WorldWideScience

Sample records for monomolecular reversible reactions

  1. Chemical reactions in organic monomolecular layers. Condensation of hydrazine on carbonyl functions

    International Nuclear Information System (INIS)

    Rosilio, Charles; Ruaudel-Teixier, Annie.

    1976-01-01

    Evidence is given for chemical reactions of hydrazine (NH 2 -NH 2 ) with different carbonyl functional groups of organic molecules in the solid state, in monomolecular layer structures. The condensation of hydrazine with these molecules leads to conjugated systems by bridging the N-N links, to cyclizations, and also to polycondensations. The reactions investigated were followed up by infrared spectrophotometry, by transmission and metallic reflection. These chemical reactions revealed in the solid phase constitute a polycondensation procedure which is valuable in obtaining organized polymers in monomolecular layers [fr

  2. Photo- and radiation-chemical stability of molecules. Reactions of monomolecular hydrogen atom splitting off

    International Nuclear Information System (INIS)

    Plotnikov, V.G.; Ovchinnikov, A.A.

    1978-01-01

    In the review of works published up to 1978 one of the main problems of radiation chemistry is discussed, namely the relationship between the structure of organic molecules and their resistance to the effect of ionizing radiation. Theoretical aspects of this problem are considered for reactions of monomolecular hydrogen atom splitting off. It is shown that the radical yield in low-temperature radiation-chemical experiments is connected with the position of lower triplet states of molecules, ionization potentials, polarity of medium and the energy of C-H bonds in cation radicals

  3. Enzymatic reactions in reversed micelles

    NARCIS (Netherlands)

    Hilhorst, M.H.

    1984-01-01

    It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
    In Chapter 1 the present knowledge about reversed micelles and

  4. Chemical reactions in reverse micelle systems

    Science.gov (United States)

    Matson, Dean W.; Fulton, John L.; Smith, Richard D.; Consani, Keith A.

    1993-08-24

    This invention is directed to conducting chemical reactions in reverse micelle or microemulsion systems comprising a substantially discontinuous phase including a polar fluid, typically an aqueous fluid, and a microemulsion promoter, typically a surfactant, for facilitating the formation of reverse micelles in the system. The system further includes a substantially continuous phase including a non-polar or low-polarity fluid material which is a gas under standard temperature and pressure and has a critical density, and which is generally a water-insoluble fluid in a near critical or supercritical state. Thus, the microemulsion system is maintained at a pressure and temperature such that the density of the non-polar or low-polarity fluid exceeds the critical density thereof. The method of carrying out chemical reactions generally comprises forming a first reverse micelle system including an aqueous fluid including reverse micelles in a water-insoluble fluid in the supercritical state. Then, a first reactant is introduced into the first reverse micelle system, and a chemical reaction is carried out with the first reactant to form a reaction product. In general, the first reactant can be incorporated into, and the product formed in, the reverse micelles. A second reactant can also be incorporated in the first reverse micelle system which is capable of reacting with the first reactant to form a product.

  5. Mass transfer with complex reversible chemical reactions. II: Parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, Geert; van Beckum, F.P.H.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  6. Mass transfer with complex reversible chemical reactions. II: parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, van F.P.H.; van Swaaij, W.P.M.

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  7. Chemical boundary layers in CVD II. Reversible reactions

    NARCIS (Netherlands)

    Croon, de M.H.J.M.; Giling, L.J.

    1990-01-01

    In addition to irreversible reactions, which were treated in part I, reversible reactions in the gas phase have beenstudied using the concept of the chemical boundary layer. The analysis is given for the situations in which either the forwardor the back reaction is dominant. Two conceptual models

  8. Simulation of square wave voltammetry of three electrode reactions coupled by two reversible chemical reactions

    OpenAIRE

    Lovrić, Milivoj

    2017-01-01

    Three fast and reversible electrode reactions that are connected by two reversible chemical reactions that are permanently in the equilibrium are analysed theoretically for square wave voltammetry. The dependence of peak potentials on the dimensionless equilibrium constants of chemical reactions is calculated. The influence of the basic thermodynamic parameters on the square wave voltammetric responses is analysed.

  9. The Forward-Reverse Algorithm for Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2015-01-01

    In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

  10. Time reversal tests in polarized neutron reactions

    International Nuclear Information System (INIS)

    Asahi, Koichiro; Bowman, J.D.; Crawford, B.

    1998-01-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). In recent years the nuclear weak interaction has been studied in the compound nucleus via parity violation. The observed parity-violating effects are strongly enhanced by nuclear structure. The predictions are that the interaction of polarized neutrons with polarized nuclear targets could be also used to perform sensitive tests of time-reversal-violation because of the nuclear enhancements. The author has designed experiments to search for time-reversal violation in neutron-nucleus interactions. He has also developed techniques to polarize neutrons with laser-polarized 3 He gas targets. Using the polarized 3 He neutron spin filter, he has performed two experiments at LANSCE: an absolute neutron beam polarization measurement with an accuracy of 0.2--0.3% and a neutron spin-rotation measurement on a 139 La sample

  11. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  12. Analysis of Brownian Dynamics Simulations of Reversible Bimolecular Reactions

    KAUST Repository

    Lipková, Jana

    2011-01-01

    A class of Brownian dynamics algorithms for stochastic reaction-diffusion models which include reversible bimolecular reactions is presented and analyzed. The method is a generalization of the λ-bcȳ model for irreversible bimolecular reactions which was introduced in [R. Erban and S. J. Chapman, Phys. Biol., 6(2009), 046001]. The formulae relating the experimentally measurable quantities (reaction rate constants and diffusion constants) with the algorithm parameters are derived. The probability of geminate recombination is also investigated. © 2011 Society for Industrial and Applied Mathematics.

  13. Mass transfer with complex reversible chemical reactions—I. Single reversible chemical reaction

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1989-01-01

    An improved numerical technique was used in order to develop an absorption model with which it is possible to calculate rapidly absorption rates for the phenomenon of mass transfer accompanied by a complex reversible chemical reaction. This model can be applied for the calculation of the mass

  14. Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

    NARCIS (Netherlands)

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and

  15. Single-molecule stochastic times in a reversible bimolecular reaction

    Science.gov (United States)

    Keller, Peter; Valleriani, Angelo

    2012-08-01

    In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.

  16. Characterization of reversible reactions of isocyanides with molybdenum dithiolate complexes

    International Nuclear Information System (INIS)

    Miller, D.J.; DuBois, M.R.

    1980-01-01

    Dimeric molybdenum complexes with bridging dithiocarbonimidate ligands of the formula [C 5 H 5 MoS 2 CNR] 2 (where R = CH 3 , CH 2 C 6 H 5 , C 6 H 11 , and n-C 4 H 9 ) have been synthesized and characterized. The syntheses involve the room-temperature reactions of excess isocyanides with solutions of the dimeric complex [C 5 H 5 MoSC 3 H 6 S] 2 . During the course of these reactions, propene is displaced from the sulfur atoms of the bridging dithiolate ligands. Addition of excess alkene reverses the above reactions. Equilibrium constants have been calculated for the following reactions by integration of NMR resonances: [CH 3 C 5 H 4 MoSC 2 H 4 S] 2 + RNC reversible (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + C == C, K 1 = 2.9 +- 0.2; (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + RNC reversible [CH 3 C 5 H 4 MoS 2 CNR] 2 + C == C, K 2 = 0.7 +- 0.1 (R = CH 2 C 6 H 5 ). The dithiocarbonimidate complexes react cleanly with the electrophiles CH 3 OSO 2 F and HOSO 2 CF 3 to form [C 5 H 5 MoS 2 CNRR'] 2 2+ where R' = H or CH 3 . These products have been characterized by spectral and conductivity methods. The reactions of the dithiocarbonimidate complexes with reducing agents and with carbon monoxide are discussed. 1 figure, 2 tables

  17. Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

    OpenAIRE

    Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

    1990-01-01

    An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and concentration profiles for a wide range of processes and conditions, for both film and penetration model. With the aid of this mass transfer model it is demonstrated that the absorption rates in syst...

  18. The Forward-Reverse Algorithm for Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian

    2015-01-07

    In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which we solve a set of deterministic optimization problems where the SRNs are replaced by the classical ODE rates; then, during the second phase, the Monte Carlo version of the EM algorithm is applied starting from the output of the previous phase. Starting from a set of over-dispersed seeds, the output of our two-phase method is a cluster of maximum likelihood estimates obtained by using convergence assessment techniques from the theory of Markov chain Monte Carlo.

  19. Properties of the reverse transcription reaction in mRNA quantification

    DEFF Research Database (Denmark)

    Ståhlberg, Anders; Håkansson, Joakim; Xian, Xiaojie

    2004-01-01

    BACKGROUND: In most measurements of gene expression, mRNA is first reverse-transcribed into cDNA. We studied the reverse transcription reaction and its consequences for quantitative measurements of gene expression. METHODS: We used SYBR green I-based quantitative real-time PCR (QPCR) to measure...... the properties of reverse transcription reaction for the beta-tubulin, glyceraldehyde-3-phosphate dehydrogenase, Glut2, CaV1D, and insulin II genes, using random hexamers, oligo(dT), and gene-specific reverse transcription primers. RESULTS: Experimental variation in reverse transcription-QPCR (RT......-QPCR) was mainly attributable to the reverse transcription step. Reverse transcription efficiency depended on priming strategy, and the dependence was different for the five genes studied. Reverse transcription yields also depended on total RNA concentration. CONCLUSIONS: RT-QPCR gene expression measurements...

  20. Reduced Reactivity of Amines against Nucleophilic Substitution via Reversible Reaction with Carbon Dioxide

    Directory of Open Access Journals (Sweden)

    Fiaz S. Mohammed

    2015-12-01

    Full Text Available The reversible reaction of carbon dioxide (CO2 with primary amines to form alkyl-ammonium carbamates is demonstrated in this work to reduce amine reactivity against nucleophilic substitution reactions with benzophenone and phenyl isocyanate. The reversible formation of carbamates has been recently exploited for a number of unique applications including the formation of reversible ionic liquids and surfactants. For these applications, reduced reactivity of the carbamate is imperative, particularly for applications in reactions and separations. In this work, carbamate formation resulted in a 67% reduction in yield for urea synthesis and 55% reduction for imine synthesis. Furthermore, the amine reactivity can be recovered upon reversal of the carbamate reaction, demonstrating reversibility. The strong nucleophilic properties of amines often require protection/de-protection schemes during bi-functional coupling reactions. This typically requires three separate reaction steps to achieve a single transformation, which is the motivation behind Green Chemistry Principle #8: Reduce Derivatives. Based upon the reduced reactivity, there is potential to employ the reversible carbamate reaction as an alternative method for amine protection in the presence of competing reactions. For the context of this work, CO2 is envisioned as a green protecting agent to suppress formation of n-phenyl benzophenoneimine and various n-phenyl–n-alky ureas.

  1. An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2016-01-01

    In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

  2. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  3. Reversal of a Suspected Paradoxical Reaction to Zopiclone with Flumazenil

    DEFF Research Database (Denmark)

    Jordahn, Zarah; Andersen, Cheme; Aaberg, Anne Marie Roust

    2016-01-01

    We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA), the pat......We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA...... indicates that zopiclone induced behavioral changes resembling a paradoxical reaction to benzodiazepines and these symptoms may be treated with flumazenil....

  4. Do high school chemistry examinations inhibit deeper level understanding of dynamic reversible chemical reactions?

    Science.gov (United States)

    Wheeldon, R.; Atkinson, R.; Dawes, A.; Levinson, R.

    2012-07-01

    Background and purpose : Chemistry examinations can favour the deployment of algorithmic procedures like Le Chatelier's Principle (LCP) rather than reasoning using chemical principles. This study investigated the explanatory resources which high school students use to answer equilibrium problems and whether the marks given for examination answers require students to use approaches beyond direct application of LCP. Sample : The questionnaire was administered to 162 students studying their first year of advanced chemistry (age 16/17) in three high achieving London high schools. Design and methods : The students' explanations of reversible chemical systems were inductively coded to identify the explanatory approaches used and interviews with 13 students were used to check for consistency. AS level examination questions on reversible reactions were analysed to identify the types of explanations sought and the students' performance in these examinations was compared to questionnaire answers. Results : 19% of students used a holistic explanatory approach: when the rates of forward and reverse reactions are correctly described, recognising their simultaneous and mutually dependent nature. 36% used a mirrored reactions approach when the connected nature of the forward and reverse reactions is identified, but not their mutual dependency. 42% failed to recognize the interdependence of forward and reverse reactions (reactions not connected approach). Only 4% of marks for AS examination questions on reversible chemical systems asked for responses which went beyond either direct application of LCP or recall of equilibrium knowledge. 37% of students attained an A grade in their AS national examinations. Conclusions : Examinations favour the application of LCP making it possible to obtain the highest grade with little understanding of reversible chemical systems beyond a direct application of this algorithm. Therefore students' understanding may be attenuated so that they are

  5. Reversible aqueous zinc/manganese oxide energy storage from conversion reactions

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huilin; Shao, Yuyan; Yan, Pengfei; Cheng, Yingwen; Han, Kee Sung; Nie, Zimin; Wang, Chongmin; Yang, Jihui; Li, Xiaolin; Bhattacharya, Priyanka; Mueller, Karl T.; Liu, Jun

    2016-04-18

    Rechargeable aqueous batteries are attracting growing interest for energy storage due to their low cost and high safety. Fundamental understanding of highly reversible aqueous reactions is critical for building high-performance batteries. Herein, we studied the reversibility of Zn/MnO2 battery chemistry in mild aqueous MnSO4 electrolytes. α-MnO2 nanofibers were used as a high performance cathode. Our study provides good evidence for a conversion reaction mechanism through reversible formation of short nanorods and nanoparticle aggregates. This reversible conversion reaction provides an operating voltage of 1.44 V, high capacity of 285 mAh g-1, excellent rate and capacity retention of 92% after 5000 cycles. Zn metal anode also shows high reversibility in the mild aqueous MnSO4 electrolytes. The highly reversible and stable chemistries in aqueous Zn/MnO2 batteries open new opportunity for energy storage technologies with potentially high energy density, high safety, and low cost.

  6. Time-reversal asymmetry: polarization and analyzing power in nuclear reactions

    International Nuclear Information System (INIS)

    Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.

    1984-01-01

    Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers in the inverse reactions, initiated by polarized protons at the same center-of-mass energies, show significant differences. This implies the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show smaller differences. A discussion of instrumental asymmetries is presented

  7. Efficacy of Aquatain, a Monomolecular Film, for the Control of Malaria Vectors in Rice Paddies

    NARCIS (Netherlands)

    Bukhari, S.T.; Takken, W.; Githeko, A.K.; Koenraadt, C.J.M.

    2011-01-01

    Background Rice paddies harbour a large variety of organisms including larvae of malaria mosquitoes. These paddies are challenging for mosquito control because their large size, slurry and vegetation make it difficult to effectively apply a control agent. Aquatain, a monomolecular surface film, can

  8. A copper-mediated reverse aromatic Finkelstein reaction in ionic liquid

    Directory of Open Access Journals (Sweden)

    Anh T.H. Nguyen

    2018-03-01

    Full Text Available We have developed a general method for reverse aromatic Finkelstein reactions. Good reaction yields were obtained when aryl iodides or aryl bromides were treated with copper halide salts as promoters in a 1-butyl-3-methylimidazolium bromide ([BMIM]Br ionic liquid (IL solvent at 140 °C for 8 h. Preliminary investigation supported that the copper salts were also the halide sources in halogen exchange reactions. The optimized conditions are applicable to a variety of substrates and have excellent functional group tolerance. Additionally, the [BMIM]Br solvent showed good stability for at least 10 consecutive runs. Results indicated that the [BMIM]Br solvent was recyclable for reverse aromatic Finkelstein reactions.

  9. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

    2005-01-01

    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  10. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

    2018-01-01

    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  11. On the graph and systems analysis of reversible chemical reaction networks with mass action kinetics

    NARCIS (Netherlands)

    Rao, Shodhan; Jayawardhana, Bayu; Schaft, Arjan van der

    2012-01-01

    Motivated by the recent progresses on the interplay between the graph theory and systems theory, we revisit the analysis of reversible chemical reaction networks described by mass action kinetics by reformulating it using the graph knowledge of the underlying networks. Based on this formulation, we

  12. The role of reversed kinematics and double kinematic solutions in nuclear reactions studies

    International Nuclear Information System (INIS)

    Kaplan, M.; Parker, W.E.; Moses, D.J.; Lacey, R.; Alexander, J.M.

    1993-01-01

    The advantages of reversed kinematics in nuclear reactions studies are discussed, with particular emphasis on the origin of double solutions in the reaction kinematics. This possibility for double solutions does not exist in normal kinematics, and provides the basis for a new method of imposing important experimental constraints on the uniqueness of fitting complex observations. By gating on one or the other of the two solutions, light particle kinematics can be greatly influenced in coincidence measurements. The power of the method is illustrated with data for the reaction 1030 MeV 121 Sb+ 27 Al, where charged particle emissions arise from several different sources. (orig.)

  13. An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

    KAUST Repository

    Bayer, Christian

    2016-01-06

    In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce an efficient two-phase algorithm in which the first phase is deterministic and it is intended to provide a starting point for the second phase which is the Monte Carlo EM Algorithm.

  14. A novel three-input monomolecular logic circuit on a rhodamine inspired bio-compatible bi-compartmental molecular platform

    International Nuclear Information System (INIS)

    Mistri, Tarun; Bhowmick, Rahul; Katarkar, Atul; Chaudhuri, Keya; Ali, Mahammad

    2017-01-01

    Methodological synthesis of a new biocompatible bi-compartmental rhodamine based probe (L 3 ) provides a multi-inputs and multi-outputs molecular logic circuit based on simple chemosensing phenomena. Spectroscopic responses of Cu 2+ and Hg 2+ towards L 3 together with reversible binding of S 2- with L 3 -Cu 2+ and L 3 -Hg 2+ complexes help us to construct a thee-input molecular circuit on their control and sequential addition to a solution of L 3 in a mixed organo-aqueous medium. We have further successfully encoded binary digits out of these inputs and outputs which may convert a three-digit input string into a two-digit output string resulting a simple monomolecular logic circuit. Such a molecular ‘Boolean’ logic operation may improve the complexity of logic gate circuitry and computational speed and may be useful to employ in potential biocompatible molecular logic platforms. - Graphical abstract: A new bi-compartmental molecular system equipped with Rhodamine fluorophore unit provides a Multi-inputs and Multi-outputs Molecular Logic Circuit based on a very simple observation of chemosensing activities.

  15. A novel three-input monomolecular logic circuit on a rhodamine inspired bio-compatible bi-compartmental molecular platform

    Energy Technology Data Exchange (ETDEWEB)

    Mistri, Tarun; Bhowmick, Rahul [Department of Chemistry, Jadavpur University, 188 Raja S.C. Mullick Road, Kolkata 700032 (India); Katarkar, Atul; Chaudhuri, Keya [Molecular & Human Genetics Division, CSIR-Indian Institute of Chemical Biology, 4 Raja S.C. Mullick Road, Kolkata 700032 (India); Ali, Mahammad, E-mail: mali@chemistry.jdvu.ac.in [Department of Chemistry, Jadavpur University, 188 Raja S.C. Mullick Road, Kolkata 700032 (India)

    2017-05-15

    Methodological synthesis of a new biocompatible bi-compartmental rhodamine based probe (L{sup 3}) provides a multi-inputs and multi-outputs molecular logic circuit based on simple chemosensing phenomena. Spectroscopic responses of Cu{sup 2+} and Hg{sup 2+} towards L{sup 3} together with reversible binding of S{sup 2-} with L{sup 3}-Cu{sup 2+} and L{sup 3}-Hg{sup 2+} complexes help us to construct a thee-input molecular circuit on their control and sequential addition to a solution of L{sup 3} in a mixed organo-aqueous medium. We have further successfully encoded binary digits out of these inputs and outputs which may convert a three-digit input string into a two-digit output string resulting a simple monomolecular logic circuit. Such a molecular ‘Boolean’ logic operation may improve the complexity of logic gate circuitry and computational speed and may be useful to employ in potential biocompatible molecular logic platforms. - Graphical abstract: A new bi-compartmental molecular system equipped with Rhodamine fluorophore unit provides a Multi-inputs and Multi-outputs Molecular Logic Circuit based on a very simple observation of chemosensing activities.

  16. Nanoscale control of reversible chemical reaction between fullerene C60 molecules using scanning tunneling microscope.

    Science.gov (United States)

    Nakaya, Masato; Kuwahara, Yuji; Aono, Masakazu; Nakayama, Tomonobu

    2011-04-01

    The nanoscale control of reversible chemical reactions, the polymerization and depolymerization between C60 molecules, has been investigated. Using a scanning tunneling microscope (STM), the polymerization and depolymerization can be controlled at designated positions in ultrathin films of C60 molecules. One of the two chemical reactions can be selectively induced by controlling the sample bias voltage (V(s)); the application of negative and positive values of V(s) results in polymerization and depolymerization, respectively. The selectivity between the two chemical reactions becomes extremely high when the thickness of the C60 film increases to more than three molecular layers. We conclude that STM-induced negative and positive electrostatic ionization are responsible for the control of the polymerization and depolymerization, respectively.

  17. Modified lignin: Preparation and use in reversible gel via Diels-Alder reaction.

    Science.gov (United States)

    Zhou, Wanpeng; Zhang, Hui; Chen, Fangeng

    2018-02-01

    In this study, popular soda lignin was modified with either furan or maleimide ring, and the modified lignins were subjected to reversible Diels-Alder reaction. A new process was proposed to prepare the functionalized lignin. A long chain was introduced to the hydroxyl groups of lignin, and then either the furan or maleimide ring was added to the other end of the chain. The test results confirmed that either the furan ring or the maleimide ring was bound to lignin. Furan- and maleimide-functionalized lignins were also combined to generate crosslinking via Diels-Alder [4+2] cycloaddition reaction. Under appropriate conditions, the formation of a gel was identified, which reverted to liquid state after retro Diels-Alder reaction upon heating at 120°C. This study reveals the significant versatility and potential of the developed strategy for the utilization of lignin-based recyclable networks. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Asymmetric effect of mechanical stress on the forward and reverse reaction catalyzed by an enzyme.

    Directory of Open Access Journals (Sweden)

    Collin Joseph

    Full Text Available The concept of modulating enzymatic activity by exerting a mechanical stress on the enzyme has been established in previous work. Mechanical perturbation is also a tool for probing conformational motion accompanying the enzymatic cycle. Here we report measurements of the forward and reverse kinetics of the enzyme Guanylate Kinase from yeast (Saccharomyces cerevisiae. The enzyme is held in a state of stress using the DNA spring method. The observation that mechanical stress has different effects on the forward and reverse reaction kinetics suggests that forward and reverse reactions follow different paths, on average, in the enzyme's conformational space. Comparing the kinetics of the stressed and unstressed enzyme we also show that the maximum speed of the enzyme is comparable to the predictions of the relaxation model of enzyme action, where we use the independently determined dissipation coefficient [Formula: see text] for the enzyme's conformational motion. The present experiments provide a mean to explore enzyme kinetics beyond the static energy landscape picture of transition state theory.

  19. Communication: Rate coefficients from quasiclassical trajectory calculations from the reverse reaction: The Mu + H2 reaction re-visited

    Science.gov (United States)

    Homayoon, Zahra; Jambrina, Pablo G.; Aoiz, F. Javier; Bowman, Joel M.

    2012-07-01

    In a previous paper [P. G. Jambrina et al., J. Chem. Phys. 135, 034310 (2011), 10.1063/1.3611400] various calculations of the rate coefficient for the Mu + H2 → MuH + H reaction were presented and compared to experiment. The widely used standard quasiclassical trajectory (QCT) method was shown to overestimate the rate coefficients by several orders of magnitude over the temperature range 200-1000 K. This was attributed to a major failure of that method to describe the correct threshold for the reaction owing to the large difference in zero-point energies (ZPE) of the reactant H2 and product MuH (˜0.32 eV). In this Communication we show that by performing standard QCT calculations for the reverse reaction and then applying detailed balance, the resulting rate coefficient is in very good agreement with the other computational results that respect the ZPE, (as well as with the experiment) but which are more demanding computationally.

  20. An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Vilanova, Pedro

    2016-01-07

    In this work, we present an extension of the forward-reverse representation introduced in Simulation of forward-reverse stochastic representations for conditional diffusions , a 2014 paper by Bayer and Schoenmakers to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the Expectation-Maximization algorithm to the phase I output. By selecting a set of over-dispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

  1. Efficient Solar Energy Harvesting and Storage through a Robust Photocatalyst Driving Reversible Redox Reactions.

    Science.gov (United States)

    Zhou, Yangen; Zhang, Shun; Ding, Yu; Zhang, Leyuan; Zhang, Changkun; Zhang, Xiaohong; Zhao, Yu; Yu, Guihua

    2018-06-14

    Simultaneous solar energy conversion and storage is receiving increasing interest for better utilization of the abundant yet intermittently available sunlight. Photoelectrodes driving nonspontaneous reversible redox reactions in solar-powered redox cells (SPRCs), which can deliver energy via the corresponding reverse reactions, present a cost-effective and promising approach for direct solar energy harvesting and storage. However, the lack of photoelectrodes having both high conversion efficiency and high durability becomes a bottleneck that hampers practical applications of SPRCs. Here, it is shown that a WO 3 -decorated BiVO 4 photoanode, without the need of extra electrocatalysts, can enable a single-photocatalyst-driven SPRC with a solar-to-output energy conversion efficiency as high as 1.25%. This SPRC presents stable performance over 20 solar energy storage/delivery cycles. The high efficiency and stability are attributed to the rapid redox reactions, the well-matched energy level, and the efficient light harvesting and charge separation of the prepared BiVO 4 . This demonstrated device system represents a potential alternative toward the development of low-cost, durable, and easy-to-implement solar energy technologies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. [Are there pseudophototropic reactions in biology? Part 4: On the reversibility of biologic/synthetic polymere systems (author's transl)].

    Science.gov (United States)

    Patschorke, J

    1979-01-01

    In further research on pseudophototropic behaviour in cellular membranes of halobacteria the reversibility of vinylmethylethermaleic anhydride-copolymeres with biological liquids is tested and the basic principles of different colour generating reactions are studied.

  3. Reversible alkyne insertion in the benzannulation reaction of Fischer carbene complexes with alkynes

    Energy Technology Data Exchange (ETDEWEB)

    Waters, M.L.; Bos, M.E.; Wulff, W.D. [Univ. of Chicago, IL (United States)

    1995-12-31

    The benzannulation reaction of Fischer carbene complexes with alkynes to give phenols is highly regioselective with terminal alkynes, and reasonably regioselective with internal alkynes. This has been attributed to steric factors in intermediates, where one form is favored due to close contact between the R substituent and a cis-CO ligand. Whether alkyne insertion is kinetically or thermodynamically controlled has not been determined. The authors now have evidence from regioselectivity studies that alkyne insertion into the metal-carbon bond is reversible. Implications of these results and further mechanistic considerations will be presented.

  4. On null tests of time-reversal invariance in scattering and reactions

    International Nuclear Information System (INIS)

    Conzett, H.E.

    1993-01-01

    There have been suggestions in the literature, both recently and in the more distant past, that, in the lowest-order Born approximation, time-reversal (T)-odd experimental observables in certain reactions are required by T-symmetry to vanish. These observables are the final-state spin-correlation coefficient C xy in the reaction e + e - → τ + τ - and the target analysing power A oy in the inclusive process ep → eX with a polarized proton target. These assertions are in direct conflict with a theorem that states that there can be no null-test of T-symmetry in such processes; that is, T-symmetry does not require any single observable to vanish. This talk addresses the resolution of that conflict

  5. SIMULTANEOUS ABSORPTION AND DESORPTION WITH REVERSIBLE 1ST-ORDER CHEMICAL-REACTION - ANALYTICAL SOLUTION AND NEGATIVE ENHANCEMENT FACTORS

    NARCIS (Netherlands)

    WINKELMAN, JGM; BEENACKERS, AACM

    The problem of ps absorption accompanied by a first-order reversible reaction, producing a volatile reaction product, is considered. A general analytical solution is developed for the film model, resulting in explicit relations for the concentration profiles in the film and for the mass transfer

  6. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  7. An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Bayer, Christian

    2016-02-20

    © 2016 Taylor & Francis Group, LLC. ABSTRACT: In this work, we present an extension of the forward–reverse representation introduced by Bayer and Schoenmakers (Annals of Applied Probability, 24(5):1994–2032, 2014) to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, that is, SRNs conditional on their values in the extremes of given time intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the expectation-maximization algorithm to the phase I output. By selecting a set of overdispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

  8. Performance and cost of energy transport and storage systems for dish applications using reversible chemical reactions

    Science.gov (United States)

    Schredder, J. M.; Fujita, T.

    1984-01-01

    The use of reversible chemical reactions for energy transport and storage for parabolic dish networks is considered. Performance and cost characteristics are estimated for systems using three reactions (sulfur-trioxide decomposition, steam reforming of methane, and carbon-dioxide reforming of methane). Systems are considered with and without storage, and in several energy-delivery configurations that give different profiles of energy delivered versus temperature. Cost estimates are derived assuming the use of metal components and of advanced ceramics. (The latter reduces the costs by three- to five-fold). The process that led to the selection of the three reactions is described, and the effects of varying temperatures, pressures, and heat exchanger sizes are addressed. A state-of-the-art survey was performed as part of this study. As a result of this survey, it appears that formidable technical risks exist for any attempt to implement the systems analyzed in this study, especially in the area of reactor design and performance. The behavior of all components and complete systems under thermal energy transients is very poorly understood. This study indicates that thermochemical storage systems that store reactants as liquids have efficiencies below 60%, which is in agreement with the findings of earlier investigators.

  9. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  10. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  11. Neural Network Control of CSTR for Reversible Reaction Using Reverence Model Approach

    Directory of Open Access Journals (Sweden)

    Duncan ALOKO

    2007-01-01

    Full Text Available In this work, non-linear control of CSTR for reversible reaction is carried out using Neural Network as design tool. The Model Reverence approach in used to design ANN controller. The idea is to have a control system that will be able to achieve improvement in the level of conversion and to be able to track set point change and reject load disturbance. We use PID control scheme as benchmark to study the performance of the controller. The comparison shows that ANN controller out perform PID in the extreme range of non-linearity.This paper represents a preliminary effort to design a simplified neutral network control scheme for a class of non-linear process. Future works will involve further investigation of the effectiveness of thin approach for the real industrial chemical process

  12. Controlling Solid–Liquid Conversion Reactions for a Highly Reversible Aqueous Zinc–Iodine Battery

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Huilin; Li, Bin; Mei, Donghai; Nie, Zimin; Shao, Yuyan; Li, Guosheng; Li, Xiaohong S.; Han, Kee Sung; Muller, Karl T.; Sprenkle, Vincent L.; Liu, Jun

    2017-10-30

    Aqueous rechargeable batteries are desirable for many energy storage applications due to their low cost and high safety. However, low capacity and short cycle life are the significant obstacles to their practical applications. Here, we demonstrate a highly reversible aqueous zinc-iodine battery using encapsulated iodine in microporous active carbon fibers (ACFs) as cathode materials through the rational control of solid-liquid conversion reactions. The experiments and density function theory (DFT) calculations were employed to investigate the effects of solvents and properties of carbon hosts, e.g. pore size, surface chemistries, on the adsorption of iodine species. The rational manipulation of the competition between the adsorption in carbon and solvation in electrolytes for iodine species is responsible for the high reversibility and cycling stability. The zinc-iodine batteries deliver a high capacity of 180 mAh g-1 at 1C and a stable cycle life over 3000 cycles with ~90% capacity retention as well as negligible self-discharge. We believe the principles for stabilizing the zinc-iodine system could provide new insight into conversion systems such as Li-S systems.

  13. Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

    Science.gov (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

    2004-03-01

    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  14. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  15. Hydrolysis of mixed monomolecular films of triglyceride/lecithin by pancreatic lipase.

    Science.gov (United States)

    Pieroni, G; Verger, R

    1979-10-25

    The main purpose of this study was to describe the influence of lecithin upon lipolysis of mixed monomolecular films of trioctanoylglycerol/didodecanoylphosphatidycholine by pancreatic lipase in order to mimic some physiological situations. The quantity of enzyme adsorbed to the interface was simultaneously determined using 5-thio-2-nitro[14C]benzoyl lipase. Lipolytic activity was enhanced 3- to 4-fold in the presence of colipase, an effect which is attributed to increased enzyme turnover number. When a pure triglyceride film was progressively diluted with lecithin, the minimum specific activity of lipase exhibited a bell-shaped curve: a mixed film containing only 20% trioctanoylglycerol was hydrolyzed at the same rate as a monolayer of pure triglyceride.

  16. Mass transfer with complex chemical reactions in gas–liquid systems : two-step reversible reactions with unit stoichiometric and kinetic orders

    NARCIS (Netherlands)

    Vas Bhat, R.D.; Kuipers, J.A.M.; Versteeg, G.F.

    2000-01-01

    An absorption model to study gas–liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

  17. Mass transfer with complex chemical reactions in gas-liquid systems: two-step reversible reactions with unit stoichiometric and kinetic orders

    NARCIS (Netherlands)

    Vas bhat, R.D.; Kuipers, J.A.M.; Versteeg, Geert

    2000-01-01

    An absorption model to study gas¿liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

  18. On the feasibility of producing secondary radioactive nuclear beams using reactions in reversed geometries at HI-13 tandem accelerator

    International Nuclear Information System (INIS)

    Bai Xixiang; Liu Weiping

    1993-01-01

    Some of (p,n),(d,p),(d,n) and (d, 3 He) reactions involving heavy-ions in reversed geometries are proposed for producing the kinematically compressed beams of ions such as 6 He, 7 Be, 8 Li, 11 C, 12 B, 13 N, 15 O and 17 F. A simple facility being constructed to produce and utilize these beams is briefly described

  19. Enhanced reversibility and durability of a solid oxide Fe-air redox battery by carbothermic reaction derived energy storage materials.

    Science.gov (United States)

    Zhao, Xuan; Li, Xue; Gong, Yunhui; Huang, Kevin

    2014-01-18

    The recently developed solid oxide metal-air redox battery is a new technology capable of high-rate chemistry. Here we report that the performance, reversibility and stability of a solid oxide iron-air redox battery can be significantly improved by nanostructuring energy storage materials from a carbothermic reaction.

  20. Reversible logic gates based on enzyme-biocatalyzed reactions and realized in flow cells: a modular approach.

    Science.gov (United States)

    Fratto, Brian E; Katz, Evgeny

    2015-05-18

    Reversible logic gates, such as the double Feynman gate, Toffoli gate and Peres gate, with 3-input/3-output channels are realized using reactions biocatalyzed with enzymes and performed in flow systems. The flow devices are constructed using a modular approach, where each flow cell is modified with one enzyme that biocatalyzes one chemical reaction. The multi-step processes mimicking the reversible logic gates are organized by combining the biocatalytic cells in different networks. This work emphasizes logical but not physical reversibility of the constructed systems. Their advantages and disadvantages are discussed and potential use in biosensing systems, rather than in computing devices, is suggested. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  2. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  3. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  4. Kinetics and thermochemistry of the reversible gas phase reaction HONO+NH3->3N-HONO studied by infrared diode laser spectroscopy

    DEFF Research Database (Denmark)

    Pagsberg, P.; Ratajczak, E.; Sillesen, A.

    1994-01-01

    The kinetics of the reversible reaction HONO+NH3 reversible H3N-HONO (1) was studied by monitoring trans-HONO relaxation kinetics. The rate of approach towards equilibrium was studied as a function of the ammonia concentration to obtain values of the rate constants for the forward and reverse rea...

  5. Effect of lateralized design on muscle and joint reaction forces for reverse shoulder arthroplasty.

    Science.gov (United States)

    Liou, William; Yang, Yang; Petersen-Fitts, Graysen R; Lombardo, Daniel J; Stine, Sasha; Sabesan, Vani J

    2017-04-01

    Manufacturers of reverse shoulder arthroplasty (RSA) implants have recently designed innovative implants to optimize performance in rotator cuff-deficient shoulders. These advancements are not without tradeoffs and can have negative biomechanical effects. The objective of this study was to develop an integrated finite element analysis-kinematic model to compare the muscle forces and joint reaction forces (JRFs) of 3 different RSA designs. A kinematic model of a normal shoulder joint was adapted from the Delft model and integrated with the well-validated OpenSim shoulder model. Static optimizations then allowed for calculation of the individual muscle forces, moment arms, and JRFs relative to net joint moments. Three-dimensional computer models of 3 RSA designs-humeral lateralized design (HLD), glenoid lateralized design, and Grammont design-were integrated, and parametric studies were performed. Overall, there were decreases in deltoid and rotator cuff muscle forces for all 3 RSA designs. These decreases were greatest in the middle deltoid of the HLD model for abduction and flexion and in the rotator cuff muscles under both internal rotation and external rotation. The JRFs in abduction and flexion decreased similarly for all RSA designs compared with the normal shoulder model, with the greatest decrease seen in the HLD model. These findings demonstrate that the design characteristics implicit in these modified RSA prostheses result in mechanical differences most prominently seen in the deltoid muscle and overall JRFs. Further research using this novel integrated model can help guide continued optimization of RSA design and clinical outcomes. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  6. On the ambiguity of the reaction rate constants in multivariate curve resolution for reversible first-order reaction systems.

    Science.gov (United States)

    Schröder, Henning; Sawall, Mathias; Kubis, Christoph; Selent, Detlef; Hess, Dieter; Franke, Robert; Börner, Armin; Neymeyr, Klaus

    2016-07-13

    If for a chemical reaction with a known reaction mechanism the concentration profiles are accessible only for certain species, e.g. only for the main product, then often the reaction rate constants cannot uniquely be determined from the concentration data. This is a well-known fact which includes the so-called slow-fast ambiguity. This work combines the question of unique or non-unique reaction rate constants with factor analytic methods of chemometrics. The idea is to reduce the rotational ambiguity of pure component factorizations by considering only those concentration factors which are possible solutions of the kinetic equations for a properly adapted set of reaction rate constants. The resulting set of reaction rate constants corresponds to those solutions of the rate equations which appear as feasible factors in a pure component factorization. The new analysis of the ambiguity of reaction rate constants extends recent research activities on the Area of Feasible Solutions (AFS). The consistency with a given chemical reaction scheme is shown to be a valuable tool in order to reduce the AFS. The new methods are applied to model and experimental data. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Formation of a Molecular Wire Using the Chemically Adsorbed Monomolecular Layer Having Pyrrolyl Groups

    Directory of Open Access Journals (Sweden)

    Kazufumi Ogawa

    2011-01-01

    Full Text Available A molecular wire containing polypyrrolyl conjugate bonds has been prepared by a chemical adsorption technique using 1,1,1-trichloro-12-pyrrolyl-1-siladodecane (PNN and an electrooxidative polymerization technique, and the conductivity of the molecular wire without any dopant has been measured by using AFM/STM at room temperature. When sample dimension measured was about 0.3 nm (thickness of the conductive portion in the PNN monomolecular layer ×100 μm (the average width of an electric path ×2 mm (the distance between Pt positive electrode and the AFM tip covered with Au, the conductivity of the polymerized PNN molecular wire at room temperature was larger than 1.6 × 105 S/cm both in an atmosphere and in a vacuum chamber of 10−5 Torr. The activation energy obtained by Arrhenius' plots was almost zero in the temperature range between 320 and 450 K.

  8. S-factor measurement of the 13C(p,γ)14N reaction in reverse kinematics

    International Nuclear Information System (INIS)

    Genard, G; Terwagne, G; Descouvemont, P

    2010-01-01

    We measure the S-factor of the 13 C(p,γ) 14 N reaction in reverse kinematics for energies ranging from 561 down to 225 keV with a low background experimental setup. The results are compared with previous measurements and an R-matrix treatment is applied to the data in order to obtain the properties of the 511 keV resonance that dominates the cross section at low energies.

  9. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  10. Safety analysis of switching between reductive and oxidative conditions in a reaction coupling reverse flow reactor.

