-Ala-Arg and have an apparent M r of 75,000 as determined by gel filtration and sucrose density sedimentation. In the kinase I preparation a single protein band with an apparent M r of about 78,000 is photolabeled with 8-azido[ 32 P]cAMP and is also phosphorylated with [γ- 32 P]ATP in a cAMP-dependent manner, after autoradiography following sodium dodecyl sulfate gel electrophoresis. The rate of phosphorylation of the 78,000-dalton band is independent of the enzyme concentration. The results indicate that (i) these diatom cAMP-dependent protein kinases are monomeric proteins, possessing both the cAMP-binding regulatory and catalytic domains on the same polypeptide chain, (ii) the enzymes do not dissociate into smaller species upon activation by binding cAMP, and (iii) self-phosphorylation of the enzymes by an intrapeptide reaction is cAMP dependent. The two diatom cAMP kinases are refractory to the heat-stable protein kinase modulator from rabbit muscle, but they respond differently to proteolytic degradation and to inhibition by arachidonic acid and several microbial alkaloids

  4. Enzyme architecture: deconstruction of the enzyme-activating phosphodianion interactions of orotidine 5'-monophosphate decarboxylase.

    Science.gov (United States)

    Goldman, Lawrence M; Amyes, Tina L; Goryanova, Bogdana; Gerlt, John A; Richard, John P

    2014-07-16

    The mechanism for activation of orotidine 5'-monophosphate decarboxylase (OMPDC) by interactions of side chains from Gln215 and Try217 at a gripper loop and R235, adjacent to this loop, with the phosphodianion of OMP was probed by determining the kinetic parameters k(cat) and K(m) for all combinations of single, double, and triple Q215A, Y217F, and R235A mutations. The 12 kcal/mol intrinsic binding energy of the phosphodianion is shown to be equal to the sum of the binding energies of the side chains of R235 (6 kcal/mol), Q215 (2 kcal/mol), Y217 (2 kcal/mol), and hydrogen bonds to the G234 and R235 backbone amides (2 kcal/mol). Analysis of a triple mutant cube shows small (ca. 1 kcal/mol) interactions between phosphodianion gripper side chains, which are consistent with steric crowding of the side chains around the phosphodianion at wild-type OMPDC. These mutations result in the same change in the activation barrier to the OMPDC-catalyzed reactions of the whole substrate OMP and the substrate pieces (1-β-D-erythrofuranosyl)orotic acid (EO) and phosphite dianion. This shows that the transition states for these reactions are stabilized by similar interactions with the protein catalyst. The 12 kcal/mol intrinsic phosphodianion binding energy of OMP is divided between the 8 kcal/mol of binding energy, which is utilized to drive a thermodynamically unfavorable conformational change of the free enzyme, resulting in an increase in (k(cat))(obs) for OMPDC-catalyzed decarboxylation of OMP, and the 4 kcal/mol of binding energy, which is utilized to stabilize the Michaelis complex, resulting in a decrease in (K(m))(obs).

  5. Effects of octacosanol extracted from rice bran on blood hormone levels and gene expressions of glucose transporter protein-4 and adenosine monophosphate protein kinase in weaning piglets

    Directory of Open Access Journals (Sweden)

    Lei Long

    2015-12-01

    Full Text Available The object of this study was to explore the regulatory mechanism of octacosanol to the body of animals and the effects of octacosanol on blood hormone levels and gene expressions of glucose transporter protein (GLUT-4 and adenosine monophosphate protein kinase (AMPK in liver and muscle tissue of weaning piglets. A total of 105 crossbred piglets ([Yorkshire × Landrace] × Duroc with an initial BW of 5.70 ± 1.41 kg (21 d of age were used in a 6-wk trial to evaluate the effects of octacosanol and tiamulin supplementation on contents of triiodothyronine (T3, thyroxine (T4, growth hormone (GH, glucagon (GU and adrenaline (AD in blood and gene expressions of GLUT-4 and AMPK in liver and muscle. Piglets were randomly distributed into 3 dietary treatments on the basis of BW and sex. Each treatment had 7 replicate pens with 5 piglets per pen. Treatments were as followed: control group, tiamulin group and octacosanol group. The results showed that compared with control group and tiamulin group, octacosanol greatly promoted the secretion of T3, GH, GU and AD (P  0.05. Results of the present study has confirmed that octacosanol affects energy metabolism of body by regulating secretion of blood hormones and related gene expression in tissue of weaning piglets, which can reduce stress response and has an impact on performance.

  6. Adenosine monophosphate is elevated in the bronchoalveolar lavage fluid of mice with acute respiratory toxicity induced by nanoparticles with high surface hydrophobicity.

    Science.gov (United States)

    Dailey, Lea Ann; Hernández-Prieto, Raquel; Casas-Ferreira, Ana Maria; Jones, Marie-Christine; Riffo-Vasquez, Yanira; Rodríguez-Gonzalo, Encarnación; Spina, Domenico; Jones, Stuart A; Smith, Norman W; Forbes, Ben; Page, Clive; Legido-Quigley, Cristina

    2015-02-01

    Inhaled nanomaterials present a challenge to traditional methods and understanding of respiratory toxicology. In this study, a non-targeted metabolomics approach was used to investigate relationships between nanoparticle hydrophobicity, inflammatory outcomes and the metabolic fingerprint in bronchoalveolar fluid. Measures of acute lung toxicity were assessed following single-dose intratracheal administration of nanoparticles with varying surface hydrophobicity (i.e. pegylated lipid nanocapsules, polyvinyl acetate nanoparticles and polystyrene beads; listed in order of increasing hydrophobicity). Broncho-alveolar lavage (BAL) fluid was collected from mice exposed to nanoparticles at a surface area dose of 220 cm(2) and metabolite fingerprints were acquired via ultra pressure liquid chromatography-mass spectrometry-based metabolomics. Particles with high surface hydrophobicity were pro-inflammatory. Multivariate analysis of the resultant small molecule fingerprints revealed clear discrimination between the vehicle control and polystyrene beads (p < 0.05), as well as between nanoparticles of different surface hydrophobicity (p < 0.0001). Further investigation of the metabolic fingerprints revealed that adenosine monophosphate (AMP) concentration in BAL correlated with neutrophilia (p < 0.01), CXCL1 levels (p < 0.05) and nanoparticle surface hydrophobicity (p < 0.001). Our results suggest that extracellular AMP is an intermediary metabolite involved in adenine nucleotide-regulated neutrophilic inflammation as well as tissue damage, and could potentially be used to monitor nanoparticle-induced responses in the lung following pulmonary administration.

  7. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  8. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  9. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  10. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  11. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  12. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  13. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  14. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  15. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  16. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  17. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  18. Further studies on the effect of adenosine cyclic monophosphate derivatives on cell proliferation in the jejunal crypts of rat.

    Science.gov (United States)

    Tutton, P J; Barkla, D H

    1982-01-01

    1. Cell proliferation in the jejunal crypt epithelium of rat was measured using a stathmokinetic technique. 2. Sodium butyrate was found to promote jejunal crypt cell proliferation. 3. N6, O2'-Dibutyryl cyclic adenosine monophosphate (cAMP), N6-monobutyryl-cAMP and N6-monobutyryl-8-bromo-cAMP were found to inhibit cell proliferation when compared to sodium butyrate treated tissues. 4. 8-Chlorophenylthio-cAMP was found to inhibit cell division when compared to untreated animals. 5. O2'-Monobutyryl cAMP and 8-bromo-cAMP were not found to inhibit cell proliferation.

  19. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  20. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  1. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  2. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  3. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  4. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  5. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  6. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Directory of Open Access Journals (Sweden)

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  7. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  8. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  9. The effect of adenosine 5'-monophosphate (AMP) on tenderness, microstructure and chemical-physical index of duck breast meat.

    Science.gov (United States)

    Wang, Daoying; Deng, Shaoying; Zhang, Muhan; Geng, Zhiming; Sun, Chong; Bian, Huan; Xu, Weimin; Zhu, Yongzhi; Liu, Fang; Wu, Haihong

    2016-03-30

    Adenosine 5'-monophosphate (AMP) is often used in meat and poultry soups as a flavor enhancer (flavor modifier), or as food additives for specific nutritional purposes. Our previous research as well as evidence from others showed that actomyosin could be dissociated into myosin and actin by AMP in extracted muscle solution. However, there is no report available on the application of AMP to dissociate actomyosin and to improve meat tenderness. The objectives of this study were to evaluate the effect of AMP on duck meat tenderness and other quality traits and to explore the mechanism of the action of AMP on meat tenderness. Duck breast muscle was treated with 0, 10, 20, 30, 40 mmol L(-1) AMP at 5 °C for 10 h and examined for shear force, microstructure, actomyosin dissociation, myofibril fragmentation index (MFI), pH, water content, cooking loss, CIE* color (L*, a*, b*), inosine monophosphate (IMP) and free amino acid (FAA) contents. Results showed that shear force, cooking loss, L* and b* of the muscles significantly decreased after AMP treatment (P 0.05), and muscle shrinkage in transverse and longitudinal directions were restrained after AMP treatment. The results suggest that AMP could notably improve meat tenderness, and this effect was probably mainly through increasing muscle pH, promoting actomyosin dissociation and disrupting the Z-line; meanwhile, the conversion of AMP to IMP may contribute to the flavor of meat. © 2015 Society of Chemical Industry.

  10. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  11. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    OpenAIRE

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  12. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Directory of Open Access Journals (Sweden)

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  13. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    International Nuclear Information System (INIS)

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  14. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Directory of Open Access Journals (Sweden)

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  15. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Science.gov (United States)

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  16. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  17. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Science.gov (United States)

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  18. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  19. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Science.gov (United States)

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  20. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  1. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  2. Galvanic element. Galvanisches Element

    Energy Technology Data Exchange (ETDEWEB)

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  3. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  4. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  5. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  6. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Energy Technology Data Exchange (ETDEWEB)

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  7. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    International Nuclear Information System (INIS)

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  8. Cows are not mice: the role of cyclic AMP, phosphodiesterases, and adenosine monophosphate-activated protein kinase in the maintenance of meiotic arrest in bovine oocytes.

    Science.gov (United States)

    Bilodeau-Goeseels, Sylvie

    2011-01-01

    Meiotic maturation in mammalian oocytes is initiated during fetal development, and is then arrested at the dictyate stage - possibly for several years. Oocyte meiosis resumes in preovulatory follicles in response to the lutenizing hormone (LH) surge or spontaneously when competent oocytes are removed from follicles and cultured. The mechanisms involved in meiotic arrest and resumption in bovine oocytes are not fully understood, and several studies point to important differences between oocytes from rodent and livestock species. This paper reviews earlier and contemporary studies on the effects of cAMP-elevating agents and phosphodiesterase (PDE) enzyme inhibitors on the maintenance of meiotic arrest in bovine oocytes in vitro. Contrary to results obtained with mouse oocytes, bovine oocyte meiosis is inhibited by activators of the energy sensor adenosine monophosphate-activated protein kinase (AMPK, mammalian gene PRKA), which is activated by AMP, the degradation product of cAMP. It is not clear whether or not the effects were due to AMPK activation, and they may depend on culture conditions. Evidence suggests that other signaling pathways (for example, the cGMP/nitric oxide pathway) are involved in bovine oocyte meiotic arrest, but further studies are needed to understand the interactions between the signaling pathways that lead to maturation promoting factor (MPF) being inactive or active. An improved understanding of the mechanisms involved in the control of bovine oocyte meiosis will facilitate better control of the process in vitro, resulting in increased developmental competence and increased efficiency of in vitro embryo production procedures. Copyright © 2011 Wiley Periodicals, Inc.

  9. The potent, indirect adenosine monophosphate-activated protein kinase activator R419 attenuates mitogen-activated protein kinase signaling, inhibits nociceptor excitability, and reduces pain hypersensitivity in mice

    Directory of Open Access Journals (Sweden)

    Galo L. Mejia

    2016-07-01

    Full Text Available Abstract. There is a great need for new therapeutics for the treatment of pain. A possible avenue to development of such therapeutics is to interfere with signaling pathways engaged in peripheral nociceptors that cause these neurons to become hyperexcitable. There is strong evidence that mitogen-activated protein kinases and phosphoinositide 3-kinase (PI3K/mechanistic target of rapamycin signaling pathways are key modulators of nociceptor excitability in vitro and in vivo. Activation of adenosine monophosphate-activated protein kinase (AMPK can inhibit signaling in both of these pathways, and AMPK activators have been shown to inhibit nociceptor excitability and pain hypersensitivity in rodents. R419 is one of, if not the most potent AMPK activator described to date. We tested whether R419 activates AMPK in dorsal root ganglion (DRG neurons and if this leads to decreased pain hypersensitivity in mice. We find that R419 activates AMPK in DRG neurons resulting in decreased mitogen-activated protein kinase signaling, decreased nascent protein synthesis, and enhanced P body formation. R419 attenuates nerve growth factor (NGF-induced changes in excitability in DRG neurons and blocks NGF-induced mechanical pain amplification in vivo. Moreover, locally applied R419 attenuates pain hypersensitivity in a model of postsurgical pain and blocks the development of hyperalgesic priming in response to both NGF and incision. We conclude that R419 is a promising lead candidate compound for the development of potent and specific AMPK activation to inhibit pain hypersensitivity as a result of injury.