    NARCIS (Netherlands)

    van Sint Annaland, M.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria

    2001-01-01

    A new reverse flow reactor is developed where endothermic reactants (propane dehydrogenation) and exothermic reactants (fuel combustion) are fed sequentially to a monolithic catalyst, while periodically alternating the inlet and outlet positions. Upon switching from reductive to oxidative conditions

  11. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  12. Efficacy of aquatain, a monomolecular film, for the control of malaria vectors in rice paddies.

    Directory of Open Access Journals (Sweden)

    Tullu Bukhari

    Full Text Available BACKGROUND: Rice paddies harbour a large variety of organisms including larvae of malaria mosquitoes. These paddies are challenging for mosquito control because their large size, slurry and vegetation make it difficult to effectively apply a control agent. Aquatain, a monomolecular surface film, can be considered a suitable mosquito control agent for such breeding habitats due to its physical properties. The properties allow Aquatain to self-spread over a water surface and affect multiple stages of the mosquito life cycle. METHODOLOGY/PRINCIPAL FINDINGS: A trial based on a pre-test/post-test control group design evaluated the potential of Aquatain as a mosquito control agent at Ahero rice irrigation scheme in Kenya. After Aquatain application at a dose of 2 ml/m(2 on rice paddies, early stage anopheline larvae were reduced by 36%, and late stage anopheline larvae by 16%. However, even at a lower dose of 1 ml/m(2 there was a 93.2% reduction in emergence of anopheline adults and 69.5% reduction in emergence of culicine adults. No pupation was observed in treated buckets that were part of a field bio-assay carried out parallel to the trial. Aquatain application saved nearly 1.7 L of water in six days from a water surface of 0.2 m(2 under field conditions. Aquatain had no negative effect on rice plants as well as on a variety of non-target organisms, except backswimmers. CONCLUSIONS/SIGNIFICANCE: We demonstrated that Aquatain is an effective agent for the control of anopheline and culicine mosquitoes in irrigated rice paddies. The agent reduced densities of aquatic larval stages and, more importantly, strongly impacted the emergence of adult mosquitoes. Aquatain also reduced water loss due to evaporation. No negative impacts were found on either abundance of non-target organisms, or growth and development of rice plants. Aquatain, therefore, appears a suitable mosquito control tool for use in rice agro-ecosystems.

  13. A Key Role of Xanthophylls That Are Not Embedded in Proteins in Regulation of the Photosynthetic Antenna Function in Plants, Revealed by Monomolecular Layer Studies.

    Science.gov (United States)

    Welc, Renata; Luchowski, Rafal; Grudzinski, Wojciech; Puzio, Michal; Sowinski, Karol; Gruszecki, Wieslaw I

    2016-12-29

    The main physiological function of LHCII (light-harvesting pigment-protein complex of photosystem II), the largest photosynthetic antenna complex of plants, is absorption of light quanta and transfer of excitation energy toward the reaction centers, to drive photosynthesis. However, under strong illumination, the photosynthetic apparatus faces the danger of photodegradation and therefore excitations in LHCII have to be down-regulated, e.g., via thermal energy dissipation. One of the elements of the regulatory system, operating in the photosynthetic apparatus under light stress conditions, is a conversion of violaxanthin, the xanthophyll present under low light, to zeaxanthin, accumulated under strong light. In the present study, an effect of violaxanthin and zeaxanthin on the molecular organization and the photophysical properties of LHCII was studied in a monomolecular layer system with application of molecular imaging (atomic force microscopy, fluorescence lifetime imaging microscopy) and spectroscopy (UV-Vis absorption, FTIR, fluorescence spectroscopy) techniques. The results of the experiments show that violaxanthin promotes the formation of supramolecular LHCII structures preventing dissipative excitation quenching while zeaxanthin is involved in the formation of excitonic energy states able to quench chlorophyll excitations in both the higher (B states) and lower (Q states) energy levels. The results point to a strategic role of xanthophylls that are not embedded in a protein environment, in regulation of the photosynthetic light harvesting activity in plants.

  14. Scandium(III) catalysis of transimination reactions. Independent and constitutionally coupled reversible processes.

    Science.gov (United States)

    Giuseppone, Nicolas; Schmitt, Jean-Louis; Schwartz, Evan; Lehn, Jean-Marie

    2005-04-20

    Sc(OTf)(3) efficiently catalyzes the self-sufficient transimination reaction between various types of C=N bonds in organic solvents, with turnover frequencies up to 3600 h(-)(1) and rate accelerations up to 6 x 10(5). The mechanism of the crossover reaction in mixtures of amines and imines is studied, comparing parallel individual reactions with coupled equilibria. The intrinsic kinetic parameters for isolated reactions cannot simply be added up when several components are mixed, and the behavior of the system agrees with the presence of a unique mediator that constitutes the core of a network of competing reactions. In mixed systems, every single amine or imine competes for the same central hub, in accordance with their binding affinity for the catalyst metal ion center. More generally, the study extends the basic principles of constitutional dynamic chemistry to interconnected chemical transformations and provides a step toward dynamic systems of increasing complexity.

  15. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  16. In Situ Insight into Reversible O2 Gas-Solid Reactions

    DEFF Research Database (Denmark)

    Wegeberg, Christina

    2016-01-01

    Non-porous crystalline solids containing a series of cationic tetracobalt complexes reversibly, selectively and stoichiometrically chemisorb dioxygen in temperature/O2 partial pressure induced processes involving the oxidation of cobalt with concurrent reduction of two equivalents of sorbed O2 to...

  17. Plant Acyl-CoA:Lysophosphatidylcholine Acyltransferases (LPCATs) Have Different Specificities in Their Forward and Reverse Reactions*

    Science.gov (United States)

    Lager, Ida; Yilmaz, Jenny Lindberg; Zhou, Xue-Rong; Jasieniecka, Katarzyna; Kazachkov, Michael; Wang, Peng; Zou, Jitao; Weselake, Randall; Smith, Mark A.; Bayon, Shen; Dyer, John M.; Shockey, Jay M.; Heinz, Ernst; Green, Allan; Banas, Antoni; Stymne, Sten

    2013-01-01

    Acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT) enzymes have central roles in acyl editing of phosphatidylcholine (PC). Plant LPCAT genes were expressed in yeast and characterized biochemically in microsomal preparations of the cells. Specificities for different acyl-CoAs were similar for seven LPCATs from five different species, including species accumulating hydroxylated acyl groups in their seed oil, with a preference for C18-unsaturated acyl-CoA and low activity with palmitoyl-CoA and ricinoleoyl (12-hydroxyoctadec-9-enoyl)-CoA. We showed that Arabidopsis LPCAT1 and LPCAT2 enzymes catalyzed the acylation and de-acylation of both sn positions of PC, with a preference for the sn-2 position. When acyl specificities of the Arabidopsis LPCATs were measured in the reverse reaction, sn-2-bound oleoyl, linoleoyl, and linolenoyl groups from PC were transferred to acyl-CoA to a similar extent. However, a ricinoleoyl group at the sn-2-position of PC was removed 4–6-fold faster than an oleoyl group in the reverse reaction, despite poor utilization in the forward reaction. The data presented, taken together with earlier published reports on in vivo lipid metabolism, support the hypothesis that plant LPCAT enzymes play an important role in regulating the acyl-CoA composition in plant cells by transferring polyunsaturated and hydroxy fatty acids produced on PC directly to the acyl-CoA pool for further metabolism or catabolism. PMID:24189065

  18. On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

    International Nuclear Information System (INIS)

    Plante, Ianik; Devroye, Luc

    2015-01-01

    Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well

  19. On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

    Energy Technology Data Exchange (ETDEWEB)

    Plante, Ianik, E-mail: ianik.plante-1@nasa.gov [Wyle Science, Technology & Engineering, 1290 Hercules, Houston, TX 77058 (United States); Devroye, Luc, E-mail: lucdevroye@gmail.com [School of Computer Science, McGill University, 3480 University Street, Montreal H3A 0E9 (Canada)

    2015-09-15

    Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well.

  20. The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A↔C↔B + B

    Energy Technology Data Exchange (ETDEWEB)

    Kipriyanov, Alexey A.; Kipriyanov, Alexander A.; Doktorov, Alexander B. [Voevodsky Institute of Chemical Kinetics and Combustion, Siberian Branch of the Russian Academy of Sciences, Novosibirsk 630090, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

    2016-04-14

    Specific two-stage reversible reaction A + A↔C↔B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

  1. The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A ↔ C ↔ B + B.

    Science.gov (United States)

    Kipriyanov, Alexey A; Kipriyanov, Alexander A; Doktorov, Alexander B

    2016-04-14

    Specific two-stage reversible reaction A + A ↔ C ↔ B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

  2. Features of E-Z-photoisomerization reversible reaction of 4-styrylpyridine crown-containing complexes with different cations

    International Nuclear Information System (INIS)

    Fedorov, Yu.V.; Shepel', N.Eh.; Chernikova, E.Yu.; Fedorova, O.A.; Gulakova, E.N.; Avakyan, V.G.; Jonushauskas, G.

    2008-01-01

    E-Z-Photoisomerization reversible reaction of crown-containing 4-styrylpyridine in the presence of alkali metal perchlorates (Ca 2+ , Mg 2+ , Ba 2+ ) gifted in the formation of complexes with crown-ether fragments, as well as heavy metal perchlorates (Hg 2+ , Cd 2+ ) gifted in the coordination with nitrogen atom of heterocyclic residuum has been studied. Effect of complexing on the photoisomerization is determined by electron spectroscopy and NMR 1 H, structures of the formed Z-isomers are established. The possibility of the E-Z-isomerization control with the use of supramolecular complexing is confirmed by the investigations [ru

  3. Current status and future prospect of space and time reversal symmetry violation on low energy neutron reactions

    International Nuclear Information System (INIS)

    Masuda, Yasuhiro

    1993-01-01

    In this report, the papers on symmetry violation under space reflection and time reversal and neutron spin, neutron spin rotation and P-violation, parity nonconservation in neutron capture reaction, some advantage of the search for CP-violation in neutron scattering, dynamic polarization of 139 La target, alexandrite laser for optical pumping, polarized 3 He system for T- and P-violation neutron experiments, control of neutron spin in T-violation neutron experiment, symmetry regarding time and space and angular distribution and angular correlation of radiation and particle beams, T-violation due to low temperature nuclear polarization and axion exploration using nuclear transition are collected. (K.I.)

  4. Core-shell rhodium sulfide catalyst for hydrogen evolution reaction / hydrogen oxidation reaction in hydrogen-bromine reversible fuel cell

    Science.gov (United States)

    Li, Yuanchao; Nguyen, Trung Van

    2018-04-01

    Synthesis and characterization of high electrochemical active surface area (ECSA) core-shell RhxSy catalysts for hydrogen evolution oxidation (HER)/hydrogen oxidation reaction (HOR) in H2-Br2 fuel cell are discussed. Catalysts with RhxSy as shell and different percentages (5%, 10%, and 20%) of platinum on carbon as core materials are synthesized. Cyclic voltammetry is used to evaluate the Pt-equivalent mass specific ECSA and durability of these catalysts. Transmission electron microscopy (TEM), X-ray Photoelectron spectroscopy (XPS) and Energy-dispersive X-ray spectroscopy (EDX) techniques are utilized to characterize the bulk and surface compositions and to confirm the core-shell structure of the catalysts, respectively. Cycling test and polarization curve measurements in the H2-Br2 fuel cell are used to assess the catalyst stability and performance in a fuel cell. The results show that the catalysts with core-shell structure have higher mass specific ECSA (50 m2 gm-Rh-1) compared to a commercial catalyst (RhxSy/C catalyst from BASF, 6.9 m2 gm-Rh-1). It also shows better HOR/HER performance in the fuel cell. Compared to the platinum catalyst, the core-shell catalysts show more stable performance in the fuel cell cycling test.

  5. A meson-exchange isobar model for the {pi}{sup +}d {r_reversible} pp reaction

    Energy Technology Data Exchange (ETDEWEB)

    Canton, L.; Cattapan, G.; Dortmans, P.J.; Pisent, G. [Istituto Nazionale di Fisica Nucleare, Padua (Italy); Svenne, J.P. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics]|[Winnipeg Inst. for Theoretical Physics, Winnipeg, MB (Canada)

    1994-10-10

    A broad set of observables are calculated for the {pi}{sup +} d {r_reversible} pp reaction with a relatively simple meson-exchange isobar model. The comparison between the calculated results and experimental data (including spin observables), shows that the model gives an overall phenomenologically acceptable description of the reaction around the {Delta} resonance. The effects due to the inclusion of Galilei invariant (pseudovector) recoil term in the {pi}NN vertex, of relativistic corrections to the {rho}-exchange component of the {Delta}N transition potential, and of NN final state interaction in the {pi}{sup +}d {yields} p+p process are also discussed. It is estimated that the model is sufficiently simple to be extended to the case of pion absorption on other light nuclei, in particular {sup 3}He (or tritium). 32 refs., 13 figs.

  6. An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Vilanova, Pedro

    2016-01-01

    reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ

  7. Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS

    OpenAIRE

    Batista, Mariana Dias [UNIFESP; Porro, Adriana Maria [UNIFESP; Maeda, Solange Miki [UNIFESP; Gomes, Elimar Elias [UNIFESP; Yoshioka, Marcia Cristina Naomi [UNIFESP; Enokihara, Mílvia Maria Simões e Silva [UNIFESP; Tomimori, Jane [UNIFESP

    2008-01-01

    We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.

  8. Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS.

    Science.gov (United States)

    Batista, Mariana D; Porro, Adriana M; Maeda, Solange M; Gomes, Elimar E; Yoshioka, Márcia C N; Enokihara, Mílvia M S S; Tomimori, Jane

    2008-03-15

    We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.

  9. An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

    KAUST Repository

    Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

    2016-01-01

    then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve

  10. The retro Grignard addition reaction revisited: the reversible addition of benzyl reagents to ketones

    DEFF Research Database (Denmark)

    Christensen, Stig Holden; Holm, Torkil; Madsen, Robert

    2014-01-01

    transformation. The retro benzyl reaction was shown by the addition of benzylmagnesium chloride to di-tert-butyl ketone followed by exchange of both the benzyl and the ketone moiety with another substrate. Similar experiments were performed with phenylmagnesium bromide and tert-butylmagnesium chloride...

  11. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    Science.gov (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  12. Pressure effects on enzyme reactions in mainly organic media: alpha-chymotrypsin in reversed micelles of Aerosol OT in octane.

    Science.gov (United States)

    Mozhaev, V V; Bec, N; Balny, C

    1994-08-01

    Biocatalytic transformations in reversed micelles formed by anionic surfactant Aerosol OT in octane have been studied at high pressures by an example of alpha-chymotrypsin-catalyzed hydrolysis of N-carbobenzoxy-L-tyrosine p-nitrophenyl ester and N-succinyl-L-phenylalanine p-nitroanilide. For the first time it has been found that the enzyme retains high activity in these water-in-oil microemulsions up to a pressure of 2 kbar. The value of the activation volume (delta V*) for the enzyme reactions shows a dependence on the water content in the system. When the size of the micellar aqueous inner cavity (as evaluated at 1 atm) approaches the molecular size of alpha-chymotrypsin, delta V* becomes significantly different from the value in aqueous solution and in the micelles with a larger size. Possibilities of regulating the enzyme activity by pressure in systems with a low content of water are discussed.

  13. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  14. Click and chemically triggered declick reactions through reversible amine and thiol coupling via a conjugate acceptor

    Science.gov (United States)

    Diehl, Katharine L.; Kolesnichenko, Igor V.; Robotham, Scott A.; Bachman, J. Logan; Zhong, Ye; Brodbelt, Jennifer S.; Anslyn, Eric V.

    2016-10-01

    The coupling and decoupling of molecular units is a fundamental undertaking of organic chemistry. Herein we report the use of a very simple conjugate acceptor, derived from Meldrum's acid, for the sequential ‘clicking’ together of an amine and a thiol in aqueous conditions at neutral pH. Subsequently, this linkage can be ‘declicked’ by a chemical trigger to release the original amine and thiol undisturbed. The reactivity differs from that of other crosslinking agents because the selectivity for sequential functionalization derives from an altering of the electrophilicity of the conjugate acceptor on the addition of the amine. We describe the use of the procedure to modify proteins, create multicomponent libraries and synthesize oligomers, all of which can be declicked to their starting components in a controlled fashion when desired. Owing to the mild reaction conditions and ease of use in a variety of applications, the method is predicted to have wide utility.

  15. Kinetics and reversibility of radionuclide sorption reactions with rocks. Progress report for fiscal year 1979

    International Nuclear Information System (INIS)

    Barney, G.S.; Brown, G.E.

    1979-01-01

    Sorption-desorption reactions of cesium, strontium, neptunium, americium, and plutonium on basalt, granite, and argillite were observed for 218 days. Equilibrium in batch experiments was not reached for most radionuclides even after this long time. Reactions of the crushed rock with ground waters (dissolution, hydrolysis, precipitation, etc.) also did not reach equilibrium after 150 days. The dissolution of basalt is accompanied by the formation of colloidal particles which contain Si, Fe, Ca, and Al. These colloids sorb Cs, Sr, Am, and Pu during equilibration. Some of the colloids pass through 0.3-μm flters, are not retained even on 0.01-μm filters and, therefore, cause calculated K/sub d/ values to be too low. Samples of crushed basalt, granite, and argillite were artificially weathered by continuous leaching with distilled water for 6 months both in air and in an oxygen-free stream of nitrogen gas. The weathered rock was then characterized for surface area, surface structure, cation exchange capacity, and composition of weathered surface on the rock. Comparisons were made of radionuclide sorption (after 14 days) on fresh rock, rock weathered in air, and rock weathered in N 2 . Sorption on rocks weathered in N 2 generally is less than on rock weathered in air. This is possibly due to the lack of an Fe(OH) 3 coating on the rock weathered in N 2 . The Fe(OH) 3 is known to scavenge cations and silica from solution. Sorption of Cs, Si, Am, and Pu is strongly affected by weathering basalt and argillite. However, the cation exchange capacity is changed very little, suggesting that ion exchange plays a minor role in sorption of these radionuclides

  16. Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

    Science.gov (United States)

    Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

    2011-12-01

    Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

  17. Efficacy of AquatainTM, a monomolecular surface film, against the malaria vectors Anopheles stephensi and An. gambiae s.s. in the laboratory

    NARCIS (Netherlands)

    Bukhari, S.T.; Knols, B.G.J.

    2009-01-01

    Monomolecular films are used for mosquito control because of their asphyxiating effect on larvae and pupae. Compared with other films, Aquatain mosquito formulation (AMFTM) has an improved spreading ability and flexibility on a water surface. In the laboratory, AMFTM showed larvicidal, pupicidal,

  18. Influence of surface chemistry on the structural organization of monomolecular protein layers adsorbed to functionalized aqueous interfaces

    DEFF Research Database (Denmark)

    Lösche, M.; Piepenstock, M.; Diederich, A.

    1993-01-01

    The molecular organization of streptavidin (SA) bound to aqueous surface monolayers of biotin-functionalized lipids and binary lipid mixtures has been investigated with neutron reflectivity and electron and fluorescence microscopy. The substitution of deuterons (2H) for protons (1H), both...... in subphase water molecules and in the alkyl chains of the lipid surface monolayer, was utilized to determine the interface structure on the molecular length scale. In all cases studied, the protein forms monomolecular layers underneath the interface with thickness values of apprx 40 ANG . A systematic...... dependence of the structural properties of such self-assembled SA monolayers on the surface chemistry was observed: the lateral protein density depends on the length of the spacer connecting the biotin moiety and its hydrophobic anchor. The hydration of the lipid head groups in the protein-bound state...

  19. Thermomchromic Reaction-Induced Reversible Upconversion Emission Modulation for Switching Devices and Tunable Upconversion Emission Based on Defect Engineering of WO3:Yb3+,Er3+ Phosphor.

    Science.gov (United States)

    Ruan, Jiufeng; Yang, Zhengwen; Huang, Anjun; Zhang, Hailu; Qiu, Jianbei; Song, Zhiguo

    2018-05-02

    Reversible luminescence modulation of upconversion phosphors has the potential applications as photoswitches and optical memory and data storage devices. Previously, the photochromic reaction was extensively used for the realization of reversible luminescence modulation. It is very necessary to develop other approaches such as thermomchromic reaction to obtain the reversible upconversion luminescence modulation. In this work, the WO 3 :Yb 3+ ,Er 3+ phosphors with various colors were prepared at various temperatures, exhibiting tunable upconversion luminescence attributed to the formation of oxygen vacancies in the host. Upon heat treatment in the reducing atmosphere or air, the WO 3 :Yb 3+ ,Er 3+ phosphors show a reversible thermomchromic property. The reversible upconversion luminescence modulation of WO 3 :Yb 3+ ,Er 3+ phosphors was observed based on thermomchromic reaction. Additionally, the upconversion luminescence modulation is maintained after several cycles, indicating its excellent stability. The WO 3 :Yb 3+ ,Er 3+ phosphors with reversible upconversion luminescence and excellent reproducibility have potential applications as the photoswitches and optical memory and data storage devices.

  20. Fiber-Optic Bio-sniffer (Biochemical Gas Sensor) Using Reverse Reaction of Alcohol Dehydrogenase for Exhaled Acetaldehyde.

    Science.gov (United States)

    Iitani, Kenta; Chien, Po-Jen; Suzuki, Takuma; Toma, Koji; Arakawa, Takahiro; Iwasaki, Yasuhiko; Mitsubayashi, Kohji

    2018-02-23

    Volatile organic compounds (VOCs) exhaled in breath have huge potential as indicators of diseases and metabolisms. Application of breath analysis for disease screening and metabolism assessment is expected since breath samples can be noninvasively collected and measured. In this research, a highly sensitive and selective biochemical gas sensor (bio-sniffer) for gaseous acetaldehyde (AcH) was developed. In the AcH bio-sniffer, a reverse reaction of alcohol dehydrogenase (ADH) was employed for reducing AcH to ethanol and simultaneously consuming a coenzyme, reduced form of nicotinamide adenine dinucleotide (NADH). The concentration of AcH can be quantified by fluorescence detection of NADH that was consumed by reverse reaction of ADH. The AcH bio-sniffer was composed of an ultraviolet light-emitting diode (UV-LED) as an excitation light source, a photomultiplier tube (PMT) as a fluorescence detector, and an optical fiber probe, and these three components were connected with a bifurcated optical fiber. A gas-sensing region of the fiber probe was developed with a flow-cell and an ADH-immobilized membrane. In the experiment, after optimization of the enzyme reaction conditions, the selectivity and dynamic range of the AcH bio-sniffer were investigated. The AcH bio-sniffer showed a short measurement time (within 2 min) and a broad dynamic range for determination of gaseous AcH, 0.02-10 ppm, which encompassed a typical AcH concentration in exhaled breath (1.2-6.0 ppm). Also, the AcH bio-sniffer exhibited a high selectivity to gaseous AcH based on the specificity of ADH. The sensor outputs were observed only from AcH-contained standard gaseous samples. Finally, the AcH bio-sniffer was applied to measure the concentration of AcH in exhaled breath from healthy subjects after ingestion of alcohol. As a result, a significant difference of AcH concentration between subjects with different aldehyde dehydrogenase type 2 (ALDH2) phenotypes was observed. The AcH bio-sniffer can be

  1. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Directory of Open Access Journals (Sweden)

    Laurent Dacheux

    2016-07-01

    Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

  2. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Science.gov (United States)

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  3. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  4. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Chemiluminescence from an oxidation reaction of rhodamine B with cerium(IV) in a reversed micellar medium of cetyltrimethylammonium chloride in 1-hexanol-cyclohexane/water.

    Science.gov (United States)

    Hasanin, Tamer H A; Tsunemine, Yusuke; Tsukahara, Satoshi; Okamoto, Yasuaki; Fujiwara, Terufumi

    2011-01-01

    The chemiluminescence (CL) emission, observed when rhodamine B (RB) in 1-hexanol-cyclohexane was mixed with cerium(IV) sulfate in sulfuric acid dispersed in a reversed micellar medium of cetyltrimethylammonium chloride (CTAC) in 1-hexanol-cyclohexane/water, was investigated using a flow-injection system. The CL emission from the oxidation reaction of RB with Ce(IV) was found to be stronger in the CTAC reversed micellar solution compared with an aqueous solution. Bearing on the enhancement effect of the CTAC reverse micelles on the RB-Ce(IV) CL, several studies including stopped-flow, fluorescence and electron spin resonance (ESR) spectrometries were performed. Rapid spectral changes of an intermediate in the RB-Ce(IV) reaction in the aqueous and reversed micellar solutions were successfully observed using a stopped-flow method. The effect of the experimental variables, i.e., oxidant concentration, sulfuric acid concentration, the mole fraction of 1-hexanol, water-to-surfactant molar concentration ratio, flow rate, upon the CL intensity was evaluated. Under the experimental conditions optimized for a flow-injection determination of RB based on the new reversed micellar-mediated CL reaction with Ce(IV), a detection limit of 0.08 µmol dm(-3) RB was achieved, and a linear calibration graph was obtained with a dynamic range from 0.5 to 20 µmol dm(-3). The relative standard deviation (n = 6) obtained at an RB concentration of 3 µmol dm(-3) was 3%.

  6. Relation between the 16O(α,γ)20Ne capture reaction and its reverse 20Ne(γ,α)16O photodisintegration reaction in stars and in the lab

    International Nuclear Information System (INIS)

    Mohr, P.; Angulo, C.; Descouvemont, P.

    2005-01-01

    The astrophysical reaction rates of the 16 O(α,γ) 20 Ne capture reaction and its reverse 20 Ne(γ,α) 16 O photodisintegration reaction are dominated by a few narrow resonances. Only at very low temperatures direct capture plays a significant role. Usually the reaction rate of photodisintegration reactions is calculated from the reaction rate of the corresponding capture reaction using the detailed balanced theorem. This is only valid for nuclei which are thermalized. The reaction rates of the 16 O(α,γ) 20 Ne capture reaction in the lab and under stellar conditions are identical. However, for the inverse 20 Ne(γ,α) 16 O photodisintegration reaction one finds a significant contribution of the thermally populated first excited state at E x = 1634 keV in 20 Ne. Consequently, the reaction rates of the 20 Ne(γ,α) 16 O photodisintegration reaction are different in the lab and under stellar conditions. It is shown that the detailed balance theorem remains valid for the reaction rates under stellar conditions. Photodisintegration rates in the lab have been measured recently using a quasi-thermal photon spectrum from bremsstrahlung, and a quasi-thermal photon spectrum with superior quality has been suggested using high-energy synchrotron radiation. (author)

  7. The Concentration Dependence of the (Delta)s Term in the Gibbs Free Energy Function: Application to Reversible Reactions in Biochemistry

    Science.gov (United States)

    Gary, Ronald K.

    2004-01-01

    The concentration dependence of (delta)S term in the Gibbs free energy function is described in relation to its application to reversible reactions in biochemistry. An intuitive and non-mathematical argument for the concentration dependence of the (delta)S term in the Gibbs free energy equation is derived and the applicability of the equation to…

  8. Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

    NARCIS (Netherlands)

    Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

    2003-01-01

    An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

  9. Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study

    NARCIS (Netherlands)

    Verhagen, C. E.; Wierenga, E. A.; Buffing, A. A.; Chand, M. A.; Faber, W. R.; Das, P. K.

    1997-01-01

    Borderline leprosy patients often undergo acute changes in immune reactivity that manifest as reversal reaction (RR) in the course of the disease. RR is associated with an exacerbated local delayed-type cellular immune response to Mycobacterium leprae and is responsible for severe tissue damage. We

  10. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

    2005-01-01

    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  11. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  12. Redox behavior of transition metal ions in zeolites 6. Reversibility of the reduction reaction in silver zeolites

    Energy Technology Data Exchange (ETDEWEB)

    Jacobs, P A; Uytterhoeven, J B; Beyer, H K

    1977-01-01

    Degassing above 573/sup 0/K of Ag-Y or Ag-mordenite previously reduced by hydrogen at 623/sup 0/K resulted in hydrogen evolution, the amount of hydrogen increasing to a maximum at about 873/sup 0/K. No hydrogen was evolved when the zeolite was reduced by hydrazine or hydroxylamine, indicating that hydrogen is formed by reaction between silver metal and hydroxyl groups formed in the reduction step (i.e., the reverse of the reduction step). Consumption of hydroxyl groups was proven by IR studies of pyridine chemisorption which occurs entirely as pyridinium ions on Broensted sites or reduced samples but with increasing formation of pyridine on Lewis acid sites as the degassing temperature increases; formation of silver(I) ions was proven by carbon monoxide complexation. Silver metal outside the zeolite pores was not affected by the degassing, and the amount of hydrogen evolved upon degassing decreased with increasing number of reduction-degassing cycles, probably as a result of dehydroxylation or sintering. Spectra, graphs, tables, and 21 references.

  13. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    Science.gov (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  14. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  16. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

    Science.gov (United States)

    Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

    2012-05-15

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  17. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  18. Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

    Science.gov (United States)

    Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

    2007-10-01

    Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

  19. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    Directory of Open Access Journals (Sweden)

    Marcos Lázaro Moreli

    2004-10-01

    Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

  20. I + (H2O)2 → HI + (H2O)OH Forward and Reverse Reactions. CCSD(T) Studies Including Spin-Orbit Coupling.

    Science.gov (United States)

    Wang, Hui; Li, Guoliang; Li, Qian-Shu; Xie, Yaoming; Schaefer, Henry F

    2016-03-03

    The potential energy profile for the atomic iodine plus water dimer reaction I + (H2O)2 → HI + (H2O)OH has been explored using the "Gold Standard" CCSD(T) method with quadruple-ζ correlation-consistent basis sets. The corresponding information for the reverse reaction HI + (H2O)OH → I + (H2O)2 is also derived. Both zero-point vibrational energies (ZPVEs) and spin-orbit (SO) coupling are considered, and these notably alter the classical energetics. On the basis of the CCSD(T)/cc-pVQZ-PP results, including ZPVE and SO coupling, the forward reaction is found to be endothermic by 47.4 kcal/mol, implying a significant exothermicity for the reverse reaction. The entrance complex I···(H2O)2 is bound by 1.8 kcal/mol, and this dissociation energy is significantly affected by SO coupling. The reaction barrier lies 45.1 kcal/mol higher than the reactants. The exit complex HI···(H2O)OH is bound by 3.0 kcal/mol relative to the asymptotic limit. At every level of theory, the reverse reaction HI + (H2O)OH → I + (H2O)2 proceeds without a barrier. Compared with the analogous water monomer reaction I + H2O → HI + OH, the additional water molecule reduces the relative energies of the entrance stationary point, transition state, and exit complex by 3-5 kcal/mol. The I + (H2O)2 reaction is related to the valence isoelectronic bromine and chlorine reactions but is distinctly different from the F + (H2O)2 system.

  1. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  2. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  3. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  4. Lecithin-cholesterol acyltransferase (LCAT) catalyzes transacylation of intact cholesteryl esters. Evidence for the partial reversal of the forward LCAT reaction

    International Nuclear Information System (INIS)

    Sorci-Thomas, M.; Babiak, J.; Rudel, L.L.

    1990-01-01

    Lecithin-cholesterol acyltransferase (LCAT) catalyzes the intravascular synthesis of lipoprotein cholesteryl esters by converting cholesterol and lecithin to cholesteryl ester and lysolecithin. LCAT is unique in that it catalyzes sequential reactions within a single polypeptide sequence. In this report we find that LCAT mediates a partial reverse reaction, the transacylation of lipoprotein cholesteryl oleate, in whole plasma and in a purified, reconstituted system. As a result of the reverse transacylation reaction, a linear accumulation of [3H]cholesterol occurred during incubations of plasma containing high density lipoprotein labeled with [3H]cholesteryl oleate. When high density lipoprotein labeled with cholesteryl [14C]oleate was also included in the incubation the labeled fatty acyl moiety remained in the cholesteryl [14C]oleate pool showing that the formation of labeled cholesterol did not result from hydrolysis of the doubly labeled cholesteryl esters. The rate of release of [3H]cholesterol was only about 10% of the forward rate of esterification of cholesterol using partially purified human LCAT and was approximately 7% in whole monkey plasma. Therefore, net production of cholesterol via the reverse LCAT reaction would not occur. [3H]Cholesterol production from [3H]cholesteryl oleate was almost completely inhibited by a final concentration of 1.4 mM 5,5'-dithiobis(nitrobenzoic acid) during incubation with either purified LCAT or whole plasma. Addition of excess lysolecithin to the incubation system did not result in the formation of [14C]oleate-labeled lecithin, showing that the reverse reaction found here for LCAT was limited to the last step of the reaction. To explain these results we hypothesize that LCAT forms a [14C]oleate enzyme thioester intermediate after its attack on the cholesteryl oleate molecule

  5. Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

    Science.gov (United States)

    Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

    2015-10-01

    The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

  6. Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

    Directory of Open Access Journals (Sweden)

    Boissière-Michot Florence

    2009-04-01

    Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

  7. Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

    Science.gov (United States)

    Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

    2012-02-01

    Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

  8. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Faggioli, F; Pasquini, G; Barba, M

    1998-09-01

    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  9. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  10. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    Science.gov (United States)

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  11. Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol

    NARCIS (Netherlands)

    Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; Van Den Berg, Albert; Olthuis, Wouter; Pascual-García, César

    2017-01-01

    The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used

  12. TR-ESR Investigation on Reaction of Vitamin C with Excited Triplet of 9,10-phenanthrenequinone in Reversed Micelle Solutions

    Science.gov (United States)

    Xu, Xin-sheng; Shi, Lei; Liu, Yi; Ji, Xue-han; Cui, Zhi-feng

    2011-04-01

    Time-resolved electron spin resonance has been used to study quenching reactions between the antioxidant Vitamin C (VC) and the triplet excited states of 9,10-phenanthrenequinone (PAQ) in ethylene glycol-water (EG-H2O) homogeneous and inhomogeneous reversed micelle solutions. Reversed micelle solutions were used to be the models of physiological environment of biological cell and tissue. In PAQ/EG-H2O homogeneous solution, the excited triplet of PAQ (3PAQ*) abstracts hydrogen atom from solvent EG. In PAQ/VC/EG-H2O solution, 3PAQ* abstracts hydrogen atom not only from solvent EG but also from VC. The quenching rate constant of 3PAQ* by VC is close to the diffusion-controlled value of 1.41 × 108 L/(mol ·s). In hexadecyltrimethylammonium bromide (CTAB)/EG-H2O and aerosol OT (AOT)/EG-H2O reversed micelle solutions, 3PAQ* and VC react around the water-oil interface of the reversed micelle. Exit of 3PAQ* from the lipid phase slows down the quenching reaction. For Triton X-100 (TX-100)/EG-H2O reversed micelle solution, PAQ and VC coexist inside the hydrophilic polyethylene glycol core, and the quenching rate constant of 3PAQ* by VC is larger than those in AOT/EG-H2O and CTAB/EG-H2O reversed micelle solutions, even a little larger than that in EG-H2O homogeneous solution. The strong emissive chemically induced dynamic electron polarization of As.- resulted from the effective TM spin polarization transfer in hydrogen abstraction of 3PAQ* from VC.

  13. Effect of reverse Boudouard reaction catalyst on the performance of solid oxide carbon fuel cells integrated with a dry gasifier

    International Nuclear Information System (INIS)

    Kim, Sun-Kyung; Mehran, Muhammad Taqi; Mushtaq, Usman; Lim, Tak-Hyoung; Lee, Jong-Won; Lee, Seung-Bok; Park, Seok-Joo; Song, Rak-Hyun

    2016-01-01

    Highlights: • The addition of K_2CO_3 catalyst in carbon fuel improves the performance of SO-CFC. • Thermal and electrochemical analyses done to elucidate the catalytic enhancement. • Material characterization of SO-CFC performed after long-term degradation test. - Abstract: A solid oxide carbon fuel cell (SO-CFC) integrated with a dry gasifier was operated on activated carbon fuel and the effect of adding a reverse Boudouard gasification catalyst on the performance and long-term operation characteristics of the SO-CFC was investigated. The reactivity of the carbon fuels for the Boudouard gasification reaction was analyzed by a thermal analysis at various operating conditions. The SO-CFC was then operated on gasified fuel gas consisting of CO_2 and CO obtained from the integrated dry gasifier. The SO-CFC operated on activated carbon fuel with 5 wt.% K_2CO_3 achieved a maximum power density of 202, 262, and 271 mW/cm"2 at 750, 800, and 850 °C, respectively; the SO-CFC fueled with activated carbon fuel without a catalyst meanwhile yielded maximum power density of 168 mW/cm"2 at 850 °C. By using electrochemical impedance spectroscopy, the effect of adding the catalyst on the gasification products and subsequently on the performance of the SO-CFC was studied. A long-term degradation test was conducted by continuously operating the SO-CFC at 50 mA/cm"2 for 518 h at 750 °C. During the long-term degradation test, the average degradation rate of the SO-CFC was found to be 183 mV/kh. The post-mortem SEM and XRD analyses of the SO-CFC after the long-term test revealed the presence of carbon deposits and oxidation of Ni at the anode, causing a relatively higher degree of degradation in the SO-CFC integrated with the dry gasifier during the long-term operation. The addition of the K_2CO_3 based dry gasification catalyst significantly enhances the performance of the SO-CFC integrated with dry gasification, but during long-term operation, the degradation rate is found

  14. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  15. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  16. NUMERICAL TECHNIQUES TO SOLVE CONDENSATIONAL AND DISSOLUTIONAL GROWTH EQUATIONS WHEN GROWTH IS COUPLED TO REVERSIBLE REACTIONS (R823186)

    Science.gov (United States)

    Noniterative, unconditionally stable numerical techniques for solving condensational anddissolutional growth equations are given. Growth solutions are compared to Gear-code solutions forthree cases when growth is coupled to reversible equilibrium chemistry. In all cases, ...

  17. Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol.

    Science.gov (United States)

    Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; van den Berg, Albert; Olthuis, Wouter; Pascual-García, César

    2017-11-13

    The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used electrochemical and photo-polymerisation in neutral buffers and plasma polymerisation in air to induce reversible redox states. The chemical stoichiometry and surface coverage of PATP in the polymerized layers were characterized by X-ray photoelectron spectroscopy (XPS), while cyclic voltammetry (CV) was used to measure the charge transfer, double layer capacitance and electrochemical rate of the layers during successive potential cycles. Our results show that the surface coverage of the redox active species is higher on electro-polymerised samples, however, after consecutive cycles all the methods converge to the same charge transfer, while the plasma polymerised samples achieve higher efficiency per molecule and UV polymerised samples have a higher electron transfer rate.

  18. The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2014-03-01

    Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

  19. The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

    International Nuclear Information System (INIS)

    Doktorov, Alexander B.

    2015-01-01

    Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants

  20. The influence of the "cage effect" on the mechanism of reversible bimolecular multistage chemical reactions in solutions.

    Science.gov (United States)

    Doktorov, Alexander B

    2015-08-21

    Manifestations of the "cage effect" at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a "cage complex." Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the "cage effect" leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

  1. The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

    Energy Technology Data Exchange (ETDEWEB)

    Doktorov, Alexander B., E-mail: doktorov@kinetics.nsc.ru [Voevodsky Institute of Chemical Kinetics & Combustion, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

    2015-08-21

    Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

  2. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

  3. Reaction

    African Journals Online (AJOL)

    abp

    19 oct. 2017 ... Reaction to Mohamed Said Nakhli et al. concerning the article: "When the axillary block remains the only alternative in a 5 year old child". .... Bertini L1, Savoia G, De Nicola A, Ivani G, Gravino E, Albani A et al ... 2010;7(2):101-.

  4. Introduction to time reversal theory

    International Nuclear Information System (INIS)

    Henley, E.M.

    1987-01-01

    Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs

  5. Experimental study of line reversal symmetry in the reactions anti pp→π-π+ and π+p→pπ+ at 6 GeV/c

    International Nuclear Information System (INIS)

    Stein, N.A.