  10. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Science.gov (United States)

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Crystallization and preliminary X-ray crystallographic analysis of adenosine 5′-monophosphate deaminase (AMPD) from Arabidopsis thaliana in complex with coformycin 5′-phosphate

    International Nuclear Information System (INIS)

    Han, Byung Woo; Bingman, Craig A.; Mahnke, Donna K.; Sabina, Richard L.; Phillips, George N. Jr

    2005-01-01

    Adenosine 5′-monophosphate deaminase from A. thaliana has been crystallized in complex with coformycin 5′-phosphate. Diffraction data have been collected to 3.34 Å resolution. Adenosine 5′-monophosphate deaminase (AMPD) is a eukaryotic enzyme that converts adenosine 5′-monophosphate (AMP) to inosine 5′-monophosphate (IMP) and ammonia. AMPD from Arabidopsis thaliana (AtAMPD) was cloned into the baculoviral transfer vector p2Bac and co-transfected along with a modified baculoviral genome into Spodoptera frugiperda (Sf9) cells. The resulting recombinant baculovirus were plaque-purified, amplified and used to overexpress recombinant AtAMPD. Crystals of purified AtAMPD have been obtained to which coformycin 5′-phosphate, a transition-state inhibitor, is bound. Crystals belong to space group P6 2 22, with unit-cell parameters a = b = 131.325, c = 208.254 Å, α = β = 90, γ = 120°. Diffraction data were collected to 3.34 Å resolution from a crystal in complex with coformycin 5′-phosphate and to 4.05 Å resolution from a crystal of a mercury derivative

  12. Crystallization and preliminary X-ray crystallographic analysis of adenosine 5′-monophosphate deaminase (AMPD) from Arabidopsis thaliana in complex with coformycin 5′-phosphate

    Energy Technology Data Exchange (ETDEWEB)

    Han, Byung Woo [Department of Biochemistry, University of Wisconsin-Madison, WI 53706-1544 (United States); Center for Eukaryotic Structural Genomics (CESG), University of Wisconsin-Madison, WI 53706-1549 (United States); Bingman, Craig A. [Center for Eukaryotic Structural Genomics (CESG), University of Wisconsin-Madison, WI 53706-1549 (United States); Mahnke, Donna K.; Sabina, Richard L. [Department of Biochemistry, The Medical College of Wisconsin, Milwaukee, WI 53226-4801 (United States); Phillips, George N. Jr, E-mail: phillips@biochem.wisc.edu [Department of Biochemistry, University of Wisconsin-Madison, WI 53706-1544 (United States); Center for Eukaryotic Structural Genomics (CESG), University of Wisconsin-Madison, WI 53706-1549 (United States)

    2005-08-01

    Adenosine 5′-monophosphate deaminase from A. thaliana has been crystallized in complex with coformycin 5′-phosphate. Diffraction data have been collected to 3.34 Å resolution. Adenosine 5′-monophosphate deaminase (AMPD) is a eukaryotic enzyme that converts adenosine 5′-monophosphate (AMP) to inosine 5′-monophosphate (IMP) and ammonia. AMPD from Arabidopsis thaliana (AtAMPD) was cloned into the baculoviral transfer vector p2Bac and co-transfected along with a modified baculoviral genome into Spodoptera frugiperda (Sf9) cells. The resulting recombinant baculovirus were plaque-purified, amplified and used to overexpress recombinant AtAMPD. Crystals of purified AtAMPD have been obtained to which coformycin 5′-phosphate, a transition-state inhibitor, is bound. Crystals belong to space group P6{sub 2}22, with unit-cell parameters a = b = 131.325, c = 208.254 Å, α = β = 90, γ = 120°. Diffraction data were collected to 3.34 Å resolution from a crystal in complex with coformycin 5′-phosphate and to 4.05 Å resolution from a crystal of a mercury derivative.

  13. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Directory of Open Access Journals (Sweden)

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  14. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  16. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  17. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  18. Regulation of Maltodextrin Phosphorylase Synthesis in Escherichia coli by Cyclic Adenosine 3′, 5′-Monophosphate and Glucose1

    Science.gov (United States)

    Chao, Julie; Weathersbee, Carolyn J.

    1974-01-01

    Cyclic adenosine 3′, 5′-monophosphate (AMP) stimulates maltodextrin phosphorylase synthesis in Escherichia coli cells induced with maltose. A maximal effect occurs at 2 to 3 mM cyclic AMP. The action of cyclic AMP is specific, inasmuch as adenosine triphosphate, 3′-AMP, 5′-AMP, adenosine, and dibutyryl cyclic AMP are inactive. Glucose, α-methyl glucoside, 2-deoxyglucose, and pyridoxal 5′-phosphate repress maltodextrin phosphorylase synthesis. This repression is reversed by cyclic AMP. The action of cyclic AMP appears to be at the transcriptional level, since cyclic AMP fails to stimulate phosphorylase production in induced cells in which messenger ribonucleic acid synthesis has been arrested by rifampin or by inducer removal. The two other enzymes involved in the metabolism of maltose, amylomaltase and maltose permease, are also induced in this strain of E. coli and affected by glucose and cyclic AMP in a manner similar to phosphorylase. PMID:4358043

  19. Stereoselective aminoacylation of a dinucleoside monophosphate by the imidazolides of DL-alanine and N-(tert-butoxycarbonyl)-DL-alanine

    Science.gov (United States)

    Profy, A. T.; Usher, D. A.

    1984-01-01

    The aminoacylation of diinosine monophosphate was studied experimentally. When the acylating agent was the imidazolide of N-(tert-butoxycarbonyl)-DL-alanine, a 40 percent enantiomeric excess of the isomer was incorporated at the 2' site and the positions of equilibrium for the reversible 2'-3' migration reaction differed for the D and L enantiomers. The reactivity of the nucleoside hydroxyl groups was found to decrease on the order 2'(3') less than internal 2' and less than 5', and the extent of the reaction was affected by the concentration of the imidazole buffer. Reaction of IpI with imidazolide of unprotected DL-alanine, by contrast, led to an excess of the D isomer at the internal 2' site. Finally, reaction with the N-carboxy anhydride of DL-alanine occurred without stereoselection. These results are found to be relevant to the study of the evolution of optical chemical activity and the origin of genetically directed protein synthesis.

  20. Brain-natriuretic peptide and cyclic guanosine monophosphate as biomarkers of myxomatous mitral valve disease in dogs

    DEFF Research Database (Denmark)

    Moesgaard, Sophia Gry; Falk, Bo Torkel; Teerlink, Tom

    2011-01-01

    Elevations in the plasma concentrations of natriuretic peptides correlate with increased severity of myxomatous mitral valve disease (MMVD) in dogs. This study correlates the severity of MMVD with the plasma concentrations of the biomarkers N-terminal fragment of the pro-brain-natriuretic peptide...... (NT-proBNP) and its second messenger, cyclic guanosine monophosphate (cGMP). Furthermore, the l-arginine:asymmetric dimethylarginine (ADMA) ratio was measured as an index of nitric oxide availability. The study included 75 dogs sub-divided into five groups based on severity of MMVD as assessed...... by clinical examination and echocardiography. Plasma NT-proBNP and cGMP concentrations increased with increasing valve dysfunction and were significantly elevated in dogs with heart failure. The cGMP:NT-proBNP ratio decreased significantly in dogs with heart failure, suggesting the development of natriuretic...

  1. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Science.gov (United States)

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  2. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Science.gov (United States)

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  3. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    Directory of Open Access Journals (Sweden)

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  4. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  5. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Science.gov (United States)

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  7. Molecular cloning and preliminary function study of iron responsive element binding protein 1 gene from cypermethrin-resistant Culex pipiens pallens

    Directory of Open Access Journals (Sweden)

    Tan Wenbin

    2011-11-01

    Full Text Available Abstract Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP. Method RT-PCR and RACE (rapid amplification of cDNA end were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1 has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain. Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens.

  8. Transplutonium elements

    Energy Technology Data Exchange (ETDEWEB)

    Sivaramakrishnan, C. K.; Jadhav, A. V.; Reghuraman, K.; Mathew, K. A.; Nair, P. S.; Ramaniah, M. V.

    1973-07-01

    Research progress is reported on studies of the transplutonium elements including recovery and purification of americium, preparation of /sup 238/Pu, extraction studies using diethylhexyl phosphate. (DHM)

  9. Role of an ER stress response element in regulating the bidirectional promoter of the mouse CRELD2 - ALG12 gene pair

    Directory of Open Access Journals (Sweden)

    Hirata Yoko

    2010-11-01

    Full Text Available Abstract Background Recently, we identified cysteine-rich with EGF-like domains 2 (CRELD2 as a novel endoplasmic reticulum (ER stress-inducible gene and characterized its transcriptional regulation by ATF6 under ER stress conditions. Interestingly, the CRELD2 and asparagine-linked glycosylation 12 homolog (ALG12 genes are arranged as a bidirectional (head-to-head gene pair and are separated by less than 400 bp. In this study, we characterized the transcriptional regulation of the mouse CRELD2 and ALG12 genes that is mediated by a common bidirectional promoter. Results This short intergenic region contains an ER stress response element (ERSE sequence and is well conserved among the human, rat and mouse genomes. Microarray analysis revealed that CRELD2 and ALG12 mRNAs were induced in Neuro2a cells by treatment with thapsigargin (Tg, an ER stress inducer, in a time-dependent manner. Other ER stress inducers, tunicamycin and brefeldin A, also increased the expression of these two mRNAs in Neuro2a cells. We then tested for the possible involvement of the ERSE motif and other regulatory sites of the intergenic region in the transcriptional regulation of the mouse CRELD2 and ALG12 genes by using variants of the bidirectional reporter construct. With regards to the promoter activities of the CRELD2-ALG12 gene pair, the entire intergenic region hardly responded to Tg, whereas the CRELD2 promoter constructs of the proximal region containing the ERSE motif showed a marked responsiveness to Tg. The same ERSE motif of ALG12 gene in the opposite direction was less responsive to Tg. The direction and the distance of this motif from each transcriptional start site, however, has no impact on the responsiveness of either gene to Tg treatment. Additionally, we found three putative sequences in the intergenic region that antagonize the ERSE-mediated transcriptional activation. Conclusions These results show that the mouse CRELD2 and ALG12 genes are arranged as a

  10. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fujikubo, M.; Yao, T.; Oida, H. [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1996-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  11. Structural response analysis of very large floating structures in waves using one-dimensional finite element model; Ichijigen yugen yoso model ni yoru choogata futai no harochu kozo oto kaiseki

    Energy Technology Data Exchange (ETDEWEB)

    Fujikubo, M; Yao, T; Oida, H [Hiroshima University, Hiroshima (Japan). Faculty of Engineering

    1997-12-31

    Formulation was made on a one-dimensional beam finite element which is effective in analyzing structural response of very large floating structures by modeling them on beams on an elastic foundation. This element allows strict solution of vibration response in the beams on the elastic foundation to be calculated efficiently for a case where mass and rigidity change in the longitudinal direction. This analysis method was used to analyze structural response of a large pontoon-type floating structure to investigate mass in the end part for the structural response and the effect of decay while passing the structure. With a pontoon-type floating structure, reduction in bends and bending stress in the end part of the floating structure is important in designing the structure. Reducing the mass in the end part is effective as a means to avoid resonance in these responses and reduce the responses. Increase in rigidity of a floating structure shifts the peak in quasi-static response to lower frequency side, and reduces response in resonance, hence it is advantageous for improving the response. Since incident waves decay while passing through the floating structure, response in the lower wave side decreases. The peak frequency in the quasi-static response also decreases at the end part of the structure in the upper wave side due to decay in wave force. 7 refs., 11 figs., 1 tab.

  12. Effects of tire inclination (turning traffic and dynamic loading on the pavement stress–strain responses using 3-D finite element modeling

    Directory of Open Access Journals (Sweden)

    Xiaodi Hu

    2017-07-01

    Full Text Available In this study, ABAQUS finite element (FE modeling in three-dimensional (3-D loading mode was utilized to analytically investigate and quantify the effects of tire inclination and dynamic loading on the stress–strain responses of a pavement structure under varying loading and environmental conditions. The input variables for modeling consisted of actual laboratory and field data obtained from an in-service highway US 59 and included the in-situ pavement structure, material properties (i.e., modulus and shear strength, traffic, and climatic (i.e., temperature data. Computational modeling and sensitivity analyses were conducted through variation of the following two input variables with a focus on the top surfacing hot-mix asphalt (HMA layer: a tire inclination angle to simulate turning traffic, and, b dynamic loading to simulate accelerating, steady rolling, and decelerating (braking traffic. The generated maximum shear stress and vertical strain responses were then analyzed and correlated to the HMA material strength and the actual measured/observed field rutting performance data. The corresponding results indicated that inclined tires (simulating turning traffic and decelerating (braking vehicles induced the most severe shear stresses and vertical strains on the pavement structure in terms of magnitude (i.e., increased; exceeding the HMA material strength in some cases. Thus, for pavement design and structural analysis purposes, the following critical highway areas that may be subjected to extreme stresses and strains due to turning and stopping (braking traffic, particularly in high temperature environments, should be given more attention with respect to material strength characterization to mitigate potential shear/rutting failures: intersections, junctions; urban stop–go sections, and curves. Keywords: 3-D FE stress–strain modeling, Rutting, Shear deformation, Shear stress, Vertical strains

  13. Regulation of cAMP Responsive Element Binding Protein 3-Like 1 (Creb3l1 Expression by Orphan Nuclear Receptor Nr4a1

    Directory of Open Access Journals (Sweden)

    Michael P. Greenwood

    2017-12-01

    Full Text Available Cyclic AMP (cAMP inducible transcription factor cAMP responsive element binding protein 3 like 1 (Creb3l1 is strongly activated in the hypothalamus in response to hyperosmotic cues such as dehydration (DH. We have recently shown that Creb3l1 expression is upregulated by cAMP pathways in vitro, however the exact mechanisms are not known. Here we show that increasing Creb3l1 transcription by raising cAMP levels in mouse pituitary AtT20 cells automatically initiates cleavage of Creb3l1, leading to a greater abundance of the transcriptionally active N-terminal portion. Inhibiting protein synthesis indicated that de novo protein synthesis of an intermediary transcription factor was required for Creb3l1 induction. Strategic mining of our microarray data from dehydrated rodent hypothalamus revealed four candidates, reduced to two by analysis of acute hyperosmotic-induced transcriptional activation profiles in the hypothalamus, and one, orphan nuclear receptor Nr4a1, by direct shRNA mediated silencing in AtT20 cells. We show that activation of Creb3l1 transcription by Nr4a1 involves interaction with a single NBRE site in the promoter region. The ability to activate Creb3l1 transcription by this pathway in vitro is dictated by the level of methylation of a CpG island within the proximal promoter/5′UTR of this gene. We thus identify a novel cAMP-Nr4a1-Creb3l1 transcriptional pathway in AtT20 cells and also, our evidence would suggest, in the hypothalamus.

  14. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    Science.gov (United States)

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  15. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    Science.gov (United States)

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  16. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE.

    Directory of Open Access Journals (Sweden)

    Amitava Basu

    Full Text Available DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  17. Efficient transfection of Xenobiotic Responsive Element-biosensor plasmid using diether lipid and phosphatidylcholine liposomes in differentiated HepaRG cells.

    Science.gov (United States)

    Demazeau, Maxime; Quesnot, Nicolas; Ripoche, Nicolas; Rauch, Claudine; Jeftić, Jelena; Morel, Fabrice; Gauffre, Fabienne; Benvegnu, Thierry; Loyer, Pascal

    2017-05-30

    In this study, we evaluated cationic liposomes prepared from diether-NH 2 and egg phosphatidylcholine (EPC) for in vitro gene delivery. The impact of the lipid composition, i.e. the EPC and Diether-NH 2 molar ratio, on in vitro transfection efficiency and cytotoxicity was investigated using the human HEK293T and hepatoma HepaRG cells known to be permissive and poorly permissive cells for liposome-mediated gene transfer, respectively. Here, we report that EPC/Diether-NH 2 -based liposomes enabled a very efficient transfection with low cytotoxicity compared to commercial transfection reagents in both HEK293T and proliferating progenitor HepaRG cells. Taking advantage of these non-toxic EPC/Diether-NH 2 -based liposomes, we developed a method to efficiently transfect differentiated hepatocyte-like HepaRG cells and a biosensor plasmid containing a Xenobiotic Responsive Element and a minimal promoter driving the transcription of the luciferase reporter gene. We demonstrated that the luciferase activity was induced by a canonical inducer of cytochrome P450 genes, the benzo[a]pyrene, and two environmental contaminants, the fluoranthene, a polycyclic aromatic hydrocarbon, and the endosulfan, an organochlorine insecticide, known to induce toxicity and genotoxicity in differentiated HepaRG cells. In conclusion, we established a new efficient lipofection-mediated gene transfer in hepatocyte-like HepaRG cells opening new perspectives in drug evaluation relying on xenobiotic inducible biosensor plasmids. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Astragalus membranaceus augment sperm parameters in male mice associated with cAMP-responsive element modulator and activator of CREM in testis

    Directory of Open Access Journals (Sweden)

    Wonnam Kim

    2016-07-01

    Full Text Available Astragalus membranaceus BUNGE (AM; 黃芪 huáng qí has been widely used as a medicinal herb for different kinds of diseases. AM treatment in vitro enhance sperm motility and ameliorates testicular toxicity, it has demonstrated the ability as a potential treatment for male infertility. In order to gain further insights on the molecular understanding of how AM enhances spermatogenesis, this study investigated whether AM has an affect on sperm parameters associated with cAMP response element modulator (CREM and activator of CREM in testis (ACT expression. Five-week-old male ICR mice were divided into four groups; control group and three different concentrations of AM treated groups. Each group was treated for 5 days a week for 5 weeks. Testis samples were collected for real time quantitative PCR and western blot analysis. Epididymis was taken out and used for sperm analysis using the computer assisted semen analysis (CASA system. To facilitate expression of genes required for spermatogenesis, it is controlled by fine-tuning of CREM and its coactivator, ACT. AM treatment promotes CREM and ACT mRNA expression and also protein expression compared to control. AM enhances sperm values such as sperm count and motility compared to control. Overall, the study highlights, the ability of AM to increases CREM and ACT expression to facilitate sperm development and semen quality.

  19. Protein kinases mediate increment of the phosphorylation of cyclic AMP -responsive element binding protein in spinal cord of rats following capsaicin injection

    Directory of Open Access Journals (Sweden)

    Li Junfa

    2005-09-01

    Full Text Available Abstract Background Strong noxious stimuli cause plastic changes in spinal nociceptive neurons. Intracellular signal transduction pathways from cellular membrane to nucleus, which may further regulate gene expression by critical transcription factors, convey peripheral stimulation. Cyclic AMP-responsive element binding protein (CREB is a well-characterized stimulus-induced transcription factor whose activation requires phosphorylation of the Serine-133 residue. Phospho-CREB can further induce gene transcription and strengthen synaptic transmission by the activation of the protein kinase cascades. However, little is known about the mechanisms by which CREB phosphorylation is regulated by protein kinases during nociception. This study was designed to use Western blot analysis to investigate the role of mitogen-activated protein (MAP/extracellular signal-regulated kinase (ERK kinase (MEK 1/2, PKA and PKC in regulating the phosphorylation of CREB in the spinal cord of rats following intraplantar capsaicin injection. Results We found that capsaicin injection significantly increased the phosphorylation level of CREB in the ipsilateral side of the spinal cord. Pharmacological manipulation of MEK 1/2, PKA and PKC with their inhibitors (U0126, H89 and NPC 15473, respectively significantly blocked this increment of CREB phosphorylation. However, the expression of CREB itself showed no change in any group. Conclusion These findings suggest that the activation of intracellular MAP kinase, PKA and PKC cascades may contribute to the regulation of phospho-CREB in central nociceptive neurons following peripheral painful stimuli.

  20. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Science.gov (United States)

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  1. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    Science.gov (United States)

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada

    2013-01-01

    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  2. Investigation on the Cyclic Response of Superelastic Shape Memory Alloy (SMA Slit Damper Devices Simulated by Quasi-Static Finite Element (FE Analyses

    Directory of Open Access Journals (Sweden)

    Jong Wan Hu

    2014-02-01

    Full Text Available In this paper, the superelastic shape memory alloy (SMA slit damper system as an alternative design approach for steel structures is intended to be evaluated with respect to inelastic behavior simulated by refined finite element (FE analyses. Although the steel slit dampers conventionally used for aseismic design are able to dissipate a considerable amount of energy generated by the plastic yielding of the base materials, large permanent deformation may occur in the entire structure. After strong seismic events, extra damage repair costs are required to restore the original configuration and to replace defective devices with new ones. Innovative slit dampers fabricated by superelastic SMAs that automatically recover their initial conditions only by the removal of stresses without heat treatment are introduced with a view toward mitigating the problem of permanent deformation. The cyclically tested FE models are calibrated to experimental results for the purpose of predicting accurate behavior. This study also focuses on the material constitutive model that is able to reproduce the inherent behavior of superelastic SMA materials by taking phase transformation between austenite and martensite into consideration. The responses of SMA slit dampers are compared to those of steel slit dampers. Axial stress and strain components are also investigated on the FE models under cyclic loading in an effort to validate the adequacy of FE modeling and then to compare between two slit damper systems. It can be shown that SMA slit dampers exhibit many structural advantages in terms of ultimate strength, moderate energy dissipation and recentering capability.

  3. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    Science.gov (United States)

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H

    1994-09-15

    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress.

  4. Rescue of cAMP response element-binding protein signaling reversed spatial memory retention impairments induced by subanesthetic dose of propofol.

    Science.gov (United States)

    Zhang, Hao; Zhang, Shao-Bo; Zhang, Qing-Qing; Liu, Meng; He, Xing-Ying; Zou, Zui; Sun, Hai-Jing; You, Zhen-Dong; Shi, Xue-Yin

    2013-07-01

    The intravenous anesthetic propofol caused episodic memory impairments in human. We hypothesized propofol caused episodic-like spatial memory retention but not acquisition impairments in rats and rescuing cAMP response element-binding protein (CREB) signaling using selective type IV phosphodiesterase (PDEIV) inhibitor rolipram reversed these effects. Male Sprague-Dawley rats were randomized into four groups: control; propofol (25 mg/kg, intraperitoneal); rolipram; and rolipram + propofol (pretreatment of rolipram 25 min before propofol, 0.3 mg/kg, intraperitoneal). Sedation and motor coordination were evaluated 5, 15, and 25 min after propofol injection. Invisible Morris water maze (MWM) acquisition and probe test (memory retention) were performed 5 min and 24 h after propofol injection. Visible MWM training was simultaneously performed to resist nonspatial effects. Hippocampal CREB signaling was detected 5 min, 50 min, and 24 h after propofol administration. Rolipram did not change propofol-induced anesthetic/sedative states or impair motor skills. No difference was found on the latency to the platform during the visible MWM. Propofol impaired spatial memory retention but not acquisition. Rolipram reversed propofol-induced spatial memory impairments and suppression on cAMP levels, CaMKIIα and CREB phosphorylation, brain-derived neurotropic factor (BDNF) and Arc protein expression. Propofol caused spatial memory retention impairments but not acquisition inability possibly by inhibiting CREB signaling. © 2013 John Wiley & Sons Ltd.

  5. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    Science.gov (United States)

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  6. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  7. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5’-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris, semiaquatic (Lontra longicaudis annectens and terrestrial (Sus scrofa

    Directory of Open Access Journals (Sweden)

    Myrna eBarjau Perez-Milicua

    2015-07-01

    Full Text Available Aquatic and semiaquatic mammals have the capacity of breath hold (apnea diving. Northern elephant seals (Mirounga angustirostris have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens can hold their breath for about 30 sec. Such periods of apnea may result in reduced oxygen concentration (hypoxia and reduced blood supply (ischemia to tissues. Production of adenosine 5’-triphosphate (ATP requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa, are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal (n=11, semiaquatic (neotropical river otter (n=4 and terrestrial (domestic pig (n=11. Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT was determined by spectrophotometry, and activity of inosine 5’-monophosphate dehydrogenase (IMPDH and the concentration of hypoxanthine (HX, inosine 5’-monophosphate (IMP, adenosine 5’-monophosphate (AMP, adenosine 5’-diphosphate (ADP, ATP, guanosine 5’-diphosphate (GDP, guanosine 5’-triphosphate (GTP, and xanthosine 5’-monophosphate (XMP were determined by high-performance liquid chromatography (HPLC. The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise, aquatic and semiaquatic mammals have less purine mobilization than their terrestrial counterparts.

  8. Pretreatment long interspersed element (LINE-1 methylation levels, not early hypomethylation under treatment, predict hematological response to azacitidine in elderly patients with acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Cross M

    2013-06-01

    Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0

  9. Orotidine-5'-monophosphate decarboxylase catalysis: Kinetic isotope effects and the state of hybridization of a bound transition-state analogue

    Energy Technology Data Exchange (ETDEWEB)

    Acheson, S.A.; Bell, J.B.; Jones, M.E.; Wolfenden, R. (Univ. of North Carolina School of Medicine, Chapel Hill (USA))

    1990-04-03

    The enzymatic decarboxylation of orotidine 5'-monophosphate may proceed by an addition-elimination mechanism involving a covalently bound intermediate or by elimination of CO2 to generate a nitrogen ylide. In an attempt to distinguish between these two alternatives, 1-(phosphoribosyl)barbituric acid was synthesized with 13C at the 5-position. Interaction of this potential transition-state analogue inhibitor with yeast orotidine-5'-monophosphate decarboxylase resulted in a small (0.6 ppm) downfield displacement of the C-5 resonance, indicating no rehybridization of the kind that might have been expected to accompany 5,6-addition of an enzyme nucleophile. When the substrate orotidine 5'-monophosphate was synthesized with deuterium at C-5, no significant change in kcat (H/D = 0.99 +/- 0.06) or kcat/KM (H/D = 1.00 +/- 0.06) was found to result, suggesting that C-5 does not undergo significant changes in geometry before or during the step that determines the rate of the catalytic process. These results are consistent with a nitrogen ylide mechanism and offer no support for the intervention of covalently bound intermediates in the catalytic process.

  10. A new sensitive 32P-postlabeling assay based on the specific enzymatic conversion of bulky DNA lesions to radiolabeled dinucleotides and nucleoside 5'-monophosphates

    International Nuclear Information System (INIS)

    Randerath, Kurt; Randerath, Erika; Danna, T.F.; Van Golen, K.L.; Putman, K.L.

    1989-01-01

    A new sensitive 32 P-postlabelling assay for DNA adducts has been developed. When DNA containing bulky adducts, X 1 , X 2 , .....X n , is digested with nuclease P1 at pH 5, normal nucleotides are released as 5'-monophosphates, pN, while adducts are excised as 5'-phosphorylated dinucleotides, pX i pN, because inter-nucleotide linkages on the 3' side of X resist attack by nuclease P1. Addition of prostatic acid phosphatase to such a digest results in 5'-dephosphorylation of the nucleotides to normal nucleosides, N, and adducted dinucleotides, X i pN, carrying a 5'-terminal free hydroxyl group. The dinucleotides but not nucleosides are converted to 5'- 32 P-labeled dinucleotides,[ 32 P]pX i pN, by T4 polynucleotide kinase-catalyzed [ 32 P]posphate transfer from [γ- 32 P]ATP. Upon mapping on polyethyleneimine-cellulose anion-exchange TLC, the labeled dinucleotide adducts produce characteristic autoradiographic fingerprints. Alternatively, they are further digested with snake venom phosphodiesterase to yield 5'-monophosphates, [ 32 P]pX i and pN. TLC profiles of the monophosphate adducts are distinct from those of the dinucleotides. These reactions provide the basis of the new 32 P-postlabeling scheme, which is compared in this paper with a previously reported protocol yielding adducts in the form of 5'- 32 P-labeled 3',5'-bisphosphates, [ 32 P]pX i p. (author)

  11. Regulation of cessation of respiration and killing by cyclic 3',5'-adenosine monophosphate and its receptor protein after far-ultraviolet irradiation of Escherichia coli

    International Nuclear Information System (INIS)

    Swenson, P.A.; Schenley, R.L.; Joshi, J.G.