    1977-01-01

    The differential cross sections were measured for several two body and quasi-two body baryon exchange scattering channels at 6 GeV/c in a spark chamber-counter experiment utilizing the Brookhaven National Laboratory Multi-Particle Spectrometer. Among these is a comparison study of anti pp→π - π + and its line reversed partner π + p→pπ + in the range t/sub min/ > t > -1.5 (GeV/c) 2 . For the first time structure analogous to the striking dip in the backward elastic scattering reaction at t approx. -0.15 (GeV/c) 2 is observed in the annihilation reaction. The structure which appears as a break in the t slope at t approx. -0.40 (GeV/c) 2 and perhaps a shallow dip at that point, demonstrates the strong role played by absorption in these channels

  6. Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

    1999-01-01

    A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

  7. PdZnAl Catalysts for the Reactions of Water-Gas-Shift, Methanol Steam Reforming, and Reverse-Water-Gas-Shift

    Energy Technology Data Exchange (ETDEWEB)

    Dagle, Robert A.; Platon, Alexandru; Datye, Abhaya K.; Vohs, John M.; Wang, Yong; Palo, Daniel R.

    2008-03-07

    Pd/ZnO/Al2O3 catalysts were studied for water-gas-shift (WGS), methanol steam reforming, and reverse-water-gas-shift (RWGS) reactions. WGS activity was found to be dependent on the Pd:Zn ratio with a maximum activity obtained at approximately 0.50, which was comparable to that of a commercial Pt-based catalyst. The catalyst stability was demonstrated for 100 hours time-on-stream at a temperature of 3600C without evidence of metal sintering. WGS reaction rates were approximately 1st order with respect to CO concentration, and kinetic parameters were determined to be Ea = 58.3 kJ mol-1 and k0 = 6.1x107 min-1. During methanol steam reforming, the CO selectivities were observed to be lower than the calculated equilibrium values over a range of temperatures and steam/carbon ratios studied while the reaction rate constants were approximately of the same magnitude for both WGS and methanol steam reforming. These results indicate that although Pd/ZnO/Al2O3 are active WGS catalysts, WGS is not involved in methanol steam reforming. RWGS rate constants are on the order of about 20 times lower than that of methanol steam reforming, suggesting that RWGS reaction could be one of the sources for small amount of CO formation in methanol steam reforming.

  8. Silver Nanowire Embedded Colorless Polyimide Heater for Wearable Chemical Sensors: Improved Reversible Reaction Kinetics of Optically Reduced Graphene Oxide.

    Science.gov (United States)

    Choi, Seon-Jin; Kim, Sang-Joon; Jang, Ji-Soo; Lee, Ji-Hyun; Kim, Il-Doo

    2016-09-14

    Optically reduced graphene oxide (ORGO) sheets are successfully integrated on silver nanowire (Ag NW)-embedded transparent and flexible substrate. As a heating element, Ag NWs are embedded in a colorless polyimide (CPI) film by covering Ag NW networks using polyamic acid and subsequent imidization. Graphene oxide dispersed aqueous solution is drop-coated on the Ag NW-embedded CPI (Ag NW-CPI) film and directly irradiated by intense pulsed light to obtain ORGO sheets. The heat generation property of Ag NW-CPI film is investigated by applying DC voltage, which demonstrates unprecedentedly reliable and stable characteristics even in dynamic bending condition. To demonstrate the potential application in wearable chemical sensors, NO 2 sensing characteristic of ORGO is investigated with respect to the different heating temperature (22.7-71.7 °C) of Ag NW-CPI film. The result reveals that the ORGO sheets exhibit high sensitivity of 2.69% with reversible response/recovery sensing properties and minimal deviation of baseline resistance of around 1% toward NO 2 molecules when the temperature of Ag NW-CPI film is 71.7 °C. This work first demonstrates the improved reversible NO 2 sensing properties of ORGO sheets on flexible and transparent Ag NW-CPI film assisted by Ag NW heating networks. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  10. Reverse line blot probe design and polymerase chain reaction optimization for bloodmeal analysis of ticks from the eastern United States.

    Science.gov (United States)

    Scott, M C; Harmon, J R; Tsao, J I; Jones, C J; Hickling, G J

    2012-05-01

    Determining the host preference of vector ticks is vital to elucidating the eco-epidemiology of the diseases they spread. Detachment of ticks from captured hosts can provide evidence of feeding on those host species, but only for those species that are feasible to capture. Recently developed, highly sensitive molecular assays show great promise in allowing host selection to be determined from minute traces of host DNA that persist in recently molted ticks. Using methods developed in Europe as a starting-point, we designed 12S rDNA mitochondrial gene probes suitable for use in a reverse line blot (RLB) assay of ticks feeding on common host species in the eastern United States. This is the first study to use the 12S mitochondrial gene in a RLB bloodmeal assay in North America. The assay combines conventional PCR with a biotin-labeled primer and reverse line blots that can be stripped and rehybridized up to 20 times, making the method less expensive and more straightforward to interpret than previous methods of tick bloodmeal identification. Probes were designed that target the species, genus, genus group, family, order, or class of eight reptile, 13 birds, and 32 mammal hosts. After optimization, the RLB assay correctly identified the current hostspecies for 99% of ticks [Amblyomma americanum (L.) and eight other ixodid tick species] collected directly from known hosts. The method identified previous-host DNA for approximately half of all questing ticks assayed. Multiple bloodmeal determinations were obtained in some instances from feeding and questing ticks; this pattern is consistent with previous RLB studies but requires further investigation. Development of this probe library, suitable for eastern U.S. ecosystems, opens new avenues for eco-epidemiological investigations of this region's tick-host systems.

  11. Photochemical reactions in dehydrated photosynthetic organisms, leaves, chloroplasts and photosystem II particles: reversible reduction of pheophytin and chlorophyll and oxidation of {beta}-carotene

    Energy Technology Data Exchange (ETDEWEB)

    Shuvalov, Vladimir A.; Heber, Ulrich

    2003-11-01

    Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q{sub A} in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of {beta}-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of {beta}-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680{sup -} or Car{sup +} in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q{sub A} reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680{sup +} with consequent recombination of

  12. Photochemical reactions in dehydrated photosynthetic organisms, leaves, chloroplasts and photosystem II particles: reversible reduction of pheophytin and chlorophyll and oxidation of β-carotene

    International Nuclear Information System (INIS)

    Shuvalov, Vladimir A.; Heber, Ulrich

    2003-01-01

    Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q A in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of β-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of β-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680 - or Car + in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q A reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680 + with consequent recombination of Car + and Chl-680 - (or Pheo

  13. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta

    2005-08-01

    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  14. Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

    Directory of Open Access Journals (Sweden)

    C Coelho

    2003-06-01

    Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

  15. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

  16. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    Science.gov (United States)

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  17. Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

    Directory of Open Access Journals (Sweden)

    W. Ali

    2017-06-01

    Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

  18. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Directory of Open Access Journals (Sweden)

    Cui Shang-jin

    2010-05-01

    Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  19. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    Science.gov (United States)

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  20. Enzymatic Synthesis of Highly Fluorescent 8-Azapurine Ribosides Using a Purine Nucleoside Phosphorylase Reverse Reaction: Variable Ribosylation Sites

    Directory of Open Access Journals (Sweden)

    Goran Mikleušević

    2013-10-01

    Full Text Available Various forms of purine-nucleoside phosphorylase (PNP were used as catalysts of enzymatic ribosylation of selected fluorescent 8-azapurines. It was found that the recombinant calf PNP catalyzes ribosylation of 2,6-diamino-8-azapurine in a phosphate-free medium, with ribose-1-phosphate as ribose donor, but the ribosylation site is predominantly N7 and N8, with the proportion of N8/N7 ribosylated products markedly dependent on the reaction conditions. Both products are fluorescent. Application of the E. coli PNP gave a mixture of N8 and N9-substituted ribosides. Fluorescence of the ribosylated 2,6-diamino-8-azapurine has been briefly characterized. The highest quantum yield, ~0.9, was obtained for N9-β-d-riboside (λmax 365 nm, while for N8-β-d-riboside, emitting at ~430 nm, the fluorescence quantum yield was found to be close to 0.4. Ribosylation of 8-azaguanine with calf PNP as a catalyst goes exclusively to N9. By contrast, the E. coli PNP ribosylates 8-azaGua predominantly at N9, with minor, but highly fluorescent products ribosylated at N8/N7.

  1. Development of a quantitative competitive reverse transcriptase polymerase chain reaction for the quantification of growth hormone gene expression in pigs

    Directory of Open Access Journals (Sweden)

    Maurício Machaim Franco

    2003-01-01

    Full Text Available After the advent of the genome projects, followed by the discovery of DNA polymorphisms, basic understanding of gene expression is the next focus to explain the association between polymorphisms and the level of gene expression, as well as to demonstrate the interaction among genes. Among the various techniques for the investigation of transcriptional profiling involving patterns of gene expression, quantitative PCR is the simplest analytical laboratory technique. The objective of this work was to analyze two strategies of a competitive PCR technique for the quantification of the pig growth hormone (GH gene expression. A pair of primers was designed targeting exons 3 and 5, and two competitive PCR strategies were performed, one utilizing a specific amplicon as a competitor, and the other utilizing a low-stringency PCR amplicon as a competitor. The latter strategy proved to be easier and more efficient, offering an accessible tool that can be used in any kind of competitive reaction, facilitating the study of gene expression patterns for both genetics and diagnostics of infectious diseases.

  2. A Near-Infrared Photothermal Effect-Responsive Drug Delivery System Based on Indocyanine Green and Doxorubicin-Loaded Polymeric Micelles Mediated by Reversible Diels-Alder Reaction.

    Science.gov (United States)

    Li, Hui; Li, Junjie; Ke, Wendong; Ge, Zhishen

    2015-10-01

    Near-infrared light (NIR) possesses great advantages for light-responsive controllable drug release, such as deep tissue penetration and low damage to healthy tissues. Herein, a NIR-responsive drug delivery system is developed based on a NIR dye, indocyanine green (ICG), and anticancer drug, doxorubicin (DOX)-loaded thermoresponsive block copolymer micelles, in which the drug release can be controlled via NIR irradiation. First, block copolymers, poly(oligo(ethylene glycol) methacrylate)-block-poly(furfuryl methacrylate) (POEGMA-b-PFMA), are synthesized by sequential reversible addition-fragmentation chain-transfer (RAFT) polymerization, followed by modification with N-octyl maleimide through Diels-Alder (DA) reaction to produce POEGMA-b-POMFMA. The self-assembly of POEGMA-b-POMFMA by nano-precipitation in aqueous solution affords the polymeric micelles which are used to simultaneously encapsulate ICG and DOX. Upon irradiation by NIR light (805 nm), the loaded DOX is released rapidly from the micelles due to partial retro DA reaction and local temperature increase-induced faster drug diffusion by the photothermal effect. Cytotoxicity evaluation and intracellular distribution observation demonstrate significant synergistic effects of NIR-triggered drug release, photothermal, and chemotherapy toward cancer cells under NIR irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Prediction of thermodynamically reversible hydrogen storage reactions utilizing Ca-M(M = Li, Na, K)-B-H systems: a first-principles study.

    Science.gov (United States)

    Guo, Yajuan; Ren, Ying; Wu, Haishun; Jia, Jianfeng

    2013-12-01

    Calcium borohydride is a potential candidate for onboard hydrogen storage because it has a high gravimetric capacity (11.5 wt.%) and a high volumetric hydrogen content (∼130 kg m(-3)). Unfortunately, calcium borohydride suffers from the drawback of having very strongly bound hydrogen. In this study, Ca(BH₄)₂ was predicted to form a destabilized system when it was mixed with LiBH₄, NaBH₄, or KBH₄. The release of hydrogen from Ca(BH₄)₂ was predicted to proceed via two competing reaction pathways (leading to CaB₆ and CaH₂ or CaB₁₂H₁₂ and CaH₂) that were found to have almost equal free energies. Using a set of recently developed theoretical methods derived from first principles, we predicted five new hydrogen storage reactions that are among the most attractive of those presently known. These combine high gravimetric densities (>6.0 wt.% H₂) with have low enthalpies [approximately 35 kJ/(mol(-1) H₂)] and are thermodynamically reversible at low pressure within the target window for onboard storage that is actively being considered for hydrogen storage applications. Thus, the first-principles theoretical design of new materials for energy storage in future research appears to be possible.

  4. Detection and serotyping of dengue virus in serum samples by multiplex reverse transcriptase PCR-ligase detection reaction assay.

    Science.gov (United States)

    Das, S; Pingle, M R; Muñoz-Jordán, J; Rundell, M S; Rondini, S; Granger, K; Chang, G-J J; Kelly, E; Spier, E G; Larone, D; Spitzer, E; Barany, F; Golightly, L M

    2008-10-01

    The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV.

  5. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    Science.gov (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  6. Reversible bulk-phase change of anthroyl compounds for photopatterning based on photodimerization in the molten state and thermal back reaction.

    Science.gov (United States)

    Kihara, Hideyuki; Yoshida, Masaru

    2013-04-10

    As new organic materials for rewritable photopatterning, 2-anthroyl and 9-anthroyl ester compounds were synthesized. Their bulk-phase changes (we use "bulk-phase change" as complete phase change in a mass of a material neither in a surface nor in a small quantity in this study) triggered by photodimerization under melting conditions (melt-photodimerization) and subsequent thermal back reactions were investigated. All the anthroyl compounds exhibited melting points lower than ca. 160 °C, and they were nearly quantitatively converted to the corresponding photodimers by UV irradiation at temperatures of ∼5 °C higher than their respective melting points. We found that there were two kinds of bulk-phase change behaviors through the photoreaction. Two of the anthroyl compounds remained isotropic and lost fluidity during the melt-photodimerization. The obtained photodimers exhibited robust solid-state amorphous phases at room temperature. In contrast, the other three anthroyl compounds showed crystallization during the melt-photodimerization. The resulting photodimers changed from isotropic to crystalline phases, even at high temperature. Various experiments revealed that the bulk phase of the photodimers was affected not by the existence of regioisomers but by their fluidity at the photoirradiation temperature. The latter three photodimers retained enough fluidity, reflecting their high molecular mobilities at the photoirradiation temperature at which the isothermal crystallization occurred. The other two products were not able to crystallize due to low fluidity, resulting in amorphous phases. We also found that all the photodimers reverted to the corresponding monomers by thermal back reaction and recovered their initial photochemical and thermal properties. Using these reversible bulk-phase changes of the anthroyl compounds, we successfully demonstrated rewritable photopatterning in not only negative images but also positive ones, based on the optical contrast

  7. A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

    Science.gov (United States)

    Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

    2007-01-01

    Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

  8. Simultaneous determination of Cr(iii) and Cr(vi) using reversed-phased ion-pairing liquid chromatography with dynamic reaction cell inductively coupled plasma mass spectrometry

    Science.gov (United States)

    Wolf, R.E.; Morrison, J.M.; Goldhaber, M.B.

    2007-01-01

    A method for the simultaneous determination of Cr(iii) and Cr(vi) species in waters, soil leachates and synthetic bio-fluids is described. The method uses reversed-phase ion-pairing liquid chromatography to separate the chromium species and a dynamic reaction cell (DRC??) equipped ICP-MS for detection of chromium. Separation of the chromium species is carried out in less than 2 min. Cr(iii) is complexed with ethylenediaminetetraacetic acid (EDTA) prior to separation by mixing samples with the mobile phase containing 2.0 mM tetrabutylammonium hydroxide (TBAOH), 0.5 mM EDTA (dipotassium salt), and 5% (vol/vol) methanol, adjusted to pH 7.6. The interfering 40Ar 12C+ background peak at mass 52 was reduced by over four orders of magnitude to less than 200 cps by using 0.65 mL min-1 ammonia as a reaction gas and an RPq setting on the DRC of 0.75. Method detection limits (MDLs) of 0.09 ??g L-1 for Cr(iii) and 0.06 ??g L-1 for Cr(vi) were obtained based on peak areas at mass 52 for 50 ??L injections of low level spikes. Reproducibility at 2 ??g L-1 was 3% RSD for 5 replicate injections. The tolerance of the method to various levels of common cations and anions found in natural waters and to matrix constituents found in soil leachates and simulated gastric and lung fluids was tested by performing spike recovery calculations for a variety of samples. ?? The Royal Society of Chemistry.

  9. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  10. Analysis of phosphorus herbicides by ion-pairing reversed-phase liquid chromatography coupled to inductively coupled plasma mass spectrometry with octapole reaction cell.

    Science.gov (United States)

    Sadi, Baki B M; Vonderheide, Anne P; Caruso, Joseph A

    2004-09-24

    A reversed phase ion-pairing high performance liquid chromatographic (RPIP-HPLC) method is developed for the separation of two phosphorus herbicides, Glufosinate and Glyphosate as well as Aminomethylphosphonic acid (AMPA), the major metabolite of Glyphosate. Tetrabutylammonium hydroxide is used as the ion-pairing reagent in conjunction with an ammonium acetate/acetic acid buffering system at pH 4.7. An inductively coupled plasma mass spectrometer (ICP-MS) is coupled to the chromatographic system to detect the herbicides at m/z = 31P. Historically, phosphorus has been recognized as one of the elements difficult to analyze in argon plasma. This is due to its relatively high ionization potential (10.5 eV) as well as the inherent presence of the polyatomic interferences 14N16O1H+ and 15N16O+ overlapping its only isotope at m/z = 31. An octapole reaction cell is utilized to minimize the isobaric polyatomic interferences and to obtain the highest signal-to-background ratio. Detection limits were found to be in the low ppt range (25-32 ng/l). The developed method is successfully applied to the analysis of water samples collected from the Ohio River and spiked with a standard compounds at a level of 20 microg/l.

  11. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  12. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    Science.gov (United States)

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  13. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  14. Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

    International Nuclear Information System (INIS)

    Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

    2006-01-01

    Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

  15. Mechanism of the transition from orthorhombic to tetragonal YBa 2Cu 3O 7- x. Investigation of a reversible topotactic reaction in the electron microscope

    Science.gov (United States)

    Müller, J.-H.; Gruehn, R.

    The phase transition from orthorhombic to tetragonal could be observed (in situ) with High-Resolution Transmission Electron Microscopy (HRTEM). In superconducting samples of YBa 2Cu 3O 7- x ( x=0.09) twinned areas were found which changed from orthorhombic to tetragonal symmetry upon electron irradiation parallel to the long c axis. In opposition to annealing experiments the length of the c-axis remained unchanged. The transition was reversible in the high vacuum of the electron microscope. Therefore we surmise that this reaction has no reductive character (no perceptible loss of oxygen). Within the tetragonal structure one can assume a statistical sharing (“disorder”) of oxygen by the metal atoms. The transition could also be explained by a migration of oxygen to the surface. After finishing the irradiation experiment and waiting for several minutes, the oxygen seems to occupy partially ordered positions resulting again in an orthorhombic symmetry. In some cases we could observed transition states of the structural transformation. A schematic model of the mechanism is depicted.

  16. Evaluating viral interference between Influenza virus and Newcastle disease virus using real-time reverse transcription–polymerase chain reaction in chicken eggs

    Directory of Open Access Journals (Sweden)

    Ge Shengqiang

    2012-07-01

    Full Text Available Abstract Background Simultaneous and sequential allantoic cavity inoculations of Specific-pathogen-free (SPF chicken eggs with Influenza virus (AIV and Newcastle disease virus (NDV demonstrated that the interaction of AIV and NDV during co-infection was variable. Our research revisited the replication interference potential of AIV and NDV using real-time reverse transcription–polymerase chain reaction (real-time RT-PCR for AIV and NDV to specifically detect the viral genomes in mixed infections. Results Data from this survey showed that when different doses of NDV (Lasota or F48E8 and AIV (F98 or H5N1 were simultaneously inoculated into embryonating chicken eggs (ECE, interference with the growth of NDV occurred, while interference with the growth of AIV did not occur. When equal amount of the two viruses were sequentially employed, the degree of interference was dependent upon the time of superinfection and the virulence of virus. Conclusion AIV have a negative impact on NDV growth if they are inoculated simultaneously or sequentially and that the degree of interference depended upon the quantity and relative virulence of the virus strains used; however, interference with AIV was not observed. Only if NDV were inoculated at an earlier time will NDV able to interfere with the growth of AIV.

  17. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    Science.gov (United States)

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  18. Simultaneous detection of viruses and Toxoplasma gondii in cerebrospinal fluid specimens by multiplex polymerase chain reaction-based reverse hybridization assay.

    Science.gov (United States)

    Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe

    2009-04-01

    The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.

  19. Chemical kinetics and reaction mechanism

    International Nuclear Information System (INIS)

    Jung, Ou Sik; Park, Youn Yeol

    1996-12-01

    This book is about chemical kinetics and reaction mechanism. It consists of eleven chapters, which deal with reaction and reaction speed on reaction mechanism, simple reaction by rate expression, reversible reaction and simultaneous reaction, successive reaction, complicated reaction mechanism, assumption for reaction mechanism, transition state theory, successive reaction and oscillating reaction, reaction by solution, research method high except kinetics on reaction mechanism, high reaction of kinetics like pulsed radiolysis.

  20. Renewable synthesis-gas-production. Do hydrocarbons in the reactant flow of the reverse water-gas shift reaction cause coke formation?

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, A.; Kern, C.; Jess, A. [Bayreuth Univ. (Germany). Dept. of Chemical Engineering

    2013-11-01

    In a two-step synthetic fuel production process based on carbon dioxide and renewable hydrogen, the best possible selectivity towards liquid hydrocarbons (Hc) shall be implemented. The process consists of a combination of the Reverse Water-Gas Shift reaction and the Fischer-Tropsch synthesis. To achieve this goal, gaseous short-chained Hc from the FTS reactor are recycled in the RWGS unit. In this paper, challenges coming up with the implementation of a recycle loop are discussed. First of all, it has to be examined whether Hc are converted under conditions present in the RWGS reactor. The coking caused by the recycle of Hc is regarded, including thermal coking in the heating zone of the reactor and catalytic coking in the catalyst bed. Coking of course is unwanted, as it deactivates the catalyst. The scope of this work is to find out to which extent and under which conditions gaseous Hc can be recycled. Therefore, experiments were carried out in both, a quartz glass reactor using a commercial Ni-catalyst at ambient pressure and in a pressurized steel reactor (without catalyst) to examine coking during the thermal decomposition of Hc. The catalytic experiments at atmospheric pressure showed that a recycle of CH{sub 4} did not cause coking up to a ratio of CH{sub 4}/CO{sub 2} below one. For these conditions, long term stability was proved. The reaction rates of the CH{sub 4} conversion were below those of the RWGS reaction. However, replacing CH{sub 4} by C{sub 3}H{sub 8} leads to thermal and catalytic coking. Catalytic coking hits the maximum level at about 700 C and decreases for higher temperatures and, thus is not regarded as a problem for the RWGS reactor. In contrast to that, thermal coking raises with higher temperatures, but it can be supressed efficiently with additional injection of H{sub 2}O, which of course shifts the equilibrium towards the undesired reactant side. (orig.)

  1. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  2. Development of real-time reverse transcription polymerase chain reaction assays to quantify insulin-like growth factor receptor and insulin receptor expression in equine tissue

    Directory of Open Access Journals (Sweden)

    Stephen B. Hughes

    2013-08-01

    Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1

  3. Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

    International Nuclear Information System (INIS)

    Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

    1999-01-01

    We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  4. Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

    Science.gov (United States)

    Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

    2016-10-15

     The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  5. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  6. Development of a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction assay for the differential diagnosis of Feline leukemia virus vaccine and wild strains.

    Science.gov (United States)

    Ho, Chia-Fang; Chan, Kun-Wei; Yang, Wei-Cheng; Chiang, Yu-Chung; Chung, Yang-Tsung; Kuo, James; Wang, Chi-Young

    2014-07-01

    A multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) was developed for the differential diagnosis of Feline leukemia virus (FeLV) vaccine and wild-type strains based on a point mutation between the vaccine strain (S) and the wild-type strain (T) located in the p27 gene. This system was further upgraded to obtain a real-time ARMS RT-PCR (ARMS qRT-PCR) with a high-resolution melt analysis (HRMA) platform. The genotyping of various strains of FeLV was determined by comparing the HRMA curves with the defined wild-type FeLV (strain TW1), and the results were expressed as a percentage confidence. The detection limits of ARMS RT-PCR and ARMS qRT-PCR combined with HRMA were 100 and 1 copies of transcribed FeLV RNA per 0.5 ml of sample, respectively. No false-positive results were obtained with 6 unrelated pathogens and 1 feline cell line. Twelve FeLV Taiwan strains were correctly identified using ARMS qRT-PCR combined with HRMA. The genotypes of the strains matched the defined FeLV wild-type strain genotype with at least 91.17% confidence. A higher degree of sequence polymorphism was found throughout the p27 gene compared with the long terminal repeat region. In conclusion, the current study describes the phylogenetic relationship of the FeLV Taiwan strains and demonstrates that the developed ARMS RT-PCR assay is able to be used to detect the replication of a vaccine strain that has not been properly inactivated, thus acting as a safety check for the quality of FeLV vaccines.

  7. Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

    Science.gov (United States)

    Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

    2016-05-01

    Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Directory of Open Access Journals (Sweden)

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  9. Detection of feline coronavirus in cheetah (Acinonyx jubatus) feces by reverse transcription-nested polymerase chain reaction in cheetahs with variable frequency of viral shedding.

    Science.gov (United States)

    Gaffney, Patricia M; Kennedy, Melissa; Terio, Karen; Gardner, Ian; Lothamer, Chad; Coleman, Kathleen; Munson, Linda

    2012-12-01

    Cheetahs (Acinonyx jubatus) are a highly threatened species because of habitat loss, human conflict, and high prevalence of disease in captivity. An epidemic of feline infectious peritonitis and concern for spread of infectious disease resulted in decreased movement of cheetahs between U.S. zoological facilities for managed captive breeding. Identifying the true feline coronavirus (FCoV) infection status of cheetahs is challenging because of inconsistent correlation between seropositivity and fecal viral shedding. Because the pattern of fecal shedding of FCoV is unknown in cheetahs, this study aimed to assess the frequency of detectable fecal viral shedding in a 30-day period and to determine the most efficient fecal sampling strategy to identify cheetahs shedding FCoV. Fecal samples were collected from 16 cheetahs housed at seven zoological facilities for 30 to 46 consecutive days; the samples were evaluated for the presence of FCoV by reverse transcription-nested polymerase chain reaction (RT-nPCR). Forty-four percent (7/16) of cheetahs had detectable FCoV in feces, and the proportion of positive samples for individual animals ranged from 13 to 93%. Cheetahs shed virus persistently, intermittently, or rarely over 30-46 days. Fecal RT-nPCR results were used to calculate the probability of correctly identifying a cheetah known to shed virus given multiple hypothetical fecal collection schedules. The most efficient hypothetical fecal sample collection schedule was evaluation of five individual consecutive fecal samples, resulting in a 90% probability of identifying a known shedder. Demographic and management risk factors were not significantly associated (P cheetahs shed virus intermittently to rarely, fecal sampling schedules meant to identify all known shedders would be impractical with current tests and eradication of virus from the population unreasonable. Managing the captive population as endemically infected with FCoV may be a more feasible approach.

  10. Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

    Science.gov (United States)

    Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

    2011-01-01

    Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

  11. Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

    DEFF Research Database (Denmark)

    Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

    2011-01-01

    and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

  12. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    Science.gov (United States)

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

  13. Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

    Science.gov (United States)

    Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

    2008-05-20

    Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

  14. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

    Science.gov (United States)

    de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

    2010-09-20

    Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression

  15. Detection of influenza viruses by coupling multiplex reverse-transcription loop-mediated isothermal amplification with cascade invasive reaction using nanoparticles as a sensor

    Directory of Open Access Journals (Sweden)

    Ge Y

    2017-04-01

    Full Text Available Yiyue Ge,1 Qiang Zhou,2 Kangchen Zhao,1 Ying Chi,1 Bin Liu,3 Xiaoyan Min,4 Zhiyang Shi,1 Bingjie Zou,2 Lunbiao Cui1 1Institute of Pathogenic Microbiology, Key Laboratories of Enteric Pathogenic Microbiology (Ministry of Health, Jiangsu Provincial Center for Disease Control and Prevention, 2Department of Pharmacology, Jinling Hospital, Medical School of Nanjing University, 3Department of Biomedical Engineering, Nanjing Medical University, 4Department of Geriatrics, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu, People’s Republic of China Abstract: Influenza virus infections represent a worldwide public health and economic problem due to the significant morbidity and mortality caused by seasonal epidemics and pandemics. Sensitive and convenient methodologies for detection of influenza viruses are essential for further disease control. Loop-mediated isothermal amplification (LAMP is the most commonly used method of nucleic acid isothermal amplification. However, with regard to multiplex LAMP, differentiating the ladder-like LAMP products derived from multiple targets is still challenging today. The requirement of specialized instruments has further hindered the on-site application of multiplex LAMP. We have developed an integrated assay coupling multiplex reverse transcription LAMP with cascade invasive reaction using nanoparticles (mRT-LAMP-CIRN as a sensor for the detection of three subtypes of influenza viruses: A/H1N1pdm09, A/H3 and influenza B. The analytic sensitivities of the mRT-LAMP-CIRN assay were 101 copies of RNA for both A/H1N1pdm09 and A/H3, and 102 copies of RNA for influenza B. This assay demonstrated highly specific detection of target viruses and could differentiate them from other genetically or clinically related viruses. Clinical specimen analysis showed the mRT-LAMP-CIRN assay had an overall sensitivity and specificity of 98.3% and 100%, respectively. In summary, the mRT-LAMP-CIRN assay is

  16. Utility of a multiplex reverse transcriptasepolymerase chain reaction assay (HemaVision in the evaluation of genetic abnormalities in Korean children with acute leukemia: a single institution study

    Directory of Open Access Journals (Sweden)

    Hye-Jin kim

    2013-06-01

    Full Text Available &lt;b&gt;Purpose:&lt;/b&gt; In children with acute leukemia, bone marrow genetic abnormalities (GA have prognostic significance, and may be the basis for minimal residual disease monitoring. Since April 2007, we have used a multiplex reverse transcriptase-polymerase chain reaction tool (HemaVision to detect of GA. &lt;b&gt;Methods:&lt;/b&gt; In this study, we reviewed the results of HemaVision screening in 270 children with acute leukemia, newly diagnosed at The Catholic University of Korea from April 2007 to December 2011, and compared the results with those of fluorescence in situ hybridization (FISH, and G-band karyotyping. &lt;b&gt;Results:&lt;/b&gt; Among the 270 children (153 males, 117 females, 187 acute lymphoblastic leukemia and 74 acute myeloid leukemia patients were identified. Overall, GA was detected in 230 patients (85.2%. HemaVision, FISH, and G-band karyotyping identified GA in 125 (46.3%, 126 (46.7%, and 215 patients (79.6%, respectively. TEL-AML1 (20.9%, 39/187 and AML1-ETO (27%, 20/74 were the most common GA in ALL and AML, respectively. Overall sensitivity of HemaVision was 98.4%, with false-negative results in 2 instances: 1 each for TEL-AML1 and MLL-AF4 . An aggregate of diseasesspecific FISH showed 100% sensitivity in detection of GA covered by HemaVision for actual probes utilized. G-band karyotype revealed GA other than those covered by HemaVison screening in 133 patients (49.3%. Except for hyperdiplody and hypodiploidy, recurrent GA as defined by the World Health Organizationthat were not screened by HemaVision, were absent in the karyotype. &lt;b&gt;Conclusion:&lt;/b&gt; HemaVision, supported by an aggregate of FISH tests for important translocations, may allow for accurate diagnosis of GA in Korean children with acute leukemia.

  17. Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

    Science.gov (United States)

    Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

    2013-07-10

    The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process

  18. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    Science.gov (United States)

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Reverse Algols

    Science.gov (United States)

    Leung, K. C.

    1989-01-01

    Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.

  20. Reverse Logistics

    OpenAIRE

    Kulikova, Olga

    2016-01-01

    This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...

  1. The influence of the "cage" effect on the mechanism of reversible bimolecular multistage chemical reactions proceeding from different sites in solutions.

    Science.gov (United States)

    Doktorov, Alexander B

    2016-08-28

    Manifestations of the "cage" effect at the encounters of reactants have been theoretically treated on the example of multistage reactions (including bimolecular exchange reactions as elementary stages) proceeding from different active sites in liquid solutions. It is shown that for reactions occurring near the contact of reactants, consistent consideration of quasi-stationary kinetics of such multistage reactions (possible in the framework of the encounter theory only) can be made on the basis of chemical concepts of the "cage complex," just as in the case of one-site model described in the literature. Exactly as in the one-site model, the presence of the "cage" effect gives rise to new channels of reactant transformation that cannot result from elementary event of chemical conversion for the given reaction mechanism. Besides, the multisite model demonstrates new (as compared to one-site model) features of multistage reaction course.

  2. Electrical characterization of single molecule and Langmuir–Blodgett monomolecular films of a pyridine-terminated oligo(phenylene-ethynylene derivative

    Directory of Open Access Journals (Sweden)

    Henrry M. Osorio

    2015-05-01

    Full Text Available Monolayer Langmuir–Blodgett (LB films of 1,4-bis(pyridin-4-ylethynylbenzene (1 together with the “STM touch-to-contact” method have been used to study the nature of metal–monolayer–metal junctions in which the pyridyl group provides the contact at both molecule–surface interfaces. Surface pressure vs area per molecule isotherms and Brewster angle microscopy images indicate that 1 forms true monolayers at the air–water interface. LB films of 1 were fabricated by deposition of the Langmuir films onto solid supports resulting in monolayers with surface coverage of 0.98 × 10−9 mol·cm−2. The morphology of the LB films that incorporate compound 1 was studied using atomic force microscopy (AFM. AFM images indicate the formation of homogeneous, monomolecular films at a surface pressure of transference of 16 mN·m−1. The UV–vis spectra of the Langmuir and LB films reveal that 1 forms two dimensional J-aggregates. Scanning tunneling microscopy (STM, in particular the “STM touch-to-contact” method, was used to determine the electrical properties of LB films of 1. From these STM studies symmetrical I–V curves were obtained. A junction conductance of 5.17 × 10−5 G0 results from the analysis of the pseudolinear (ohmic region of the I–V curves. This value is higher than that of the conductance values of LB films of phenylene-ethynylene derivatives contacted by amines, thiols, carboxylate, trimethylsilylethynyl or acetylide groups. In addition, the single molecule I–V curve of 1 determined using the I(s method is in good agreement with the I–V curve obtained for the LB film, and both curves fit well with the Simmons model. Together, these results not only indicate that the mechanism of transport through these metal–molecule–metal junctions is non-resonant tunneling, but that lateral interactions between molecules within the LB film do not strongly influence the molecule conductance. The results presented here

  3. Reverse Osmosis

    Indian Academy of Sciences (India)

    many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...

  4. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    Science.gov (United States)

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  5. Detection of infectious bursal disease virus in various lymphoid tissues of experimentally infected specific pathogen free chickens by different reverse transcription polymerase chain reaction assays

    DEFF Research Database (Denmark)

    Kabell, Susanne; Handberg, Kurt; Kusk, Mette

    2005-01-01

    Infectious bursal disease (IBD) is a worldwide distributed immunosuppressive viral disease in young chickens, controlled by vaccination. Emergence of several strains of IBD virus (IBDV) has created a demand for strain-specific diagnostic tools. In the present experiment, five different reverse...... included vaccine strain D78, classical strain Faragher 52/70, and the very virulent Danish strain DK01 The presence of the virus infection was confirmed by histopathologic evaluation of bursa lesions. The largest number of positive samples was obtained with a strain-specific two-step multiplex (MPX) RT...

  6. Synthesis of a Self-Healing Polymer Based on Reversible Diels-Alder Reaction: An Advanced Undergraduate Laboratory at the Interface of Organic Chemistry and Materials Science

    Science.gov (United States)

    Weizman, Haim; Nielsen, Christian; Weizman, Or S.; Nemat-Nasser, Sia

    2011-01-01

    This laboratory experiment exposes students to the chemistry of self-healing polymers based on a Diels-Alder reaction. Students accomplish a multistep synthesis of a monomer building block and then polymerize it to form a cross-linked polymer. The healing capability of the polymer is verified by differential scanning calorimetry (DSC) experiments.…

  7. Simplified mathematical model for heat supply and removal with allowance for chemical reaction kinetics in the N2O4 reversible 2NO2 reversible 2NO + O2 system

    International Nuclear Information System (INIS)

    Shiryaeva, N.M.

    1977-01-01

    The processes of heat supply and removal with chemical reactions proceeding in the circuit are usually described by a set of nonlinear ordinary differential equations. Considering a non-equilibrium state of a chemically reacting gas relative to equilibrium, to which the nonequilibrium system approaches according to a certain process and applying the Tailor series expansion near this equilibrium point, a set of differential equations can be reduced to one differential and some algebraic equations. The analysis shows that of the differential equation obtained can be quasilinearized, and then the linear differential equation can be solved. On the basis of the analytical solutions obtained the calculations of flow parameters have been performed for the cases of cooling and heating the dissociating coolant in channels of a constant cross-section at various pressures. The calculation results are in a satisfactory agreement with the numerical solution of a set of differential equations performed on the ''Minsk-22'' computer. The solution may be applied to calculate isobaric processes in thermodynamic cycles, where the N 2 O 4 coolant is used

  8. A new general method for simultaneous fitting of temperature and concentration dependence of reaction rates yields kinetic and thermodynamic parameters for HIV reverse transcriptase specificity.

    Science.gov (United States)

    Li, An; Ziehr, Jessica L; Johnson, Kenneth A

    2017-04-21

    Recent studies have demonstrated the dominant role of induced fit in enzyme specificity of HIV reverse transcriptase and many other enzymes. However, relevant thermodynamic parameters are lacking, and equilibrium thermodynamic methods are of no avail because the key parameters can only be determined by kinetic measurement. By modifying KinTek Explorer software, we present a new general method for globally fitting data collected over a range of substrate concentrations and temperatures and apply it to HIV reverse transcriptase. Fluorescence stopped-flow methods were used to record the kinetics of enzyme conformational changes that monitor nucleotide binding and incorporation. The nucleotide concentration dependence was measured at temperatures ranging from 5 to 37 °C, and the raw data were fit globally to derive a single set of rate constants at 37 °C and a set of activation enthalpy terms to account for the kinetics at all other temperatures. This comprehensive analysis afforded thermodynamic parameters for nucleotide binding ( K d , Δ G , Δ H , and Δ S at 37 °C) and kinetic parameters for enzyme conformational changes and chemistry (rate constants and activation enthalpy). Comparisons between wild-type enzyme and a mutant resistant to nucleoside analogs used to treat HIV infections reveal that the ground state binding is weaker and the activation enthalpy for the conformational change step is significantly larger for the mutant. Further studies to explore the structural underpinnings of the observed thermodynamics and kinetics of the conformational change step may help to design better analogs to treat HIV infections and other diseases. Our new method is generally applicable to enzyme and chemical kinetics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Amplitude analysis of Y*(1385) production in the line-reversed reactions: π+p → K+Y*(1385) and K-p → π-Y*(1385) at 7 and 11.5 GeV/c

    International Nuclear Information System (INIS)

    Ballam, J.; Bouchez, J.; Carroll, J.T.

    1978-08-01

    For the first time in one detector measurements were made of the complete decay angular distribution on Y* → Λπ, Λ → pπ - in the two line-reversed reactions: π + p → K + Y*(1385) and K - p → π - Y*(1385). The experiment was conducted in the SLAC 1 m rapid cycling bubble chamber (15 Hertz) triggered by electronic detectors and an online algorithm. The extended maximum likelihood method was used to obtain the transversity amplitudes of the Y *(1385). Results are in good agreement with both the quark model and Stodolsky-Sakurai model predictions. Finite helicity nonflip contributions at the Y*vertex observed in these data can be associated with double quark scattering in the forward direction. 15 references

  10. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    Science.gov (United States)

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  11. Significance of detecting circulating hepatocellular carcinoma cells in peripheral blood of hepatocellular carcinoma patients by nested reverse transcription-polymerase chain reaction and its clinical value: a retrospective study.