    1978-01-01

    When Escherichia coli B/r cultures are irradiated with ultraviolet light (UV) (254 nm), those cells that are killed stop respiring by 60 min after irradiation. Post-UV treatment with cyclic adenosine 3',5'-adenosine monophosphate (cAMP) causes more cells to stop respiring and to die. We have studied these effects at a UV fluence of 52 I/m 2 in a a wild-type E. coli K 12 strain and in mutants defective in cAMP metabolism. Strain CA 8,000 has crp + and cya + genes for the cAMP receptor protein (CRP) (required for transcription of operons regulated by cAMP) and for adenylate cyclase, respectively; CA 7901 is crp - ; and CA 8306 is a cya deletion (Δ). The wild-type culture showed a small transient cessation of respiration, and addition of cAMP caused cessation to be nearly complete. The crp - culture showed no evidence of cessation of respiration, and cAMP had no effect. The Δ cya mutant also showed no cessation of respiration, but cAMP (5 mM) caused as complete inhibition as in the wild type. cAMP caused a 10-fold loss in viability of UV-irradiated wild-type and Δ cya liquid cultures but had no effect on the cpr - culture. Respiration and viability changes were also studied in a double mutant, CA8404 Δ cya crp*, which has an altered CRP that is, with respect to the lac operon, independent of cAMP. The respiration response to UV was similar to that of the wild-type culture, and both respiration and viability of cells in liquid culture were sensitive to cAMP. The survival data, obtained by plating immediately after irradiation, show the wild type, Δ cya strains, and Δ cya crp* to be equally sensitive and the crp - strain to be more resistant. We conclude that cessation of respiration and cell killing after UV irradiation are regulated by cAMP and the CRP. (orig.) [de

  12. Investigation of the enzymatic mechanism of yeast orotidine-5'-monophosphate decarboxylase using 13C kinetic isotope effects

    International Nuclear Information System (INIS)

    Smiley, J.A.; Bell, J.B.; Jones, M.E.; Paneth, P.; O'Leary, M.H.

    1991-01-01

    Orotidine-5'-monophosphate decarboxylase (ODCase) from Saccharomyces cerevisiae displays an observed 13 C kinetic isotope effect of 1.0247 ± 0.0008 at 25 C, pH 6.8. The observed isotope effect is sensitive to changes in the reaction medium, such as pH, temperature, or glycerol content. The value of 1.0494 ± 0.0006 measured at pH 4.0, 25 C, is not altered significantly by temperature or glycerol, and thus the intrinsic isotope effect for the reaction is apparently being observed under these conditions and decarboxylation is almost entirely rate-determining. These data require a catalytic mechanism with freely reversible binding and one in which a very limited contribution to the overall rate is made by chemical steps preceding decarboxylation; the zwitterion mechanism of Beak and Siegel, which involves only protonation of the pyrimidine ring, is such a mechanism. With use of an intrinsic isotope effect of 1.05, a partitioning factor of less than unity is calculated for ODCase at pH 6.0, 25 C. A quantitative kinetic analysis using this result excludes the possibility of an enzymatic mechanism involving covalent attachment of an enzyme nucleophile to C-5 of the pyrimidine ring. These data fit a kinetic model in which an enzyme proton necessary for catalysis is titrated at high pH, thus providing evidence for the catalytic mechanism of Beak and Siegal

  13. Mechanism of adenylate kinase. Dose adenosine 5'-triphosphate bind to the adenosine 5'-monophosphate site

    Energy Technology Data Exchange (ETDEWEB)

    Shyy, Y.J.; Tian, G.; Tsai, M.D.

    1987-10-06

    Although the subtrate binding properties of adenylate kinase (AK) have been studied extensively by various biochemical and biophysical techniques, it remains controversial whether uncomplexed adenosine 5'-triphosphate (ATP) binds to the adenosine 5'-monophosphate (AMP) site of AK. The authors present two sets of experiments which argue against binding of ATP to the AMP site. (a) /sup 31/P nuclear magnetic resonance titration of ATP with AK indicated a 1:1 stoichiometry on the basis of changes in coupling constants and line widths. This ruled out binding of ATP to both sites. (b) ATP and MgATP were found to behave similarly by protecting AK from spontaneous inactivation while AMP showed only a small degree of protection. Such inactivation could also be protected or reversed by dithioerythritol and is most likely due to oxidation of sulfhydryl groups, one of which (cysteine-25) is located near the MgATP site. The results support binding of ATP to the MgATP site predominantly, instead of the AMP site, in the absence of Mg/sup 2 +/.

  14. Barrier-free proton transfer in the valence anion of 2'-deoxyadenosine-5'-monophosphate. II. A computational study

    Science.gov (United States)

    Kobyłecka, Monika; Gu, Jiande; Rak, Janusz; Leszczynski, Jerzy

    2008-01-01

    The propensity of four representative conformations of 2'-deoxyadenosine-5'-monophosphate (5'-dAMPH) to bind an excess electron has been studied at the B3LYP /6-31++G(d,p) level. While isolated canonical adenine does not support stable valence anions in the gas phase, all considered neutral conformations of 5'-dAMPH form adiabatically stable anions. The type of an anionic 5'-dAMPH state, i.e., the valence, dipole bound, or mixed (valence/dipole bound), depends on the internal hydrogen bond(s) pattern exhibited by a particular tautomer. The most stable anion results from an electron attachment to the neutral syn-south conformer. The formation of this anion is associated with a barrier-free proton transfer triggered by electron attachment and the internal rotation around the C4'-C5' bond. The adiabatic electron affinity of the a&barbelow;south-syn anion is 1.19eV, while its vertical detachment energy is 1.89eV. Our results are compared with the photoelectron spectrum (PES) of 5'-dAMPH- measured recently by Stokes et al., [J. Chem. Phys. 128, 044314 (2008)]. The computational VDE obtained for the most stable anionic structure matches well with the experimental electron binding energy region of maximum intensity. A further understanding of DNA damage might require experimental and computational studies on the systems in which purine nucleotides are engaged in hydrogen bonding.

  15. Experimental measurement and modelling of solubility of inosine-5′-monophosphate disodium in pure and mixed solvents

    International Nuclear Information System (INIS)

    Zou, Fengxia; Zhuang, Wei; Wu, Jinglan; Zhou, Jingwei; Liu, Qiyan; Chen, Yong; Xie, Jingjing; Zhu, Chenjie; Guo, Ting; Ying, Hanjie

    2014-01-01

    Graphical abstract: - Highlights: • Solubility of 5′-IMPNa 2 in various solvents was studied for the first time. • The solubility could be ranked as follows: water > methanol > ethanol > acetone. • Modified Apelblat equation gave the best correlating results. • Mixing Gibbs free energies, enthalpies, and entropies were predicted. • Solubility data and equations can optimise the crystallization conditions. - Abstract: The solubility of biological chemicals in solvents provide important fundamental data and is generally considered as an essential factor in the design of crystallization processes. The equilibrium solubility data of inosine-5′-monophosphate disodium (5′-IMPNa 2 ) in water, methanol, ethanol, acetone, as well as in the solvent mixtures (methanol + water, ethanol + water, acetone + water), were measured by an isothermal method at temperatures ranging from (293.15 to 313.15) K. The measured data in pure and mixed solvents were then modelled using the modified Apelblat equation, van’t Hoff equation, λh equation, ideal model and the Wilson model. The modified Apelblat equation showed the best modelling results, and it was therefore used to predict the mixing Gibbs free energies, enthalpies, and entropies of 5′-IMPNa 2 in pure and binary solvents. The positive values of the calculated partial molar Gibbs free energies indicated the variations in the solubility trends of 5′-IMPNa 2 . Water and ethanol (in the binary mixture with water) were found to be the most effective solvent and anti-solvent, respectively

  16. Amino Acid Change in the Carbohydrate Response Element Binding Protein is associated with lower triglycerides and myocardial infarction incidence depending on level of adherence to the Mediterranean diet in the PREDIMED trial

    Science.gov (United States)

    A variant (rs3812316, C771G, and Gln241His) in the MLXIPL (Max-like protein X interacting protein-like) gene encoding the carbohydrate response element binding protein has been associated with lower triglycerides. However, its association with cardiovascular diseases and gene-diet interactions modul...

  17. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses.

    Science.gov (United States)

    Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2003-04-01

    Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.

  18. Fuel element

    International Nuclear Information System (INIS)

    Armijo, J.S.

    1976-01-01

    A fuel element for nuclear reactors is proposed which has a higher corrosion resisting quality in reactor operations. The zirconium alloy coating around the fuel element (uranium or plutonium compound) has on its inside a protection layer of metal which is metallurgically bound to the substance of the coating. As materials are namned: Alluminium, copper, niobium, stainless steel, and iron. This protective metallic layer has another inner layer, also metallurgically bound to its surface, which consists usually of a zirconium alloy. (UWI) [de

  19. The Arabidopsis thaliana Cyclic-Nucleotide-Dependent Response – a Quantitative Proteomic and Phosphoproteomic Analysis

    KAUST Repository

    Alqurashi, May M.

    2013-01-01

    monophosphate (cAMP), has been shown to be a second messenger in abiotic and biotic stress responses. However, little is known about the precise role of cAMP in plants and in the down-stream activation of kinases, and hence cAMP

  20. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  1. cAMP response element-binding protein in the amygdala is required for long- but not short-term conditioned taste aversion memory.

    Science.gov (United States)

    Lamprecht, R; Hazvi, S; Dudai, Y

    1997-11-01

    In conditioned taste aversion (CTA) organisms learn to avoid a taste if the first encounter with that taste is followed by transient poisoning. The neural mechanisms that subserve this robust and long-lasting association of taste and malaise have not yet been elucidated, but several brain areas have been implicated in the process, including the amygdala. In this study we investigated the role of amygdala in general, and the cAMP response element-binding protein (CREB) in the amygdala in particular, in CTA learning and memory. Toward that end, we combined antisense technology in vivo with behavioral, molecular, and histochemical analysis. Local microinjection of phosphorothioate-modified oligodeoxynucleotides (ODNs) antisense to CREB into the rat amygdala several hours before CTA training transiently reduced the level of CREB protein during training and impaired CTA memory when tested 3-5 d later. In comparison, sense ODNs had no effect on memory. The effect of antisense was not attributable to differential tissue damage and was site-specific. CREB antisense in the amygdala had no effect on retrieval of CTA memory once it had been formed, and did not affect short-term CTA memory. We propose that the amygdala, specifically the central nucleus, is required for the establishment of long-term CTA memory in the behaving rat; that the process involves long-term changes, subserved by CRE-regulated gene expression, in amygdala neurons; and that the amygdala may retain some CTA-relevant information over time rather than merely modulating the gustatory trace during acquisition of CTA.

  2. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Science.gov (United States)

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  3. Activation of the transcription factor carbohydrate-responsive element-binding protein by glucose leads to increased pancreatic beta cell differentiation in rats.

    Science.gov (United States)

    Soggia, A; Flosseau, K; Ravassard, P; Szinnai, G; Scharfmann, R; Guillemain, G

    2012-10-01

    Pancreatic cell development is a tightly controlled process. Although information is available regarding the mesodermal signals that control pancreatic development, little is known about the role of environmental factors such as nutrients, including glucose, on pancreatic development. We previously showed that glucose and its metabolism through the hexosamine biosynthesis pathway (HBP) promote pancreatic endocrine cell differentiation. Here, we analysed the role of the transcription factor carbohydrate-responsive element-binding protein (ChREBP) in this process. This transcription factor is activated by glucose, and has been recently described as a target of the HBP. We used an in vitro bioassay in which pancreatic endocrine and exocrine cells develop from rat embryonic pancreas in a way that mimics in vivo pancreatic development. Using this model, gain-of-function and loss-of-function experiments were undertaken. ChREBP was produced in the endocrine lineage during pancreatic development, its abundance increasing with differentiation. When rat embryonic pancreases were cultured in the presence of glucose or xylitol, the production of ChREBP targets was induced. Concomitantly, beta cell differentiation was enhanced. On the other hand, when embryonic pancreases were cultured with inhibitors decreasing ChREBP activity or an adenovirus producing a dominant-negative ChREBP, beta cell differentiation was reduced, indicating that ChREBP activity was necessary for proper beta cell differentiation. Interestingly, adenovirus producing a dominant-negative ChREBP also reduced the positive effect of N-acetylglucosamine, a substrate of the HBP acting on beta cell differentiation. Our work supports the idea that glucose, through the transcription factor ChREBP, controls beta cell differentiation from pancreatic progenitors.

  4. Inhibition of both HIV-1 reverse transcription and gene expression by a cyclic peptide that binds the Tat-transactivating response element (TAR RNA.

    Directory of Open Access Journals (Sweden)

    Matthew S Lalonde

    2011-05-01

    Full Text Available The RNA response element TAR plays a critical role in HIV replication by providing a binding site for the recruitment of the viral transactivator protein Tat. Using a structure-guided approach, we have developed a series of conformationally-constrained cyclic peptides that act as structural mimics of the Tat RNA binding region and block Tat-TAR interactions at nanomolar concentrations in vitro. Here we show that these compounds block Tat-dependent transcription in cell-free systems and in cell-based reporter assays. The compounds are also cell permeable, have low toxicity, and inhibit replication of diverse HIV-1 strains, including both CXCR4-tropic and CCR5-tropic primary HIV-1 isolates of the divergent subtypes A, B, C, D and CRF01_AE. In human peripheral blood mononuclear cells, the cyclic peptidomimetic L50 exhibited an IC(50 ∼250 nM. Surprisingly, inhibition of LTR-driven HIV-1 transcription could not account for the full antiviral activity. Timed drug-addition experiments revealed that L-50 has a bi-phasic inhibition curve with the first phase occurring after HIV-1 entry into the host cell and during the initiation of HIV-1 reverse transcription. The second phase coincides with inhibition of HIV-1 transcription. Reconstituted reverse transcription assays confirm that HIV-1 (- strand strong stop DNA synthesis is blocked by L50-TAR RNA interactions in-vitro. These findings are consistent with genetic evidence that TAR plays critical roles both during reverse transcription and during HIV gene expression. Our results suggest that antiviral drugs targeting TAR RNA might be highly effective due to a dual inhibitory mechanism.

  5. Transcription factor HIF1A: downstream targets, associated pathways, polymorphic hypoxia response element (HRE) sites, and initiative for standardization of reporting in scientific literature.

    Science.gov (United States)

    Slemc, Lucija; Kunej, Tanja

    2016-11-01

    Hypoxia-inducible factor-1α (HIF-1α) has crucial role in adapting cells to hypoxia through expression regulation of many genes. Identification of HIF-1α target genes (HIF-1α-TGs) is important for understanding the adapting mechanism. The aim of the present study was to collect known HIF-1α-TGs and identify their associated pathways. Targets and associated genomics data were retrieved using PubMed, WoS ( http://apps.webofknowledge.com/ ), HGNC ( http://www.genenames.org/ ), NCBI ( http://www.ncbi.nlm.nih.gov/ ), Ensemblv.84 ( http://www.ensembl.org/index.html ), DAVID Bioinformatics Resources ( https://david.ncifcrf.gov /), and Disease Ontology database ( http://disease-ontology.org/ ). From 51 papers, we collected 98 HIF-1α TGs found to be associated with 20 pathways, including metabolism of carbohydrates and pathways in cancer. Reanalysis of genomic coordinates of published HREs (hypoxia response elements) revealed six polymorphisms within HRE sites (HRE-SNPs): ABCG2, ACE, CA9, and CP. Due to large heterogeneity of results presentation in scientific literature, we also propose a first step towards reporting standardization of HIF-1α-target interactions consisting of ten relevant data types. Suggested minimal checklist for reporting will enable faster development of a complete catalog of HIF-1α-TGs, data sharing, bioinformatics analyses, and setting novel more targeted hypotheses. The proposed format for data standardization is not yet complete but presents a baseline for further optimization of the protocol with additional details, for example, regarding the experimental validation.

  6. Numerical Simulation on Seismic Response of the Filled Joint under High Amplitude Stress Waves Using Finite-Discrete Element Method (FDEM

    Directory of Open Access Journals (Sweden)

    Xiaolin Huang

    2016-12-01

    Full Text Available This paper numerically investigates the seismic response of the filled joint under high amplitude stress waves using the combined finite-discrete element method (FDEM. A thin layer of independent polygonal particles are used to simulate the joint fillings. Each particle is meshed using the Delaunay triangulation scheme and can be crushed when the load exceeds its strength. The propagation of the 1D longitude wave through a single filled joint is studied, considering the influences of the joint thickness and the characteristics of the incident wave, such as the amplitude and frequency. The results show that the filled particles under high amplitude stress waves mainly experience three deformation stages: (i initial compaction stage; (ii crushing stage; and (iii crushing and compaction stage. In the initial compaction stage and crushing and compaction stage, compaction dominates the mechanical behavior of the joint, and the particle area distribution curve varies little. In these stages, the transmission coefficient increases with the increase of the amplitude, i.e., peak particle velocity (PPV, of the incident wave. On the other hand, in the crushing stage, particle crushing plays the dominant role. The particle size distribution curve changes abruptly with the PPV due to the fragments created by the crushing process. This process consumes part of wave energy and reduces the stiffness of the filled joint. The transmission coefficient decreases with increasing PPV in this stage because of the increased amount of energy consumed by crushing. Moreover, with the increase of the frequency of the incident wave, the transmission coefficient decreases and fewer particles can be crushed. Under the same incident wave, the transmission coefficient decreases when the filled thickness increases and the filled particles become more difficult to be crushed.

  7. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  8. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  9. Utilization of a hybrid finite-element based registration method to quantify heterogeneous tumor response for adaptive treatment for lung cancer patients

    Science.gov (United States)

    Sharifi, Hoda; Zhang, Hong; Bagher-Ebadian, Hassan; Lu, Wei; Ajlouni, Munther I.; Jin, Jian-Yue; (Spring Kong, Feng-Ming; Chetty, Indrin J.; Zhong, Hualiang

    2018-03-01

    Tumor response to radiation treatment (RT) can be evaluated from changes in metabolic activity between two positron emission tomography (PET) images. Activity changes at individual voxels in pre-treatment PET images (PET1), however, cannot be derived until their associated PET-CT (CT1) images are appropriately registered to during-treatment PET-CT (CT2) images. This study aimed to investigate the feasibility of using deformable image registration (DIR) techniques to quantify radiation-induced metabolic changes on PET images. Five patients with non-small-cell lung cancer (NSCLC) treated with adaptive radiotherapy were considered. PET-CTs were acquired two weeks before RT and 18 fractions after the start of RT. DIR was performed from CT1 to CT2 using B-Spline and diffeomorphic Demons algorithms. The resultant displacements in the tumor region were then corrected using a hybrid finite element method (FEM). Bitmap masks generated from gross tumor volumes (GTVs) in PET1 were deformed using the four different displacement vector fields (DVFs). The conservation of total lesion glycolysis (TLG) in GTVs was used as a criterion to evaluate the quality of these registrations. The deformed masks were united to form a large mask which was then partitioned into multiple layers from center to border. The averages of SUV changes over all the layers were 1.0  ±  1.3, 1.0  ±  1.2, 0.8  ±  1.3, 1.1  ±  1.5 for the B-Spline, B-Spline  +  FEM, Demons and Demons  +  FEM algorithms, respectively. TLG changes before and after mapping using B-Spline, Demons, hybrid-B-Spline, and hybrid-Demons registrations were 20.2%, 28.3%, 8.7%, and 2.2% on average, respectively. Compared to image intensity-based DIR algorithms, the hybrid FEM modeling technique is better in preserving TLG and could be useful for evaluation of tumor response for patients with regressing tumors.

  10. Plant HDAC inhibitor chrysin arrest cell growth and induce p21WAF1 by altering chromatin of STAT response element in A375 cells

    International Nuclear Information System (INIS)

    Pal-Bhadra, Manika; Bhadra, Utpal; Ramaiah, M Janaki; Reddy, T Lakshminarayan; Krishnan, Anita; Pushpavalli, SNCVL; Babu, K Suresh; Tiwari, Ashok K; Rao, J Madhusudana; Yadav, Jhillu S

    2012-01-01

    Chrysin and its analogues, belongs to flavonoid family and possess potential anti-tumour activity. The aim of this study is to determine the molecular mechanism by which chrysin controls cell growth and induce apoptosis in A375 cells. Effect of chrysin and its analogues on cell viability and cell cycle analysis was determined by MTT assay and flowcytometry. A series of Western blots was performed to determine the effect of chrysin on important cell cycle regulatory proteins (Cdk2, cyclin D1, p53, p21, p27). The fluorimetry and calorimetry based assays was conducted for characterization of chrysin as HDAC inhibitor. The changes in histone tail modification such as acetylation and methylation was studied after chrysin treatment was estimated by immuno-fluorescence and western blot analysis. The expression of Bcl-xL, survivin and caspase-3 was estimated in chrysin treated cells. The effect of chrysin on p21 promoter activity was studied by luciferase and ChIP assays. Chrysin cause G1 cell cycle arrest and found to inhibit HDAC-2 and HDAC-8. Chrysin treated cells have shown increase in the levels of H3acK14, H4acK12, H4acK16 and decrease in H3me2K9 methylation. The p21 induction by chrysin treatment was found to be independent of p53 status. The chromatin remodelling at p21 WAF1 promoter induces p21 activity, increased STAT-1 expression and epigenetic modifications that are responsible for ultimate cell cycle arrest and apoptosis. Chrysin shows in vitro anti-cancer activity that is correlated with induction of histone hyperacetylation and possible recruitment of STAT-1, 3, 5 proteins at STAT (−692 to −684) region of p21 promoter. Our results also support an unexpected action of chrysin on the chromatin organization of p21 WAF1 promoter through histone methylation and hyper-acetylation. It proposes previously unknown sequence specific chromatin modulations in the STAT responsive elements for regulating cell cycle progression negatively via the induction of the CDK

  11. Characteristics and crystal structure of bacterial inosine-5'-monophosphate dehydrogenase.

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, R.; Evans, G.; Rotella, F. J.; Westbrook, E. M.; Beno, D.; Huberman, E.; Joachimiak, A.; Collart, F. R.

    1999-01-01

    IMP dehydrogenase (IMPDH) is an essential enzyme that catalyzes the first step unique to GTP synthesis. To provide a basis for the evaluation of IMPDH inhibitors as antimicrobial agents, we have expressed and characterized IMPDH from the pathogenic bacterium Streptococcus pyogenes. Our results show that the biochemical and kinetic characteristics of S. pyogenes IMPDH are similar to other bacterial IMPDH enzymes. However, the lack of sensitivity to mycophenolic acid and the K{sub m} for NAD (1180 {mu}M) exemplify some of the differences between the bacterial and mammalian IMPDH enzymes, making it an attractive target for antimicrobial agents. To evaluate the basis for these differences, we determined the crystal structure of the bacterial enzyme at 1.9 {angstrom} with substrate bound in the catalytic site. The structure was determined using selenomethionine-substituted protein and multiwavelength anomalous (MAD) analysis of data obtained with synchrotron radiation from the undulator beamline (19ID) of the Structural Biology Center at Argonne's Advanced Photon Source. S. pyogenes IMPDH is a tetramer with its four subunits related by a crystallographic 4-fold axis. The protein is composed of two domains: a TIM barrel domain that embodies the catalytic framework and a cystathione {beta}-synthase (CBS) dimer domain of so far unknown function. Using information provided by sequence alignments and the crystal structure, we prepared several site-specific mutants to examine the role of various active site regions in catalysis. These variants implicate the active site flap as an essential catalytic element and indicate there are significant differences in the catalytic environment of bacterial and mammalian IMPDH enzymes. Comparison of the structure of bacterial IMPDH with the known partial structures from eukaryotic organisms will provide an explanation of their distinct properties and contribute to the design of specific bacterial IMPDH inhibitors.

  12. Response

    Science.gov (United States)

    Higgins, Chris

    2012-01-01

    This article presents the author's response to the reviews of his book, "The Good Life of Teaching: An Ethics of Professional Practice." He begins by highlighting some of the main concerns of his book. He then offers a brief response, doing his best to address the main criticisms of his argument and noting where the four reviewers (Charlene…

  13. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  14. Transposable elements in cancer.

    Science.gov (United States)

    Burns, Kathleen H

    2017-07-01

    Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

  15. Ginsenoside Compound K suppresses the hepatic gluconeogenesis via activating adenosine-5'monophosphate kinase: A study in vitro and in vivo.

    Science.gov (United States)

    Wei, Shengnan; Li, Wei; Yu, Yang; Yao, Fan; A, Lixiang; Lan, Xiaoxin; Guan, Fengying; Zhang, Ming; Chen, Li

    2015-10-15

    Compound K (CK) is a final intestinal metabolite of protopanaxadiol-type ginsenoside. We have reported that CK presented anti-diabetic effect via diminishing the expressions of hepatic gluconeogenesis key enzyme. Here, we further explore the possible mechanism of CK on suppression hepatic gluconeogenesis via activation of adenosine-5'monophosphate kinase (AMPK) on type 2 diabetes mice in vivo and in HepG2 cells. Type 2 diabetes mice model was developed by high fat diet combined with STZ injection. 30mg/kg/d CK was orally administrated for 4weeks, the fasting blood glucose level and 2h OGTT were conducted, and the protein expression of AMPK, peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), Phosphoenolpyruvate carboxykinase (PEPCK) and Glucose-6-phosphatase (G6Pase) were examined. The mechanism of Compound K on hepatic gluconeogenesis was further explored in HepG2 hepatocytes. Glucose production, the protein expression of AMPK, PEPCK, G6pase and PGC-1α, hepatic nuclear factor 4α (HNF-4α) and forkhead transcription factor O1 (FOXO1) were determined after Compound K treatment at the presence of AMPK inhibitor Compound C. We observed that CK inhibited the expression of PEPCK and G6Pase in the liver and in HepG2 hepatocytes. Meanwhile, CK treatment remarkably increased the activation of AMPK, while decreasing the expressions of PGC-1α, HNF-4α and FOXO1. However, AMPK inhibitor Compound C could reverse these effects of CK on gluconeogenesis in part. The results indicated that the effect of CK on suppression hepatic gluconeogenesis might be via the activation the AMPK activity. Copyright © 2015. Published by Elsevier Inc.

  16. Myricetin is a novel inhibitor of human inosine 5′-monophosphate dehydrogenase with anti-leukemia activity

    International Nuclear Information System (INIS)

    Pan, Huiling; Hu, Qian; Wang, Jingyuan; Liu, Zehui; Wu, Dang; Lu, Weiqiang; Huang, Jin

    2016-01-01

    Human inosine 5′-monophosphate dehydrogenase (hIMPDH) is a rate-limiting enzyme in the de novo biosynthetic pathway of purine nucleotides, playing crucial roles in cellular proliferation, differentiation, and transformation. Dysregulation of hIMPDH expression and activity have been found in a variety of human cancers including leukemia. In this study, we found that myricetin, a naturally occurring phytochemical existed in berries, wine and tea, was a novel inhibitor of human type 1 and type 2 IMPDH (hIMPDH1/2) with IC_5_0 values of 6.98 ± 0.22 μM and 4.10 ± 0.14 μM, respectively. Enzyme kinetic analysis using Lineweaver-Burk plot revealed that myricetin is a mix-type inhibitor for hIMPDH1/2. Differential scanning fluorimetry and molecular docking simulation data demonstrate that myricetin is capable of binding with hIMPDH1/2. Myricetin treatment exerts potent anti-proliferative and pro-apoptotic effects on K562 human leukemia cells in a dose-dependent manner. Importantly, cytotoxicity of myricetin on K562 cells were markedly attenuated by exogenous addition of guanosine, a salvage pathway of maintaining intracellular pool of guanine nucleotides. Taking together, these results indicate that natural product myricetin exhibits potent anti-leukemia activity by interfering with purine nucleotides biosynthetic pathway through the suppression of hIMPDH1/2 catalytic activity. - Highlights: • Myricetin, a common dietary flavonoid, is a novel inhibitor of hIMPDH1/2. • Myricetin directly binds with hIMPDH1/2 and induces cell cycle arrest and apoptosis of leukemia cells. • The cytotoxicity of myricetin on K562 cells is markedly attenuated by exogenous addition of guanosine.

  17. Erythrocyte metabolism in hyperthyroidism: a microcalorimetric study on changes in the Embden-Meyerhof and the hexose monophosphate pathways.