    Science.gov (United States)

    Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun

    2014-01-01

    Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating

  12. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  13. Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

    Science.gov (United States)

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

    2000-05-01

    We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

  14. Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

    2011-11-01

    Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

  15. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India

    Directory of Open Access Journals (Sweden)

    K. Nithin Prabhu

    2018-02-01

    Full Text Available Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT, as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR, have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat and wild (leopard, wolf and jackal animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  16. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  17. Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

    Science.gov (United States)

    Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

    2016-01-01

    Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

  18. Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Nishiura, T; Abe, K

    1999-01-01

    The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

  19. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

    Science.gov (United States)

    Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

    2018-02-28

    Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  20. Reversible Statistics

    DEFF Research Database (Denmark)

    Tryggestad, Kjell

    2004-01-01

    The study aims is to describe how the inclusion and exclusion of materials and calculative devices construct the boundaries and distinctions between statistical facts and artifacts in economics. My methodological approach is inspired by John Graunt's (1667) Political arithmetic and more recent work...... within constructivism and the field of Science and Technology Studies (STS). The result of this approach is here termed reversible statistics, reconstructing the findings of a statistical study within economics in three different ways. It is argued that all three accounts are quite normal, albeit...... in different ways. The presence and absence of diverse materials, both natural and political, is what distinguishes them from each other. Arguments are presented for a more symmetric relation between the scientific statistical text and the reader. I will argue that a more symmetric relation can be achieved...

  1. Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

    Science.gov (United States)

    Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

    2012-04-01

    Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  3. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction.

    Science.gov (United States)

    Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A

    2015-03-01

    African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).

  4. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

    Science.gov (United States)

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

    2017-08-02

    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  5. Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

    Science.gov (United States)

    Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

    2014-01-01

    Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

  6. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  7. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    Science.gov (United States)

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  8. How decision reversibility affects motivation.

    Science.gov (United States)

    Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E

    2014-04-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.

  9. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    Science.gov (United States)

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

  10. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

    Science.gov (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

    2017-04-01

    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  11. Reverse transcription and polymerase chain reaction: principles and applications in dentistry Transcrição reversa e reação em cadeia da polimerase: princípios e aplicações em odontologia

    Directory of Open Access Journals (Sweden)

    Carlos Ferreira dos Santos

    2004-03-01

    Full Text Available Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR, which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT reaction in order to produce cDNA from RNA (RT-PCR. RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer. Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.Várias técnicas de biologia molecular têm sido disponibilizadas nos últimos anos. Uma que revolucionou a análise de ácidos nucléicos foi a reação em cadeia da polimerase (PCR, descrita pela primeira vez em 1985. Esta técnica baseia-se na possibilidade de amplificação exponencial de fragmentos específicos de DNA, com a criação de milhões de cópias que servirão como matéria-prima para diferentes tipos de análises. A PCR pode ser precedida por uma reação de transcrição reversa (RT para a obtenção de cDNA a partir de RNA (RT-PCR, representando, por exemplo, uma possibilidade de análise de expressão gênica em células ou tecidos. As técnicas de PCR e RT-PCR têm sido utilizadas em pesquisas odontológicas como

  12. Managing Reverse Logistics or Reversing Logistics Management?

    OpenAIRE

    Brito, Marisa

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...

  13. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis

    NARCIS (Netherlands)

    Felten, Sandra; Leutenegger, Christian M.; Balzer, Hans Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman|info:eu-repo/dai/nl/089740890; Hartmann, Katrin

    2017-01-01

    Background: Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse

  14. Reaction Formulation: A Bibliography.

    Science.gov (United States)

    Pedrini, D. T.; Pedrini, Bonnie C.

    Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

  15. Managing Reverse Logistics or Reversing Logistics Management?

    NARCIS (Netherlands)

    M.P. de Brito (Marisa)

    2004-01-01

    textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse

  16. Reversible Thermoset Adhesives

    Science.gov (United States)

    Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)

    2016-01-01

    Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

  17. Recoil halogen reactions in liquid and frozen aqueous solutions of biomolecules

    International Nuclear Information System (INIS)

    Arsenault, L.J.; Blotcky, A.J.; Firouzbakht, M.L.; Rack, E.P.; Nebraska Univ., Omaha

    1982-01-01

    Reactions of recoil 38 Cl, 80 Br and 128 I have been studied in crystalline systems of 5-halouracil, 5-halo-2'-deoxyuridine and 5-halouridine as well as liquid and frozen aqueous solutions of these halogenated biomolecules. In all systems expect crystalline 5-iuodouracil the major product was the radio-labelled halide ion. There was no evidence for other halogen inorganic species. The major labelled organic product was the parent molecule. A recoil atom tracer technique was developed to acquire site information of the biomolecule solutes in the liquid and frozen aqueous systems. For all liquid and frozen aqueous systems, the halogenated biomolecules tended to aggregate. For liquid systems, the tendency for aggregation diminished as the solute concentration approached zero, where the probable state of the solute approached a monomolecular dispersion. Unlike the liquid state, the frozen ice lattice demonstated a ''caging effect'' for the solute aggregates which resulted in constant product yields over the whole concentration range. (orig.)

  18. Reversible conversion of valence-tautomeric copper metal-organic frameworks dependent single-crystal-to-single-crystal oxidation/reduction: a redox-switchable catalyst for C-H bonds activation reaction.

    Science.gov (United States)

    Huang, Chao; Wu, Jie; Song, Chuanjun; Ding, Ran; Qiao, Yan; Hou, Hongwei; Chang, Junbiao; Fan, Yaoting

    2015-06-28

    Upon single-crystal-to-single-crystal (SCSC) oxidation/reduction, reversible structural transformations take place between the anionic porous zeolite-like Cu(I) framework and a topologically equivalent neutral Cu(I)Cu(II) mixed-valent framework. The unique conversion behavior of the Cu(I) framework endowed it as a redox-switchable catalyst for the direct arylation of heterocycle C-H bonds.

  19. Tubal Ligation Reversal

    Science.gov (United States)

    ... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...

  20. General theory of the multistage geminate reactions of the isolated pairs of reactants. II. Detailed balance and universal asymptotes of kinetics.

    Science.gov (United States)

    Kipriyanov, Alexey A; Doktorov, Alexander B

    2014-10-14

    The analysis of general (matrix) kinetic equations for the mean survival probabilities of any of the species in a sample (or mean concentrations) has been made for a wide class of the multistage geminate reactions of the isolated pairs. These kinetic equations (obtained in the frame of the kinetic approach based on the concept of "effective" particles in Paper I) take into account various possible elementary reactions (stages of a multistage reaction) excluding monomolecular, but including physical and chemical processes of the change in internal quantum states carried out with the isolated pairs of reactants (or isolated reactants). The general basic principles of total and detailed balance have been established. The behavior of the reacting system has been considered on macroscopic time scales, and the universal long-term kinetics has been determined.

  1. Reverse logistics - a framework

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)

    2002-01-01

    textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of

  2. Reversible flowchart languages and the structured reversible program theorem

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2008-01-01

    Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...

  3. Remendable Polymeric Materials Using Reversible Covalent Bonds

    Science.gov (United States)

    2008-12-01

    response in poly(ethylene-co-methacrylic acid ) copolymers. Journal of The Royal Society Interface, 4, 405-411. Kavitha, A. A., and N. K. Singha...2007: A tailor-made polymethacrylate bearing a reactive diene in reversible diels-alder reaction. J. Polym. Sci. A Polym. Chem., 45, 4441-4449

  4. Compound nucleus studies withy reverse kinematics

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1985-06-01

    Reverse kinematics reactions are used to demonstrate the compound nucleus origin of intermediate mass particles at low energies and the extension of the same mechanism at higher energies. No evidence has appeared in our energy range for liquid-vapor equilibrium or cold fragmentation mechanisms. 11 refs., 12 figs

  5. Obtainment the reverse phase spinel [Zn2+0,5Fe3+0,5](Ni2+0,5Fe3+ 1,5)O4 by the method combustion reaction: the form of assessment heating

    International Nuclear Information System (INIS)

    Silva, M.C.; Costa, A.C.F.; Coutinho, J.P.; Silva, A.T.C.; Freitas, N.L.

    2011-01-01

    This paper aims to synthesize the inverse spinel phase of by combustion reaction method and to evaluate how [Zn 2+ 0,5Fe 3+ 0,5](Ni 2+ 0,5Fe 3+ 1,5)O 4 the heat source influences the structural and morphological this phase. The forms of heating were muffle oven and ceramic plate with built-in resistance and aniline as reducing agent. Comparisons were made between temperature, reaction time and physical changes undergone by the material during the combustion carried out in two warm-up. The material was characterized by XRD, SEM, and textural analysis. Based on the results showed that the spinel phase was successfully obtained, were found traces of the phases ZnO and Fe2O3. The Most crystallite size and higher reaction temperature were presented by the material produced in the plate. As for surface area and pore volume, the highest values were achieved by the material synthesized in the oven. The agglomerates were presented in the form of skeins made of pre-sintered particles. (author)

  6. Nuclear reaction studies using inverse kinematics

    International Nuclear Information System (INIS)

    Shapira, D.

    1985-01-01

    Reaction studies with reversed kinematics refer to studies of nuclear reactions induced by a heavy projectile colliding with lighter target nuclei. The technique of using reversed kinematics is costly in terms of the available center-of-mass energy. Most of the projectile's energy goes into forward motion of the reaction products in the laboratory system. Examples are presented where the use of reversed kinematics techniques has provided new information on certain reaction processes. A list of kinematic properties and advantages they may afford is shown. Clearly the possible studies listed can be done without using reversed kinematics but because of the difficulty associated with some of these studies they were never performed until more energetic heavier beams have become available and the reversed kinematics technique was utilized

  7. Introduction to reversible computing

    CERN Document Server

    Perumalla, Kalyan S

    2013-01-01

    Few books comprehensively cover the software and programming aspects of reversible computing. Filling this gap, Introduction to Reversible Computing offers an expanded view of the field that includes the traditional energy-motivated hardware viewpoint as well as the emerging application-motivated software approach. Collecting scattered knowledge into one coherent account, the book provides a compendium of both classical and recently developed results on reversible computing. It explores up-and-coming theories, techniques, and tools for the application of rever

  8. Reversibility of female sterilization.

    Science.gov (United States)

    Siegler, A M; Hulka, J; Peretz, A

    1985-04-01

    The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their

  9. Quantum reverse hypercontractivity

    Energy Technology Data Exchange (ETDEWEB)

    Cubitt, Toby [Department of Computer Science, University College London, London, United Kingdom and Centre for Quantum Information and Foundations, DAMTP, University of Cambridge, Cambridge (United Kingdom); Kastoryano, Michael [NBIA, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark); Montanaro, Ashley [School of Mathematics, University of Bristol, Bristol (United Kingdom); Temme, Kristan [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States)

    2015-10-15

    We develop reverse versions of hypercontractive inequalities for quantum channels. By generalizing classical techniques, we prove a reverse hypercontractive inequality for tensor products of qubit depolarizing channels. We apply this to obtain a rapid mixing result for depolarizing noise applied to large subspaces and to prove bounds on a quantum generalization of non-interactive correlation distillation.

  10. Atrioventricular Pacemaker Lead Reversal

    Directory of Open Access Journals (Sweden)

    Mehmet K Aktas, MD

    2007-01-01

    Full Text Available During cardiac surgery temporary epicardial atrial and ventricular leads are placed in case cardiac pacing is required postoperatively. We present the first reported series of patients with reversal of atrioventricular electrodes in the temporary pacemaker without any consequent deleterious hemodynamic effect. We review the electrocardiographic findings and discuss the findings that lead to the discovery of atrioventricular lead reversal.

  11. Characterization of ion implanted silicon by the electrolytic reverse current

    International Nuclear Information System (INIS)

    Hueller, J.; Pham, M.T.

    1977-01-01

    The current voltage behaviour of ion implanted silicon electrodes in HF electrolyte is investigated. The electrolytic reverse current, i.e. the reaction rate of the minority carrier limited reactions is found to increase. The current increase depends on the implanted dose and layer stripping. Reason for the increased reverse current can be referred to radiation damage acting as generation centres for minority carriers. Measurement of the electrolytic reverse current can be used for determining damage profiles. Layer stripping is carried out by anodic dissolution in the same electrolyte. The sensitivity of this new method for characterizing ion implanted silicon layers lies at 10 11 to 10 12 atoms/cm 2 . (author)

  12. An algebra of reversible computation.

    Science.gov (United States)

    Wang, Yong

    2016-01-01

    We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

  13. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    Science.gov (United States)

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  14. Sex reversal in vertebrates

    OpenAIRE

    2016-01-01

    This special topic issue of Sexual Development gives an overview of sex reversal in vertebrates, from fishes naturally changing their sex, to rodents escaping the mammalian SRY-determining system. It offers eight up-to-date reviews on specific subjects in sex reversal, considering fishes, amphibians, reptiles, birds, marsupials, and placental mammals, including humans. The broad scope of represented animals makes this ideal for students and researchers, especially those interested in the...

  15. On thermodynamic and microscopic reversibility

    International Nuclear Information System (INIS)

    Crooks, Gavin E

    2011-01-01

    The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa

  16. Nuclear reactions

    International Nuclear Information System (INIS)

    Lane, A.M.

    1980-01-01

    In reviewing work at Harwell over the past 25 years on nuclear reactions it is stated that a balance has to be struck in both experiment and theory between work on cross-sections of direct practical relevance to reactors and on those relevant to an overall understanding of reaction processes. The compound nucleus and direct process reactions are described. Having listed the contributions from AERE, Harwell to developments in nuclear reaction research in the period, work on the optical model, neutron capture theory, reactions at doorway states with fine structure, and sum-rules for spectroscopic factors are considered in more detail. (UK)

  17. Reversible Communicating Processes

    Directory of Open Access Journals (Sweden)

    Geoffrey Brown

    2016-02-01

    Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

  18. Requirements for DNA strand transfer during reverse transcription in mutant HIV-1 virions

    NARCIS (Netherlands)

    Berkhout, B.; van Wamel, J.; Klaver, B.

    1995-01-01

    Retroviruses convert their RNA genome into a DNA form by means of reverse transcription. According to the current model of reverse transcription, two strand transfer reactions are needed to synthesize a full-length DNA genome. Because reverse transcription is initiated close to the 5' end of the RNA

  19. Economic impact of reversion

    International Nuclear Information System (INIS)

    2005-01-01

    Estimations of the Norwegian hydropower production and various reversion models' market value have been made. The value of the Norwegian hydropower production until 01.01.2007 is estimated to about Nok 289 billion after taxes, or about 2,42 Nok/kWh medium production, given an expected future electricity price of around 0,25 Nok/kWh and a discount rate at 6,5 percent in nominal terms after taxes. The estimate is slightly above the level of prices for Norwegian hydropower plants in the last 8-10 years. The value of reversion in private plants which today have a limited licence time is estimated to Nok 5,5 billion. The value of reversion in public-owned Norwegian hydropower plants are about Nok 21 billion with a 60 year licence period from 01.01.2007, and about 12 billion for 75 years (ml)

  20. Reversible deep disposal

    International Nuclear Information System (INIS)

    2009-10-01

    This presentation, given by the national agency of radioactive waste management (ANDRA) at the meeting of October 8, 2009 of the high committee for the nuclear safety transparency and information (HCTISN), describes the concept of deep reversible disposal for high level/long living radioactive wastes, as considered by the ANDRA in the framework of the program law of June 28, 2006 about the sustainable management of radioactive materials and wastes. The document presents the social and political reasons of reversibility, the technical means considered (containers, disposal cavities, monitoring system, test facilities and industrial prototypes), the decisional process (progressive development and blocked off of the facility, public information and debate). (J.S.)

  1. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of 'cold' and 'warm' materials are reversed. In this paper, this effect is quantified by

  2. Thermosensory reversal effect quantified

    NARCIS (Netherlands)

    Bergmann Tiest, W.M.; Kappers, A.M.L.

    2008-01-01

    At room temperature, some materials feel colder than others due to differences in thermal conductivity, heat capacity and geometry. When the ambient temperature is well above skin temperature, the roles of ‘cold’ and ‘warm’ materials are reversed. In this paper, this effect is quantified by

  3. Time reversal communication system

    Science.gov (United States)

    Candy, James V.; Meyer, Alan W.

    2008-12-02

    A system of transmitting a signal through a channel medium comprises digitizing the signal, time-reversing the digitized signal, and transmitting the signal through the channel medium. The channel medium may be air, earth, water, tissue, metal, and/or non-metal.

  4. Engineering Encounters: Reverse Engineering

    Science.gov (United States)

    McGowan, Veronica Cassone; Ventura, Marcia; Bell, Philip

    2017-01-01

    This column presents ideas and techniques to enhance your science teaching. This month's issue shares information on how students' everyday experiences can support science learning through engineering design. In this article, the authors outline a reverse-engineering model of instruction and describe one example of how it looked in our fifth-grade…

  5. Sex Reversal in Birds.

    Science.gov (United States)

    Major, Andrew T; Smith, Craig A

    2016-01-01

    Sexual differentiation in birds is controlled genetically as in mammals, although the sex chromosomes are different. Males have a ZZ sex chromosome constitution, while females are ZW. Gene(s) on the sex chromosomes must initiate gonadal sex differentiation during embryonic life, inducing paired testes in ZZ individuals and unilateral ovaries in ZW individuals. The traditional view of avian sexual differentiation aligns with that expounded for other vertebrates; upon sexual differentiation, the gonads secrete sex steroid hormones that masculinise or feminise the rest of the body. However, recent studies on naturally occurring or experimentally induced avian sex reversal suggest a significant role for direct genetic factors, in addition to sex hormones, in regulating sexual differentiation of the soma in birds. This review will provide an overview of sex determination in birds and both naturally and experimentally induced sex reversal, with emphasis on the key role of oestrogen. We then consider how recent studies on sex reversal and gynandromorphic birds (half male:half female) are shaping our understanding of sexual differentiation in avians and in vertebrates more broadly. Current evidence shows that sexual differentiation in birds is a mix of direct genetic and hormonal mechanisms. Perturbation of either of these components may lead to sex reversal. © 2016 S. Karger AG, Basel.

  6. Elastomers with Reversible Nanoporosity

    DEFF Research Database (Denmark)

    Szewczykowski, Piotr Przemyslaw; Andersen, K.; Schulte, Lars

    2009-01-01

    nanostructure and displays liquid-filled cavities. Upon several cycles of swelling and drying the cavities open and close in a reversible fashion. When exposed to a nonsolvent, the material remains collapsed. This discriminating behavior of liquid-material interaction holds potential for the use...

  7. Dual kinetic curves in reversible electrochemical systems.

    Directory of Open Access Journals (Sweden)

    Michael J Hankins

    Full Text Available We introduce dual kinetic chronoamperometry, in which reciprocal relations are established between the kinetic curves of electrochemical reactions that start from symmetrical initial conditions. We have performed numerical and experimental studies in which the kinetic curves of the electron-transfer processes are analyzed for a reversible first order reaction. Experimental tests were done with the ferrocyanide/ferricyanide system in which the concentrations of each component could be measured separately using the platinum disk/gold ring electrode. It is shown that the proper ratio of the transient kinetic curves obtained from cathodic and anodic mass transfer limited regions give thermodynamic time invariances related to the reaction quotient of the bulk concentrations. Therefore, thermodynamic time invariances can be observed at any time using the dual kinetic curves for reversible reactions. The technique provides a unique possibility to extract the non-steady state trajectory starting from one initial condition based only on the equilibrium constant and the trajectory which starts from the symmetrical initial condition. The results could impact battery technology by predicting the concentrations and currents of the underlying non-steady state processes in a wide domain from thermodynamic principles and limited kinetic information.

  8. Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

    Directory of Open Access Journals (Sweden)

    Gilberto Simeone Henriques

    2005-12-01

    , primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

  9. Mining of biomarker genes from expressed sequence tags and differential display reverse transcriptase-polymerase chain reaction in the self-fertilizing fish, Kryptolebias marmoratus and their expression patterns in response to exposure to an endocrine-disrupting alkylphenol, bisphenol A.

    Science.gov (United States)

    Lee, Young-Mi; Rhee, Jae-Sung; Hwang, Dae-Sik; Kim, Il-Chan; Raisuddin, Sheikh; Lee, Jae-Seong

    2007-06-30

    Expressed sequence tags (ESTs) and differentially expressed cDNAs from the self-fertilizing fish, Kryptolebias marmoratus were mined to develop alternative biomarkers for endocrine-disrupting chemicals (EDCs). 1,577 K. marmoratus cDNA clones were randomly sequenced from the 5'-end. These clones corresponded to 1,518 and 1,519 genes in medaka dbEST and zebrafish dbEST, respectively. Of the matched genes, 197 and 115 genes obtained Unigene IDs in medaka dbEST and zebrafish dbEST, respectively. Many of the annotated genes are potential biomarkers for environmental stresses. In a differential display reverse transcriptase-polymerase chain reaction (DD RT-PCR) study, 56 differential expressed genes were obtained from fish liver exposed to bisphenol A. Of these, 16 genes were identified after BLAST search to GenBank, and the annotated genes were mainly involved in catalytic activity and binding. The expression patterns of these 16 genes were validated by real-time RT-PCR of liver tissue from fish exposed to bisphenol A. Our findings suggest that expression of these 16 genes is modulated by endocrine disrupting chemicals, and therefore that they are potential biomarkers for environmental stress including EDCs exposure.

  10. Artificial Self-Sufficient P450 in Reversed Micelles

    Directory of Open Access Journals (Sweden)

    Teruyuki Nagamune

    2010-04-01

    Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.

  11. Reversed field pinch diagnostics

    International Nuclear Information System (INIS)

    Weber, P.G.

    1986-01-01

    The Reversed Field Pinch (RFP) is a toroidal, axisymmetric magnetic confinement configuration characterized by a magnetic field configuration in which the toroidal magnetic field is of similar strength to the poloidal field, and is reversed at the edge compared to the center. The RFP routinely operates at high beta, and is a strong candidate for a compact fusion device. Relevant attributes of the configuration will be presented, together with an overview of present and planned experiments and their diagnostics. RFP diagnostics are in many ways similar to those of other magnetic confinement devices (such as tokamaks); these lectures will point out pertinent differences, and will present some diagnostics which provide special insights into unique attributes of the RFP

  12. Posterior Reversible Encephalopathy (PRES)

    International Nuclear Information System (INIS)

    Moron E, Fanny E; Diaz Marchan, Pedro

    2005-01-01

    The Posterior Reversible Encephalopathy Syndrome (PRES) is a clinical Syndrome composed of cephalea, alteration in vision and convulsions, usually observed in patients with sudden elevation of arterial pressure. The imagenologic evidence shows reversible vasogenic brain edema without stroke. Its location is predominantly posterior; it affects the cortex and the subcortical white matter of the occipital, parietal and temporal lobes. The treatment with antihypertensive drugs and the removing of immunosupressor medication are generally associated with complete neurological recovery; this is reflected also in the images which return to their basal condition. The untreated hypertension, on the other side, can result in a progressive defect of the autoregulation system of the central nervous system with cerebral hemorrhage, irreversible brain stroke, coma and death

  13. Quasielastic reactions

    International Nuclear Information System (INIS)

    Henning, W.

    1979-01-01

    Quasielastic reaction studies, because of their capability to microscopically probe nuclear structure, are still of considerable interest in heavy-ion reactions. The recent progress in understanding various aspects of the reaction mechanism make this aim appear closer. The relation between microscopic and macroscopic behavior, as suggested, for example, by the single proton transfer data to individual final states or averaged excitation energy intervals, needs to be explored. It seems particularly useful to extend measurements to higher incident energies, to explore and understand nuclear structure aspects up to the limit of the energy range where they are important

  14. Reversible infantile mitochondrial diseases.

    Science.gov (United States)

    Boczonadi, Veronika; Bansagi, Boglarka; Horvath, Rita

    2015-05-01

    Mitochondrial diseases are usually severe and progressive conditions; however, there are rare forms that show remarkable spontaneous recoveries. Two homoplasmic mitochondrial tRNA mutations (m.14674T>C/G in mt-tRNA(Glu)) have been reported to cause severe infantile mitochondrial myopathy in the first months of life. If these patients survive the first year of life by extensive life-sustaining measures they usually recover and develop normally. Another mitochondrial disease due to deficiency of the 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU) causes severe liver failure in infancy, but similar to the reversible mitochondrial myopathy, within the first year of life these infants may also recover completely. Partial recovery has been noted in some other rare forms of mitochondrial disease due to deficiency of mitochondrial tRNA synthetases and mitochondrial tRNA modifying enzymes. Here we summarize the clinical presentation of these unique reversible mitochondrial diseases and discuss potential molecular mechanisms behind the reversibility. Understanding these mechanisms may provide the key to treatments of potential broader relevance in mitochondrial disease, where for the majority of the patients no effective treatment is currently available.

  15. Positioning paper on reversibility

    International Nuclear Information System (INIS)

    2016-01-01

    After having recalled the legal framework adopted in 2006 for the deep geological storage of radioactive wastes, and briefly introduced the concept of reversibility, this publication presents the principle of geological storage, presents high and medium level and long life wastes, highlights the ethical necessity to deal with these radioactive wastes, outlines that geological storage is the generally admitted and adopted solution at the international level, and presents additional means implemented for radioactive waste management. It presents the Cigeo project as the technical answer to the issue of radioactive waste storage, describes the Cigeo development process, its current status and its development planning, and justifies the choice of this technical solution, notably from an ethical point of view. It addresses the issue of reversibility and proposes an overview of the various tools and means which aim at guaranteeing this reversibility. Appendices propose figures illustrating the Cigeo project and its development process, and a rather detailed Power Point presentation of the project by the ANDRA (history, object, planning, installations, and so on)

  16. cycloaddition reactions

    Indian Academy of Sciences (India)

    Unknown

    Molecular Modeling Group, Organic Chemical Sciences, Indian Institute of Chemical Technology,. Hyderabad ... thus obtained are helpful to model the regioselectivity ... compromise to model Diels–Alder reactions involving ...... acceptance.

  17. Status of time reversal invariance

    International Nuclear Information System (INIS)

    Henley, E.M.

    1989-01-01

    Time Reversal Invariance is introduced, and theories for its violation are reviewed. The present experimental and theoretical status of Time Reversal Invariance and tests thereof will be presented. Possible future tests will be discussed. 30 refs., 2 figs., 1 tab

  18. The Causes of Preference Reversal.

    OpenAIRE

    Tversky, Amos; Slovic, Paul; Kahneman, Daniel

    1990-01-01

    Observed preference reversal cannot be adequately explained by violations of independence, the reduction axiom, or transitivity. The primary cause of preference reversal is the failure of procedure invariance, especially the overpricing of low-probability, high-payoff bets. This result violates regret theory and generalized (nonindependent) utility models. Preference reversal and a new reversal involving time preferences are explained by scale compatibility, which implies that payoffs are wei...

  19. Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, J. R.

    2003-01-01

    It has frequently been suggested that only the geomagnetic dipole, rather than higher order poles, reverse during a geomagnetic field reversal. Under this assumption the geomagnetic field strength has been calculated for the surface of the Earth for various steps of the reversal process. Even without an eminent a reversal of the field, extrapolation of the present secular change (although problematic) shows that the field strength may become zero in some geographic areas within a few hundred years.

  20. A Study on Reverse Logistics

    OpenAIRE

    Reddy, Dhananjaya

    2011-01-01

    In the competitive world of manufacturing, companies are often searching for new ways to improve their process, customer satisfaction and stay ahead in the game with their competitors. Reverse logistics has been considered a strategy to bring these things to life for the past decade or so. This thesis work tries to shed some light on the basics of reverse logistics and how reverse logistics can be used as a management strategy. This paper points out the fundamentals of reverse logistics and l...

  1. Geomagnetic Reversals during the Phanerozoic.

    Science.gov (United States)

    McElhinny, M W

    1971-04-09

    An antalysis of worldwide paleomagnetic measurements suggests a periodicity of 350 x 10(6) years in the polarity of the geomagnetic field. During the Mesozoic it is predominantly normal, whereas during the Upper Paleozoic it is predominantly reversed. Although geomagnetic reversals occur at different rates throughout the Phanerozoic, there appeaars to be no clear correlation between biological evolutionary rates and reversal frequency.

  2. Nonequilibrium thermodynamics and a fluctuation theorem for individual reaction steps in a chemical reaction network

    International Nuclear Information System (INIS)

    Pal, Krishnendu; Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam

    2015-01-01

    We have introduced an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the propensities of the individual elementary reactions and the corresponding reverse reactions. The method is a microscopic formulation of the dissipation function in terms of the relative entropy or Kullback-Leibler distance which is based on the analogy of phase space trajectory with the path of elementary reactions in a network of chemical process. We have introduced here a fluctuation theorem valid for each opposite pair of elementary reactions which is useful in determining the contribution of each sub-reaction on the nonequilibrium thermodynamics of overall reaction. The methodology is applied to an oligomeric enzyme kinetics at a chemiostatic condition that leads the reaction to a nonequilibrium steady state for which we have estimated how each step of the reaction is energy driven or entropy driven to contribute to the overall reaction. (paper)

  3. Crystallization features of ternary reversible reciprocal systems

    International Nuclear Information System (INIS)

    Tomashik, V.N.; Shcherbak, L.P.; Fejchuk, P.I.; Grytsiv, V.I.

    2006-01-01

    Some features of the primary crystallization of phases in ternary reversible reciprocal system are considered and discussed. The diagonal join CdTe-GeSe of the CdTe + GeSe = CdSe + GeTe ternary reciprocal system is studied to show that the features in primary and secondary heating and cooling curves in such systems under fully equilibrium conditions are not reproduced upon consecutive heating and cooling sessions, because of the existence of different amounts of the reagents and the reaction products in the mixture; the temperatures of each transformation lie in a range. Those who experimentally investigate other ternary and more complex reversible reciprocal systems should take this fact into account [ru

  4. Reversal Strategies for NOACs

    DEFF Research Database (Denmark)

    Husted, Steen; Verheugt, Freek; Comuth, Willemijn

    2015-01-01

    , coagulation factor concentrates or NOAC-specific antidotes could be used. Coagulation factor concentrates can be used in patients with haemophilia and to reverse the effect of VKAs but, in NOAC-treated patients, results are inconsistent and these agents could potentially have pro-thrombotic effects. Specific...... antidotes for NOACs are expected to be on the market soon. Phase III clinical trials with a humanized antibody fragment directed against dabigatran (idarucizumab) and recombinant, modified factor Xa (andexanet alfa) are ongoing. A molecule (aripazine) with broad activity against various anticoagulants...

  5. Reversible brazing process

    Science.gov (United States)

    Pierce, Jim D.; Stephens, John J.; Walker, Charles A.

    1999-01-01

    A method of reversibly brazing surfaces together. An interface is affixed to each surface. The interfaces can be affixed by processes such as mechanical joining, welding, or brazing. The two interfaces are then brazed together using a brazing process that does not defeat the surface to interface joint. Interfaces of materials such as Ni-200 can be affixed to metallic surfaces by welding or by brazing with a first braze alloy. The Ni-200 interfaces can then be brazed together using a second braze alloy. The second braze alloy can be chosen so that it minimally alters the properties of the interfaces to allow multiple braze, heat and disassemble, rebraze cycles.

  6. Direct Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Austern, N. [University of Pittsburgh, Pittsburgh, PA (United States)

    1963-01-15

    In order to give a unified presentation of one point of view, these lectures are devoted only to a detailed development of the standard theories of direct reactions, starting from basic principles. Discussion is given of the present status of the theories, of the techniques used for practical calculation, and of possible future developments. The direct interaction (DI) aspects of a reaction are those which involve only a few of the many degrees of freedom of a nucleus. In fact the minimum number of degrees of freedom which must be involved in a reaction are those required to describe the initial and final channels, and DI studies typically consider these degrees of freedom and no others. Because of this simplicity DI theories may be worked out in painstaking detail. DI processes concern only part of the wave function for a problem. The other part involves complicated excitations of many degrees of freedom, and gives the compound nucleus (CN) effects. While it is extremely interesting to learn how to separate DI and CN effects in an orderly manner, if they are both present in a reaction, no suitable method has yet been found. Instead, current work stresses the kinds of reactions and the kinds of final states in which DI effects dominate and in which CN effects may almost be forgotten. The DI cross-sections which are studied are often extremely large, comparable to elastic scattering cross-sections. (author)

  7. Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

    International Nuclear Information System (INIS)

    Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

    2013-01-01

    In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

  8. Reversibly Bistable Flexible Electronics

    KAUST Repository

    Alfaraj, Nasir

    2015-05-01

    Introducing the notion of transformational silicon electronics has paved the way for integrating various applications with silicon-based, modern, high-performance electronic circuits that are mechanically flexible and optically semitransparent. While maintaining large-scale production and prototyping rapidity, this flexible and translucent scheme demonstrates the potential to transform conventionally stiff electronic devices into thin and foldable ones without compromising long-term performance and reliability. In this work, we report on the fabrication and characterization of reversibly bistable flexible electronic switches that utilize flexible n-channel metal-oxide-semiconductor field-effect transistors. The transistors are fabricated initially on rigid (100) silicon substrates before they are peeled off. They can be used to control flexible batches of light-emitting diodes, demonstrating both the relative ease of scaling at minimum cost and maximum reliability and the feasibility of integration. The peeled-off silicon fabric is about 25 µm thick. The fabricated devices are transferred to a reversibly bistable flexible platform through which, for example, a flexible smartphone can be wrapped around a user’s wrist and can also be set back to its original mechanical position. Buckling and cyclic bending of such host platforms brings a completely new dimension to the development of flexible electronics, especially rollable displays.

  9. Reaction mechanisms

    International Nuclear Information System (INIS)

    Nguyen Trong Anh

    1988-01-01

    The 1988 progress report of the Reaction Mechanisms laboratory (Polytechnic School, France), is presented. The research topics are: the valence bond methods, the radical chemistry, the modelling of the transition states by applying geometric constraints, the long range interactions (ion - molecule) in gaseous phase, the reaction sites in gaseous phase and the mass spectroscopy applications. The points of convergence between the investigations of the mass spectroscopy and the theoretical chemistry teams, as well as the purposes guiding the research programs, are discussed. The published papers, the conferences, the congress communications and the thesis, are also reported [fr

  10. Recycling tires? Reversible crosslinking of poly(butadiene).

    Science.gov (United States)

    Trovatti, Eliane; Lacerda, Talita M; Carvalho, Antonio J F; Gandini, Alessandro

    2015-04-01

    Furan-modified poly(butadiene) prepared by the thiol-ene click reaction is crosslinked with bismaleimides through the Diels-Alder reaction, giving rise to a novel recyclable elastomer. This is possible because of the thermal reversibility of the adducts responsible for the formation of the network. The use of this strategy provides the possibility to produce recyclable tires. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Reversed rainbow with a nonlocal metamaterial

    Energy Technology Data Exchange (ETDEWEB)

    Morgado, Tiago A., E-mail: tiago.morgado@co.it.pt; Marcos, João S.; Silveirinha, Mário G., E-mail: mario.silveirinha@co.it.pt [Department of Electrical Engineering, Instituto de Telecomunicações, University of Coimbra, 3030 Coimbra (Portugal); Costa, João T. [CST AG, Bad Nauheimer Strasse 19, 64289 Darmstadt (Germany); Costa, Jorge R. [Instituto de Telecomunicações and Instituto Universitário de Lisboa (ISCTE-IUL), 1649-026 Lisboa (Portugal); Fernandes, Carlos A. [Instituto de Telecomunicações, and Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal)

    2014-12-29

    One of the intriguing potentials of metamaterials is the possibility to realize a nonlocal electromagnetic reaction, such that the effective medium response at a given point is fundamentally entangled with the macroscopic field distribution at long distances. Here, it is experimentally and numerically verified that a microwave nonlocal metamaterial formed by crossed metallic wires enables a low-loss broadband anomalous material response such that the refractive index decreases with frequency. Notably, it is shown that an electromagnetic beam refracted by our metamaterial prism creates a reversed microwave rainbow.

  12. Allergic reactions

    Science.gov (United States)

    ... that don't bother most people (such as venom from bee stings and certain foods, medicines, and pollens) can ... person. If the allergic reaction is from a bee sting, scrape the ... more venom. If the person has emergency allergy medicine on ...

  13. Reversible posterior leukoencephalopathy syndrome

    International Nuclear Information System (INIS)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won; Song, Chang Joon; Song, Soon-Young; Koo, Ja Hong; Kim, Man Deuk

    2001-01-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  14. Reversible posterior leukoencephalopathy syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Ja; Yu, Won Jong; Ahn, Kook Jin; Jung, So Lyung; Lee, Yeon Soo; Kim, Ji Chang; Kang, Si Won [The Catholic Univ. of Korea, Taejon (Korea, Republic of); Song, Chang Joon [Chungnam National Univ. School of Medicine, Cheonju (Korea, Republic of); Song, Soon-Young; Koo, Ja Hong [Kwandong Univ. College of Medicine, Myungji Hospital, Seoul (Korea, Republic of); Kim, Man Deuk [College of Medicine Pochon CHA Univ., Seoul (Korea, Republic of)

    2001-10-01

    To review reversible posterior leukoencephalopathy syndrome. We reviewed 22 patients (M:F=3:19; age, 17-46 years) with the characteristic clinical and imaging features of reversible posterior leukoencephalopathy syndrome. All underwent brain MRI, and in three cases both CT and MRI were performed. In one, MRA was obtained, and in eleven, follow-up MR images were obtained. We evaluated the causes of this syndrome, its clinical manifestations, and MR findings including the locations of lesions, the presence or absence of contrast enhancement, and the changes seen at follow-up MRI. Of the 22 patients, 13 had eclampsia (six during pregnancy and seven during puerperium). Four were receiving immunosuppressive therapy (three, cyclosporine ; one, FK 506). Four suffered renal failure and one had complicated migraine. The clinical manifestations included headache (n=12), visual disturbance (n=13), seizure (n=15), focal neurologic sign (n=3), and altered mental status (n=2). Fifteen patients had hypertension and the others normotension. MRI revealed that lesions were bilateral (n=20) or unilateral (n=2). In all patients the lesion was found in the cortical and subcortical areas of the parieto-occipital lobes ; other locations were the basal ganglia (n=9), posterior temporal lobe (n=8), frontal lobe (n=5), cerebellum (n=5), pons (n=2), and thalamus (n=1). All lesions were of high signal intensity on T2-weighted images, and of iso to low intensity on T1-weighted images. One was combined with acute hematoma in the left basal ganglia. In eight of 11 patients who underwent postcontrast T1-weighted MRI, there was no definite enhancement ; in one, enhancement was mild, and in tow, patchy. CT studies showed low attenuation, and MRA revealed mild vasospasm. The symptoms of all patients improved. Follow-up MRI in nine of 11 patients depicted complete resolution of the lesions ; in two, small infarctions remained but the extent of the lesions had decreased. Reversible posterior

  15. Reversible exciplex formation followed charge separation.

    Science.gov (United States)

    Petrova, M V; Burshtein, A I

    2008-12-25

    The reversible exciplex formation followed by its decomposition into an ion pair is considered, taking into account the subsequent geminate and bulk ion recombination to the triplet and singlet products (in excited and ground states). The integral kinetic equations are derived for all state populations, assuming that the spin conversion is performed by the simplest incoherent (rate) mechanism. When the forward and backward electron transfer is in contact as well as all dissociation/association reactions of heavy particles, the kernels of integral equations are specified and expressed through numerous reaction constants and characteristics of encounter diffusion. The solutions of these equations are used to specify the quantum yields of the excited state and exciplex fluorescence induced by pulse or stationary pumping. In the former case, the yields of the free ions and triplet products are also found, while in the latter case their stationary concentrations are obtained.

  16. Reverse osmosis application studies

    International Nuclear Information System (INIS)

    Golomb, A.

    1982-02-01

    To assess the feasibility of applying reverse osmosis (RO) and ultrafiltration (UF) for effective treatment of process and waste streams from operations at Ontario Hydro's thermal and nuclear stations, an extensive literature survey has been carried out. It is concluded that RO is not at present economic for pretreatment of Great Lakes water prior to ion exchange demineralization for boiler makeup. Using both conventional and novel commercial membrane modules, RO pilot studies are recommended for treatment of boiler cleaning wastes, fly ash leachates, and flue gas desulphurization scrubber discharges for removal of heavy metals. Volume reduction and decontamination of nuclear station low-level active liquid waste streams by RO/UF also appear promising. Research programmes are proposed

  17. Reverse photoacoustic standoff spectroscopy

    Science.gov (United States)

    Van Neste, Charles W [Kingston, TN; Senesac, Lawrence R [Knoxville, TN; Thundat, Thomas G [Knoxville, TN

    2011-04-12

    A system and method are disclosed for generating a reversed photoacoustic spectrum at a greater distance. A source may emit a beam to a target and a detector measures signals generated as a result of the beam being emitted on the target. By emitting a chopped/pulsed light beam to the target, it may be possible to determine the target's optical absorbance by monitoring the intensity of light collected at the detector at different wavelengths. As the wavelength of light is changed, the target may absorb or reject each optical frequency. Rejection may increase the intensity at the sensing element and absorption may decrease the intensity. Accordingly, an identifying spectrum of the target may be made with the intensity variation of the detector as a function of illuminating wavelength.

  18. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    McMordie Stoughton, Kate; Duan, Xiaoli; Wendel, Emily M.

    2013-08-26

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). ¬The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.¬

  19. Reverse Osmosis Optimization

    Energy Technology Data Exchange (ETDEWEB)

    None

    2013-08-01

    This technology evaluation was prepared by Pacific Northwest National Laboratory on behalf of the U.S. Department of Energy’s Federal Energy Management Program (FEMP). The technology evaluation assesses techniques for optimizing reverse osmosis (RO) systems to increase RO system performance and water efficiency. This evaluation provides a general description of RO systems, the influence of RO systems on water use, and key areas where RO systems can be optimized to reduce water and energy consumption. The evaluation is intended to help facility managers at Federal sites understand the basic concepts of the RO process and system optimization options, enabling them to make informed decisions during the system design process for either new projects or recommissioning of existing equipment. This evaluation is focused on commercial-sized RO systems generally treating more than 80 gallons per hour.

  20. Sex Reversal in Amphibians.

    Science.gov (United States)

    Flament, Stéphane

    2016-01-01

    Amphibians have been widely used to study developmental biology due to the fact that embryo development takes place independently of the maternal organism and that observations and experimental approaches are easy. Some amphibians like Xenopus became model organisms in this field. In the first part of this article, the differentiation of the gonads in amphibians and the mechanisms governing this process are reviewed. In the second part, the state of the art about sex reversal, which can be induced by steroid hormones in general and by temperature in some species, is presented. Also information about pollutants found in the environment that could interfere with the development of the amphibian reproductive apparatus or with their reproductive physiology is given. Such compounds could play a part in the amphibian decline, since in the wild, many amphibians are endangered species. © 2016 S. Karger AG, Basel.

  1. 49 CFR 230.89 - Reverse gear.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Reverse gear. 230.89 Section 230.89 Transportation... Reversing Gear § 230.89 Reverse gear. (a) General provisions. Reverse gear, reverse levers, and quadrants... quadrant. Proper counterbalance shall be provided for the valve gear. (b) Air-operated power reverse gear...

  2. Computational reverse shoulder prosthesis model: Experimental data and verification.

    Science.gov (United States)

    Martins, A; Quental, C; Folgado, J; Ambrósio, J; Monteiro, J; Sarmento, M

    2015-09-18

    The reverse shoulder prosthesis aims to restore the stability and function of pathological shoulders, but the biomechanical aspects of the geometrical changes induced by the implant are yet to be fully understood. Considering a large-scale musculoskeletal model of the upper limb, the aim of this study is to evaluate how the Delta reverse shoulder prosthesis influences the biomechanical behavior of the shoulder joint. In this study, the kinematic data of an unloaded abduction in the frontal plane and an unloaded forward flexion in the sagittal plane were experimentally acquired through video-imaging for a control group, composed of 10 healthy shoulders, and a reverse shoulder group, composed of 3 reverse shoulders. Synchronously, the EMG data of 7 superficial muscles were also collected. The muscle force sharing problem was solved through the minimization of the metabolic energy consumption. The evaluation of the shoulder kinematics shows an increase in the lateral rotation of the scapula in the reverse shoulder group, and an increase in the contribution of the scapulothoracic joint to the shoulder joint. Regarding the muscle force sharing problem, the musculoskeletal model estimates an increased activity of the deltoid, teres minor, clavicular fibers of the pectoralis major, and coracobrachialis muscles in the reverse shoulder group. The comparison between the muscle forces predicted and the EMG data acquired revealed a good correlation, which provides further confidence in the model. Overall, the shoulder joint reaction force was lower in the reverse shoulder group than in the control group. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Why has reversal of the actin-myosin cross-bridge cycle not been observed experimentally?

    KAUST Repository

    Loiselle, D. S.; Tran, K.; Crampin, E. J.; Curtin, N. A.

    2010-01-01

    We trace the history of attempts to determine whether the experimentally observed diminution of metabolic energy expenditure when muscles lengthen during active contraction is consistent with reversibility of biochemical reactions and, in particular

  4. Reference genes for reverse transcription quantitative PCR in canine brain tissue

    NARCIS (Netherlands)

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-01-01

    BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

  5. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1978-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centers the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFC's with a major radius R = 2-6 cm, minor radius a approximately 2 cm, and a total length l approximately 35 cm. The observed temperatures are T/sub e/ approximately 100 eV and T/sub i/ = 150-350 eV with a peak density n approximately 2 x 10 15 cm -3 . After the plasma reaches equilibrium, the RFC remains stable for up to 30 μs followed by the rapid growth of the rotational m = 2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behavior of the m = 2 mode qualitatively agrees with the theoretically predicted instability for rotational velocities exceeding some critical value

  6. Field reversal experiments (FRX)

    International Nuclear Information System (INIS)

    Linford, R.K.; Armstrong, W.T.; Platts, D.A.; Sherwood, E.G.

    1979-01-01

    The equilibrium, confinement, and stability properties of the reversed-field configuration (RFC) are being studied in two theta-pinch facilities. The RFC is an elongated toroidal plasma confined in a purely poloidal field geometry. The open field lines of the linear theta pinch support the closed-field RFC much like the vertical field centres the toroidal plasma in a tokamak. Depending on stability and confinement properties, the RFC might be used to greatly reduce the axial losses in linear fusion devices such as mirrors, theta pinches, and liners. The FRX systems produce RFCs with a major radius R=2-6cm, a minor radius a approximately 2cm, and a total length l approximately 35cm. The observed temperatures are Tsub(e) approximately 100eV and Tsub(i)=150-350eV with a peak density n approximately 2x10 15 cm -3 . After the plasma has reached equilibrium, the RFC remains stable for up to 30μs, followed by the rapid growth of the rotational m=2 instability, which terminates the confinement. During the stable equilibrium, the particle and energy confinement times are more than 10 times longer than in an open-field system. The behaviour of the m=2 mode agrees qualitatively with the theoretically predicted instability for rotational velocities exceeding some critical value. (author)

  7. Quantifying fluctuations in reversible enzymatic cycles and clocks

    Science.gov (United States)

    Wierenga, Harmen; ten Wolde, Pieter Rein; Becker, Nils B.

    2018-04-01

    Biochemical reactions are fundamentally noisy at a molecular scale. This limits the precision of reaction networks, but it also allows fluctuation measurements that may reveal the structure and dynamics of the underlying biochemical network. Here, we study nonequilibrium reaction cycles, such as the mechanochemical cycle of molecular motors, the phosphorylation cycle of circadian clock proteins, or the transition state cycle of enzymes. Fluctuations in such cycles may be measured using either of two classical definitions of the randomness parameter, which we show to be equivalent in general microscopically reversible cycles. We define a stochastic period for reversible cycles and present analytical solutions for its moments. Furthermore, we associate the two forms of the randomness parameter with the thermodynamic uncertainty relation, which sets limits on the timing precision of the cycle in terms of thermodynamic quantities. Our results should prove useful also for the study of temporal fluctuations in more general networks.

  8. Luminescence quenching by reversible ionization or exciplex formation/dissociation.

    Science.gov (United States)

    Ivanov, Anatoly I; Burshtein, Anatoly I

    2008-11-20

    The kinetics of fluorescence quenching by both charge transfer and exciplex formation is investigated, with an emphasis on the reversibility and nonstationarity of the reactions. The Weller elementary kinetic scheme of bimolecular geminate ionization and the Markovian rate theory are shown to lead to identical results, provided the rates of the forward and backward reactions account for the numerous recontacts during the reaction encounter. For excitation quenching by the reversible exciplex formation, the Stern-Volmer constant is specified in the framework of the integral encounter theory. The bulk recombination affecting the Stern-Volmer quenching constant makes it different for pulse excited and stationary luminescence. The theory approves that the free energy gap laws for ionization and exciplex formation are different and only the latter fits properly the available data (for lumiflavin quenching by aliphatic amines and aromatic donors) in the endergonic region.

  9. A Reverse Stroop Task with Mouse Tracking

    Science.gov (United States)

    Yamamoto, Naohide; Incera, Sara; McLennan, Conor T.

    2016-01-01

    In a reverse Stroop task, observers respond to the meaning of a color word irrespective of the color in which the word is printed—for example, the word red may be printed in the congruent color (red), an incongruent color (e.g., blue), or a neutral color (e.g., white). Although reading of color words in this task is often thought to be neither facilitated by congruent print colors nor interfered with incongruent print colors, this interference has been detected by using a response method that does not give any bias in favor of processing of word meanings or processing of print colors. On the other hand, evidence for the presence of facilitation in this task has been scarce, even though this facilitation is theoretically possible. By modifying the task such that participants respond to a stimulus color word by pointing to a corresponding response word on a computer screen with a mouse, the present study investigated the possibility that not only interference but also facilitation would take place in a reverse Stroop task. Importantly, in this study, participants’ responses were dynamically tracked by recording the entire trajectories of the mouse. Arguably, this method provided richer information about participants’ performance than traditional measures such as reaction time and accuracy, allowing for more detailed (and thus potentially more sensitive) investigation of facilitation and interference in the reverse Stroop task. These trajectories showed that the mouse’s approach toward correct response words was significantly delayed by incongruent print colors but not affected by congruent print colors, demonstrating that only interference, not facilitation, was present in the current task. Implications of these findings are discussed within a theoretical framework in which the strength of association between a task and its response method plays a critical role in determining how word meanings and print colors interact in reverse Stroop tasks. PMID:27199881

  10. HIV-1 reverse transcription initiation: a potential target for novel antivirals?

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Berkhout, Ben

    2008-01-01

    Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is

  11. Quasielastic reactions

    International Nuclear Information System (INIS)

    Hansen, O.

    1983-01-01

    A brief review is presented of the experimental and theoretical situation regarding transfer reactions and inelastic scattering. In the first category there is little (very little) precision data for heavy projectiles and consequently almost no experience with quantitative theoretical analysis. For the inelastic scattering the rather extensive data strongly supports the coupled channels models with collective formfactors. At the most back angles, at intensities about 10 -5 of Rutherford scattering, a second, compound-like mechanism becomes dominant. The description of the interplay of these two opposite mechanisms provides a new challenge for our understanding

  12. LSM-YSZ Reactions in Different Atmospheres

    DEFF Research Database (Denmark)

    Chen, Ming; Liu, Yi-Lin; Hagen, Anke

    2009-01-01

    -powder reaction. LSM reacts differently with YSZ in different atmospheres. In air, m-ZrO2 (monoclinic) is formed; while in N2, SrZrO3 and/or La2Zr2O7 are formed depending on the initial LSM/YSZ ratio. The reactions are reversible with varying P(O2) i.e. treating the sample in air after the heat treatment in N2...

  13. Towards a reversible functional language

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2012-01-01

    /equality operator also simplifies inverse computation and program inversion. We discuss the advantages of a reversible functional language using example programs, including run-length encoding. Program inversion is seen to be as lightweight as for imperative reversible languages and realized by recursive descent...

  14. Reverse engineering of RFID devices

    NARCIS (Netherlands)

    Bokslag, W.

    2015-01-01

    This paper discusses the relevance and potential impact of both RFID and reverse engineering of RFID technology, followed by a discussion of common protocols and internals of RFID technology. The focus of the paper is on providing an overview of the different approaches to reverse engineering RFID

  15. How decision reversibility affects motivation

    NARCIS (Netherlands)

    Bullens, L.; van Harreveld, F.; Förster, J.; Higgins, T.E.

    2014-01-01

    The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making,

  16. Reversible networks in supramolecular polymers

    NARCIS (Netherlands)

    Havermans - van Beek, D.J.M.

    2007-01-01

    Non–covalent interactions between low molecular weight polymers form the basis of supramolecular polymers. The material properties of such polymers are determined by the strength and lifetime of the non–covalent reversible interactions. Due to the reversibility of the interactions between the low

  17. Reverse genetics of avian metapneumoviruses

    Science.gov (United States)

    An overview of avian metapneumovirus (aMPV) infection in turkeys and development of a reverse genetics system for aMPV subgroup C (aMPV-C) virus will be presented. By using reverse genetics technology, we generated recombinant aMPV-C viruses containing a different length of glycoprotein (G) gene or...

  18. Reciprocity theory of homogeneous reactions

    Science.gov (United States)

    Agbormbai, Adolf A.

    1990-03-01

    The reciprocity formalism is applied to the homogeneous gaseous reactions in which the structure of the participating molecules changes upon collision with one another, resulting in a change in the composition of the gas. The approach is applied to various classes of dissociation, recombination, rearrangement, ionizing, and photochemical reactions. It is shown that for the principle of reciprocity to be satisfied it is necessary that all chemical reactions exist in complementary pairs which consist of the forward and backward reactions. The backward reaction may be described by either the reverse or inverse process. The forward and backward processes must satisfy the same reciprocity equation. Because the number of dynamical variables is usually unbalanced on both sides of a chemical equation, it is necessary that this balance be established by including as many of the dynamical variables as needed before the reciprocity equation can be formulated. Statistical transformation models of the reactions are formulated. The models are classified under the titles free exchange, restricted exchange and simplified restricted exchange. The special equations for the forward and backward processes are obtained. The models are consistent with the H theorem and Le Chatelier's principle. The models are also formulated in the context of the direct simulation Monte Carlo method.

  19. MODELS OF PROJECT REVERSE ENGINEERING

    Directory of Open Access Journals (Sweden)

    Віктор Володимирович ІВАНОВ

    2017-03-01

    Full Text Available Reverse engineering decided important scientific and technical problems of increasing the cost of the existing technical product by transforming it into a product with other features or design. Search ideas of the new application of existing products on the base of heuristic analysis were created. The concept of reverse engineering and its division into three types: conceptual, aggregate and complete was expanded. The use of heuristic methods for reverse engineering concept was showed. The modification model of Reverse engineering based on the model of РМВОК was developed. Our model includes two new phases: identification and transformation. At the identification phase, technical control is made. At the transformation phase, search heuristic idea of the new applied existing technical product was made. The model of execution phase that included heuristic methods, metrological equipment, and CAD/CAM/CAE program complex was created. The model that connected economic indicators of reverse engineering project was developed.

  20. What do reversible programs compute?

    DEFF Research Database (Denmark)

    Axelsen, Holger Bock; Glück, Robert

    2011-01-01

    Reversible computing is the study of computation models that exhibit both forward and backward determinism. Understanding the fundamental properties of such models is not only relevant for reversible programming, but has also been found important in other fields, e.g., bidirectional model...... transformation, program transformations such as inversion, and general static prediction of program properties. Historically, work on reversible computing has focussed on reversible simulations of irreversible computations. Here, we take the viewpoint that the property of reversibility itself should...... are not strictly classically universal, but that they support another notion of universality; we call this RTM-universality. Thus, even though the RTMs are sub-universal in the classical sense, they are powerful enough as to include a self-interpreter. Lifting this to other computation models, we propose r...

  1. Fundamentals of reversible flowchart languages

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2016-01-01

    Abstract This paper presents the fundamentals of reversible flowcharts. They are intended to naturally represent the structure and control flow of reversible (imperative) programming languages in a simple computation model, in the same way classical flowcharts do for conventional languages......, structured reversible flowcharts are as expressive as unstructured ones, as shown by a reversible version of the classic Structured Program Theorem. We illustrate how reversible flowcharts can be concretized with two example programming languages, complete with syntax and semantics: a low-level unstructured...... language and a high-level structured language. We introduce concrete tools such as program inverters and translators for both languages, which follow the structure suggested by the flowchart model. To further illustrate the different concepts and tools brought together in this paper, we present two major...

  2. Nuclear reactions

    International Nuclear Information System (INIS)

    Corner, J.; Richardson, K.; Fenton, N.

    1990-01-01

    Nuclear reactions' marks a new development in the study of television as an agency of public policy debate. During the Eighties, nuclear energy became a major international issue. The disasters at Three-mile Island and Chernobyl created a global anxiety about its risks and a new sensitivity to it among politicians and journalists. This book is a case-study into documentary depictions of nuclear energy in television and video programmes and into the interpretations and responses of viewers drawn from many different occupational groupings. How are the complex and specialist arguments about benefit, risk and proof conveyed through the different conventions of commentary, interview and film sequence? What symbolic associations does the visual language of television bring to portrayals of the issue? And how do viewers make sense of various and conflicting accounts, connecting what they see and hear on the screen with their pre-existing knowledge, experience and 'civic' expectations. The authors examine some of the contrasting forms and themes which have been used by programme makers to explain and persuade, and then give a sustained analysis of the nature and sources of viewers' own accounts. 'Nuclear Reactions' inquires into the public meanings surrounding energy and the environment, spelling out in its conclusion some of the implications for future media treatments of this issue. It is also a key contribution to the international literature on 'television knowledge' and the processes of active viewing. (author)

  3. The trypsin-catalyzed hydrolysis of monomolecular films of lysylphosphatidylglycerol

    NARCIS (Netherlands)

    Gould, R.M.; Dawson, R.M.C.

    1972-01-01

    The hydrolysis by trypsin of the bacterial phospholipid, lysylphosphatidyl-glycerol has been studied at the air-water interface. High specific activity [14C]-lysylphosphatidylglycerol was prepared biosynthetically and the trypsin action followed by measuring the loss of surface radioactivity from a

  4. Ultrathin monomolecular films and robust assemblies based on cyclic catechols

    Czech Academy of Sciences Publication Activity Database

    Zieger, M. M.; Pop-Georgievski, Ognen; de los Santos Pereira, Andres; Verveniotis, E.; Preuss, C. M.; Zorn, M.; Reck, B.; Goldmann, A. S.; Rodriguez-Emmenegger, Cesar; Barner-Kowollik, C.

    2017-01-01

    Roč. 33, č. 3 (2017), s. 670-679 ISSN 0743-7463 R&D Projects: GA ČR(CZ) GJ15-09368Y Grant - others:OPPK(XE) CZ.2.16/3.1.00/21545 Program:OPPK Institutional support: RVO:61389013 Keywords : cyclic catechols * ultrathin films * macromolecules monolayers Subject RIV: CD - Macromolecular Chemistry OBOR OECD: Polymer science Impact factor: 3.833, year: 2016

  5. The Geomagnetic Field During a Reversal

    Science.gov (United States)

    Heirtzler, James R.

    2003-01-01

    By modifying the IGRF it is possible to learn what may happen to the geomagnetic field during a geomagnetic reversal. If the entire IGRF reverses then the declination and inclination only reverse when the field strength is zero. If only the dipole component of the IGRF reverses a large geomagnetic field remains when the dipole component is zero and he direction of the field at the end of the reversal is not exactly reversed from the directions at the beginning of the reversal.

  6. Spallation reactions; Reactions de spallation

    Energy Technology Data Exchange (ETDEWEB)

    Cugon, J.

    1996-12-31

    Spallation reactions dominate the interactions of hadrons with nuclei in the GeV range (from {approx} 0.1 to {approx} 10 GeV). They correspond to a sometimes important ejection of light particles leaving most of the time a residue of mass commensurate with the target mass. The main features of the experimental data are briefly reviewed. The most successful theoretical model, namely the intranuclear cascade + evaporation model, is presented. Its physical content, results and possible improvements are critically discussed. Alternative approaches are shortly reviewed. (author). 84 refs.

  7. Transfer and breakup reactions at intermediate energies

    International Nuclear Information System (INIS)

    Stokstad, R.G.

    1986-04-01

    The origin of the quasi-elastic peak in peripheral heavy-ion reactions is discussed in terms of inelastic scattering and transfer reactions to unbound states of the primary projectile-like fragment. The situation is analogous to the use of reverse kinematics in fusion reactions, a technique in which the object of study is moving with nearly the beam velocity. It appears that several important features of the quasi-elastic peak may be explained by this approach. Projectile-breakup reactions have attractive features for the study of nuclear structure. They may also be used to determine the partition of excitation energy in peripheral reactions. At intermediate energies, neutron-pickup reactions leading to four-body final states become important. Examples of experiments are presented that illustrate these points. 15 refs., 14 figs

  8. Supercritical fluid reverse micelle separation

    Science.gov (United States)

    Fulton, J.L.; Smith, R.D.

    1993-11-30

    A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.

  9. Reverse engineering for quality systems

    International Nuclear Information System (INIS)

    Nolan, A.J.

    1995-01-01

    When the age of software engineering began, many companies were faced with a problem of how to support the older, pre-software-engineering, programs. The techniques of reverse engineering and re-engineering were developed to bridge the gap between the past and the present. Although reverse engineering can be used for generating missing documentation, it can also be used as a means to demonstrate quality in these older programs. This paper presents, in the form of a case study, how Rolls-Royce and Associates Limited addressed the quality issues of reverse engineering and re-engineering. (author)

  10. Field reversal in mirror machines

    International Nuclear Information System (INIS)

    Pearlstein, L.D.; Anderson, D.V.; Boozer, A.H.

    1978-01-01

    This report discusses some of the physics issues anticipated in field-reversed mirrors. The effect of current cancellation due to electrons is described. An estimate is made of the required impurity level to maintain a field-reversed configuration. The SUPERLAYER code is used to simulate the high-β 2XIIB results, and favorable comparisons require inclusion of quasilinear RF turbulence. Impact of a quadrupole field on field-line closure and resonant transport is discussed. A simple self-consistent model of ion currents is presented. Conditions for stability of field-reversed configurations to E x B driven rotations are determined

  11. Zero field reversal probability in thermally assisted magnetization reversal

    Science.gov (United States)

    Prasetya, E. B.; Utari; Purnama, B.

    2017-11-01

    This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.

  12. A Typology of Reverse Innovation

    DEFF Research Database (Denmark)

    von Zedtwitz, Max; Corsi, Simone; Søberg, Peder Veng

    2015-01-01

    secondary market introduction, this study expands the espoused definition of reverse innovation beyond its market-introduction focus with reversals in the flow of innovation in the ideation and product development phases. Recognizing that each phase can take place in different geographical locations...... taking place in an emerging country. This analytical framework allows recasting of current research at the intersection between innovation and international business. Of the 10 reverse innovation flows, six are new and have not been covered in the literature to date. The study addresses questions......’s portfolio of global innovation competence and capability. The implications for management are concerned with internal and external resistance to reverse innovation. Most significantly, while greater recognition and power of innovation in formerly subordinate organizational units is inconvenient to some...

  13. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.

    1991-01-01

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  14. Spontaneous direct and reverse osmosis

    International Nuclear Information System (INIS)

    Valitov, N.Kh.

    1996-01-01

    It has been ascertained experimentally that in the course of separation of CsCl, KCl, NaCl aqueous solutions by semi-permeable membrane from distilled water the direct and then reverse osmosis are observed. The same sequence is observed in case of separation of CsCl aqueous solutions from NaCl of different concentrations. The reason for the direct and reverse osmosis has been explained. 5 refs.; 3 figs. 1 tab

  15. Garbage collection for reversible functional languages

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2015-01-01

    Reversible languages are programming languages where all programs can run both forwards and backwards. Reversible functional languages have been proposed that use symmetric pattern matching and data construction. To be reversible, these languages require linearity: Every variable must be used...

  16. Reversal of liver fibrosis: From fiction to reality.

    Science.gov (United States)

    Zoubek, Miguel Eugenio; Trautwein, Christian; Strnad, Pavel

    2017-04-01

    In chronic liver diseases, an ongoing hepatocellular injury together with inflammatory reaction results in activation of hepatic stellate cells (HSCs) and increased deposition of extracellular matrix (ECM) termed as liver fibrosis. It can progress to cirrhosis that is characterized by parenchymal and vascular architectural changes together with the presence of regenerative nodules. Even at late stage, liver fibrosis is reversible and the underlying mechanisms include a switch in the inflammatory environment, elimination or regression of activated HSCs and degradation of ECM. While animal models have been indispensable for our understanding of liver fibrosis, they possess several important limitations and need to be further refined. A better insight into the liver fibrogenesis resulted in a large number of clinical trials aiming at reversing liver fibrosis, particularly in patients with non-alcoholic steatohepatitis. Collectively, the current developments demonstrate that reversal of liver fibrosis is turning from fiction to reality. Copyright © 2017. Published by Elsevier Ltd.

  17. The spallation in reverse kinematics: what for a coincidence measurement?

    International Nuclear Information System (INIS)

    Ducret, J.E.

    2006-07-01

    The Spaladin installation has been designed to study spallation reactions in reverse kinematics. Furthermore, the heavy and light fragments are detected by coincidence which allows us to get an instantaneous picture of the reaction at a level of accuracy better than that obtained through inclusive measurement. The first part is dedicated to the theoretical description of the different mechanisms involved in the spallation reactions. In the second part we describe the Spaladin installation and report some results on the reaction: Fe 56 + p at an energy of 1 GeV/nucleon. In the third part we expose the performance of the installation through its simulation with the Geant-IV model. We present a study about the sensitivity of the Spaladin installation to theoretical predictions. The fourth part is dedicated to the future experiments that will be performed with the Spaladin installation. (A.C.)

  18. Direct catalytic asymmetric aldol-Tishchenko reaction.

    Science.gov (United States)

    Gnanadesikan, Vijay; Horiuchi, Yoshihiro; Ohshima, Takashi; Shibasaki, Masakatsu

    2004-06-30

    A direct catalytic asymmetric aldol reaction of propionate equivalent was achieved via the aldol-Tishchenko reaction. Coupling an irreversible Tishchenko reaction to a reversible aldol reaction overcame the retro-aldol reaction problem and thereby afforded the products in high enantio and diastereoselectivity using 10 mol % of the asymmetric catalyst. A variety of ketones and aldehydes, including propyl and butyl ketones, were coupled efficiently, yielding the corresponding aldol-Tishchenko products in up to 96% yield and 95% ee. Diastereoselectivity was generally below the detection limit of 1H NMR (>98:2). Preliminary studies performed to clarify the mechanism revealed that the aldol products were racemic with no diastereoselectivity. On the other hand, the Tishchenko products were obtained in a highly enantiocontrolled manner.

  19. Cascade enzymatic reactions for efficient carbon sequestration.

    Science.gov (United States)

    Xia, Shunxiang; Zhao, Xueyan; Frigo-Vaz, Benjamin; Zheng, Wenyun; Kim, Jungbae; Wang, Ping

    2015-04-01

    Thermochemical processes developed for carbon capture and storage (CCS) offer high carbon capture capacities, but are generally hampered by low energy efficiency. Reversible cascade enzyme reactions are examined in this work for energy-efficient carbon sequestration. By integrating the reactions of two key enzymes of RTCA cycle, isocitrate dehydrogenase and aconitase, we demonstrate that intensified carbon capture can be realized through such cascade enzymatic reactions. Experiments show that enhanced thermodynamic driving force for carbon conversion can be attained via pH control under ambient conditions, and that the cascade reactions have the potential to capture 0.5 mol carbon at pH 6 for each mole of substrate applied. Overall it manifests that the carbon capture capacity of biocatalytic reactions, in addition to be energy efficient, can also be ultimately intensified to approach those realized with chemical absorbents such as MEA. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Vasectomy reversal: a clinical update

    Directory of Open Access Journals (Sweden)

    Abhishek P Patel

    2016-01-01

    Full Text Available Vasectomy is a safe and effective method of contraception used by 42-60 million men worldwide. Approximately 3%-6% of men opt for a vasectomy reversal due to the death of a child or divorce and remarriage, change in financial situation, desire for more children within the same marriage, or to alleviate the dreaded postvasectomy pain syndrome. Unlike vasectomy, vasectomy reversal is a much more technically challenging procedure that is performed only by a minority of urologists and places a larger financial strain on the patient since it is usually not covered by insurance. Interest in this procedure has increased since the operating microscope became available in the 1970s, which consequently led to improved patency and pregnancy rates following the procedure. In this clinical update, we discuss patient evaluation, variables that may influence reversal success rates, factors to consider in choosing to perform vasovasostomy versus vasoepididymostomy, and the usefulness of vasectomy reversal to alleviate postvasectomy pain syndrome. We also review the use of robotics for vasectomy reversal and other novel techniques and instrumentation that have emerged in recent years to aid in the success of this surgery.

  1. Reverse Knowledge Transfer in MNEs

    DEFF Research Database (Denmark)

    Mudambi, Ram; Piscitello, Lucia; Rabbiosi, Larissa

    2014-01-01

    a positive correlation with the extent of reverse knowledge transfers to the parent MNE. Relying on the headquarters-subsidiary view of the MNE, we argue that, beyond a point, increasing subsidiary innovativeness will be associated with lower reverse knowledge transfers. Further, we argue......It is now well recognized that multinational enterprises (MNEs) are differentiated networks wherein subsidiaries vary in terms of their ability to create new knowledge and competencies for their parent groups. In much of this theory, it is taken for granted that subsidiary innovativeness has...... that this relationship is sensitive to the subsidiary entry mode. Using data from a sample of 293 Italian subsidiaries, we find strong support for our hypotheses. In particular, our results confirm that the effect of subsidiary innovativeness on reverse knowledge transfers displays an inverted-U shape...

  2. Ice ages and geomagnetic reversals

    Science.gov (United States)

    Wu, Patrick

    1992-01-01

    There have been speculations on the relationship between climatic cooling and polarity reversals of the earth's magnetic field during the Pleistocene. Two of the common criticisms on this relationship have been the reality of these short duration geomagnetic events and the accuracy of their dates. Champion et al. (1988) have reviewed recent progress in this area. They identified a total of 10 short-duration polarity events in the last 1 Ma and 6 of these events have been found in volcanic rocks, which also have K-Ar dates. Supposing that the speculated relationship between climatic cooling and geomagnetic reversals actually exist, two mechanisms that assume climatic cooling causes short period magnetic reversals will be investigated. These two methods are core-mantle boundary topography and transfer of the rotational energy to the core.

  3. Reverse innovation in maternal health.

    Science.gov (United States)

    Firoz, Tabassum; Makanga, Prestige Tatenda; Nathan, Hannah L; Payne, Beth; Magee, Laura A

    2017-09-01

    Reverse innovation, defined as the flow of ideas from low- to high-income settings, is gaining traction in healthcare. With an increasing focus on value, investing in low-cost but effective and innovative solutions can be of mutual benefit to both high- and low-income countries. Reverse innovation has a role in addressing maternal health challenges in high-income countries by harnessing these innovative solutions for vulnerable populations especially in rural and remote regions. In this paper, we present three examples of 'reverse innovation' for maternal health: a low-cost, easy-to-use blood pressure device (CRADLE), a diagnostic algorithm (mini PIERS) and accompanying mobile app (PIERS on the Move), and a novel method for mapping maternal outcomes (MOM).

  4. Reverse Transfection Using Gold Nanoparticles

    Science.gov (United States)

    Yamada, Shigeru; Fujita, Satoshi; Uchimura, Eiichiro; Miyake, Masato; Miyake, Jun

    Reverse transfection from a solid surface has the potential to deliver genes into various types of cell and tissue more effectively than conventional methods of transfection. We present a method for reverse transfection using a gold colloid (GC) as a nanoscaffold by generating nanoclusters of the DNA/reagentcomplex on a glass surface, which could then be used for the regulation of the particle size of the complex and delivery of DNA into nuclei. With this method, we have found that the conjugation of gold nanoparticles (20 nm in particle size) to the pEGFP-N1/Jet-PEI complex resulted in an increase in the intensity of fluorescence of enhanced green fluorescent protein (EGFP) (based on the efficiency of transfection) from human mesenchymal stem cells (hMSCs), as compared with the control without GC. In this manner, we constructed a method for reverse transfection using GC to deliver genes into the cells effectively.

  5. Designing the Reverse Supply Chain

    DEFF Research Database (Denmark)

    Gobbi, Chiara

    2011-01-01

    Purpose – The purpose of this paper is to explore the impact of the product residual value (PRV) and the loss of value over time of returned products in the reverse supply chain configuration. It also examines whether or not the distinction of Fisher's functional and innovative products holds...... that allows for recapturing most of the PRV. These notions have then been tested by analyzing two reverse supply chains with a case study research methodology. Findings – The findings show that low PRV is associated with second-class recovery options (recycling and energy recovery) and that high PRV...... is associated with first-class recovery options (reconditioning and remarketing). When the recovery option is recycling, time is not relevant, the primary objective is cost reduction (efficiency), the chain is centralized, and actors and phases of the reverse chain are determined by the specificity...

  6. Reverse genetics with animal viruses. NSV reverse genetics

    International Nuclear Information System (INIS)

    Mebatsion, T.

    2005-01-01

    New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)

  7. Pervaporation applied for dewatering of reaction mixture during esterification

    OpenAIRE

    Krasiński Andrzej; Wierzba Patrycja; Grudzień Agata; Hajmowicz Halina; Zawada Krzysztof; Synoradzki Ludwik

    2016-01-01

    In this work the esterification of diethyl tartrate was studied. The research was focused on the enhancement of reversible reaction yield, which is accomplished by dewatering of the reaction mixture. The removal of water shifts the equilibrium towards the main product. Pervaporation was applied for this purpose, and results were compared to distillation. The advantages and limitations of both processes are discussed. The experimental part consists of dewatering of mixture after the reaction h...

  8. Marburg Virus Reverse Genetics Systems

    Directory of Open Access Journals (Sweden)

    Kristina Maria Schmidt

    2016-06-01

    Full Text Available The highly pathogenic Marburg virus (MARV is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems.

  9. Reverse Zymography: Overview and Pitfalls.

    Science.gov (United States)

    Sharma, Kanika; Bhattacharyya, Debasish

    2017-01-01

    Reverse zymography is a technique by which protease inhibitor(s) in a sample could be electrophoretically separated in a substrate-impregnated acrylamide gel and their relative abundance could be semi-quantified. The gel after electrophoresis is incubated with a protease when the impregnated substrate and all other proteins of the sample are degraded into small peptides except the inhibitor(s) that show clear bands against a white background. Since reverse zymography cannot distinguish between a protease inhibitor and a protein that is resistant against proteolysis, the results should be confirmed from inhibition of protease activity by solution state assay.

  10. Reverse hybrid total hip arthroplasty

    DEFF Research Database (Denmark)

    Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M

    2017-01-01

    Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...

  11. Reference counting for reversible languages

    DEFF Research Database (Denmark)

    Mogensen, Torben Ægidius

    2014-01-01

    inverses: Freeing a block of memory is done by running the allocation procedure backwards. Axelsen and Glück use this heap manager to sketch implementation of a simple reversible functional language where pattern matching a constructor is the inverse of construction, so pattern-matching implies......Modern programming languages and operating systems use heap memory that allows allocation and deallocation of memory to be decoupled, so they don't follow a stack discipline. Axelsen and Glück have presented a reversible heap manager where allocation and deallocation are each other's logical...

  12. A functional language for describing reversible logic

    DEFF Research Database (Denmark)

    Thomsen, Michael Kirkedal

    2012-01-01

    Reversible logic is a computational model where all gates are logically reversible and combined in circuits such that no values are lost or duplicated. This paper presents a novel functional language that is designed to describe only reversible logic circuits. The language includes high....... Reversibility of descriptions is guaranteed with a type system based on linear types. The language is applied to three examples of reversible computations (ALU, linear cosine transformation, and binary adder). The paper also outlines a design flow that ensures garbage- free translation to reversible logic...... circuits. The flow relies on a reversible combinator language as an intermediate language....

  13. Electrochemical transformation of trichloroethylene in aqueous solution by electrode polarity reversal.

    Science.gov (United States)

    Rajic, Ljiljana; Fallahpour, Noushin; Yuan, Songhu; Alshawabkeh, Akram N

    2014-12-15

    Electrode polarity reversal is evaluated for electrochemical transformation of trichloroethylene (TCE) in aqueous solution using flow-through reactors with mixed metal oxide electrodes and Pd catalyst. The study tests the hypothesis that optimizing electrode polarity reversal will generate H2O2 in Pd presence in the system. The effect of polarity reversal frequency, duration of the polarity reversal intervals, current intensity and TCE concentration on TCE removal rate and removal mechanism were evaluated. TCE removal efficiencies under 6 cycles h(-1) were similar in the presence of Pd catalyst (50.3%) and without Pd catalyst (49.8%), indicating that Pd has limited impact on TCE degradation under these conditions. The overall removal efficacies after 60 min treatment under polarity reversal frequencies of 6, 10, 15, 30 and 90 cycles h(-1) were 50.3%, 56.3%, 69.3%, 34.7% and 23.4%, respectively. Increasing the frequency of polarity reversal increases TCE removal as long as sufficient charge is produced during each cycle for the reaction at the electrode. Electrode polarity reversal shifts oxidation/reduction and reduction/oxidation sequences in the system. The optimized polarity reversal frequency (15 cycles h(-1) at 60 mA) enables two reaction zones formation where reduction/oxidation occurs at each electrode surface. Published by Elsevier Ltd.

  14. CAPSULE REPORT: REVERSE OSMOSIS PROCESS

    Science.gov (United States)

    A failure analysis has been completed for the reverse osmosis (RO) process. The focus was on process failures that result in releases of liquids and vapors to the environment. The report includes the following: 1) A description of RO and coverage of the principles behind the proc...

  15. Time reversal and parity tests

    International Nuclear Information System (INIS)

    Terwilliger, K.

    1975-01-01

    A recent review by Henley discusses the present status of Time Reversal and Parity symmetry violations, and comments on the implications for high energy hadron scattering. This note will briefly summarize the situation with particular attention to the sizes of possible effects, relating them to experimental accuracy available or reasonably possible at the ZGS

  16. A Framework for Reverse Logistics

    NARCIS (Netherlands)

    M.P. de Brito (Marisa); R. Dekker (Rommert)

    2003-01-01

    textabstractReverse Logistics has been stretching out worldwide, involving all the layers of supply chains in various industry sectors. While some actors in the chain have been forced to take products back, others have pro-actively done so, attracted by the value in used products One way or the

  17. Reverse ventilation--perfusion mismatch

    International Nuclear Information System (INIS)

    Palmaz, J.C.; Barnett, C.A.; Reich, S.B.; Krumpe, P.E.; Farrer, P.A.

    1984-01-01

    Patients having lobar airway obstruction or consolidation usually have decreases of both ventilation and perfusion on lung scans. We report three patients in whom hypoxic vasoconstriction was apparently incomplete, resulting in a ''reversed'' ventilation-perfusion mismatch. Perfusion of the hypoxic lobe on the radionuclide scan was associated with metabolic alkalosis, pulmonary venous and pulmonary arterial hypertension in these patients

  18. Reverse amblyopia with atropine treatment.

    Science.gov (United States)

    Hainline, Bryan C; Sprunger, Derek C; Plager, David A; Neely, Daniel E; Guess, Matthew G

    2009-01-01

    Occlusion, pharmacologic pernalization and combined therapy have been documented in controlled studies to effectively treat amblyopia with few complications. However, there remain concerns about the effectiveness and complications when, as in this case, there are not standardized treatment protocols. A retrospective chart review of 133 consecutive patients in one community based ophthalmology practice treated for amblyopia was performed. Treatments evaluated were occlusion only, atropine penalization, and combination of occlusion and atropine. Reverse amblyopia was defined as having occured when the visual acuity of the sound eye was 3 LogMar units worse than visual acuity of the amblyopia eye after treatment. Improvement in vision after 6 months and 1 year of amblyopia therapy was similar among all three groups: 0.26 LogMar lines and 0.30 in the atropine group, 0.32 and 0.34 in the occlusion group, and 0.24 and 0.32 in the combined group. Eight (6%) patients demonstrated reverse amblyopia. The mean age of those who developed reverse amblyopia was 3.5 years, 1.5 years younger than the mean age of the study population, 7/8 had strabismic amblyopia, 6/8 were on daily atropine and had a mean refractive error of +4.77 diopters in the amblyopic eye and +5.06 diopters in the sound eye. Reverse amblyopia did not occur with occlusion only therapy. In this community based ophthalmology practice, atropine, patching, and combination therapy appear to be equally effective modalities to treat ambyopia. Highly hyperopic patients under 4 years of age with dense, strabismic amblyopia and on daily atropine appeared to be most at risk for development of reverse amblyopia.