    Science.gov (United States)

    Monti, M; Hedner, P; Ikomi-Kumm, J; Valdemarsson, S

    1987-05-01

    Erythrocyte metabolism was studied in vitro by microcalorimetry in 10 hyperthyroid subjects before and after treatment. By inhibiting the enzyme enolase in the Embden-Meyerhof pathway with sodium fluoride (NaF) we have recorded the anaerobic and aerobic contributions in erythrocyte thermogenesis. The decrease in heat production rate in samples with NaF corresponds to the anaerobic contribution, whereas the values from samples with NaF reflect aerobic processes. Before treatment, total heat production rate was 120 +/- 2 mW/l erythrocytes which was higher than the post-treatment value of 99 +/- 2 (P less than 0.001) as well as the value for 14 euthyroid subjects, 108 +/- 2 mW/l (P less than 0.001). The NaF inhibitable rate was 73 +/- 2 before and 63 +/- 1 mW/l after therapy (P less than 0.01). These values correspond to 61 +/- 1 and 64 +/- 1% (n.s.) of the total heat production rate, and were similar to that of 61 +/- 2% for the controls. Heat production rates in the presence of NaF were 47 +/- 1 before and 36 +/- 1 mW/l after therapy (P less than 0.001), representing 39 +/- 1 and 36 +/- 1% of total values, respectively. The present results show that overall metabolism is increased in erythrocytes from hyperthyroid subjects before treatment and returns to normal after normalization of the thyroid function. Moreover, by using microcalorimetry we found that the metabolic activity along the Embden-Meyerhof anaerobic pathway as well as along the hexose monophosphate aerobic pathway in erythrocytes is stimulated by thyroid hormones.

  18. Myricetin is a novel inhibitor of human inosine 5′-monophosphate dehydrogenase with anti-leukemia activity

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huiling; Hu, Qian; Wang, Jingyuan; Liu, Zehui; Wu, Dang [Shanghai Key Laboratory of New Drug Design, School of Pharmacy, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237 (China); Lu, Weiqiang, E-mail: wqlu@bio.ecnu.edu.cn [Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University, 500 Dongchuan Road, Shanghai 200241 (China); Huang, Jin, E-mail: huangjin@ecust.edu.cn [Shanghai Key Laboratory of New Drug Design, School of Pharmacy, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237 (China)

    2016-09-02

    Human inosine 5′-monophosphate dehydrogenase (hIMPDH) is a rate-limiting enzyme in the de novo biosynthetic pathway of purine nucleotides, playing crucial roles in cellular proliferation, differentiation, and transformation. Dysregulation of hIMPDH expression and activity have been found in a variety of human cancers including leukemia. In this study, we found that myricetin, a naturally occurring phytochemical existed in berries, wine and tea, was a novel inhibitor of human type 1 and type 2 IMPDH (hIMPDH1/2) with IC{sub 50} values of 6.98 ± 0.22 μM and 4.10 ± 0.14 μM, respectively. Enzyme kinetic analysis using Lineweaver-Burk plot revealed that myricetin is a mix-type inhibitor for hIMPDH1/2. Differential scanning fluorimetry and molecular docking simulation data demonstrate that myricetin is capable of binding with hIMPDH1/2. Myricetin treatment exerts potent anti-proliferative and pro-apoptotic effects on K562 human leukemia cells in a dose-dependent manner. Importantly, cytotoxicity of myricetin on K562 cells were markedly attenuated by exogenous addition of guanosine, a salvage pathway of maintaining intracellular pool of guanine nucleotides. Taking together, these results indicate that natural product myricetin exhibits potent anti-leukemia activity by interfering with purine nucleotides biosynthetic pathway through the suppression of hIMPDH1/2 catalytic activity. - Highlights: • Myricetin, a common dietary flavonoid, is a novel inhibitor of hIMPDH1/2. • Myricetin directly binds with hIMPDH1/2 and induces cell cycle arrest and apoptosis of leukemia cells. • The cytotoxicity of myricetin on K562 cells is markedly attenuated by exogenous addition of guanosine.

  19. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    OpenAIRE

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  20. Expression of N-WASP is regulated by HiF1α through the hypoxia response element in the N-WASP promoter

    Directory of Open Access Journals (Sweden)

    Amrita Salvi

    2017-03-01

    Full Text Available Cancer cell migration and invasion involves temporal and spatial regulation of actin cytoskeleton reorganization, which is regulated by the WASP family of proteins such as N-WASP (Neural- Wiskott Aldrich Syndrome Protein. We have previously shown that expression of N-WASP was increased under hypoxic conditions. In order to characterize the regulation of N-WASP expression, we constructed an N-WASP promoter driven GFP reporter construct, N-WASPpro-GFP. Transfection of N-WASPpro-GFP construct and plasmid expressing HiF1α (Hypoxia Inducible factor 1α enhanced the expression of GFP suggesting that increased expression of N-WASP under hypoxic conditions is mediated by HiF1α. Sequence analysis of the N-WASP promoter revealed the presence of two hypoxia response elements (HREs characterized by the consensus sequence 5′-GCGTG-3′ at -132 bp(HRE1 and at -662 bp(HRE2 relative to transcription start site (TSS. Site-directed mutagenesis of HRE1(-132 but not HRE2(-662 abolished the HiF1α induced activation of N-WASP promoter. Similarly ChIP assay demonstrated that HiF1α bound to HRE1(-132 but not HRE2(-662 under hypoxic condition. MDA-MB-231 cells but not MDA-MB-231KD cells treated with hypoxia mimicking agent, DMOG showed enhanced gelatin degradation. Similarly MDA-MB-231KD(N-WASPpro-N-WASPR cells expressing N-WASPR under the transcriptional regulation of WT N-WASPpro but not MDA-MB-231KD(N-WASPproHRE1-N-WASPR cells expressing N-WASPR under the transcriptional regulation of N-WASPproHRE1 showed enhanced gelatin degradation when treated with DMOG. Thus indicating the importance of N-WASP in hypoxia induced invadopodia formation. Thus, our data demonstrates that hypoxia-induced activation of N-WASP expression is mediated by interaction of HiF1α with the HRE1(-132 and explains the role of N-WASP in hypoxia induced invadopodia formation.

  1. A case report of spontaneous mutation (C33>U) in the iron-responsive element of L-ferritin causing hyperferritinemia-cataract syndrome.

    LENUS (Irish Health Repository)

    Cao, Wei

    2010-01-15

    The hereditary hyperferritinemia cataract syndrome (HHCS) is an autosomal dominant disorder characterized by juvenile-onset cataracts and elevated serum ferritin levels. It is caused by mutation in the iron response element (IRE) within the 5\\'UTR of L-ferritin gene. The mutation results in a loss of post-transcriptional negative feedback exerted by the interaction between iron regulatory proteins 1, 2 (IRP1 and IRP2) and IRE, which leads to uncontrolled expression of L-ferritin. In this paper, we describe the molecular pathogenesis of non-hereditary hyperferritinemia cataract syndrome (non-H-HCS) in a patient with typical HHCS ocular lens morphology and high ferritin levels without obvious family history. Initial sequencing of the full-length L-ferritin cloned from genomic DNA demonstrated a mutation (C33>T) in the IRE of the affected patient but not in her unaffected family members. The mutation (C\\/T heterozygote) was also detected in cDNA derived from her blood mononuclear cells. Structure-prediction-modeling indicates that this mutation would significantly alter the secondary structure of the IRE, resulting in a loss of the interaction between IRP and IRE. By using IRP1\\/IRP2-human IgG1 Fc fusion proteins, we established a novel in vitro report system (modified ELISA) to verify impaired IRE\\/IRP binding. Both the C33>U and A40G mutations (the first identified mutation for HHCS) showed a dramatically decreased binding to IRP1\\/IRP2 protein, compared to the normal IRE RNA. Surprisingly, a decrease in L-ferritin mRNA levels was observed in the affected patient compared to controls suggesting a mechanism of transcriptional negative feedback by high intracellular L-ferritin protein levels not described heretofore. Taken together, spontaneous mutation in the IRE of L-ferritin may cause non-H-HCS by the same mechanism as HHCS. In addition, under abnormal circumstances, the protein level of L-ferritin may be principally controlled by post

  2. Fuel element

    International Nuclear Information System (INIS)

    Kennedy, S.T.

    1982-01-01

    A nuclear reactor fuel element wherein a stack of nuclear fuel is prevented from displacement within its sheath by a retainer comprising a tube member which is radially expanded into frictional contact with the sheath by means of a captive ball within a tapered bore. (author)

  3. Transactinide elements

    International Nuclear Information System (INIS)

    Hemingway, J.D.

    1975-01-01

    The review is covered in sections, entitled: predicted nuclear properties - including closed shells, decay characteristics; predicted chemical properties - including electronic structure and calculated properties, X-radiation, extrapolated chemical properties, separation chemistry; methods of synthesis; the natural occurrence of superheavy elements. (U.K.)

  4. Regulation of 5'-adenosine monophosphate deaminase in the freeze tolerant wood frog, Rana sylvatica.

    Science.gov (United States)

    Dieni, Christopher A; Storey, Kenneth B

    2008-04-22

    . Maintenance of long term viability under the ischemic conditions in frozen muscle requires attention to the control of cellular energetics. Differential regulatory controls on AMPD by mechanisms including binding to muscle proteins, actions allosteric effectors, glucose and temperature effects and reversible phosphorylation adjust enzyme function for an optimal role in controlling cellular adenylate levels in ischemic frozen muscle. Stable modification of AMPD properties via freeze-responsive phosphorylation may contribute both to AMPD control and to coordinating AMPD function with other enzymes of energy metabolism in cold ischemic muscle.

  5. Separation and Recycling for Rare Earth Elements by Homogeneous Liquid-Liquid Extraction (HoLLE Using a pH-Responsive Fluorine-Based Surfactant

    Directory of Open Access Journals (Sweden)

    Shotaro Saito

    2015-08-01

    Full Text Available A selective separation and recycling system for metal ions was developed by homogeneous liquid-liquid extraction (HoLLE using a fluorosurfactant. Sixty-two different elemental ions (e.g., Ag, Al, As, Au, B, Ba, Be, Bi, Ca, Cd, Ce, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Gd, Ge, Hf, Hg, Ho, In, Ir, La, Lu, Mg, Mn, Mo, Nb, Nd, Ni, Os, P, Pb, Pd, Pr, Pt, Re, Rh, Ru, Sb, Sc, Se, Si, Sm, Sn, Sr, Ta, Tb, Te, Ti, Tl, Tm, V, W, Y, Yb, Zn, and Zr were examined. By changing pH from a neutral or alkaline solution (pH ≥ 6.5 to that of an acidic solution (pH < 4.0, gallium, zirconium, palladium, silver, platinum, and rare earth elements were extracted at >90% efficiency into a sedimented Zonyl FSA® (CF3(CF2n(CH22S(CH22COOH, n = 6–8 liquid phase. Moreover, all rare earth elements were obtained with superior extraction and stripping percentages. In the recycling of rare earth elements, the sedimented phase was maintained using a filter along with a mixed solution of THF and 1 M sodium hydroxide aqueous solution. The Zonyl FSA® was filtrated and the rare earth elements were recovered on the filter as a hydroxide. Furthermore, the filtrated Zonyl FSA was reusable by conditioning the subject pH.

  6. Characterization of radiation-induced products of thymidine 3'-monophosphate and thymidylyl (3'→5') thymidine by high-performance liquid chromatography and laser-desorption fourier-transform mass spectrometry

    International Nuclear Information System (INIS)

    Yoshida, H.; Hettich, R.L.

    1994-01-01

    High-performance liquid chromatography (HPLC) and laser-desorption Fourier-transform mass spectrometry (LD FTMS) have been applied for direct measurements of radiation-induced products of nucleic acid constituents containing thymidine. Laser desorption FTMS could be used for the direct detection (neither hydrolyzed nor derivatized) of X-ray-induced decomposition products of aqueous thymidine monophosphate. After these initial experiments, a variety of hydrogenated and hydroxylated thymine standards were acquired and examined by FTMS to assist in the identification of unknown radiation-induced decomposition products of thymine-containing nucleotides and dinucleotides. To extend these studies to dinucleotides, the radiation-induced products generated by the gamma radiolysis of thymidylyl (3'→5') thymidine (TpT) were isolated by reverse-phase HPLC and identified by LD FTMS. Thymine and thymidine 3'-monophosphate were observed as the major products in this case. Several of the minor products of the HPLC profile were pooled in a single fraction and characterized simultaneously by LD FTMS. The resulting mass spectra indicated the presence of hydroxy-5,6-dihydothymidine monophosphate, 5,6-dihydrothymidine monophosphate and thymidine monophosphate, thymine glycol, hydroxy-5,6-dihydrothymine, 5-hydroxy-methyl-uracil and 5,6-dihydrothymine. The combination of HPLC purification and LD FTMS structural characterization provides a useful tool for the direct measurement of radiation-induced products of nucleotides and dinucleotides. 28 refs., 6 figs., 2 tabs

  7. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I

    International Nuclear Information System (INIS)

    Seiki, Motoharu; Inoue, Junichiro; Hidaka, Makoto; Yoshida, Mitsuaki

    1988-01-01

    The pX sequence of human T-cell leukemia virus type I codes for two nuclear proteins, p40 tax and p27 rex and a cytoplasmic protein, p21 X-III . p40 tax activates transcription from the long terminal repeat (LTR), whereas p27 rex modulates posttranscriptional processing to accumulate gag and env mRNAs that retain intron sequences. In this paper, the authors identify two cis-acting sequence elements needed for regulation by p27 rex : a 5' splice signal and a specific sequence in the 3' LTR. These two sequence elements are sufficient for regulation by p27 rex ; expression of a cellular gene (metallothionein I) became sensitive to rex regulation when the LTR was inserted at the 3' end of this gene. The requirement for these two elements suggests and unusual regulatory mechanism of RNA processing in the nucleus

  8. Boundary Element Analysis of the Steady-state Response of an Elastic Half-Space to a Moving Force on its Surface

    DEFF Research Database (Denmark)

    Andersen, Lars; Nielsen, Søren R. K.