  19. Modeling of uncertainties in biochemical reactions.

    Science.gov (United States)

    Mišković, Ljubiša; Hatzimanikatis, Vassily

    2011-02-01

    Mathematical modeling is an indispensable tool for research and development in biotechnology and bioengineering. The formulation of kinetic models of biochemical networks depends on knowledge of the kinetic properties of the enzymes of the individual reactions. However, kinetic data acquired from experimental observations bring along uncertainties due to various experimental conditions and measurement methods. In this contribution, we propose a novel way to model the uncertainty in the enzyme kinetics and to predict quantitatively the responses of metabolic reactions to the changes in enzyme activities under uncertainty. The proposed methodology accounts explicitly for mechanistic properties of enzymes and physico-chemical and thermodynamic constraints, and is based on formalism from systems theory and metabolic control analysis. We achieve this by observing that kinetic responses of metabolic reactions depend: (i) on the distribution of the enzymes among their free form and all reactive states; (ii) on the equilibrium displacements of the overall reaction and that of the individual enzymatic steps; and (iii) on the net fluxes through the enzyme. Relying on this observation, we develop a novel, efficient Monte Carlo sampling procedure to generate all states within a metabolic reaction that satisfy imposed constrains. Thus, we derive the statistics of the expected responses of the metabolic reactions to changes in enzyme levels and activities, in the levels of metabolites, and in the values of the kinetic parameters. We present aspects of the proposed framework through an example of the fundamental three-step reversible enzymatic reaction mechanism. We demonstrate that the equilibrium displacements of the individual enzymatic steps have an important influence on kinetic responses of the enzyme. Furthermore, we derive the conditions that must be satisfied by a reversible three-step enzymatic reaction operating far away from the equilibrium in order to respond to

  20. Time-reversal symmetry breaking in quantum billiards

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, Florian

    2009-01-26

    The present doctoral thesis describes experimentally measured properties of the resonance spectra of flat microwave billiards with partially broken timereversal invariance induced by an embedded magnetized ferrite. A vector network analyzer determines the complex scattering matrix elements. The data is interpreted in terms of the scattering formalism developed in nuclear physics. At low excitation frequencies the scattering matrix displays isolated resonances. At these the effect of the ferrite on isolated resonances (singlets) and pairs of nearly degenerate resonances (doublets) is investigated. The hallmark of time-reversal symmetry breaking is the violation of reciprocity, i.e. of the symmetry of the scattering matrix. One finds that reciprocity holds in singlets; it is violated in doublets. This is modeled by an effective Hamiltonian of the resonator. A comparison of the model to the data yields time-reversal symmetry breaking matrix elements in the order of the level spacing. Their dependence on the magnetization of the ferrite is understood in terms of its magnetic properties. At higher excitation frequencies the resonances overlap and the scattering matrix elements fluctuate irregularly (Ericson fluctuations). They are analyzed in terms of correlation functions. The data are compared to three models based on random matrix theory. The model by Verbaarschot, Weidenmueller and Zirnbauer describes time-reversal invariant scattering processes. The one by Fyodorov, Savin and Sommers achieves the same for systems with complete time-reversal symmetry breaking. An extended model has been developed that accounts for partial breaking of time-reversal invariance. This extended model is in general agreement with the data, while the applicability of the other two models is limited. The cross-correlation function between forward and backward reactions determines the time-reversal symmetry breaking matrix elements of the Hamiltonian to up to 0.3 mean level spacings. Finally

  1. Time-reversal symmetry breaking in quantum billiards

    International Nuclear Information System (INIS)

    Schaefer, Florian

    2009-01-01

    The present doctoral thesis describes experimentally measured properties of the resonance spectra of flat microwave billiards with partially broken timereversal invariance induced by an embedded magnetized ferrite. A vector network analyzer determines the complex scattering matrix elements. The data is interpreted in terms of the scattering formalism developed in nuclear physics. At low excitation frequencies the scattering matrix displays isolated resonances. At these the effect of the ferrite on isolated resonances (singlets) and pairs of nearly degenerate resonances (doublets) is investigated. The hallmark of time-reversal symmetry breaking is the violation of reciprocity, i.e. of the symmetry of the scattering matrix. One finds that reciprocity holds in singlets; it is violated in doublets. This is modeled by an effective Hamiltonian of the resonator. A comparison of the model to the data yields time-reversal symmetry breaking matrix elements in the order of the level spacing. Their dependence on the magnetization of the ferrite is understood in terms of its magnetic properties. At higher excitation frequencies the resonances overlap and the scattering matrix elements fluctuate irregularly (Ericson fluctuations). They are analyzed in terms of correlation functions. The data are compared to three models based on random matrix theory. The model by Verbaarschot, Weidenmueller and Zirnbauer describes time-reversal invariant scattering processes. The one by Fyodorov, Savin and Sommers achieves the same for systems with complete time-reversal symmetry breaking. An extended model has been developed that accounts for partial breaking of time-reversal invariance. This extended model is in general agreement with the data, while the applicability of the other two models is limited. The cross-correlation function between forward and backward reactions determines the time-reversal symmetry breaking matrix elements of the Hamiltonian to up to 0.3 mean level spacings. Finally

  2. Reversal agents in anaesthesia and critical care

    Directory of Open Access Journals (Sweden)

    Nibedita Pani

    2015-01-01

    Full Text Available Despite the advent of short and ultra-short acting drugs, an in-depth knowledge of the reversal agents used is a necessity for any anaesthesiologist. Reversal agents are defined as any drug used to reverse the effects of anaesthetics, narcotics or potentially toxic agents. The controversy on the routine reversal of neuromuscular blockade still exists. The advent of newer reversal agents like sugammadex have made the use of steroidal neuromuscular blockers like rocuronium feasible in rapid sequence induction situations. We made a review of the older reversal agents and those still under investigation for drugs that are regularly used in our anaesthesia practice.

  3. Reverse osmosis water purification system

    Science.gov (United States)

    Ahlstrom, H. G.; Hames, P. S.; Menninger, F. J.

    1986-01-01

    A reverse osmosis water purification system, which uses a programmable controller (PC) as the control system, was designed and built to maintain the cleanliness and level of water for various systems of a 64-m antenna. The installation operates with other equipment of the antenna at the Goldstone Deep Space Communication Complex. The reverse osmosis system was designed to be fully automatic; with the PC, many complex sequential and timed logic networks were easily implemented and are modified. The PC monitors water levels, pressures, flows, control panel requests, and set points on analog meters; with this information various processes are initiated, monitored, modified, halted, or eliminated as required by the equipment being supplied pure water.

  4. Trend towards reverse leach process

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The South African gold mining industry is making notable strides in improving recovery methods for both gold and uranium with significant additions to profits because of higher efficiencies and reductions in costs in the recovery processes. The most notable step on the gold side recently is the adoption of the reverse leach process at Buffelsfontein and Western Deep Levels. This process was pioneered at Hartebeesfontein as far back as 1975 and when introduced there resulted in a two and a half per cent improvement in recovery efficiencies. The essence of reverse leaching under which the uranium is recovered before the gold is the fact that the gold partly coated with iron oxide or locked in uranite, is exposed to be recovered later by cyanidation

  5. Reversible evolution of charged ergoregions

    Energy Technology Data Exchange (ETDEWEB)

    Kokkotas, K.; Spyrou, N.

    1987-07-01

    The reversible evolution of a charged rotating ergoregion, due to the injection into it of particles with mass-energy and angular momentum, is studied systematically. As in the uncharged case, a bulge always forms on the outer boundary of the ergoregion due to the latter's angular momentum. The behavior of the bulge's position, relative to the black hole's rotation axis and equatorial plane, is studied, on the basis of the cosmic censorship hypothesis, during the ergoregion's reversible evolution. The range of the permitted values of the ergoregion's linear dimensions along the rotation axis and perpendicular to it is specified. Finally the differences with the evolution of an uncharged ergoregion are pointed out and discussed.

  6. Reverse micelles as suitable microreactor for increased biohydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Pandey, Anjana [Nanotechnology and Molecular Biology Laboratory, Centre of Biotechnology, University of Allahabad, Allahabad 211002 (India); Pandey, Ashutosh [Centre of Energy Studies, MNNIT, Allahabad 211004 (India)

    2008-01-15

    Reverse micelles have been shown to act as efficient microreactors for enzymic reactions and whole cell entrapment in organic (non-aqueous) media wherein the reactants are protected from denaturation by the surrounding organic solvent. These micelles are thermodynamically stable, micrometer sized water droplets dispersed in an organic phase by a surfactant. It has been observed that when whole cells of photosynthetic bacteria (Rhodopseudomonas sphaeroides or Rhodobacter sphaeroides 2.4.1) are entrapped inside these reverse micelles, the H{sub 2} production enhanced from 25 to 35 folds. That is, 1.71mmol(mgprotein){sup -1}h{sup -1} in case of R. sphaeroides which is 25 fold higher in benzene-sodium lauryl sulfate reverse micelles. Whereas, in case of R. sphaeroides 2.4.1 the H{sub 2} production was increased by 35 fold within AOT-isooctane reverse micelles i.e. 11.5mmol(mgprotein){sup -1}h{sup -1}. The observations indicate that the entrapment of whole cells of microbes within reverse micelles provides a novel and efficient technique to produce hydrogen by the inexhaustible biological route. The two microorganisms R. sphaeroides 2.4.1 (a photosynthetic bacteria) and Citrobacter Y19 (a facultative anaerobic bacteria) together are also entrapped within AOT-isooctane and H{sub 2} production was measured i.e. 69mmol(mgprotein){sup -1}h{sup -1}. The nitrogenase enzyme responsible for hydrogen production by R. sphaeroides/R. sphaeroides 2.4.1 cells is oxygen sensitive, and very well protected within reverse micelles by the use of combined approach of two cells (R. sphaeroides 2.4.1 and Citrobacter Y19). In this case glucose present in the medium of Citrobacter Y19 serves double roles in enhancing the sustained production rate of hydrogen. Firstly, it quenches the free O{sub 2}liberated as a side product of reaction catalyzed by nitrogenase, which is O{sub 2} labile. Secondly, organic acid produced by this reaction is utilized by the Citrobacter Y19 as organic substrate in

  7. Malware analysis and reverse engineering

    OpenAIRE

    Šváb, Martin

    2014-01-01

    Focus of this thesis is reverse engineering in information technology closely linked with the malware analysis. It explains fundamentals of IA-32 processors architecture and basics of operating system Microsoft Windows. Main part of this thesis is dedicated to the malware analysis, including description of creating a tool for simplification of static part of the analysis. In Conclusion various approaches to the malware analysis, which were described in previous part of the thesis, are practic...

  8. How to play Reverse Hex

    DEFF Research Database (Denmark)

    Toft, Bjarne; Hayward, Ryan B.; Henderson, Philip

    2012-01-01

    We present new results on how to play Reverse Hex, also known as Rex, or Misère Hex, on n × n boards. We give new proofs – and strengthened versions – of Lagarias and Sleator’s theorem (for n × n boards, each player can prolong the game until the board is full, so the first/second player can alwa...

  9. Theory of field reversed configurations

    International Nuclear Information System (INIS)

    Steinhauer, L.C.

    1990-01-01

    This final report surveys the results of work conducted on the theory of field reversed configurations. This project has spanned ten years, beginning in early 1980. During this period, Spectra Technology was one of the leading contributors to the advances in understanding FRC. The report is organized into technical topic areas, FRC formation, equilibrium, stability, and transport. Included as an appendix are papers published in archival journals that were generated in the course of this report. 33 refs

  10. Reverse engineering of integrated circuits

    Science.gov (United States)

    Chisholm, Gregory H.; Eckmann, Steven T.; Lain, Christopher M.; Veroff, Robert L.

    2003-01-01

    Software and a method therein to analyze circuits. The software comprises several tools, each of which perform particular functions in the Reverse Engineering process. The analyst, through a standard interface, directs each tool to the portion of the task to which it is most well suited, rendering previously intractable problems solvable. The tools are generally used iteratively to produce a successively more abstract picture of a circuit, about which incomplete a priori knowledge exists.

  11. Risperidone-induced reversible neutropenia.

    Science.gov (United States)

    Kattalai Kailasam, Vasanth; Chima, Victoria; Nnamdi, Uchechukwu; Sharma, Kavita; Shah, Kairav

    2017-01-01

    This case report presents a 44-year-old man with a history of schizophrenia who developed neutropenia on risperidone therapy. The patient's laboratory reports showed a gradual decline of leukocytes and neutrophils after resolution and rechallenging. This was reversed with the discontinuation of risperidone and by switching to olanzapine. In this case report, we also discuss the updated evidence base for management of risperidone-induced neutropenia.

  12. CONCEPTUAL ISSUES REGARDING REVERSE LOGISTICS

    Directory of Open Access Journals (Sweden)

    Ioana Olariu

    2013-12-01

    Full Text Available As the power of consumers is growing, the product return for customer service and customer retention has become a common practice in the competitive market, which propels the recent practice of reverse logistics in companies. Many firms attracted by the value available in the flow, have proactively participated in handling returned products at the end of their usefulness or from other parts of the product life cycle. Reverse logistics is the flow and management of products, packaging, components and information from the point of consumption to the point of origin. It is a collection of practices similar to those of supply chain management, but in the opposite direction, from downstream to upstream. It involves activities such as reuse, repair, remanufacture, refurbish, reclaim and recycle. For the conventional forward logistics systems, the flow starts upstream as raw materials, later as manufactured parts and components to be assembled and continues downstream to reach customers as final products to be disposed once they reach their economic or useful lives. In reverse logistics, the disposed products are pushed upstream to be repaired, remanufactured, refurbished, and disassembled into components to be reused or as raw material to be recycled for later use.

  13. Studying protein assembly with reversible Brownian dynamics of patchy particles

    International Nuclear Information System (INIS)

    Klein, Heinrich C. R.; Schwarz, Ulrich S.

    2014-01-01

    Assembly of protein complexes like virus shells, the centriole, the nuclear pore complex, or the actin cytoskeleton is strongly determined by their spatial structure. Moreover, it is becoming increasingly clear that the reversible nature of protein assembly is also an essential element for their biological function. Here we introduce a computational approach for the Brownian dynamics of patchy particles with anisotropic assemblies and fully reversible reactions. Different particles stochastically associate and dissociate with microscopic reaction rates depending on their relative spatial positions. The translational and rotational diffusive properties of all protein complexes are evaluated on-the-fly. Because we focus on reversible assembly, we introduce a scheme which ensures detailed balance for patchy particles. We then show how the macroscopic rates follow from the microscopic ones. As an instructive example, we study the assembly of a pentameric ring structure, for which we find excellent agreement between simulation results and a macroscopic kinetic description without any adjustable parameters. This demonstrates that our approach correctly accounts for both the diffusive and reactive processes involved in protein assembly

  14. Studying protein assembly with reversible Brownian dynamics of patchy particles

    Energy Technology Data Exchange (ETDEWEB)

    Klein, Heinrich C. R. [Institute for Theoretical Physics, Heidelberg University, 69120 Heidelberg (Germany); Schwarz, Ulrich S., E-mail: ulrich.schwarz@bioquant.uni-heidelberg.de [Institute for Theoretical Physics, Heidelberg University, 69120 Heidelberg (Germany); BioQuant, Heidelberg University, 69120 Heidelberg (Germany)

    2014-05-14

    Assembly of protein complexes like virus shells, the centriole, the nuclear pore complex, or the actin cytoskeleton is strongly determined by their spatial structure. Moreover, it is becoming increasingly clear that the reversible nature of protein assembly is also an essential element for their biological function. Here we introduce a computational approach for the Brownian dynamics of patchy particles with anisotropic assemblies and fully reversible reactions. Different particles stochastically associate and dissociate with microscopic reaction rates depending on their relative spatial positions. The translational and rotational diffusive properties of all protein complexes are evaluated on-the-fly. Because we focus on reversible assembly, we introduce a scheme which ensures detailed balance for patchy particles. We then show how the macroscopic rates follow from the microscopic ones. As an instructive example, we study the assembly of a pentameric ring structure, for which we find excellent agreement between simulation results and a macroscopic kinetic description without any adjustable parameters. This demonstrates that our approach correctly accounts for both the diffusive and reactive processes involved in protein assembly.

  15. Constrained approximation of effective generators for multiscale stochastic reaction networks and application to conditioned path sampling

    Energy Technology Data Exchange (ETDEWEB)

    Cotter, Simon L., E-mail: simon.cotter@manchester.ac.uk

    2016-10-15

    Efficient analysis and simulation of multiscale stochastic systems of chemical kinetics is an ongoing area for research, and is the source of many theoretical and computational challenges. In this paper, we present a significant improvement to the constrained approach, which is a method for computing effective dynamics of slowly changing quantities in these systems, but which does not rely on the quasi-steady-state assumption (QSSA). The QSSA can cause errors in the estimation of effective dynamics for systems where the difference in timescales between the “fast” and “slow” variables is not so pronounced. This new application of the constrained approach allows us to compute the effective generator of the slow variables, without the need for expensive stochastic simulations. This is achieved by finding the null space of the generator of the constrained system. For complex systems where this is not possible, or where the constrained subsystem is itself multiscale, the constrained approach can then be applied iteratively. This results in breaking the problem down into finding the solutions to many small eigenvalue problems, which can be efficiently solved using standard methods. Since this methodology does not rely on the quasi steady-state assumption, the effective dynamics that are approximated are highly accurate, and in the case of systems with only monomolecular reactions, are exact. We will demonstrate this with some numerics, and also use the effective generators to sample paths of the slow variables which are conditioned on their endpoints, a task which would be computationally intractable for the generator of the full system.

  16. Characterization of Pulse Reverses Electroforming on Hard Gold Coating.

    Science.gov (United States)

    Byoun, Young-Min; Noh, Young-Tai; Kim, Young-Geun; Ma, Seung-Hwan; Kim, Gwan-Hoon

    2018-03-01

    Effect of pulse reverse current (PRC) method on brass coatings electroplated from gold solution was investigated by various plating parameters such as plating duration, the anodic duty cycle, the anodic current density and the cathodic current density. The reversed current results in a significant change in the morphology of electrodeposits, improvement of the overall current efficiency and reduction of deposit porosity. With longer pulses, hemispherical surface features are generated, while larger grains result from shorter pulse widths. The porosity of the plated samples is found to decrease compared with results at the same time-average plating rate obtained from DC or Pulse plating. A major impediment to reducing gold later thickness is the corrosion of the underlying substrate, which is affected by the porosity of the gold layer. Both the morphology and the hydrogen evolution reaction have significant impact on porosity. PRC plating affect hydrogen gold and may oxidize hydrogen produced during the cathodic portion of the waveform. Whether the dissolution of gold and oxidation of hydrogen occur depends on the type of plating bath and the plating conditions adapted. In reversed pulse plating, the amount of excess near-surface cyanide is changed after the cathodic current is applied, and the oxidation of gold under these conditions has not been fully addressed. The effects of the current density, pulse-reverse ratio and brightener concentration of the electroplating process were investigated and optimized for suitable performance.

  17. SELECTED PROBLEMS OF REVERSE LOGISTICS IN POLAND

    OpenAIRE

    Agata Mesjasz-Lech

    2009-01-01

    This paper presents the essence of reverse logistics and directions of physical and information flows between logistic network partners. It also analyses effects of implementation of the principles of reverse logistics in Poland in the years 2004-2007

  18. Dynamic Modeling of Reversible Methanolysis of Jatropha curcas Oil to Biodiesel

    Science.gov (United States)

    Syam, Azhari M.; Hamid, Hamidah A.; Yunus, Robiah; Rashid, Umer

    2013-01-01

    Many kinetics studies on methanolysis assumed the reactions to be irreversible. The aim of the present work was to study the dynamic modeling of reversible methanolysis of Jatropha curcas oil (JCO) to biodiesel. The experimental data were collected under the optimal reaction conditions: molar ratio of methanol to JCO at 6 : 1, reaction temperature of 60°C, 60 min of reaction time, and 1% w/w of catalyst concentration. The dynamic modeling involved the derivation of differential equations for rates of three stepwise reactions. The simulation study was then performed on the resulting equations using MATLAB. The newly developed reversible models were fitted with various rate constants and compared with the experimental data for fitting purposes. In addition, analysis of variance was done statistically to evaluate the adequacy and quality of model parameters. The kinetics study revealed that the reverse reactions were significantly slower than forward reactions. The activation energies ranged from 6.5 to 44.4 KJ mol−1. PMID:24363616

  19. Periodicity and Immortality in Reversible Computing

    OpenAIRE

    Kari , Jarkko; Ollinger , Nicolas

    2008-01-01

    Additional material available on the web at http://www.lif.univ-mrs.fr/~nollinge/rec/gnirut/; We investigate the decidability of the periodicity and the immortality problems in three models of reversible computation: reversible counter machines, reversible Turing machines and reversible one-dimensional cellular automata. Immortality and periodicity are properties that describe the behavior of the model starting from arbitrary initial configurations: immortality is the property of having at le...

  20. Time asymmetry: Polarization and analyzing power in the nuclear reactions

    International Nuclear Information System (INIS)

    Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.

    1983-01-01

    Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers of the inverse reactions, initiated by polarized protons at the same c.m. energies, show significant differences which imply the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show some smaller differences. A discussion of the instrumental asymmetries is presented. (orig.)

  1. r-Universal reversible logic gates

    International Nuclear Information System (INIS)

    Vos, A de; Storme, L

    2004-01-01

    Reversible logic plays a fundamental role both in ultra-low power electronics and in quantum computing. It is therefore important to know which reversible logic gates can be used as building block for the reversible implementation of an arbitrary boolean function and which cannot

  2. THEORETICAL FRAMES FOR DESIGNING REVERSE LOGISTICS PROCESSES

    OpenAIRE

    Janusz K. Grabara; Sebastian Kot

    2009-01-01

    Logistics processes of return flow became more and more important in present business practice. Because of better customer satisfaction, environmental and financial aspects many enterprises deal with reverse logistics performance. The paper is a literature review focused on the design principles of reverse logistics processes Keywords: reverse logistics, designing.

  3. Prefix reversals on binary and ternary strings

    NARCIS (Netherlands)

    Hurkens, C.A.J.; van Iersel, L.J.J.; Keijsper, J.C.M.; Kelk, S.M.; Stougie, L.; Tromp, J.T.

    2007-01-01

    Given a permutation $\\pi$, the application of prefix reversal $f^{(i)}$ to $\\pi$ reverses the order of the first $i$ elements of $\\pi$. The problem of sorting by prefix reversals (also known as pancake flipping), made famous by Gates and Papadimitriou (Discrete Math., 27 (1979), pp. 47–57), asks

  4. Prefix reversals on binary and ternary strings

    NARCIS (Netherlands)

    Hurkens, C.A.J.; Iersel, van L.J.J.; Keijsper, J.C.M.; Kelk, S.M.; Stougie, L.; Tromp, J.T.

    2007-01-01

    Given a permutation $\\pi$, the application of prefix reversal $f^{(i)}$ to $\\pi$ reverses the order of the first $i$ elements of $\\pi$. The problem of sorting by prefix reversals (also known as pancake flipping), made famous by Gates and Papadimitriou (Discrete Math., 27 (1979), pp. 47–57), asks for

  5. Reversible and Irreversible Binding of Nanoparticles to Polymeric Surfaces

    Directory of Open Access Journals (Sweden)

    Wolfgang H. Binder

    2009-01-01

    Full Text Available Reversible and irreversible binding of CdSe-nanoparticles and nanorods to polymeric surfaces via a strong, multiple hydrogen bond (= Hamilton-receptor/barbituric acid is described. Based on ROMP-copolymers, the supramolecular interaction on a thin polymer film is controlled by living polymerization methods, attaching the Hamilton-receptor in various architectures, and concentrations. Strong binding is observed with CdSe-nanoparticles and CdSe-nanorods, whose surfaces are equipped with matching barbituric acid-moieties. Addition of polar solvents, able to break the hydrogen bonds leads to the detachment of the nanoparticles from the polymeric film. Irreversible binding is observed if an azide/alkine-“click”-reaction is conducted after supramolecular recognition of the nanoparticles on the polymeric surface. Thus reversible or irreversible attachment of the nanosized objects can be achieved.

  6. Test of time-reversal invariance at COSY (TRIC)

    Energy Technology Data Exchange (ETDEWEB)

    Eversheim, D., E-mail: evershei@hiskp.uni-bonn.de; Valdau, Yu. [University Bonn, Helmholtz Institut fuer Strahlen- und Kernphysik (Germany); Lorentz, B. [Forschungszentrum Juelich, Institut fuer Kernphysik (Germany)

    2013-03-15

    At the Cooler Synchrotron COSY a novel (P-even, T-odd) null test of time-reversal invariance to an accuracy of 10{sup - 6} is planned as an internal target transmission experiment. The parity conserving time-reversal violating observable is the total cross-section asymmetry A{sub y,xz}. This quantity is measured using a polarized proton beam with an energy of 135 MeV and an internal tensor polarized deuteron target from the PAX atomic beam source. The reaction rate will be measured by means of an integrating beam current transformer. Thus, in this experiment the cooler synchroton ring serves as ideal forward spectrometer, as a detector, and an accelerator.

  7. Remote Whispering Applying Time Reversal

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Brian Eric [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-07-16

    The purpose of this project was to explore the use of time reversal technologies as a means for communication to a targeted individual or location. The idea is to have the privacy of whispering in one’s ear, but to do this remotely from loudspeakers not located near the target. Applications of this work include communicating with hostages and survivors in rescue operations, communicating imaging and operational conditions in deep drilling operations, monitoring storage of spent nuclear fuel in storage casks without wires, or clandestine activities requiring signaling between specific points. This technology provides a solution in any application where wires and radio communications are not possible or not desired. It also may be configured to self calibrate on a regular basis to adjust for changing conditions. These communications allow two people to converse with one another in real time, converse in an inaudible frequency range or medium (i.e. using ultrasonic frequencies and/or sending vibrations through a structure), or send information for a system to interpret (even allowing remote control of a system using sound). The time reversal process allows one to focus energy to a specific location in space and to send a clean transmission of a selected signal only to that location. In order for the time reversal process to work, a calibration signal must be obtained. This signal may be obtained experimentally using an impulsive sound, a known chirp signal, or other known signals. It may also be determined from a numerical model of a known environment in which the focusing is desired or from passive listening over time to ambient noise.

  8. Repeatable Reverse Engineering with PANDA

    Science.gov (United States)

    2015-12-08

    necessary layout information for the Android 2.3 and 4.2 SDK kernels. See Section IV-C for an example of the kind of deep reverse engineering of Android apps ...code re-use and simplifying complex analysis development. We demonstrate PANDA’s effectiveness via a number of use cases, including enabling an old but...continue to function. 2) Identify critical vulnerabilities . 3) Understand the true purpose and actions of code. It is common for legacy code to stop

  9. Corrosion protected reversing heat exchanger

    International Nuclear Information System (INIS)

    Zawierucha, R.

    1984-01-01

    A reversing heat exchanger of the plate and fin type having multiple aluminum parting sheets in a stacked arrangement with corrugated fins separating the sheets to form multiple flow paths, means for closing the ends of the sheets, an input manifold arrangement of headers for the warm end of of the exchanger and an output manifold arrangement for the cold end of the exchanger with the input air feed stream header and the waste gas exhaust header having an alloy of zinc and aluminum coated on the inside surface for providing corrosion protection to the stack

  10. Presbycusis: reversible with anesthesia drugs?

    Science.gov (United States)

    Kocher, Carl A

    2009-02-01

    Age-related hearing impairment, or presbycusis, is a degenerative condition not currently treatable by medication. It is therefore significant that the author, as a patient, experienced a reversal of high-frequency hearing loss during a 2-day period following abdominal surgery with general anesthesia. This report documents the surgery and the subsequent restoration of hearing, which was bilateral and is estimated to have exceeded 50dB at 4kHz. A possible role is noted for anesthetic agents such as lidocaine, propofol, or fentanyl. This experience may hold a clue for research toward the development of medical treatments for presbycusis.

  11. Field-reversed mirror reactor

    International Nuclear Information System (INIS)

    Carlson, G.A.

    1978-01-01

    The reactor design is a multicell arrangement wherein a series of field-reversed plasma layers are arranged along the axis of a long superconducting solenoid which provides the background magnetic field. Normal copper mirror coils and Ioffe bars placed at the first wall radius provide shallow axial and radial magnetic wells for each plasma layer. Each of 11 plasma layers requires the injection of 3.6 MW of 200 keV deuterium and tritium and produces 20 MW of fusion power. The reactor has a net electric output of 74 MWe and an estimated direct capital cost of $1200/kWe

  12. Kinematic reversal schemes for the geomagnetic dipole.

    Science.gov (United States)

    Levy, E. H.

    1972-01-01

    Fluctuations in the distribution of cyclonic convective cells, in the earth's core, can reverse the sign of the geomagnetic field. Two kinematic reversal schemes are discussed. In the first scheme, a field maintained by cyclones concentrated at low latitude is reversed by a burst of cyclones at high latitude. Conversely, in the second scheme, a field maintained predominantly by cyclones in high latitudes is reversed by a fluctuation consisting of a burst of cyclonic convection at low latitude. The precise fluid motions which produce the geomagnetic field are not known. However, it appears that, whatever the details are, a fluctuation in the distribution of cyclonic cells over latitude can cause a geomagnetic reversal.

  13. The effect of catalyst support on the RWGS reaction

    International Nuclear Information System (INIS)

    Laosiripojana, N.; Sutthisripok, W.

    2004-01-01

    'Full text:' Methane steam reforming is generally applied in order to produce synthesis gas mainly consist of hydrogen and carbon monoxide for later utilization in SOFC. This reaction is always carried out with the water gas shift reaction over a catalyst at elevated temperatures resulting in some carbon dioxide production. The CO/CO2 production selectivity strongly depends on the influence of water gas shift reaction. It was observed that the reactivity of this reaction depended on the type of support material. Stabilities, activities, and kinetics of the reverse water gas shift reaction (RWGS) for commercial nickel on CeO2, ZrO2, CeO2-ZrO2, TiO2, MgO, and Al2O3 supports were studied in order to observe the influence of the support on this reaction. According to the experiment, the activities of Ni/CeO2 toward the reverse water gas shift reaction (RWGS) were very high, and reached equilibrium level at approximately 600 o C (where the conversion of CO2 was closed to 1). Other oxide supports provided lower activities toward this reaction. It was observed that the activity of Ni/Al2O3 toward this reaction was the lowest. The kinetics of this reaction was also studied. Carbon dioxide presented positive effect on the reverse water gas shift reaction. The reaction orders in carbon dioxide were observed to be positive partial value between 0-1. It slightly decreased with increasing temperature for Ni/ CeO2 and Ni/CeO2-ZrO2, whereas it seemed to be independent of the operating temperature for other materials in the range of conditions studied. Hydrogen also showed positive effect on the reverse water gas shift reaction for all materials. The reaction order in hydrogen for all materials was observed to be the positive value and less than one for the range of conditions studied. The approximate values for all catalysts were between 0.45-0.65, and seemed to be independent of the operating temperature. The estimated values of the apparent activation energy for RWGS reaction

  14. Theta, time reversal and temperature

    Energy Technology Data Exchange (ETDEWEB)

    Gaiotto, Davide [Perimeter Institute for Theoretical Physics,Waterloo, Ontario, N2L 2Y5 (Canada); Kapustin, Anton [Walter Burke Institute for Theoretical Physics, California Institute of Technology,Pasadena, CA 91125 (United States); Komargodski, Zohar [Department of Particle Physics and Astrophysics, Weizmann Institute of Science,Rehovot 76100 (Israel); Seiberg, Nathan [School of Natural Sciences, Institute for Advanced Study,Princeton, NJ 08540 (United States)

    2017-05-17

    SU(N) gauge theory is time reversal invariant at θ=0 and θ=π. We show that at θ=π there is a discrete ’t Hooft anomaly involving time reversal and the center symmetry. This anomaly leads to constraints on the vacua of the theory. It follows that at θ=π the vacuum cannot be a trivial non-degenerate gapped state. (By contrast, the vacuum at θ=0 is gapped, non-degenerate, and trivial.) Due to the anomaly, the theory admits nontrivial domain walls supporting lower-dimensional theories. Depending on the nature of the vacuum at θ=π, several phase diagrams are possible. Assuming area law for space-like loops, one arrives at an inequality involving the temperatures at which CP and the center symmetry are restored. We also analyze alternative scenarios for SU(2) gauge theory. The underlying symmetry at θ=π is the dihedral group of 8 elements. If deconfined loops are allowed, one can have two O(2)-symmetric fixed points. It may also be that the four-dimensional theory around θ=π is gapless, e.g. a Coulomb phase could match the underlying anomalies.

  15. Exercise prescription to reverse frailty.

    Science.gov (United States)

    Bray, Nick W; Smart, Rowan R; Jakobi, Jennifer M; Jones, Gareth R

    2016-10-01

    Frailty is a clinical geriatric syndrome caused by physiological deficits across multiple systems. These deficits make it challenging to sustain homeostasis required for the demands of everyday life. Exercise is likely the best therapy to reverse frailty status. Literature to date suggests that pre-frail older adults, those with 1-2 deficits on the Cardiovascular Health Study-Frailty Phenotype (CHS-frailty phenotype), should exercise 2-3 times a week, for 45-60 min. Aerobic, resistance, flexibility, and balance training components should be incorporated but resistance and balance activities should be emphasized. On the other hand, frail (CHS-frailty phenotype ≥ 3 physical deficits) older adults should exercise 3 times per week, for 30-45 min for each session with an emphasis on aerobic training. During aerobic, balance, and flexibility training, both frail and pre-frail older adults should work at an intensity equivalent to a rating of perceived exertion of 3-4 ("somewhat hard") on the Borg CR10 scale. Resistance-training intensity should be based on a percentage of 1-repetition estimated maximum (1RM). Program onset should occur at 55% of 1RM (endurance) and progress to higher intensities of 80% of 1RM (strength) to maximize functional gains. Exercise is the medicine to reverse or mitigate frailty, preserve quality of life, and restore independent functioning in older adults at risk of frailty.

  16. Theta, time reversal and temperature

    International Nuclear Information System (INIS)

    Gaiotto, Davide; Kapustin, Anton; Komargodski, Zohar; Seiberg, Nathan

    2017-01-01

    SU(N) gauge theory is time reversal invariant at θ=0 and θ=π. We show that at θ=π there is a discrete ’t Hooft anomaly involving time reversal and the center symmetry. This anomaly leads to constraints on the vacua of the theory. It follows that at θ=π the vacuum cannot be a trivial non-degenerate gapped state. (By contrast, the vacuum at θ=0 is gapped, non-degenerate, and trivial.) Due to the anomaly, the theory admits nontrivial domain walls supporting lower-dimensional theories. Depending on the nature of the vacuum at θ=π, several phase diagrams are possible. Assuming area law for space-like loops, one arrives at an inequality involving the temperatures at which CP and the center symmetry are restored. We also analyze alternative scenarios for SU(2) gauge theory. The underlying symmetry at θ=π is the dihedral group of 8 elements. If deconfined loops are allowed, one can have two O(2)-symmetric fixed points. It may also be that the four-dimensional theory around θ=π is gapless, e.g. a Coulomb phase could match the underlying anomalies.

  17. Optimized reversible binary-coded decimal adders

    DEFF Research Database (Denmark)

    Thomsen, Michael Kirkedal; Glück, Robert

    2008-01-01

    Abstract Babu and Chowdhury [H.M.H. Babu, A.R. Chowdhury, Design of a compact reversible binary coded decimal adder circuit, Journal of Systems Architecture 52 (5) (2006) 272-282] recently proposed, in this journal, a reversible adder for binary-coded decimals. This paper corrects and optimizes...... their design. The optimized 1-decimal BCD full-adder, a 13 × 13 reversible logic circuit, is faster, and has lower circuit cost and less garbage bits. It can be used to build a fast reversible m-decimal BCD full-adder that has a delay of only m + 17 low-power reversible CMOS gates. For a 32-decimal (128-bit....... Keywords: Reversible logic circuit; Full-adder; Half-adder; Parallel adder; Binary-coded decimal; Application of reversible logic synthesis...

  18. Kinetic Line Voronoi Operations and Their Reversibility

    DEFF Research Database (Denmark)

    Mioc, Darka; Anton, François; Gold, Christopher

    2010-01-01

    In Geographic Information Systems the reversibility of map update operations has not been explored yet. In this paper we are using the Voronoi based Quad-edge data structure to define reversible map update operations. The reversibility of the map operations has been formalised at the lowest level...... mechanisms and dynamic map visualisations. In order to use the reversibility within the kinetic Voronoi diagram of points and open oriented line segments, we need to assure that reversing the map commands will produce exactly the changes in the map equivalent to the previous map states. To prove...... that reversing the map update operations produces the exact reverse changes, we show an isomorphism between the set of complex operations on the kinetic Voronoi diagram of points and open oriented line segments and the sets of numbers of new / deleted Voronoi regions induced by these operations, and its...

  19. Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

    Directory of Open Access Journals (Sweden)

    David Warrilow

    Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

  20. Mixed-mode chromatography with zwitterionic phosphopeptidomimetic selectors from Ugi multicomponent reaction

    NARCIS (Netherlands)

    Gargano, Andrea F G; Leek, Tomas; Lindner, Wolfgang; Lämmerhofer, Michael

    2013-01-01

    In the present contribution a novel Ugi multicomponent reaction (MCR) was used to generate zwitterionic chromatographic selectors with capability for application in mixed-mode chromatography featuring complementary selectivities in reversed-phase (RP) and hydrophilic interaction liquid

  1. Phosphite radicals and their reactions. Examples of redox, substitution, and addition reactions

    International Nuclear Information System (INIS)

    Schaefer, K.; Asmus, K.D.

    1980-01-01

    Phosphite radicals HPO 3 - and PO 3 2 -, which exist in an acid-base equilibrium with pK = 5.75, are shown to take part in various types of reactions. In the absence of scavengers, they disappear mainly by second-order disproportionation and combination; a first-order contribution to the decay is also indicated. HPO 3 - and PO 3 2 - are good reductants toward electron acceptors such as tetranitromethane. In this reaction phosphate and C(NO 2 ) 3 - are formed. Phosphite radicals can, however, also act as good oxidants, e.g., toward thiols and thiolate ions. These reactions lead to the formation of RS. radicals which were identified either directly, as in the case of penicillamine, through the optical absorption of PenS. or more indirectly through equilibration of RS. with RS- to the optically absorbing RSSR-. disulfide radical anion. A homolytic substitution reaction (S/sub H/2) occurs in the reaction of the phosphite radicals with aliphatic disulfides, yielding RS. radicals and phosphate thioester RSPO 3 2 -. Lipoic acid, as an example of a cyclic disulfide, is reduced to the corresponding RSSR-. radical anion and also undergoes the S/sub H/2 reaction with about equal probability. An addition reaction is observed between phosphite radicals and molecular oxygen. The resulting peroxo phosphate radicals establish an acid-base equilibrium HPO 5 - . reversible PO 5 2- . + H+ with a pK = 3.4. Absolute rate constants were determined for all reactions discussed

  2. Treatment and Managing Reactions

    Science.gov (United States)

    ... of reactions. Learn more here. Milk Egg Peanut Tree Nuts Soy Wheat Fish Shellfish Sesame Other Food ... a severe reaction. Consider wearing an emergency medical identification (e.g., bracelet, other jewelry). What to Read ...

  3. Microfluidic chemical reaction circuits

    Science.gov (United States)

    Lee, Chung-cheng [Irvine, CA; Sui, Guodong [Los Angeles, CA; Elizarov, Arkadij [Valley Village, CA; Kolb, Hartmuth C [Playa del Rey, CA; Huang, Jiang [San Jose, CA; Heath, James R [South Pasadena, CA; Phelps, Michael E [Los Angeles, CA; Quake, Stephen R [Stanford, CA; Tseng, Hsian-rong [Los Angeles, CA; Wyatt, Paul [Tipperary, IE; Daridon, Antoine [Mont-Sur-Rolle, CH

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  4. Preequilibrium Nuclear Reactions

    International Nuclear Information System (INIS)

    Strohmaier, B.

    1988-01-01

    After a survey on existing experimental data on precompound reactions and a description of preequilibrium reactions, theoretical models and quantum mechanical theories of preequilibrium emission are presented. The 25 papers of this meeting are analyzed separately

  5. Managing Your Emotional Reactions

    Science.gov (United States)

    ... Videos for Educators Search English Español Managing Your Emotional Reactions KidsHealth / For Teens / Managing Your Emotional Reactions ... Think about what you might do next time. Emotions 101 The skills we use to manage our ...

  6. Heavy ion transfer reactions

    Indian Academy of Sciences (India)

    array (CLARA), extensive investigations of nuclear structure and reaction dynamics have been carried out. In the present paper aspects of these studies will be presented, focussing more closely on the reaction mechanism, in particular on the ...

  7. Chemical transport reactions

    CERN Document Server

    Schäfer, Harald

    2013-01-01

    Chemical Transport Reactions focuses on the processes and reactions involved in the transport of solid or liquid substances to form vapor phase reaction products. The publication first offers information on experimental and theoretical principles and the transport of solid substances and its special applications. Discussions focus on calculation of the transport effect of heterogeneous equilibria for a gas motion between equilibrium spaces; transport effect and the thermodynamic quantities of the transport reaction; separation and purification of substances by means of material transport; and

  8. Thermally reversible cross-linked poly(ether-urethanes

    Directory of Open Access Journals (Sweden)

    V. Gaina

    2013-07-01

    Full Text Available Cross-linked poly(ether-urethanes were prepared by Diels-Alder (DA reaction of the furan-containing poly(ether-urethane to bismaleimides and showed thermal reversibility evidenced by differential scanning calorimetry and attenuated total reflectance in conjunction with Fourier transform infrared spectroscopy (ATR-FTIR. The furan-containing poly(ether-urethanes were synthesized by the polyaddition reaction of 1,6-hexamethylene diisocyanate (HMDI or 4,4'- dibenzyl diisocyanate (DBDI to poly(tetramethylene ether glycol (PTMEG having Mn = 250, 650, 1000, 1500 and 2000 and 2-[N,N-bis(2-methyl-2-hydroxyethylamino]furfuryl as chain extender by the solution prepolymer method. The molar ratio of isocyanate: PTMEG:chain extender varied from 2:1:1 to 4:1:3, which produces a molar concentration of furyl group ranging between 3.65•10–4 and 1.25•10–3 mol/g.

  9. Symmetry Relations in Chemical Kinetics Arising from Microscopic Reversibility

    Science.gov (United States)

    Adib, Artur B.

    2006-01-01

    It is shown that the kinetics of time-reversible chemical reactions having the same equilibrium constant but different initial conditions are closely related to one another by a directly measurable symmetry relation analogous to chemical detailed balance. In contrast to detailed balance, however, this relation does not require knowledge of the elementary steps that underlie the reaction, and remains valid in regimes where the concept of rate constants is ill defined, such as at very short times and in the presence of low activation barriers. Numerical simulations of a model of isomerization in solution are provided to illustrate the symmetry under such conditions, and potential applications in protein folding or unfolding are pointed out.

  10. Thermonuclear reaction rates. III

    International Nuclear Information System (INIS)

    Harris, M.J.; Fowler, W.A.; Caughlan, G.R.; Zimmerman, B.A.

    1983-01-01

    Stellar thermonuclear reaction rates are revised and updated, adding a number of new important reaction rates. Several reactions with large negative Q-values are included, and examples of them are discussed. The importance of the decay rates for Mg-26(p,n) exp 26 Al and Al-26(n,p) exp 26 Mg for stellar studies is emphasized. 19 references

  11. Maillard Reaction: review

    Directory of Open Access Journals (Sweden)

    Júlia d'Almeida Francisquini

    2017-11-01

    Full Text Available Maillard reaction is an important subject of study in food science and technology and different areas of knowledge are involved such as chemistry, food engineering, nutrition and food technology. The objective of this paper is to present the basic concepts of the Maillard reaction, such as the reaction stages, the main compounds producced and some technological consequences for dairy products.

  12. Resonant thermonuclear reaction rate

    International Nuclear Information System (INIS)

    Haubold, H.J.; Mathai, A.M.

    1986-01-01

    Basic physical principles for the resonant and nonresonant thermonuclear reaction rates are applied to find their standard representations for nuclear astrophysics. Closed-form representations for the resonant reaction rate are derived in terms of Meijer's G-function. Analytic representations of the resonant and nonresonant nuclear reaction rates are compared and the appearance of Meijer's G-function is discussed in physical terms

  13. Reversal of diaschisis by zolpidem

    International Nuclear Information System (INIS)

    Claus, R.P.; Nel, H.W.; Sathekge, M.

    2004-01-01

    Full text: Introduction: Recent literature has reported on clinical improvement after zolpidem, a GABAergic anti insomnia drug, in brain injury and stroke patients. In this study, the effect of zolpidem on crossed cerebellar diaschisis was investigated in such patients. Method: Four patients with crossed cerebellar diaschisis after brain injury or stroke were investigated before and after application of 10 mg zolpidem by 99mTc HMPAO brain SPECT. Result: Apart from clinical improvements, 99mTc HMPAO brain SPECT studies showed reversal of the crossed cerebellar diaschisis and improvement of perfusion defects after zolpidem. Conclusion: 99mTc HMPAO brain SPECT may have a role to pre-select brain injury and stroke patients who will benefit clinically from zolpidem therapy. (author)

  14. Model of reverse steam generator

    International Nuclear Information System (INIS)

    Malasek, V.; Manek, O.; Masek, V.; Riman, J.

    1987-01-01

    The claim of Czechoslovak discovery no. 239272 is a model designed for the verification of the properties of a reverse steam generator during the penetration of water, steam-water mixture or steam into liquid metal flowing inside the heat exchange tubes. The design may primarily be used for steam generators with a built-in inter-tube structure. The model is provided with several injection devices configured in different heat exchange tubes, spaced at different distances along the model axis. The design consists in that between the pressure and the circumferential casings there are transverse partitions and that in one chamber consisting of the circumferential casings, pressure casing and two adjoining partitions there is only one passage of the injection device through the inter-tube space. (Z.M.). 1 fig

  15. Department of Nuclear Reaction - Overview

    International Nuclear Information System (INIS)

    Budzanowski, A.

    2000-01-01

    . Muon catalysed dd fusion in solid deuterium at the temperature 3K was studied using ddμ, formation cross-sections previously calculated. Construction of the Forward Wall detectors for the CHIC collaboration at the CELSIUS Synchrotron is described. First tests of the Phoswich detectors were performed. A new Bragg ionization chamber for studies of spallation reactions induced by cosmic protons was manufactured in collaboration with the Jagiellonian University and tested using light heavy ion beams from the Tandem accelerator in Catania. Coalescence model analysis was applied to explain spectra of light nuclei emitted in heavy ion induced reactions at 47 AMeV. This work was done in collaboration with Texas A and M University and the Jagiellonian University. We have also joined the Brahms collaboration at RHIC. Measurements of the transverse polarization of positrons emitted from the decay of polarized muons were performed in collaboration with ETH Zurich and Paul Scherrer Institute. The aim was to study time reversal invariance of weak interaction. (author)

  16. Random attractors for stochastic lattice reversible Gray-Scott systems with additive noise

    Directory of Open Access Journals (Sweden)

    Hongyan Li

    2015-10-01

    Full Text Available In this article, we prove the existence of a random attractor of the stochastic three-component reversible Gray-Scott system on infinite lattice with additive noise. We use a transformation of addition involved with Ornstein-Uhlenbeck process, for proving the pullback absorbing property and the pullback asymptotic compactness of the reaction diffusion system with cubic nonlinearity.

  17. Reversible structural modulation of Fe-Pt bimetallic surfaces and its effect on reactivity.

    Science.gov (United States)

    Ma, Teng; Fu, Qiang; Su, Hai-Yan; Liu, Hong-Yang; Cui, Yi; Wang, Zhen; Mu, Ren-Tao; Li, Wei-Xue; Bao, Xin-He

    2009-05-11

    Tunable surface: The surface structure of the Fe-Pt bimetallic catalyst can be reversibly modulated between the iron-oxide-rich Pt surface and the Pt-skin structure with subsurface Fe via alternating reduction and oxidation treatments (see figure). The regenerated active Pt-skin structure is active in reactions involving CO and/or O.

  18. Structural features in the HIV-1 repeat region facilitate strand transfer during reverse transcription

    NARCIS (Netherlands)

    Berkhout, B.; Vastenhouw, N. L.; Klasens, B. I.; Huthoff, H.

    2001-01-01

    Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer is facilitated by terminal repeat (R) elements in the viral genome. This strand-transfer reaction depends on base pairing between the cDNA of the 5'R and the 3'R. There

  19. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  20. Versatile Dual Photoresponsive System for Precise Control of Chemical Reactions.

    Science.gov (United States)

    Xu, Can; Bing, Wei; Wang, Faming; Ren, Jinsong; Qu, Xiaogang

    2017-08-22

    A versatile method for photoregulation of chemical reactions was developed through a combination of near-infrared (NIR) and ultraviolet (UV) light sensitive materials. This regulatory effect was achieved through photoresponsive modulation of reaction temperature and pH values, two prominent factors influencing reaction kinetics. Photothermal nanomaterial graphene oxide (GO) and photobase reagent malachite green carbinol base (MGCB) were selected for temperature and pH regulation, respectively. Using nanocatalyst- and enzyme-mediated chemical reactions as model systems, we demonstrated the feasibility and high efficiency of this method. In addition, a photoresponsive, multifunctional "Band-aid"-like hydrogel platform was presented for programmable wound healing. Overall, this simple, efficient, and reversible system was found to be effective for controlling a wide variety of chemical reactions. Our work may provide a method for remote and sustainable control over chemical reactions for industrial and biomedical applications.

  1. Redox reactions of neptunium in tributyl phosphate-dodecane mixtures

    International Nuclear Information System (INIS)

    Wehrey, F.

    1989-01-01

    In relation with the reprocessing of irradiated fuels, disproportionation and oxidation by nitric acid of pentavalent neptunium in tributyl phosphate-dodecane mixtures have been studied. The experimental part of this work is based on spectrophotometric measurements. The disproportionation of pentavalent neptunium in organic perchloric medium is a second order reaction with respect to neptunium V. The reaction rate is strongly influenced by the perchloric acid concentration and has a higher value than in an aqueous medium. The reverse reaction in nitric media is a first order with respect to tetravalent and hexavalent ions. The reaction rate is a function of the reverse of the square of the nitric acid concentration. The energy of activation is the same than in aqueous medium. The oxidation rate of pentavalent neptunium by nitric acid is increased by nitrous acid. When no nitrous acid is added to the mixture, the reaction revealed to be autocatalytic, possesses an induction period. When nitrous and nitric acids are in excess to neptunium the reaction is first order with respect to neptunium. The reaction rate depends on the concentration of nitric acid and is a linear function of the concentration of nitrous acid. In tributyl phosphate dodecane mixtures the reaction occurs spontaneously. It is not the case in aqueous media. The values of thermodynamical and kinetical constants determined in this work could be used in a modelization of the behavior of neptunium in the reprocessing of irradiated fuels, which has to eliminate this element among its tasks [fr

  2. Reversible arithmetic logic unit for quantum arithmetic

    DEFF Research Database (Denmark)

    Thomsen, Michael Kirkedal; Glück, Robert; Axelsen, Holger Bock

    2010-01-01

    This communication presents the complete design of a reversible arithmetic logic unit (ALU) that can be part of a programmable reversible computing device such as a quantum computer. The presented ALU is garbage free and uses reversible updates to combine the standard reversible arithmetic...... and logical operations in one unit. Combined with a suitable control unit, the ALU permits the construction of an r-Turing complete computing device. The garbage-free ALU developed in this communication requires only 6n elementary reversible gates for five basic arithmetic-logical operations on two n......-bit operands and does not use ancillae. This remarkable low resource consumption was achieved by generalizing the V-shape design first introduced for quantum ripple-carry adders and nesting multiple V-shapes in a novel integrated design. This communication shows that the realization of an efficient reversible...

  3. Principles of a reversible programming language

    DEFF Research Database (Denmark)

    Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

    2008-01-01

    The principles of reversible programming languages are explicated and illustrated with reference to the design of a high-level imperative language, Janus. The fundamental properties for such languages include backward as well as forward determinism and reversible updates of data. The unique design...... languages, and demonstrate this for Janus. We show the practicality of the language by implementation of a reversible fast Fourier transform. Our results indicate that the reversible programming paradigm has fundamental properties that are relevant to many different areas of computer science....... features of the language include explicit post-condition assertions, direct access to an inverse semantics and the possibility of clean (i.e., garbage-free) computation of injective functions. We suggest the clean simulation of reversible Turing machines as a criterion for computing strength of reversible...

  4. Insights into the mechanisms on chemical reactions: reaction paths for chemical reactions

    International Nuclear Information System (INIS)

    Dunning, T.H. Jr.; Rosen, E.; Eades, R.A.

    1987-01-01

    We report reaction paths for two prototypical chemical reactions: Li + HF, an electron transfer reaction, and OH + H 2 , an abstraction reaction. In the first reaction we consider the connection between the energetic terms in the reaction path Hamiltonian and the electronic changes which occur upon reaction. In the second reaction we consider the treatment of vibrational effects in chemical reactions in the reaction path formalism. 30 refs., 9 figs

  5. Securing Biometric Images using Reversible Watermarking

    OpenAIRE

    Thampi, Sabu M.; Jacob, Ann Jisma

    2011-01-01

    Biometric security is a fast growing area. Protecting biometric data is very important since it can be misused by attackers. In order to increase security of biometric data there are different methods in which watermarking is widely accepted. A more acceptable, new important development in this area is reversible watermarking in which the original image can be completely restored and the watermark can be retrieved. But reversible watermarking in biometrics is an understudied area. Reversible ...

  6. Solar energy powered microbial fuel cell with a reversible bioelectrode.

    Science.gov (United States)

    Strik, David P B T B; Hamelers, Hubertus V M; Buisman, Cees J N

    2010-01-01

    The solar energy powered microbial fuel cell is an emerging technology for electricity generation via electrochemically active microorganisms fueled by solar energy via in situ photosynthesized metabolites from algae, cyanobacteria, or living higher plants. A general problem with microbial fuel cells is the pH membrane gradient which reduces cell voltage and power output. This problem is caused by acid production at the anode, alkaline production at the cathode, and the nonspecific proton exchange through the membrane. Here we report a solution for a new kind of solar energy powered microbial fuel cell via development of a reversible bioelectrode responsible for both biocatalyzed anodic and cathodic electron transfer. Anodic produced protons were used for the cathodic reduction reaction which held the formation of a pH membrane gradient. The microbial fuel cell continuously generated electricity and repeatedly reversed polarity dependent on aeration or solar energy exposure. Identified organisms within biocatalyzing biofilm of the reversible bioelectrode were algae, (cyano)bacteria and protozoa. These results encourage application of solar energy powered microbial fuel cells.

  7. Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.

    Science.gov (United States)

    Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui

    2017-07-05

    Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.

  8. Chemical-looping combustion in a reverse-flow fixed bed reactor

    International Nuclear Information System (INIS)

    Han, Lu; Bollas, George M.

    2016-01-01

    A reverse-flow fixed bed reactor concept for CLC (chemical-looping combustion) is explored. The limitations of conventional fixed bed reactors, as applied to CLC, are overcome by reversing the gas flow direction periodically to enhance the mixing characteristics of the bed, thus improving oxygen carrier utilization and energy efficiency with respect to power generation. The reverse-flow reactor is simulated by a dusty-gas model and compared with an equivalent fixed bed reactor without flow reversal. Dynamic optimization is used to calculate conditions at which each reactor operates at maximum energy efficiency. Several cases studies illustrate the benefits of reverse-flow operation for the CLC with CuO and NiO oxygen carriers and methane and syngas fuels. The results show that periodic reversal of the flow during reduction improves the contact between the fuel and unconverted oxygen carrier, enabling the system to suppress unwanted catalytic reactions and axial temperature and conversion gradients. The operational scheme presented reduces the fluctuations of temperature during oxidation and increases the high-temperature heat produced by the process. CLC in a reverse-flow reactor has the potential to achieve higher energy efficiency than conventional fixed bed CLC reactors, when integrated with a downstream gas turbine of a combined cycle power plant. - Highlights: • Reverse-flow fixed bed CLC reactors for combined cycle power systems. • Dynamic optimization tunes operation of batch and transient CLC systems. • The reverse-flow CLC system provides stable turbine-ready gas stream. • Reverse-flow CLC fixed bed reactor has superior CO 2 capture and thermal efficiency.

  9. Combining or Separating Forward and Reverse Logistics

    DEFF Research Database (Denmark)

    Herbert-Hansen, Zaza Nadja Lee; Larsen, Samuel; Nielsen, Anders

    2018-01-01

    Purpose – While forward logistics handles and manages the flow of goods downstream in the supply chain from suppliers to customers, reverse logistics (RL) manages the flow of returned goods upstream. A firm can combine reverse logistics with forward logistics, keep the flows separated, or choose......-research addresses intra-RL issues while the relationship between forward and reverse logistics is under-researched. This paper contributes to RL-theory by identifying the contextual factors that determine the most advantageous relationship between forward and reverse logistics, and proposes a novel decision making...

  10. Reversible dementia: The imitation game

    Directory of Open Access Journals (Sweden)

    Venugopalan Y Vishnu

    2016-10-01

    Full Text Available Rapidly progressive dementia (RPD is an emergency in behavioural or cognitive neurology. Many rare neuroinfections like Neurosyphilis may be missed, if they are not thoroughly evaluated. We report a patient with subacute onset and progressive cognitive decline, extrapyramidal involvement and myoclonic jerks who was initially suspected as probable autoimmune encephalitis or Creutzfeldt-Jakob disease (CJD. Investigations revealed positive serum and cerebrospinal fluid (CSF Venereal Disease Research Laboratory test (VDRL. On treatment with penicillin, he developed Jarisch-Herxheimer reaction and was treated symptomatically. After two weeks of penicillin, he improved significantly and except for mild short term memory recall, he is asymptomatic for last two years.

  11. Reversible S-nitrosylation in an engineered azurin

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Shiliang; Liu, Jing; Cowley, Ryan E.; Hosseinzadeh, Parisa; Marshall, Nicholas M.; Yu, Yang; Robinson, Howard; Nilges, Mark J.; Blackburn, Ninian J.; Solomon, Edward I.; Lu, Yi

    2016-04-25

    S-Nitrosothiols are known as reagents for NO storage and transportation and as regulators in many physiological processes. Although the S-nitrosylation catalysed by haem proteins is well known, no direct evidence of S-nitrosylation in copper proteins has been reported. Here, we report reversible insertion of NO into a copper–thiolate bond in an engineered copper centre in Pseudomonas aeruginosa azurin by rational design of the primary coordination sphere and tuning its reduction potential by deleting a hydrogen bond in the secondary coordination sphere. The results not only provide the first direct evidence of S-nitrosylation of Cu(II)-bound cysteine in metalloproteins, but also shed light on the reaction mechanism and structural features responsible for stabilizing the elusive Cu(I)–S(Cys)NO species. The fast, efficient and reversible S-nitrosylation reaction is used to demonstrate its ability to prevent NO inhibition of cytochrome bo3 oxidase activity by competing for NO binding with the native enzyme under physiologically relevant conditions.

  12. Characterizing multistationarity regimes in biochemical reaction networks.

    Directory of Open Access Journals (Sweden)

    Irene Otero-Muras

    Full Text Available Switch like responses appear as common strategies in the regulation of cellular systems. Here we present a method to characterize bistable regimes in biochemical reaction networks that can be of use to both direct and reverse engineering of biological switches. In the design of a synthetic biological switch, it is important to study the capability for bistability of the underlying biochemical network structure. Chemical Reaction Network Theory (CRNT may help at this level to decide whether a given network has the capacity for multiple positive equilibria, based on their structural properties. However, in order to build a working switch, we also need to ensure that the bistability property is robust, by studying the conditions leading to the existence of two different steady states. In the reverse engineering of biological switches, knowledge collected about the bistable regimes of the underlying potential model structures can contribute at the model identification stage to a drastic reduction of the feasible region in the parameter space of search. In this work, we make use and extend previous results of the CRNT, aiming not only to discriminate whether a biochemical reaction network can exhibit multiple steady states, but also to determine the regions within the whole space of parameters capable of producing multistationarity. To that purpose we present and justify a condition on the parameters of biochemical networks for the appearance of multistationarity, and propose an efficient and reliable computational method to check its satisfaction through the parameter space.

  13. Confining Domains Lead to Reaction Bursts: Reaction Kinetics in the Plasma Membrane

    Science.gov (United States)

    Kalay, Ziya; Fujiwara, Takahiro K.; Kusumi, Akihiro

    2012-01-01

    Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity. PMID:22479350

  14. Confining domains lead to reaction bursts: reaction kinetics in the plasma membrane.

    Directory of Open Access Journals (Sweden)

    Ziya Kalay

    Full Text Available Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity.

  15. Leprosy reactions in postelimination stage: the Bangladesh experience.

    Science.gov (United States)

    Mowla, M R; Ara, S; Mizanur Rahman, A F M; Tripura, S P; Paul, S

    2017-04-01

    Leprosy reactions are immunologically mediated conditions and a major cause of disability before, during and after multidrug therapy (MDT). Little data have been published on the epidemiology of leprosy reactions in Bangladesh. To describe the pattern and prevalence of leprosy reactions in the postelimination stage. A descriptive retrospective cross-sectional study was carried out in Chittagong Medical College Hospital using the registered records of patients in the period between 2004 and 2013. Of the 670 patients with leprosy, 488 (73.38%) were males and 182 (27.37%) were females. The prevalence of reaction was in 300 (44.78%) patients with a male:female ratio of 3.55 : 1. The age-specific cumulative reaction cases at >40 years were 115 (38.33%) among all age groups. The prevalence of reaction was found to be in 166 (55.33%) patients for the reversal reaction, 49 (16.57%) for the erythema nodosum leprosum (ENL) and 85 (28.33%) for the neuritis. Borderline tuberculoid was most common (106, 35.33%)in the reversal reaction group, while lepromatous leprosy was most common (37, 12.33%) in ENL group. More than half of the patients (169, 56.33%) had reactions at the time of presentations, while 85 (28.33%) and 46 (15.33%) patients developed reaction during and after MDT, respectively. The reversal reaction group presented with ≥six skin lesions in 96 (57.83%) patients and ≥two nerve function impairments (NFIs) in 107 (64.46%) patients. The ENL was present chiefly as papulo-nodular lesions in 45 (91.84%) patients followed by pustule-necrotic lesions in four (8.16%), neuritis in 33 (67.35%), fever in 24 (48.98%), lymphadenitis in six (12.24%), arthritis in five (10.20%) and iritis in two (4.08%). Bacterial index ≥3 had been demonstrated in 34 (60.71%) patients in ENL group. The incidence of leprosy reaction seemed to be more than three times common in borderline tuberculoid (52.33%) group than in lepromatous leprosy (14%) group. Reactions with NFI and disability

  16. Factors involved in the paradox of reverse epidemiology.

    Science.gov (United States)

    Martín-Ponce, Esther; Santolaria, Francisco; Alemán-Valls, María-Remedios; González-Reimers, Emilio; Martínez-Riera, Antonio; Rodríguez-Gaspar, Melchor; Rodríguez-Rodríguez, Eva

    2010-08-01

    The hypothesis of reverse epidemiology holds that some cardiovascular risk factors, such as obesity, hypercholesterolemia and hypertension, in the elderly or in some chronic diseases are not harmful but permit better survival. However, this phenomenon is controversial and the underlying reasons are poorly understood. To search for factors simultaneously linked to reverse epidemiology and to short or long term survival. We included 400 patients, older than 60 years, hospitalized in a general internal medicine unit; 61 died in hospital and 338 were followed up by telephone. Obesity, higher blood pressure and serum cholesterol, besides being related to lower mortality both in hospital and after discharge, were associated with better nutrition and functional capacity, less intense acute phase reaction and organ dysfunction, and lower incidence of high-mortality diseases such as dementia, pneumonia, sepsis or cancer. These associations may explain why obesity and other reverse epidemiology data are inversely related to mortality. Weight loss was related to mortality independently of BMI. Patients with BMI under 30 kg/m(2) who died in hospital showed more weight loss than those who survived; the lower the BMI, the greater the weight loss. In contrast, patients with BMI over 30 kg/m(2) who died in hospital gained more weight than those who survived; the higher the BMI, the greater the weight gain. In patients over 60 years of age admitted to an internal medicine ward, obesity did not show independent survival value, being displaced by other nutritional parameters, functional capacity, acute phase reaction, organ dysfunction and diseases with poor prognosis. Copyright 2009 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  17. Time reversal and the neutron

    International Nuclear Information System (INIS)

    Chupp, T. E.; Cooper, R. L.; Coulter, K. P.; Freedman, S. J.; Fujikawa, B. K.; Jones, G. L.; Garcia, A.; Mumm, H. P.; Nico, J. S.; Thompson, A. K.; Trull, C.; Wietfeldt, F. E.; Wilkerson, J. F.

    2013-01-01

    We have measured the triple correlation D n >/J n ·(β e x p-hat ν ) with a polarized cold-neutron beam (Mumm et al., Phys Rev Lett 107:102301, 2011; Chupp et al., Phys Rev C 86:035505, 2012). A non-zero value of D can arise due to parity-even-time-reversal-odd interactions that imply CP violation. Final-state effects also contribute to D at the level of 10  − 5 and can be calculated with precision of 1 % or better. The D coefficient is uniquely sensitive to the imaginary part of the ratio of axial-vector and vector beta-decay amplitudes as well as to scalar and tensor interactions that could arise due to beyond-Standard-Model physics. Over 300 million proton-electron coincidence events were used in a blind analysis with the result D = [ − 0.94±1.89 (stat)±0.97(sys)]×10  − 4 . Assuming only vector and axial vector interactions in beta decay, our result can be interpreted as a measure of the phase of the axial-vector coupling relative to the vector coupling, φ AV = 180.012 ° ± 0.028 °. This result also improves constrains on certain non-VA interactions.

  18. Reverse transcriptase inhibitors as microbicides.

    Science.gov (United States)

    Lewi, Paul; Heeres, Jan; Ariën, Kevin; Venkatraj, Muthusamy; Joossens, Jurgen; Van der Veken, Pieter; Augustyns, Koen; Vanham, Guido

    2012-01-01

    The CAPRISA 004 study in South Africa has accelerated the development of vaginal and rectal microbicides containing antiretrovirals that target specific enzymes in the reproduction cycle of HIV, especially reverse transcriptase inhibitors (RTI). In this review we discuss the potential relevance of HIV-1 RTIs as microbicides, focusing in the nucleotide RTI tenofovir and six classes of nonnucleoside RTIs (including dapivirine, UC781, urea and thiourea PETTs, DABOs and a pyrimidinedione). Although tenofovir and dapivirine appear to be most advanced in clinical trials as potential microbicides, several issues remain unresolved, e.g., the importance of nonhuman primates as a "gatekeeper" for clinical trials, the emergence and spread of drug-resistant mutants, the combination of microbicides that target different phases of viral reproduction and the accessibility to microbicides in low-income countries. Thus, here we discuss the latest research on RTI as microbicides in the light of the continuing spread of the HIV pandemic from the point of view of medicinal chemistry, virological, and pharmaceutical studies.

  19. Reversible hypothyroidism and Whipple's disease

    Directory of Open Access Journals (Sweden)

    Tran Huy A

    2006-05-01

    Full Text Available Abstract Background The major cause of primary hypothyroidism is autoimmune mediated with progressive and permanent destruction of the thyroid gland resulting in life-long replacement therapy. Treatable and reversible hypothyroidism is unusual and here forth is such a case due to infection of the thyroid gland with Tropheryma whippleii, Whipple disease. Case presentation A 45 year-old female presented with symptoms and signs consistent with primary hypothyroidism, which was also confirmed biochemically. Her response to thyroxine replacement therapy was poor however, requiring a significantly elevated amount. Further investigation revealed the presence of Whipple's disease involving the gastrointestinal trace and possibly the thyroid gland. Her thyroxine requirement decreased drastically following appropriate antimicrobial therapy for Whipple's disease to the extent that it was ceased. Thyrotropin releasing hormone testing in the steady state suggested there was diminished thyroid reserve due to Whipple's disease. Conclusion This is the first ante-mortem case report studying the possible involvement of the thyroid gland by Whipple's disease. Despite the normalization of her thyroid function test biochemically after antibiotic therapy, there is diminished thyroid reserve thus requiring close and regular monitoring.

  20. Time reversal and the neutron

    Energy Technology Data Exchange (ETDEWEB)

    Chupp, T. E., E-mail: chupp@umich.edu; Cooper, R. L.; Coulter, K. P. [Univeristy of Michigan (United States); Freedman, S. J.; Fujikawa, B. K. [University of California and Lawrence Berkeley Laboratory (United States); Jones, G. L. [Hamilton College (United States); Garcia, A. [University of Washington (United States); Mumm, H. P.; Nico, J. S.; Thompson, A. K. [National Institute of Standards and Technology (United States); Trull, C.; Wietfeldt, F. E. [Tulane University (United States); Wilkerson, J. F. [University of North Carolina (United States); Collaboration: emiT II Collaboration

    2013-03-15

    We have measured the triple correlation D/J{sub n}{center_dot}({beta}{sub e} x p-hat{sub {nu}}) with a polarized cold-neutron beam (Mumm et al., Phys Rev Lett 107:102301, 2011; Chupp et al., Phys Rev C 86:035505, 2012). A non-zero value of D can arise due to parity-even-time-reversal-odd interactions that imply CP violation. Final-state effects also contribute to D at the level of 10{sup - 5} and can be calculated with precision of 1 % or better. The D coefficient is uniquely sensitive to the imaginary part of the ratio of axial-vector and vector beta-decay amplitudes as well as to scalar and tensor interactions that could arise due to beyond-Standard-Model physics. Over 300 million proton-electron coincidence events were used in a blind analysis with the result D = [ - 0.94{+-}1.89 (stat){+-}0.97(sys)] Multiplication-Sign 10{sup - 4}. Assuming only vector and axial vector interactions in beta decay, our result can be interpreted as a measure of the phase of the axial-vector coupling relative to the vector coupling, {phi}{sub AV} = 180.012 Degree-Sign {+-} 0.028 Degree-Sign . This result also improves constrains on certain non-VA interactions.

  1. Relationship between thermodynamic driving force and one-way fluxes in reversible processes.

    Directory of Open Access Journals (Sweden)

    Daniel A Beard

    Full Text Available Chemical reaction systems operating in nonequilibrium open-system states arise in a great number of contexts, including the study of living organisms, in which chemical reactions, in general, are far from equilibrium. Here we introduce a theorem that relates forward and reverse fluxes and free energy for any chemical process operating in a steady state. This relationship, which is a generalization of equilibrium conditions to the case of a chemical process occurring in a nonequilibrium steady state in dilute solution, provides a novel equivalent definition for chemical reaction free energy. In addition, it is shown that previously unrelated theories introduced by Ussing and Hodgkin and Huxley for transport of ions across membranes, Hill for catalytic cycle fluxes, and Crooks for entropy production in microscopically reversible systems, are united in a common framework based on this relationship.

  2. Noncanonical Reactions of Flavoenzymes

    Directory of Open Access Journals (Sweden)

    Pablo Sobrado

    2012-11-01

    Full Text Available Enzymes containing flavin cofactors are predominantly involved in redox reactions in numerous cellular processes where the protein environment modulates the chemical reactivity of the flavin to either transfer one or two electrons. Some flavoenzymes catalyze reactions with no net redox change. In these reactions, the protein environment modulates the reactivity of the flavin to perform novel chemistries. Recent mechanistic and structural data supporting novel flavin functionalities in reactions catalyzed by chorismate synthase, type II isopentenyl diphosphate isomerase, UDP-galactopyranose mutase, and alkyl-dihydroxyacetonephosphate synthase are presented in this review. In these enzymes, the flavin plays either a direct role in acid/base reactions or as a nucleophile or electrophile. In addition, the flavin cofactor is proposed to function as a “molecular scaffold” in the formation of UDP-galactofuranose and alkyl-dihydroxyacetonephosphate by forming a covalent adduct with reaction intermediates.

  3. Dynamical barrier and isotope effects in the simplest substitution reaction via Walden inversion mechanism

    Science.gov (United States)

    Zhao, Zhiqiang; Zhang, Zhaojun; Liu, Shu; Zhang, Dong H.

    2017-02-01

    Reactions occurring at a carbon atom through the Walden inversion mechanism are one of the most important and useful classes of reactions in chemistry. Here we report an accurate theoretical study of the simplest reaction of that type: the H+CH4 substitution reaction and its isotope analogues. It is found that the reaction threshold versus collision energy is considerably higher than the barrier height. The reaction exhibits a strong normal secondary isotope effect on the cross-sections measured above the reaction threshold, and a small but reverse secondary kinetic isotope effect at room temperature. Detailed analysis reveals that the reaction proceeds along a path with a higher barrier height instead of the minimum-energy path because the umbrella angle of the non-reacting methyl group cannot change synchronously with the other reaction coordinates during the reaction due to insufficient energy transfer from the translational motion to the umbrella mode.

  4. Nuclear reaction studies

    International Nuclear Information System (INIS)

    Alexander, J.M.; Lacey, R.A.

    1994-01-01

    Research focused on the statistical and dynamical properties of ''hot'' nuclei formed in symmetric heavy-ion reactions. Theses included ''flow'' measurements and the mechanism for multifragment disassembly. Model calculations are being performed for the reactions C+C, Ne+Al, Ar+Sc, Kr+Nb, and Xe+La. It is planned to study 40 Ar reactions from 27 to 115 MeV/nucleon. 2 figs., 41 refs

  5. Knock-out reactions

    International Nuclear Information System (INIS)

    de Forest, T. Jr.

    1977-01-01

    It is pointed out that the primary motivation for performing high energy single nucleon knock-out reactions is based on the concept of quasi-elastic scattering. The validity of and corrections to the partial wave impulse approximation and kinematical invariance of knock-out reactions and tests of the reaction mechanism are treated. The effect of distortions on the momentum distribution in the effective momentum approximation for given parameters are plotted. 12 references

  6. Reaction kinetics of polybutylene terephthalate polycondensation reaction

    NARCIS (Netherlands)

    Darda, P. J.; Hogendoorn, J. A.; Versteeg, G. F.; Souren, F.

    2005-01-01

    The kinetics of the forward polycondensation reaction of polybutylene terephthalate (PBT) has been investigated using thermogravimetric analysis (TGA). PBT - prepolymer with an initial degree of polymerization of 5.5 was used as starting material. The PBT prepolymer was prepared from dimethyl

  7. Multiple reversal olfactory learning in honeybees

    Directory of Open Access Journals (Sweden)

    Theo Mota

    2010-07-01

    Full Text Available In multiple reversal learning, animals trained to discriminate a reinforced from a non-reinforced stimulus are subjected to various, successive reversals of stimulus contingencies (e.g. A+ vs. B-, A- vs. B+, A+ vs. B-. This protocol is useful to determine whether or not animals learn to learn and solve successive discriminations faster (or with fewer errors with increasing reversal experience. Here we used the olfactory conditioning of proboscis extension reflex to study how honeybees Apis mellifera perform in a multiple reversal task. Our experiment contemplated four consecutive differential conditioning phases involving the same odors (A+ vs. B- to A- vs. B+ to A+ vs. B- to A- vs. B+. We show that bees in which the weight of reinforced or non-reinforced stimuli was similar mastered the multiple olfactory reversals. Bees which failed the task exhibited asymmetric responses to reinforced and non-reinforced stimuli, thus being unable to rapidly reverse stimulus contingencies. Efficient reversers did not improve their successive discriminations but rather tended to generalize their choice to both odors at the end of conditioning. As a consequence, both discrimination and reversal efficiency decreasedalong experimental phases. This result invalidates a learning-to-learn effect and indicates that bees do not only respond to the actual stimulus contingencies but rather combine these with an average of past experiences with the same stimuli.  

  8. Online Reverse Auctions for Procurement of Services

    NARCIS (Netherlands)

    U.L. Radkevitch (Uladzimir)

    2008-01-01

    textabstractOnline reverse auctions, in which a buyer seeks to select a supplier and suppliers compete for contracts by bidding online, revolutionized corporate procurement early this century. Shortly after they had been pioneered by General Electric, many companies rushed to adopt reverse auctions

  9. Vibrational dynamics of ice in reverse micelles

    NARCIS (Netherlands)

    Dokter, A.M.; Petersen, C.; Woutersen, S.; Bakker, H.J.

    2008-01-01

    he ultrafast vibrational dynamics of HDO:D2O ice at 180 K in anionic reverse micelles is studied by midinfrared femtosecond pump-probe spectroscopy. Solutions containing reverse micelles are cooled to low temperatures by a fast-freezing procedure. The heating dynamics of the micellar solutions is

  10. Reversible logic gates on Physarum Polycephalum

    International Nuclear Information System (INIS)

    Schumann, Andrew

    2015-01-01

    In this paper, we consider possibilities how to implement asynchronous sequential logic gates and quantum-style reversible logic gates on Physarum polycephalum motions. We show that in asynchronous sequential logic gates we can erase information because of uncertainty in the direction of plasmodium propagation. Therefore quantum-style reversible logic gates are more preferable for designing logic circuits on Physarum polycephalum

  11. Magnetic reversals from planetary dynamo waves.

    Science.gov (United States)

    Sheyko, Andrey; Finlay, Christopher C; Jackson, Andrew

    2016-11-24

    A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a magnetohydrodynamic process that takes place in Earth's core, but the precise mechanism is debated. The majority of numerical geodynamo simulations that exhibit reversals operate in a regime in which the viscosity of the fluid remains important, and in which the dynamo mechanism primarily involves stretching and twisting of field lines by columnar convection. Here we present an example of another class of reversing-geodynamo model, which operates in a regime of comparatively low viscosity and high magnetic diffusivity. This class does not fit into the paradigm of reversal regimes that are dictated by the value of the local Rossby number (the ratio of advection to Coriolis force). Instead, stretching of the magnetic field by a strong shear in the east-west flow near the imaginary cylinder just touching the inner core and parallel to the axis of rotation is crucial to the reversal mechanism in our models, which involves a process akin to kinematic dynamo waves. Because our results are relevant in a regime of low viscosity and high magnetic diffusivity, and with geophysically appropriate boundary conditions, this form of dynamo wave may also be involved in geomagnetic reversals.

  12. Reverse engineering of the robot base platform

    International Nuclear Information System (INIS)

    Anwar A Rahman; Azizul Rahman A Aziz; Mohd Arif Hamzah; Muhd Nor Atan; Fadil Ismail; Rosli Darmawan

    2009-01-01

    The robot base platform used to place the robotic arm version 2 was imported through a local company. The robot base platform is used as a reference for reverse egineering development for a smaller size robot. The paper will discuss the reverse engineering design process and parameters involved in the development of the robot base platform. (Author)

  13. Reverse logistics: A review of case studies

    NARCIS (Netherlands)

    Brito, de M.P.; Dekker, Rommert; Flapper, S.D.P.; Fleischmann, B.; Klose, A.