    2003-01-01

    The paper deals with the boundary element method formulation of the steady-state wave propagation through elastic media due to a source moving with constant velocity. The Greens' function for the three-dimensional full-space is formulated in a local frame of reference following the source...... is approximated, but the error which is introduced in this way is insignificant. Numerical examples are given for a moving rectangular load on an elastic half-space. The result from a boundary element code based on the derived Green's function are compared with a semi-analytic solution....

  9. Behavior of the monophosphate tungsten bronzes (PO2)4(WO3)2m (m = 7 and 8) in the course of electrochemical lithium insertion

    International Nuclear Information System (INIS)

    Martinez-de la Cruz, A.; Longoria Rodriguez, F.E.; Gonzalez, Lucy T.; Torres-Martinez, Leticia M.

    2007-01-01

    The electrochemical lithium insertion process has been studied in the family of monophosphate tungsten bronzes (PO 2 ) 4 (WO 3 ) 2m , where m = 7 and 8. Structural changes in the pristine oxides were followed as lithium insertion proceeded. Through potentiostatic intermittent technique the different processes which take place in the cathode during the discharge of the cell were analyzed. The nature of the bronzes Li x (PO 2 ) 4 (WO 3 ) 2m formed was determined by in situ X-ray diffraction experiments. These results have allowed establishing a correlation with the reversible/irreversible processes detected during the electrochemical lithium insertion

  10. Influence of easily ionised elements on the delayed responses of the emission intensities of an analyte in a power modulated U-shaped argon stabilised DC arc plasma with an aerosol supply

    Directory of Open Access Journals (Sweden)

    MIROSLAV KUZMANOVIC

    2005-09-01

    Full Text Available The current of a U-shaped argon stabilised DC arc was square modulated with a 40 Hz repetition frequency between 6 and 3 A. The delayed line intensity responses to the modulation of the arc current were investigated using calcium as a representative analyte. The intensities of both the atomic and ionic lines were monitored at different distances from the arc axis in the presence of various concentrations of the easily ionised element. Temporal evolutions were monitored on a millisecond time scale. It was found that the responses of the line intesity to the arc current change strongly depended on the observed radial position, especially in the vicinity of the arc axis. The obtained results showed a significant influence of even small amounts of the easily ionised element on the excitation and transport of the analyte and indicated a way of possibly improving the analytical capabilities of the excitation source.

  11. New elements

    International Nuclear Information System (INIS)

    Flerov, G.

    1976-01-01

    The history is briefly described of the investigation of superheavy elements at the Joint Institute for Nuclear Research at Dubna. The significance of the investigation is assessed from the point of view of the nuclear structure study and major problems encountered in experimental efforts are indicated. Current experimental methods aiming at the discovery or the production of superheavy nuclei with Z approximately 114 are listed. (I.W.)

  12. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  13. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  14. Varying response of the concentration and content of soybean seed mineral elements, carbohydrates, organic acids, amino acids, protein, and oil to phosphorus starvation and CO2 enrichment

    Science.gov (United States)

    A detailed investigation of the concentration (g-1 seed weight) and content (g plant-1) of seed mineral elements and metabolic profile under phosphorus (P) starvation at ambient (aCO2) and elevated carbon dioxide (eCO2) in soybean is limited. Soybean plants were grown in a controlled environment at ...

  15. Neither Reb1p nor poly(dA*T) elements are responsible for the highly specific chromatin organization at the ILV1 promoter

    DEFF Research Database (Denmark)

    Moreira, José Manuel Alfonso; Hörz, Wolfram; Holmberg, Steen

    2001-01-01

    Analysis of the chromatin structure at the yeast ILV1 locus revealed highly positioned nucleosomes covering the entire locus except for a hypersensitive site in the promoter region. All previously identified cis-acting elements required for GCN4-independent ILV1 basal level transcription, includi...

  16. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake.

    Science.gov (United States)

    Shirokova, L S; Pokrovsky, O S; Moreva, O Yu; Chupakov, A V; Zabelina, S A; Klimov, S I; Shorina, N V; Vorobieva, T Ya

    2013-10-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa-0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30°C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70-80% to only 20-30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90-98% in most summers and winters to approximately 60-70% in August 2010. During this hot summer, measurable and significant (>30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved (organic matter by heterotrophic aerobic bacterioplankton and 3) photo-degradation of DOM and photo-chemical liberation of organic-bound TE. While the first process may have caused significant decreases in the total dissolved concentration of micronutrients (a factor of 2 to 5 for Cr, Mn, Fe, Ni, Cu, Zn and Cd and a factor of >100 for Co), the second and third factors could have brought

  17. Effects of adenosine monophosphate on induction of therapeutic hypothermia and neuronal damage after cardiopulmonary resuscitation in rats.

    Science.gov (United States)

    Knapp, Jürgen; Schneider, Andreas; Nees, Corinna; Bruckner, Thomas; Böttiger, Bernd W; Popp, Erik

    2014-09-01

    Animal studies and pathophysiological considerations suggest that therapeutic hypothermia after cardiopulmonary resuscitation is the more effective the earlier it is induced. Therefore this study is sought to examine whether pharmacological facilitated hypothermia by administration of 5'-adenosine monophosphate (AMP) is neuroprotective in a rat model of cardiac arrest (CA) and resuscitation. Sixty-one rats were subjected to CA. After 6 min of ventricular fibrillation advanced cardiac life support was started. After successful return of spontaneous circulation (ROSC, n=40), animals were randomized either to placebo group (n=14) or AMP group (800 mg/kg body weight, n=14). Animals were kept at an ambient temperature of 18°C for 12 h after ROSC and core body temperature was measured using a telemetry temperature probe. Neuronal damage was analyzed by counting Nissl-positive (i.e. viable) neurons and TUNEL-positive (i.e. apoptotic) cells in coronal brain sections 7 days after ROSC. Functional status evaluated on days 1, 3 and 7 after ROSC by a tape removal test. Time until core body temperature dropped to <34.0°C was 31 min [28; 45] in AMP-treated animals and 125 min [90; 180] in the control group (p=0.003). Survival until 7 days after ROSC was comparable in both groups. Also number of Nissl-positive cells (AMP: 1 [1; 7] vs. placebo: 2 [1; 3] per 100 pixel; p=0.66) and TUNEL-positive cells (AMP: 56 [44; 72] vs. placebo: 53 [41; 67] per 100 pixel; p=0.70) did not differ. Neither did AMP affect functional neurological outcome up to 7 days after ROSC. Mean arterial pressure 20 min after ROSC was 49 [45; 55] mmHg in the AMP group in comparison to 91 [83; 95] mmHg in the control group (p<0.001). Although application of AMP reduced the time to reach a core body temperature of <34°C neither survival was improved nor neuronal damage attenuated. Reason for this is probably induction of marked hypotension as an adverse reaction to AMP treatment. Copyright © 2014 Elsevier

  18. Probabilistic finite elements

    Science.gov (United States)

    Belytschko, Ted; Wing, Kam Liu

    1987-01-01

    In the Probabilistic Finite Element Method (PFEM), finite element methods have been efficiently combined with second-order perturbation techniques to provide an effective method for informing the designer of the range of response which is likely in a given problem. The designer must provide as input the statistical character of the input variables, such as yield strength, load magnitude, and Young's modulus, by specifying their mean values and their variances. The output then consists of the mean response and the variance in the response. Thus the designer is given a much broader picture of the predicted performance than with simply a single response curve. These methods are applicable to a wide class of problems, provided that the scale of randomness is not too large and the probabilistic density functions possess decaying tails. By incorporating the computational techniques we have developed in the past 3 years for efficiency, the probabilistic finite element methods are capable of handling large systems with many sources of uncertainties. Sample results for an elastic-plastic ten-bar structure and an elastic-plastic plane continuum with a circular hole subject to cyclic loadings with the yield stress on the random field are given.

  19. JAC2D: A two-dimensional finite element computer program for the nonlinear quasi-static response of solids with the conjugate gradient method

    International Nuclear Information System (INIS)

    Biffle, J.H.; Blanford, M.L.

    1994-05-01

    JAC2D is a two-dimensional finite element program designed to solve quasi-static nonlinear mechanics problems. A set of continuum equations describes the nonlinear mechanics involving large rotation and strain. A nonlinear conjugate gradient method is used to solve the equations. The method is implemented in a two-dimensional setting with various methods for accelerating convergence. Sliding interface logic is also implemented. A four-node Lagrangian uniform strain element is used with hourglass stiffness to control the zero-energy modes. This report documents the elastic and isothermal elastic/plastic material model. Other material models, documented elsewhere, are also available. The program is vectorized for efficient performance on Cray computers. Sample problems described are the bending of a thin beam, the rotation of a unit cube, and the pressurization and thermal loading of a hollow sphere

  20. Decrease of concentration and colloidal fraction of organic carbon and trace elements in response to the anomalously hot summer 2010 in a humic boreal lake

    International Nuclear Information System (INIS)

    Shirokova, L.S.; Pokrovsky, O.S.; Moreva, O.Yu.; Chupakov, A.V.; Zabelina, S.A.; Klimov, S.I.; Shorina, N.V.; Vorobieva, T.Ya.

    2013-01-01

    The colloidal distribution and size fractionation of organic carbon (OC), major elements and trace elements (TE) were studied in a seasonally stratified, organic-rich boreal lake, Lake Svyatoe, located in the European subarctic zone (NW Russia, Arkhangelsk region). This study took place over the course of 4 years in both winter and summer periods using an in situ dialysis technique (1 kDa, 10 kDa and 50 kDa) and traditional frontal filtration and ultrafiltration (5, 0.22 and 0.025 μm). We observed a systematic difference in dissolved elements and colloidal fractions between summer and winter periods with the highest proportion of organic and organo-ferric colloids (1 kDa–0.22 μm) observed during winter periods. The anomalously hot summer of 2010 in European Russia produced surface water temperatures of approximately 30 °C, which were 10° above the usual summer temperatures and brought about crucial changes in element speciation and size fractionation. In August 2010, the concentration of dissolved organic carbon (DOC) decreased by more than 30% compared to normal period, while the relative proportion of organic colloids decreased from 70–80% to only 20–30% over the full depth of the water column. Similarly, the proportion of colloidal Fe decreased from 90–98% in most summers and winters to approximately 60–70% in August 2010. During this hot summer, measurable and significant (> 30% compared to other periods) decreases in the colloidal fractions of Ca, Mg, Sr, Ba, Al, Ti, Ni, As, V, Co, Y, all rare earth elements (REEs), Zr, Hf, Th and U were also observed. In addition, dissolved ( 100 for Co), the second and third factors could have brought about the decrease of allochthonous DOC concentration as well as the concentration and proportion of organic and organo-mineral colloidal forms of non-essential low-soluble trace elements present in the form of organic colloids (Al, Y, Ti, Zr, Hf, Th, Pb, all REEs). It can be hypothesized that climate warming in

  1. JAC3D -- A three-dimensional finite element computer program for the nonlinear quasi-static response of solids with the conjugate gradient method

    International Nuclear Information System (INIS)

    Biffle, J.H.

    1993-02-01

    JAC3D is a three-dimensional finite element program designed to solve quasi-static nonlinear mechanics problems. A set of continuum equations describes the nonlinear mechanics involving large rotation and strain. A nonlinear conjugate gradient method is used to solve the equation. The method is implemented in a three-dimensional setting with various methods for accelerating convergence. Sliding interface logic is also implemented. An eight-node Lagrangian uniform strain element is used with hourglass stiffness to control the zero-energy modes. This report documents the elastic and isothermal elastic-plastic material model. Other material models, documented elsewhere, are also available. The program is vectorized for efficient performance on Cray computers. Sample problems described are the bending of a thin beam, the rotation of a unit cube, and the pressurization and thermal loading of a hollow sphere

  2. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  3. OXIDACIÓN DE p -NITROFENOL USANDO TiO 2 -ADENOSINA MONOFOSFATO I OXIDATION OF p -NITROPHENOL USING TiO 2 -ADENOSIN MONOPHOSPHATE

    Directory of Open Access Journals (Sweden)

    Carlos F. Rivas

    2018-04-01

    Full Text Available The surface of TiO2 was modified with the nucleotides adenosine 3’-monophosphate (AMP’3 and Adenosine 5’-monophosphate (AMP’5. The adsorption of nucleotides was adjusted to Langmuir ́s adsorption model, determining that the optimal condition for TiO 2 modification was at neutral pH. UV-Visible Diffuse Reflectance and IR Attenuated Total Reflectance spectra show that the chemisorption of nucleotides take placed on TiO 2 anatase. The new catalysts (TiO 2 -nucleotide improved the photodegradation of p -nitrophenol in a wide range of pH as compared with the titanium dioxide precursor. Most photoactivity was generated by using the new photocatalytic in the degradation of p -nitrophenol at pH = 6, obtaining high values for the pseudo first order kinetic constant (0.0254 min -1 and 0.0244 min -1 for TiO 2 -AMP’3 and TiO 2 -AMP’5, respectively. For all pH, the trend obtained for the photodegradation was: TiO 2 -AMP ́3 @ TiO 2 -AMP’5 > TiO 2 . Langmuir-Hinshelwood kinetics shows that the contribution of the surface reac tion rate governs the oxidation of the contaminant.

  4. Fuel element

    International Nuclear Information System (INIS)

    Hirose, Yasuo.

    1982-01-01

    Purpose: To increase the plenum space in a fuel element used for a liquid metal cooled reactor. Constitution: A fuel pellet is secured at one end with an end plug and at the other with a coil spring in a tubular container. A mechanism for fixing the coil spring composed of a tubular unit is mounted by friction with the inner surface of the tubular container. Accordingly, the recoiling force of the coil spring can be retained by fixing mechanism with a small volume, and since a large amount of plenum space can be obtained, the internal pressure rise in the cladding tube can be suppressed even if large quantities of fission products are discharged. (Kamimura, M.)

  5. Low-temperature-induced expression of rice ureidoglycolate amidohydrolase is mediated by a C-repeat/dehydration-responsive element that specifically interacts with rice C-repeat-binding factor 3

    Directory of Open Access Journals (Sweden)

    Juan eLi

    2015-11-01

    Full Text Available Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH, which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT but not abscisic acid- (ABA regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH. Series deletions revealed that a minimal region between -522 and -420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE element localized at position -434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily.