    2004-01-01

    This paper gives an overview of scientific literature that describes and discusses cases of reverse logistics activities in practice. Over sixty case studies are considered. Based on these studies we are able to indicate critical factors for the practice of reverse logistics. In addition we compare

  14. Reversal of laryngotracheal separation in paediatric patients.

    LENUS (Irish Health Repository)

    Young, Orla

    2012-02-01

    OBJECTIVE: Laryngotracheal separation (LTS) is an effective and reliable definitive treatment for intractable aspiration. A major advantage of this treatment for intractable aspiration is its\\' potential reversibility. Should the underlying disorder improve, a reversal of the procedure may be attempted. This has been successfully achieved in the adult population. To our knowledge, no previous cases have been reported of successful reversal of LTS in children. METHODS: A retrospective review from 2003 to 2010 identified four cases of intractable aspiration treated with LTS in our department. Two of these patients displayed objective evidence of sufficient recovery of their underlying aspiration to consider reversal. Patient selection for reversal was dependent upon successful oral intake for 9 months along with videofluoroscopic evidence of normal or minimally impaired swallow. RESULTS: Two children who were successfully treated for intractable aspiration with LTS demonstrated objective evidence of recovery sufficient to attempt reversal. Both children underwent successful surgical reversal of LTS using a cricotracheal resection with end-to-end anastamosis, similar to that used in treatment of subglottic stenosis. Both children can now tolerate oral diet and their speech and language development is in line with their overall developmental level. CONCLUSIONS: Laryngotracheal separation is an effective and reliable definitive treatment for intractable aspiration facilitating protection of the airway and allowing safe swallowing with unimpeded respiration, but with the major drawback of loss of phonation. To our knowledge, we document the first two cases of successful LTS reversal in children.

  15. Observation of the reversed current effect

    International Nuclear Information System (INIS)

    Jones, I.R.; Silawatshananai, C.

    1979-05-01

    The paper describes an observation of the reversed current effect, and its consequences, in a 'stabilized' Z-pinch. Magnetic probe measurements and holographic interferometry were used to follow the development of a reversed current layer and to pinpoint its location in the outer region of the pinched plasma column. The subsequent ejection of the outer plasma layer was observed using fast photography

  16. Magnetic reversals from planetary dynamo waves

    DEFF Research Database (Denmark)

    Sheyko, Andrey; Finlay, Chris; Jackson, Andrew

    2016-01-01

    A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a magnetohydrodynamic process that takes ...... to kinematic dynamo waves. Because our results are relevant in a regime of low viscosity and high magnetic diffusivity, and with geophysically appropriate boundary conditions, this form of dynamo wave may also be involved in geomagnetic reversals.......A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a magnetohydrodynamic process that takes...... place in Earth's core, but the precise mechanism is debated. The majority of numerical geodynamo simulations that exhibit reversals operate in a regime in which the viscosity of the fluid remains important, and in which the dynamo mechanism primarily involves stretching and twisting of field lines...

  17. Kronisk ileus efter iatrogen reversering af tyndtarmen

    DEFF Research Database (Denmark)

    Pedersen, Mark Ellebaek; Rahr, Hans B; Mahdi, Bassam

    2010-01-01

    We report a case of inadvertent reversal of the entire small intestine leading to severe complications and long-standing ileus. The clinical diagnosis was confirmed by magnetic resonance imaging and laparotomy. The patient was cured by surgical re-reversal of the bowel. Care should be taken to ma...... the bowel ends when multiple simultaneous bowel resections are performed....

  18. Probabilistic Reversible Automata and Quantum Automata

    OpenAIRE

    Golovkins, Marats; Kravtsev, Maksim

    2002-01-01

    To study relationship between quantum finite automata and probabilistic finite automata, we introduce a notion of probabilistic reversible automata (PRA, or doubly stochastic automata). We find that there is a strong relationship between different possible models of PRA and corresponding models of quantum finite automata. We also propose a classification of reversible finite 1-way automata.

  19. Thermonuclear reaction listing

    International Nuclear Information System (INIS)

    Fukai, Yuzo

    1993-01-01

    The following 10 elements, including T, are well known as nuclear fusion fuels: p, D, T, 3 He, 4 He, 6 Li, 7 Li, 9 Be, 10 B, 11 B, ( 12 C, 13 C), where 12 C and 13 C are considered only in the calculation of Q value. Accordingly the number of the thermonuclear reactions is 55, and 78, if including carbon elements. The reactions have some branches. For the branches having two and three reaction products, the reaction products, Q value and threshold energy are calculated by using a computer. We have investigated those of the branches having more than three products from the papers of Ajzenberg-Selove and so on. And also, by the same papers, we check whether the above mentioned branch has been observed or not. The results are as follows: (I) the number of reactions which have Q 0 branches only with γ ray production, and Q 0 and neutron production is 36(17), and (IV) that of reactions whose branch with Q > 0 does not produce neutrons is 9(3). The value in the parentheses shows the number of the case of the carbon elements. For 55 thermonuclear reactions induced by lighter nuclides than 11 B, the reaction products, the values of Q and threshold energy, and the papers with reaction cross section data are presented in the tables. (author)

  20. Sleeve reaction chamber system

    Science.gov (United States)

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  1. Tattoo reaction: Case series

    Directory of Open Access Journals (Sweden)

    Muneer Mohamed

    2018-04-01

    Full Text Available Tattoo is going to be a very common practice especially among young people and we are witnessing a gradual increase of numerous potential complications to tattoo placement which are often seen by physicians, but generally unknown to the public. The most common skin reactions to tattoo include a transient acute inflammatory reaction due to trauma of the skin with needles and medical complications such as superficial and deep local infections, systemic infections, allergic contact dermatitis, photodermatitis, granulomatous and lichenoid reactions, and skin diseases localized on tattooed area (eczema, psoriasis, lichen, and morphea. In this series we present three cases of tattoo reaction.

  2. Rapid Hydrogen Shift Reactions in Acyl Peroxy Radicals

    DEFF Research Database (Denmark)

    Knap, Hasse Christian; Jørgensen, Solvejg

    2017-01-01

    -shift with X = 6, 7, 8, or 9) in the hydroperoxy acyl peroxy radicals, this H-shift is a reversible reaction and it scrambles between two peroxides, hydroperoxy acyl peroxy and peroxy peroxoic acid radicals. The forward reaction rate constants of the 1,X-OOH H-shift reactions are estimated to be above 103 s–1...... with transition state theory corrected with Eckart quantum tunnelling correction. The ratio between the forward and reverse reaction rate constant of the 1,X-OOH H-shift reactions is around ∼105. Therefore, the equilibrium is pushed toward the production of peroxy peroxoic acid radicals. These very fast 1,X-OOH H......We have used quantum mechanical chemical calculations (CCSD(T)-F12a/cc-pVDZ-F12//M06-2X/aug-cc-pVTZ) to investigate the hydrogen shift (H-shift) reactions in acyl peroxy and hydroperoxy acyl peroxy radicals. We have focused on the H-shift reactions from a hydroperoxy group (OOH) (1,X-OOH H...

  3. Designing Novel Quaternary Quantum Reversible Subtractor Circuits

    Science.gov (United States)

    Haghparast, Majid; Monfared, Asma Taheri

    2018-01-01

    Reversible logic synthesis is an important area of current research because of its ability to reduce energy dissipation. In recent years, multiple valued logic has received great attention due to its ability to reduce the width of the reversible circuit which is a main requirement in quantum technology. Subtractor circuits are between major components used in quantum computers. In this paper, we will discuss the design of a quaternary quantum reversible half subtractor circuit using quaternary 1-qudit, 2-qudit Muthukrishnan-Stroud and 3-qudit controlled gates and a 2-qudit Generalized quaternary gate. Then a design of a quaternary quantum reversible full subtractor circuit based on the quaternary half subtractor will be presenting. The designs shall then be evaluated in terms of quantum cost, constant input, garbage output, and hardware complexity. The proposed quaternary quantum reversible circuits are the first attempt in the designing of the aforementioned subtractor.

  4. Parkinson’s disease managing reversible neurodegeneration

    Science.gov (United States)

    Hinz, Marty; Stein, Alvin; Cole, Ted; McDougall, Beth; Westaway, Mark

    2016-01-01

    Traditionally, the Parkinson’s disease (PD) symptom course has been classified as an irreversible progressive neurodegenerative disease. This paper documents 29 PD and treatment-induced systemic depletion etiologies which cause and/or exacerbate the seven novel primary relative nutritional deficiencies associated with PD. These reversible relative nutritional deficiencies (RNDs) may facilitate and accelerate irreversible progressive neurodegeneration, while other reversible RNDs may induce previously undocumented reversible pseudo-neurodegeneration that is hiding in plain sight since the symptoms are identical to the symptoms being experienced by the PD patient. Documented herein is a novel nutritional approach for reversible processes management which may slow or halt irreversible progressive neurodegenerative disease and correct reversible RNDs whose symptoms are identical to the patient’s PD symptoms. PMID:27103805

  5. Estimation and uncertainty of reversible Markov models.

    Science.gov (United States)

    Trendelkamp-Schroer, Benjamin; Wu, Hao; Paul, Fabian; Noé, Frank

    2015-11-07

    Reversibility is a key concept in Markov models and master-equation models of molecular kinetics. The analysis and interpretation of the transition matrix encoding the kinetic properties of the model rely heavily on the reversibility property. The estimation of a reversible transition matrix from simulation data is, therefore, crucial to the successful application of the previously developed theory. In this work, we discuss methods for the maximum likelihood estimation of transition matrices from finite simulation data and present a new algorithm for the estimation if reversibility with respect to a given stationary vector is desired. We also develop new methods for the Bayesian posterior inference of reversible transition matrices with and without given stationary vector taking into account the need for a suitable prior distribution preserving the meta-stable features of the observed process during posterior inference. All algorithms here are implemented in the PyEMMA software--http://pyemma.org--as of version 2.0.

  6. Drift reversal capability in helical systems

    International Nuclear Information System (INIS)

    Yokoyama, M.; Itoh, K.; Okamura, S.

    2002-10-01

    The maximum-J (J is the second adiabatic invariant) capability, i.e., the drift reversal capability, is examined in quasi-axisymmetric (QAS) stellarators and quasi-poloidally symmetric (QPS) stellarators as a possible mechanism for turbulent transport suppression. Due to the existence of non-axisymmetry of the magnetic field strength in QAS configurations, a local maximum of J is created to cause the drift reversal. The increase of magnetic shear in finite beta equilibria also has favorable effect in realizing the drift reversal. The radial variation of the uniform magnetic field component plays a crucial role for the drift reversal in a QPS configuration. Thus, the drift reversal capability and its external controllability are demonstrated for QAS and QPS stellarators, by which the impact of magnetic configuration on turbulent transport can be studied in experiments. (author)

  7. Drift reversal capability in helical systems

    International Nuclear Information System (INIS)

    Yokoyama, M.; Itoh, K.; Okamura, S.; Matsuoka, K.; Nakajima, N.; Itoh, S.-I.; Neilson, G.H.; Zarnstorff, M.C.; Rewoldt, G.

    2003-01-01

    The maximum-J (J is the second adiabatic invariant) capability, i.e., the drift reversal capability, is examined in quasi-axisymmetric (QAS) stellarators and quasi-poloidally symmetric (QPS) stellarators as a possible mechanism for turbulent transport suppression. Due to the existence of non-axisymmetry of the magnetic field strength in QAS configurations, a local maximum of J is created to cause the drift reversal. The increase of magnetic shear in finite beta equilibria also has favorable effect in realizing the drift reversal. The radial variation of the uniform magnetic field component plays a crucial role for the drift reversal in a QPS configuration. Thus, the drift reversal capability and its external controllability are demonstrated for QAS and QPS stellarators, by which the impact of magnetic configuration on turbulent transport can be studied in experiments. (author)

  8. Organocatalytic aza-Michael/retro-aza-Michael reaction: pronounced chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction.

    Science.gov (United States)

    Cai, Yong-Feng; Li, Li; Luo, Meng-Xian; Yang, Ke-Fang; Lai, Guo-Qiao; Jiang, Jian-Xiong; Xu, Li-Wen

    2011-05-01

    A detailed experimental investigation of an aza-Michael reaction of aniline and chalcone is presented. A series of Cinchona alkaloid-derived organocatalysts with different functional groups were prepared and used in the aza-Michael and retro-aza-Michael reaction. There was an interesting finding that a complete reversal of stereoselectivity when a benzoyl group was introduced to the cinchonine and cinchonidine. The chirality amplification vs. time proceeds in the quinine-derived organocatalyst containing silicon-based bulky group, QN-TBS, -catalyzed aza-Michael reaction under solvent-free conditions. In addition, we have demonstrated for the first time that racemization was occurred in suitable solvents under mild conditions due to retro-aza-Michael reaction of the Michael adduct of aniline with chalcone. These indicate the equilibrium of retro-aza-Michael reaction and aza-Michael reaction produce the happening of chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction under different conditions, which would be beneficial to the development of novel chiral catalysts for the aza-Michael reactions. Copyright © 2011 Wiley-Liss, Inc.

  9. Reversed field pinch ignition requirements

    International Nuclear Information System (INIS)

    Werley, K.A.

    1991-01-01

    Plasma models are described and used to calculated numerically the transport confinement (nτ E ) requirements and steady state operation points for both the reversed field pinch (RFP) and the tokamak. The models are used to examine the CIT tokamak ignition conditions and the RFP experimental and ignition conditions. Physics differences between RFPs and tokamaks and their consequences for a D-T ignition machine are discussed. Compared with a tokamak, the ignition RFP has many physics advantages, including Ohmic heating to ignition (no need for auxiliary heating systems), higher beta, lower ignition current, less sensitivity of ignition requirements to impurity effects, no hard disruptions (associated with beta or density limits) and successful operation with high radiation fractions (f RAD ∼ 0.95). These physics advantages, coupled with important engineering advantages associated with lower external magnetic field, larger aspect ratios and smaller plasma cross-sections, translate to significant cost reductions for both ignition and reactor applications. The primary drawback of the RFP is the uncertainty that the present scaling will extrapolate to reactor regimes. Devices that are under construction should go a long way toward resolving this scaling uncertainty. The 4 MA ZTH is expected to extend the nτ E transport scaling data by three orders of magnitude above the results of ZT-40M, and, if the present scaling holds, ZTH is expected to achieve a D-T equivalent scientific energy breakeven, Q = 1. A base case RFP ignition point is identified with a plasma current of 8.1 MA and no auxiliary heating. (author). 19 refs, 11 figs, 3 tabs

  10. Probing the RAFT process using a model reaction between alkoxyamine and dithioester

    NARCIS (Netherlands)

    Zhou, Y.

    2012-01-01

    A small-molecular model reaction was designed to probe the reversible addition–fragmentation chain transfer (RAFT) process. In this reaction, alkoxyamine releases radicals that react in situ with dithioester through the RAFT process, generating new radicals through the fragmentation of the

  11. Reversibility: An Engineer's Point of View

    Energy Technology Data Exchange (ETDEWEB)

    Berest, Pierre [LMS, ecole Polytechnique (France)

    2012-07-01

    Reversibility is the most consistent option in a democratic country. However reversibility may also have several drawbacks which must be identified and mitigated. Reversibility of a geological repository is a relatively new idea in France. The 1991 law dedicated to nuclear waste management considered reversibility as a possible option. Fifteen years later, the 2006 law mandated that a deep repository must be reversible and that the exact content of this notion should be defined by a new law to be discussed by the Parliament in 2015. Reversibility was not a concern put forward by engineers. It clearly originated from a societal demand sponsored and formulated by the Parliament. Since 1991, the exact meaning of this mandate progressively became more precise. In the early days, reversibility meant the technical and financial capability to retrieve the wastes from the repository, at least for some period of time after being emplaced. Progressively, a broader definition, suggested by Andra, was accepted: reversibility also means that a disposal facility should be operated in such a way that a stepwise decision-making process is possible. At each step, society must be able to decide to proceed to the next step, to pause or to reverse a step. Several benefits can be expected from a reversible repository. Some technical safety concerns may be only recognised after waste emplacement. Radioactive wastes may become a resource whose recoverability is desirable. Regulations may change, alternative waste treatment or better disposal techniques may be developed, or the need to modify a component of the facility may arise. Looking back at how chemical or domestic wastes were managed some 50 years ago easily underscores that it is not unreasonable to hope for significant advances in the future. For scientists and engineers, reversibility proves to have several other merits. To design and build a good repository, time is needed. The operator of a mine or of an oil field knows that

  12. Hydrogen evolution reaction catalyst

    Science.gov (United States)

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  13. Precompound Reactions: Basic Concepts

    International Nuclear Information System (INIS)

    Weidenmueller, H. A.

    2008-01-01

    Because of the non-zero nuclear equilibration time, the compound-nucleus scattering model fails when the incident energy exceeds 10 or 20 MeV, and precompound reactions become important. Basic ideas used in the quantum-statistical approaches to these reactions are described

  14. Nuclear Reaction Data Centers

    International Nuclear Information System (INIS)

    McLane, V.; Nordborg, C.; Lemmel, H.D.; Manokhin, V.N.

    1988-01-01

    The cooperating Nuclear Reaction Data Centers are involved in the compilation and exchange of nuclear reaction data for incident neutrons, charged particles and photons. Individual centers may also have services in other areas, e.g., evaluated data, nuclear structure and decay data, reactor physics, nuclear safety; some of this information may also be exchanged between interested centers. 20 refs., 1 tab

  15. Fluorogenic organocatalytic reactions

    NARCIS (Netherlands)

    Raeisolsadati Oskouei, M.

    2017-01-01

    In this thesis, we introduce fluorescence spectroscopy as a new tool to gain insight into the interactions between the substrates and catalyst during organocatalytic reactions. The ultimate goal is to resolve the kinetics of the binding and reaction steps and obtain detailed understanding of the

  16. Applications of Reaction Rate

    Science.gov (United States)

    Cunningham, Kevin

    2007-01-01

    This article presents an assignment in which students are to research and report on a chemical reaction whose increased or decreased rate is of practical importance. Specifically, students are asked to represent the reaction they have chosen with an acceptable chemical equation, identify a factor that influences its rate and explain how and why it…

  17. Chemical burn or reaction

    Science.gov (United States)

    Chemicals that touch skin can lead to a reaction on the skin, throughout the body, or both. ... leave the person alone and watch carefully for reactions affecting the entire body. Note: If a chemical gets into the eyes, the eyes should be ...

  18. Degradations and Rearrangement Reactions

    Science.gov (United States)

    Zhang, Jianbo

    This section deals with recent reports concerning degradation and rearrangement reactions of free sugars as well as some glycosides. The transformations are classified in chemical and enzymatic ways. In addition, the Maillard reaction will be discussed as an example of degradation and rearrangement transformation and its application in current research in the fields of chemistry and biology.

  19. Carbene reactions. Pt. 5

    International Nuclear Information System (INIS)

    Hoffmann, R.W.; Schuettler, R.; Marburg Univ.

    1975-01-01

    Thermal cleavage of spiro[norbornadiene-7,2'-oxiranes] respectively after 14 C labelling of the corresponding compound which was labelled by 14 C at the methylen-group, generates ketenes probably via carbenaoxiranes. An equilibration carbenaoxirane reversible oxirene could not be detected. (orig./HK) [de

  20. Study with radio-sulphur of the kinetics of the process SO{sub 2} + 0.5 O{sub 2} {r_reversible} SO{sub 3} in a state of chemical equilibrium on a platinum catalyst; Etude, a l'aide du soufre radioactif, de la cinetique de la reaction SO{sub 2} + 0,5 O{sub 2} {r_reversible} SO{sub 3} en equilibre chimique, en presence d'un catalyseur de platine; Issledovanie pri pomoshchi radioaktivnoj sery kinetiki protsessa SO{sub 2} + 0,5 O{sub 2} {r_reversible} SO{sub 3}, nakhodyashchegosya v sostoyanii khimicheskogo ravnovesiya, na platinovom katalizatore; Estudio, con ayuda de azufre radiactivo, de la cinetica de la reaccion SO{sub 2} + 0,5 O{sub 2} {r_reversible} SO{sub 3} en equilibrio quimico en presencia de un catalizador de platino

    Energy Technology Data Exchange (ETDEWEB)

    Rojter, V A; Stukanovskaya, N A; Kornejchuk, G P

    1962-03-15

    The authors describe an attempt to use radioisotopes in the study of the kinetics of heterogeneous catalytic processes in a state of equilibrium. The investigation was carried out by the circulation method. After establishment of equilibrium, a small amount of S{sup 35}O{sub 2} was introduced into the system as a tracer and its conversion rate into S{sup 35}O{sub 3} was measured. From that rate the speed of the direct and inverse processes of oxidation of SO{sub 2} on the catalyst was calculated. Possible sequence patterns for the process are suggested and discussed. (author) [French] Le memoire expose un essai d'application des radioisotopes a l'etude de la cinetique des reactions catalytiques heterogenes en equilibre chimique. Les recherches ont ete effectuees par la methode a circulation. Apres etablissement de l'equilibre, on a introduit comme indicateur une petite quantite de {sup 35}SO{sub 2} et mesure la vitesse de sa transformation en {sup 35}SO{sub 3}. En partant de cette vitesse, on a calcule celle du processus d'oxydation directe et inverse du SO{sub 2} sur le catalyseur. Les auteurs proposent et etudient differentes formules selon lesquelles la reaction peut se derouler. (author) [Spanish] Los autores describen un experimento sobre el empleo de radioisotopos en el estudio de la cinetica de procesos cataliticos heterogeneos en estado de equilibrio. La investigacion se llevo a cabo por el metodo de circulacion. Una vez establecido el equilibrio, se introdujo en el sistema una pequena cantidad de {sup 35}SO{sub 2} como trazador y se midio su indice de conversion en {sup 35}SO{sub 3}. De dicho indice se dedujo la velocidad de los procesos directo e inverso de oxidacion del SO{sub 2} en presencia del catalizador. Los autores proponen y examinan diversos tipos posibles de cinetica para el proceso. (author) [Russian] Izlagaetsya opyt primeneniya radioaktivnykh izotopov dlya izucheniya kinetiki geterogennykh kataliticheskikh protsessov, nakhodyashchikhsya v

  1. Reversible Lithium Neurotoxicity: Review of the Literature

    Science.gov (United States)

    Netto, Ivan

    2012-01-01

    Objective: Lithium neurotoxicity may be reversible or irreversible. Reversible lithium neurotoxicity has been defined as cases of lithium neurotoxicity in which patients recovered without any permanent neurologic sequelae, even after 2 months of an episode of lithium toxicity. Cases of reversible lithium neurotoxicity differ in clinical presentation from those of irreversible lithium neurotoxicity and have important implications in clinical practice. This review aims to study the clinical presentation of cases of reversible lithium neurotoxicity. Data Sources: A comprehensive electronic search was conducted in the following databases: MEDLINE (PubMed), 1950 to November 2010; PsycINFO, 1967 to November 2010; and SCOPUS (EMBASE), 1950 to November 2010. MEDLINE and PsycINFO were searched by using the OvidSP interface. Study Selection: A combination of the following search terms was used: lithium AND adverse effects AND central nervous system OR neurologic manifestation. Publications cited include articles concerned with reversible lithium neurotoxicity. Data Extraction: The age, sex, clinical features, diagnostic categories, lithium doses, serum lithium levels, precipitating factors, and preventive measures of 52 cases of reversible lithium neurotoxicity were extracted. Data Synthesis: Among the 52 cases of reversible lithium neurotoxicity, patients ranged in age from 10 to 80 years and a greater number were female (P = .008). Most patients had affective disorders, schizoaffective disorders, and/or depression (P lithium levels were less than or equal to 1.5 mEq/L (P lithium, underlying brain pathology, abnormal tissue levels, specific diagnostic categories, and elderly populations were some of the precipitating factors reported for reversible lithium neurotoxicity. The preventive measures were also described. Conclusions: Reversible lithium neurotoxicity presents with a certain clinical profile and precipitating factors for which there are appropriate

  2. Reversible lithium neurotoxicity: review of the literatur.

    Science.gov (United States)

    Netto, Ivan; Phutane, Vivek H

    2012-01-01

    Lithium neurotoxicity may be reversible or irreversible. Reversible lithium neurotoxicity has been defined as cases of lithium neurotoxicity in which patients recovered without any permanent neurologic sequelae, even after 2 months of an episode of lithium toxicity. Cases of reversible lithium neurotoxicity differ in clinical presentation from those of irreversible lithium neurotoxicity and have important implications in clinical practice. This review aims to study the clinical presentation of cases of reversible lithium neurotoxicity. A comprehensive electronic search was conducted in the following databases: MEDLINE (PubMed), 1950 to November 2010; PsycINFO, 1967 to November 2010; and SCOPUS (EMBASE), 1950 to November 2010. MEDLINE and PsycINFO were searched by using the OvidSP interface. A combination of the following search terms was used: lithium AND adverse effects AND central nervous system OR neurologic manifestation. Publications cited include articles concerned with reversible lithium neurotoxicity. The age, sex, clinical features, diagnostic categories, lithium doses, serum lithium levels, precipitating factors, and preventive measures of 52 cases of reversible lithium neurotoxicity were extracted. Among the 52 cases of reversible lithium neurotoxicity, patients ranged in age from 10 to 80 years and a greater number were female (P = .008). Most patients had affective disorders, schizoaffective disorders, and/or depression (P lithium levels were less than or equal to 1.5 mEq/L (P lithium, underlying brain pathology, abnormal tissue levels, specific diagnostic categories, and elderly populations were some of the precipitating factors reported for reversible lithium neurotoxicity. The preventive measures were also described. Reversible lithium neurotoxicity presents with a certain clinical profile and precipitating factors for which there are appropriate preventive measures. This recognition will help in early diagnosis and prompt treatment of

  3. Irradiation effects on properties of reverse osmosis membrane based on cross-linked aromatic polyamide

    International Nuclear Information System (INIS)

    Nakase, Yoshiaki; Yanagi, Tadashi; Uemura, Tadahiro.

    1994-01-01

    In order to develop a membrane suitable for reverse osmotic condensation of radioactive liquid wastes, a new cross-linked aromatic polyamide composite reverse osmosis membrane (ROM) was irradiated in water or in wet system, and its mechanical and some thermal properties, and the separation performance for inorganic salt were investigated. A membrane was degraded by irradiation more severely in wet system than in dry system, probably due to the reaction with OH-radicals. In the separation performance for NaCl, the salt rejection of the membrane was kept over 88% until irradiation reached 2MGy, maintaining about 90% of its original water flux. (author)

  4. Reverse microemulsion synthesis of layered gadolinium hydroxide nanoparticles

    Science.gov (United States)

    Xu, Yadong; Suthar, Jugal; Egbu, Raphael; Weston, Andrew J.; Fogg, Andrew M.; Williams, Gareth R.

    2018-02-01

    A reverse microemulsion approach has been explored for the synthesis of layered gadolinium hydroxide (LGdH) nanoparticles in this work. This method uses oleylamine as a multifunctional agent, acting as surfactant, oil phase and base. 1-butanol is additionally used as a co-surfactant. A systematic study of the key reaction parameters was undertaken, including the volume ratio of surfactant (oleylamine) to water, the reaction time, synthesis temperature, and the amount of co-surfactant (1-butanol) added. It proved possible to obtain pristine LGdH materials at temperatures of 120 °C or below with an oleylamine: water ratio of 1:4. Using larger amounts of surfactant or higher temperatures caused the formation of Gd(OH)3, either as the sole product or as a major impurity phase. The LGdH particles produced have sizes of ca. 200 nm, with this size being largely independent of temperature or reaction time. Adjusting the amount of 1-butanol co-surfactant added permits the size to be varied between 200 and 300 nm.

  5. Parallelization of Reversible Ripple-carry Adders

    DEFF Research Database (Denmark)

    Thomsen, Michael Kirkedal; Axelsen, Holger Bock

    2009-01-01

    The design of fast arithmetic logic circuits is an important research topic for reversible and quantum computing. A special challenge in this setting is the computation of standard arithmetical functions without the generation of \\emph{garbage}. Here, we present a novel parallelization scheme...... wherein $m$ parallel $k$-bit reversible ripple-carry adders are combined to form a reversible $mk$-bit \\emph{ripple-block carry adder} with logic depth $\\mathcal{O}(m+k)$ for a \\emph{minimal} logic depth $\\mathcal{O}(\\sqrt{mk})$, thus improving on the $mk$-bit ripple-carry adder logic depth $\\mathcal...

  6. Reverse logistics in the Brazilian construction industry.

    Science.gov (United States)

    Nunes, K R A; Mahler, C F; Valle, R A

    2009-09-01

    In Brazil most Construction and Demolition Waste (C&D waste) is not recycled. This situation is expected to change significantly, since new federal regulations oblige municipalities to create and implement sustainable C&D waste management plans which assign an important role to recycling activities. The recycling organizational network and its flows and components are fundamental to C&D waste recycling feasibility. Organizational networks, flows and components involve reverse logistics. The aim of this work is to introduce the concepts of reverse logistics and reverse distribution channel networks and to study the Brazilian C&D waste case.

  7. Reversible perspective and splitting in time.

    Science.gov (United States)

    Hart, Helen Schoenhals

    2012-01-01

    The element of time--the experience of it and the defensive use of it--is explored in conjunction with the use of reversible perspective as a psychotic defense. Clinical material from a long analysis illustrates how a psychotic patient used the reversible perspective, with its static splitting, to abolish the experience of time. When he improved and the reversible perspective became less effective for him, he replaced it with a more dynamic splitting mechanism using time gaps. With further improvement, the patient began to experience the passage of time, and along with it the excruciating pain of separation, envy, and loss.

  8. Performance of the reverse Helmbold universal portfolio

    Science.gov (United States)

    Tan, Choon Peng; Kuang, Kee Seng; Lee, Yap Jia

    2017-04-01

    The universal portfolio is an important investment strategy in a stock market where no stochastic model is assumed for the stock prices. The zero-gradient set of the objective function estimating the next-day portfolio which contains the reverse Kullback-Leibler order-alpha divergence is considered. From the zero-gradient set, the explicit, reverse Helmbold universal portfolio is obtained. The performance of the explicit, reverse Helmbold universal portfolio is studied by running them on some stock-price data sets from the local stock exchange. It is possible to increase the wealth of the investor by using these portfolios in investment.

  9. Time reversibility in the quantum frame

    Energy Technology Data Exchange (ETDEWEB)

    Masot-Conde, Fátima [Escuela Superior Ingenieros, Dpt. Física Aplicada III, Universidad de Sevilla Isla Mágica, 41092- Sevilla (Spain)

    2014-12-04

    Classic Mechanics and Electromagnetism, conventionally taken as time-reversible, share the same concept of motion (either of mass or charge) as the basis of the time reversibility in their own fields. This paper focuses on the relationship between mobile geometry and motion reversibility. The goal is to extrapolate the conclusions to the quantum frame, where matter and radiation behave just as elementary mobiles. The possibility that the asymmetry of Time (Time’s arrow) is an effect of a fundamental quantum asymmetry of elementary particles, turns out to be a consequence of the discussion.

  10. Refractory reverse amblyopia with atropine penalization

    Directory of Open Access Journals (Sweden)

    Preeti Ajit Patil

    2010-01-01

    Full Text Available Pharmacological penalization with atropine has been shown to be equally effective as conventional occlusion therapy in the treatment of amblyopia in children. Reverse amblyopia of the sound eye with atropine penalization has been reported before, but is more common in cases where the effect is augmented with optical penalization and is mostly reversible. We report a case of reverse amblyopia with atropine penalization, in a 4-year-old girl, which was refractory to treatment. This report highlights the need for strict monitoring of the vision in the sound eye and regular follow-up in children undergoing amblyopia treatment.

  11. From a Viewpoint of Clinical Settings: Pharmacoepidemiology as Reverse Translational Research (rTR).

    Science.gov (United States)

    Kawakami, Junichi

    2017-01-01

    Clinical pharmacology and pharmacoepidemiology research may converge in practise. Pharmacoepidemiology is the study of pharmacotherapy and risk management in patient groups. For many drugs, adverse reaction(s) that were not seen and/or clarified during research and development stages have been reported in the real world. Pharmacoepidemiology can detect and verify adverse drug reactions as reverse translational research. Recently, development and effective use of medical information databases (MID) have been conducted in Japan and elsewhere for the purpose of post-marketing safety of drugs. The Ministry of Health, Labour and Welfare, Japan has been promoting the development of 10-million scale database in 10 hospitals and hospital groups as "the infrastructure project of medical information database (MID-NET)". This project enables estimation of the frequency of adverse reactions, the distinction between drug-induced reactions and basal health-condition changes, and usefulness verification of administrative measures of drug safety. However, because the database information is different from detailed medical records, construction of methodologies for the detection and evaluation of adverse reactions is required. We have been performing database research using medical information system in some hospitals to establish and demonstrate useful methods for post-marketing safety. In this symposium, we aim to discuss the possibility of reverse translational research from clinical settings and provide an introduction to our research.

  12. Reversibility of oxidation and aggregation of impurity in the system of potassium halide monocrystal-phosphite molecular centre

    International Nuclear Information System (INIS)

    Lebedev, A.V.; Bogdanova, T.G.; Vasil'ev, I.A.; Mel'nikova, I.N.

    1980-01-01

    Thermo- and radiation-stimulated reversible reaction of oxidation and aggregation of phosphorus in the composition of phosphite molecular centre in the matrix of potassium iodide are studied. It is shown that in the process of isothermal annealing and γ-radiolysis in the matrix of potassium iodide destruction of phosphite molecular centre takes place. It is established that it is accompanied by oxidation of trivalent phosphorus and aggregation of the formed phosphorus-oxygen anions. Reduction of the initial phosphite centre during the sample hardening is explained by the reverse reaction as a result of which electron-exceeding centres of the base are destructed and reduction of phosphorus takes place

  13. Reversible machine code and its abstract processor architecture

    DEFF Research Database (Denmark)

    Axelsen, Holger Bock; Glück, Robert; Yokoyama, Tetsuo

    2007-01-01

    A reversible abstract machine architecture and its reversible machine code are presented and formalized. For machine code to be reversible, both the underlying control logic and each instruction must be reversible. A general class of machine instruction sets was proven to be reversible, building...

  14. Heavy ion transfer reactions

    International Nuclear Information System (INIS)

    Weisser, D.C.

    1977-06-01

    To complement discussions on the role of γ rays in heavy ion induced reactions, the author discusses the role played by particle detection. Transfer reactions are part of this subject and are among those in which one infers the properties of the residual nucleus in a reaction by observing the emerging light nucleus. Inelastic scattering ought not be excluded from this subject, although no particles are transferred, because of the role it plays in multistep reactions and in fixing O.M. parameters describing the entrance channel of the reaction. Heavy ion transfer reaction studies have been under study for some years and yet this research is still in its infancy. The experimental techniques are difficult and the demands on theory rigorous. One of the main products of heavy ion research has been the thrust to re-examine the assumptions of reaction theory and now include many effects neglected for light ion analysis. This research has spurred the addition of multistep processes to simple direct processes and coupled channel calculations. (J.R.)

  15. Enhancing chemical reactions

    Science.gov (United States)

    Morrey, John R.

    1978-01-01

    Methods of enhancing selected chemical reactions. The population of a selected high vibrational energy state of a reactant molecule is increased substantially above its population at thermal equilibrium by directing onto the molecule a beam of radiant energy from a laser having a combination of frequency and intensity selected to pump the selected energy state, and the reaction is carried out with the temperature, pressure, and concentrations of reactants maintained at a combination of values selected to optimize the reaction in preference to thermal degradation by transforming the absorbed energy into translational motion. The reaction temperature is selected to optimize the reaction. Typically a laser and a frequency doubler emit radiant energy at frequencies of .nu. and 2.nu. into an optical dye within an optical cavity capable of being tuned to a wanted frequency .delta. or a parametric oscillator comprising a non-centrosymmetric crystal having two indices of refraction, to emit radiant energy at the frequencies of .nu., 2.nu., and .delta. (and, with a parametric oscillator, also at 2.nu.-.delta.). Each unwanted frequency is filtered out, and each desired frequency is focused to the desired radiation flux within a reaction chamber and is reflected repeatedly through the chamber while reactants are fed into the chamber and reaction products are removed therefrom.

  16. Radioimmunoassay method for determination of 3, 3', 5'-triiodothyronine (reverse - T3)

    International Nuclear Information System (INIS)

    Kosowicz, J.

    1979-01-01

    To introduce radioimmunoassay, 3, 3', 5'-triiodothyronine (reverse-T 3 ) was coupled to bovine serum albumin by the carbodiimide technique and rabbits were immunized with the conjugates obtained. The immunizations were performed by multiple site intradermal injections at places in which cornynebacterium parvum was previously injected to enhance immunologic reaction. After 3 months the rabbits raised antisera to reverse-T 3 of a high titer and specificity. To obtain labelled 125 I-reverse T 3 , 3,3'-diiodothyronine was used. Iodination was performed by the chloramine T technique and the iodination mixture was subjected to gel filtration on Sephadex G-25 (fine) column. The purified monolabelled 125 I-reverse T 3 had a specific activity of 3,000 milli Curie/mg. The reverse T 3 radioimmunoassay of a high sensitivity (ca 2 pg/tube) was introduced in the clinical studies and facilitated direct determination of reverse T 3 in sera without the need of plasma extractions. The interference of serum proteins (TBG) was avoided by adding 8-anilino-1-naphtalene sulfonic acid to serum samples. Separation of free from antibody bound antigens was achieved by polyethylene glycol precipitation or immunoprecipitation. (author)

  17. The Reaction Wheel Pendulum

    CERN Document Server

    Block, Daniel J; Spong, Mark W

    2007-01-01

    This monograph describes the Reaction Wheel Pendulum, the newest inverted-pendulum-like device for control education and research. We discuss the history and background of the reaction wheel pendulum and other similar experimental devices. We develop mathematical models of the reaction wheel pendulum in depth, including linear and nonlinear models, and models of the sensors and actuators that are used for feedback control. We treat various aspects of the control problem, from linear control of themotor, to stabilization of the pendulum about an equilibrium configuration using linear control, t

  18. Electron transfer reactions

    CERN Document Server

    Cannon, R D

    2013-01-01

    Electron Transfer Reactions deals with the mechanisms of electron transfer reactions between metal ions in solution, as well as the electron exchange between atoms or molecules in either the gaseous or solid state. The book is divided into three parts. Part 1 covers the electron transfer between atoms and molecules in the gas state. Part 2 tackles the reaction paths of oxidation states and binuclear intermediates, as well as the mechanisms of electron transfer. Part 3 discusses the theories and models of the electron transfer process; theories and experiments involving bridged electron transfe

  19. Firefighter Nozzle Reaction

    DEFF Research Database (Denmark)

    Chin, Selena K.; Sunderland, Peter B.; Jomaas, Grunde

    2017-01-01

    to anchor forces, the hose becomes straight. The nozzle reaction is found to equal the jet momentum flow rate, and it does not change when an elbow connects the hose to the nozzle. A forward force must be exerted by a firefighter or another anchor that matches the forward force that the jet would exert...... on a perpendicular wall. Three reaction expressions are derived, allowing it to be determined in terms of hose diameter, jet diameter, flow rate, and static pressure upstream of the nozzle. The nozzle reaction predictions used by the fire service are 56% to 90% of those obtained here for typical firefighting hand...

  20. The 8Li(α,n)11B reaction and primordial nucleosynthesis

    International Nuclear Information System (INIS)

    Boyd, R.N.

    1992-01-01

    The cross section for the 8 Li(α,n) 11 B reaction, of importance to synthesis of 11 B and heavier nuclides following the big bang, has been measured using the radioactive beam facility of The Institute of Physical and Chemical Reasearch (RIKEN). The reaction cross section was found to be about five times larger than that estimated from the time reversed reaction cross section. (author)