  6. Regulation of cyclooxygenase-2 expression by cAMP response element and mRNA stability in a human airway epithelial cell line exposed to zinc

    Science.gov (United States)

    Exposure to zinc-laden particulate matter in ambient and occupational settings has been associated with proinflammatory responses in the lung. Cyclooxygenase 2-derived eicosanoids are important modulators of airway inflammation. In this study, we characterized the transcriptional...

  7. Influence of three-dimensional reconstruction method for building a model of the cervical spine on its biomechanical responses: A finite element analysis study

    Directory of Open Access Journals (Sweden)

    Iman Zafarparandeh

    2016-03-01

    Full Text Available In some finite element analysis studies of models of sections of the spine, the three-dimensional solid model is built by assuming symmetry about the mid-sagittal plane of the section, whereas in other studies, the model is built from the exact geometry of the section. The influence of the method used to build the solid model on model parameters, in the case of the cervical spine, has not been reported in the literature. This issue is the subject of this study, with the section being C2–C7, the applied loadings being extension, flexion, left lateral bending, and right axial rotation (each of magnitude 1 Nm, and the model parameters determined being rotation, intradiskal pressure, and facet load at each of the segments. When all the parameter results were considered, it was found that, by and large, the influence of solid model construction method used (exact geometry vs assumption of symmetry about the mid-sagittal plane of the section was marginal. As construction of a symmetric finite element model requires less time and effort, construction of an asymmetric model may be justified in special cases only.

  8. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic Conditions at Different pH and Alkalinity

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available Biomass and tissue elemental differences were quantified for lettuce grown in deep-water conventional hydroponic conditions at two pH and alkalinity conditions. Nutrient solutions were created using inorganic salts and either reverse osmosis (RO water or municipal water with high alkalinity. Three treatments were evaluated: (a nutrient solution created with reverse osmosis (RO water and maintained at pH 5.8 (H5; (b same as H5 but maintained at pH 7.0 (H7; and (c nutrient solution created using municipal water and maintained at pH 7.0, referred to as HA7. Averaged across three trials, the HA7 and H7 treatments produced 26% less shoot fresh weight (FW than the H5 treatment with an 18% reduction in dry weight (DW. The H5 treatment had the least biomass in root FW and DW. In tissue elemental analyses, both the pH 7.0 treatments showed lower concentrations than H5 in Cu, N, Mo, and Sr, and increased concentrations in Ba, Mg, Na, and Zn. There were no differences in Al, C, Ca, Fe, K, Mn, Ni, P, S, and Si concentrations among treatments (p = 0.05. The results from this experiment can be used to isolate the effects of pH and alkalinity in aquaponic conditions where pH and alkalinity will mimic HA7 conditions.

  9. Potential of Ranunculus acris L. for biomonitoring trace element contamination of riverbank soils: photosystem II activity and phenotypic responses for two soil series.

    Science.gov (United States)

    Marchand, Lilian; Lamy, Pierre; Bert, Valerie; Quintela-Sabaris, Celestino; Mench, Michel

    2016-02-01

    Foliar ionome, photosystem II activity, and leaf growth parameters of Ranunculus acris L., a potential biomonitor of trace element (TE) contamination and phytoavailability, were assessed using two riverbank soil series. R. acris was cultivated on two potted soil series obtained by mixing a TE (Cd, Cu, Pb, and Zn)-contaminated technosol with either an uncontaminated sandy riverbank soil (A) or a silty clay one slightly contaminated by TE (B). Trace elements concentrations in the soil-pore water and the leaves, leaf dry weight (DW) yield, total leaf area (TLA), specific leaf area (SLA), and photosystem II activity were measured for both soil series after a 50-day growth period. As soil contamination increased, changes in soluble TE concentrations depended on soil texture. Increase in total soil TE did not affect the leaf DW yield, the TLA, the SLA, and the photosystem II activity of R. acris over the 50-day exposure. The foliar ionome did not reflect the total and soluble TE concentrations in both soil series. Foliar ionome of R. acris was only effective to biomonitor total and soluble soil Na concentrations in both soil series and total and soluble soil Mo concentrations in the soil series B.

  10. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Science.gov (United States)

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  11. An Examination of the Role of L-Glutamate and Inosine 5'-Monophosphate in Hedonic Taste-Guided Behavior by Mice Lacking the T1R1 + T1R3 Receptor.

    Science.gov (United States)

    Blonde, Ginger D; Spector, Alan C

    2017-06-01

    The heterodimeric T1R1 + T1R3 receptor is considered critical for normal signaling of L-glutamate and 5'-ribonucleotides in the oral cavity. However, some taste-guided responsiveness remains in mice lacking one subunit of the receptor, suggesting that other receptors are sufficient to support some behaviors. Here, mice lacking both receptor subunits (KO) and wild-type (WT, both n = 13) mice were tested in a battery of behavioral tests. Mice were trained and tested in gustometers with a concentration series of Maltrin-580, a maltodextrin, in a brief-access test (10-s trials) as a positive control. Similar tests followed with monosodium glutamate (MSG) with and without the ribonucleotide inosine 5'-monophosphate (IMP), but always in the presence of the epithelial sodium channel blocker amiloride (A). Brief-access tests were repeated following short-term (30-min) and long-term (48-h) exposures to MSG + A + IMP and were also conducted with sodium gluconate replacing MSG. Finally, progressive ratio tests were conducted with Maltrin-580 or MSG + A + IMP, to assess appetitive behavior while minimizing satiation. Overall, MSG generated little concentration-dependent responding in either food-restricted WT or KO mice, even in combination with IMP. However, KO mice licked less to the amino acid stimuli, a measure of consummatory behavior in the brief-access tests. In contrast, both groups initiated a similar number of trials and had a similar breakpoint in the progressive ratio task, both measures of appetitive (approach) behavior. Collectively, these results suggest that while the T1R1 + T1R3 receptor is necessary for consummatory responding to MSG (+IMP), other receptors are sufficient to maintain appetitive responding to this "umami" stimulus complex in food-restricted mice. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    Science.gov (United States)

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  13. Transboundary geophysical mapping of geological elements and salinity distribution critical for the assessment of future sea water intrusion in response to sea level rise

    Directory of Open Access Journals (Sweden)

    F. Jørgensen

    2012-07-01

    Full Text Available Geophysical techniques are increasingly being used as tools for characterising the subsurface, and they are generally required to develop subsurface models that properly delineate the distribution of aquifers and aquitards, salt/freshwater interfaces, and geological structures that affect groundwater flow. In a study area covering 730 km2 across the border between Germany and Denmark, a combination of an airborne electromagnetic survey (performed with the SkyTEM system, a high-resolution seismic survey and borehole logging has been used in an integrated mapping of important geological, physical and chemical features of the subsurface. The spacing between flight lines is 200–250 m which gives a total of about 3200 line km. About 38 km of seismic lines have been collected. Faults bordering a graben structure, buried tunnel valleys, glaciotectonic thrust complexes, marine clay units, and sand aquifers are all examples of geological structures mapped by the geophysical data that control groundwater flow and to some extent hydrochemistry. Additionally, the data provide an excellent picture of the salinity distribution in the area and thus provide important information on the salt/freshwater boundary and the chemical status of groundwater. Although the westernmost part of the study area along the North Sea coast is saturated with saline water and the TEM data therefore are strongly influenced by the increased electrical conductivity there, buried valleys and other geological elements are still revealed. The mapped salinity distribution indicates preferential flow paths through and along specific geological structures within the area. The effects of a future sea level rise on the groundwater system and groundwater chemistry are discussed with special emphasis on the importance of knowing the existence, distribution and geometry of the mapped geological elements, and their control on the groundwater salinity distribution is assessed.

  14. SIMULTANEOUS ANALYSIS OF AZIDOTHYMIDINE AND ITS MONOPHOSPHATE, DIPHOSPHATE AND TRIPHOSPHATE DERIVATIVES IN BIOLOGICAL-FLUIDS, TISSUE AND CULTURED-CELLS BY A RAPID HIGH-PERFORMANCE LIQUID-CHROMATOGRAPHIC METHOD

    NARCIS (Netherlands)

    MOLEMA, G; JANSEN, RW; Visser, Jan; MEIJER, DKF

    1992-01-01

    A rapid high-performance liquid chromatographic (HPLC) method for the simultaneous analysis of the antiviral drug azidothymidine (AZT), AZT monophosphate, AZT diphosphate and AZT triphosphate, with ultraviolet detection in the nanomolar range, is described. Determination of these compounds in vitro

  15. Predicting the flexure response of wood-plastic composites from uni-axial and shear data using a finite-element model

    Science.gov (United States)

    Scott E. Hamel; John C. Hermanson; Steven M. Cramer

    2014-01-01

    Wood-plastic composites (WPCs), commonly used in residential decks and railings, exhibit mechanical behavior that is bimodal, anisotropic, and nonlinear viscoelastic. They exhibit different stress-strain responses to tension and compression, both of which are nonlinear. Their mechanical properties vary with respect to extrusion direction, their deformation under...

  16. Light and abiotic stresses regulate the expression of GDP-L-galactose phosphorylase and levels of ascorbic acid in two kiwifruit genotypes via light-responsive and stress-inducible cis-elements in their promoters.

    Science.gov (United States)

    Li, Juan; Liang, Dong; Li, Mingjun; Ma, Fengwang

    2013-09-01

    Ascorbic acid (AsA) plays an essential role in plants by protecting cells against oxidative damage. GDP-L-galactose phosphorylase (GGP) is the first committed gene for AsA synthesis. Our research examined AsA levels, regulation of GGP gene expression, and how these are related to abiotic stresses in two species of Actinidia (kiwifruit). When leaves were subjected to continuous darkness or light, ABA or MeJA, heat, or a hypoxic environment, we found some correlation between the relative levels of GGP mRNA and AsA concentrations. In transformed tobacco plants, activity of the GGP promoter was induced by all of these treatments. However, the degree of inducibility in the two kiwifruit species differed among the GGP promoter deletions. We deduced that the G-box motif, a light-responsive element, may have an important function in regulating GGP transcripts under various light conditions in both A. deliciosa and A. eriantha. Other elements such as ABRE, the CGTCA motif, and HSE might also control the promoter activities of GGP in kiwifruit. Altogether, these data suggest that GGP expression in the two kiwifruit species is regulated by light or abiotic stress via the relative cis-elements in their promoters. Furthermore, GGP has a critical role in modulating AsA concentrations in kiwifruit species under abiotic stresses.

  17. The influence of dibutyryl adenosine cyclic monophosphate on cell proliferation in the epithelium of the jejunal crypts, the colonic crypts and in colonic carcinomata of rat.

    Science.gov (United States)

    Tutton, P J; Barkla, D H

    1980-01-01

    1. Cell proliferation in the jejunal crypts, the colonic crypts and in dimethylhydrazine (DMH)-induced adenocarcinomata of rat colon was measured using a stathmokinetic technique. 2. Dibutryl cyclic adneosine monophosphate (dibutyryl cAMP) was found to inhibit cell proliferation in colonic crypts and in colonic adenocarcinomata. 3. Dibutryl cAMP at very high doses was found to inhibit jejunal crypt cell proliferation but at lower doses was found to accelerate jejunal crypt cell proliferation. 4. Neither bilateral adrenalectomy nor chemical sympathectomy was found to abolish the ability of dibutryl cAMP to stimulate jejunal crypt cell proliferation. 5. The present results are difficult to interpret in terms of known hormonal influences on cell proliferation in the tissues examined and of established actions, of these hormones on cyclic nucleotide metabolism in other tissues.

  18. Characterization of free radicals in γ-irradiated polycrystalline uridine 5'-monophosphate: a study combining ESR, spin-trapping and HPLC

    International Nuclear Information System (INIS)

    Hiraoka, W.; Kuwabara, M.; Sato, F.

    1991-01-01

    Free radicals generated in γ-irradiated polycrystalline uridine 5'-monophosphate (5'-UMP) were studied by ESR, spin-trapping and high-performance liquid chromatography (HPLC). Although HPLC ultimately gave four spin-adducts, one component that was originally present disappeared during HPLC. Spin adducts due to two types of C6 radials were identified. One of these was thought to be formed by electron addition and subsequent protonation at the C6 position, and the other was presumed to be produced by electron addition and subsequent protonation at the O 4 position. The spin adducts derived from the C5 and C5' radicals were also identified. The spin adduct that disappeared during HPLC was thought to correspond to the C4'-centred radical. Computer simulation of ESR spectra was carried out to estimate the hyperfine splitting constants. (author)

  19. Studies of short-lived radicals in the. gamma. -irradiated aqueous solution of uridine-5'-monophosphate by the spin-trapping method and the liquid chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Kominami, S [Hiroshima Univ. (Japan); Rokushika, S; Hatano, H

    1976-12-01

    An aerated aqueous solution of uridine-5'-monophosphate was ..gamma..-irradiated with 2-methyl-2-nitrosopropane as a spin-trapping reagent. Liquid chromatography was applied to separate the stable nitroxide radicals in the irradiated solution. The radicals were detected by U.V. and e.s.r. spectrometry. The e.s.r. detection showed four peaks in the chromatogram. The orcinol method for detection of the residual sugar moieties was applied before and after reduction of the base to determine the existence of the 5,6-double bond for the molecules in each fraction. From the combined results of the e.s.r. and orcinol methods, the short-lived radicals which were trapped by 2-methyl-2-nitrosopropane were identified as radicals of N-1 and C-6 positions of the base moiety and t-butyl radicals which was the radiolytic product of the trapping reagent.

  20. Comparison of lime and fly ash as amendments to acidic coal mine refusej growth responses and trace-element uptake of two grasses

    Energy Technology Data Exchange (ETDEWEB)

    Jasrow, J. D.; Zimmerman, C. A.; Dvorak, A. J.; Hinchman, R. R.

    1979-10-01

    Two commonly used revegetation species, Kentucky 31 tall fescue (Festuca arundinacea Schreb.) and Lincoln smooth brome (Bromus inermis Leyss.) were grown for 60 days in pots containing coarse coal mine refus