Characterization of reversible reactions of isocyanides with molybdenum dithiolate complexes

International Nuclear Information System (INIS)

Miller, D.J.; DuBois, M.R.

1980-01-01

Dimeric molybdenum complexes with bridging dithiocarbonimidate ligands of the formula [C 5 H 5 MoS 2 CNR] 2 (where R = CH 3 , CH 2 C 6 H 5 , C 6 H 11 , and n-C 4 H 9 ) have been synthesized and characterized. The syntheses involve the room-temperature reactions of excess isocyanides with solutions of the dimeric complex [C 5 H 5 MoSC 3 H 6 S] 2 . During the course of these reactions, propene is displaced from the sulfur atoms of the bridging dithiolate ligands. Addition of excess alkene reverses the above reactions. Equilibrium constants have been calculated for the following reactions by integration of NMR resonances: [CH 3 C 5 H 4 MoSC 2 H 4 S] 2 + RNC reversible (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + C == C, K 1 = 2.9 +- 0.2; (CH 3 C 5 H 4 Mo) 2 (SC 2 H 4 S)(S 2 CNR) + RNC reversible [CH 3 C 5 H 4 MoS 2 CNR] 2 + C == C, K 2 = 0.7 +- 0.1 (R = CH 2 C 6 H 5 ). The dithiocarbonimidate complexes react cleanly with the electrophiles CH 3 OSO 2 F and HOSO 2 CF 3 to form [C 5 H 5 MoS 2 CNRR'] 2 2+ where R' = H or CH 3 . These products have been characterized by spectral and conductivity methods. The reactions of the dithiocarbonimidate complexes with reducing agents and with carbon monoxide are discussed. 1 figure, 2 tables

Do high school chemistry examinations inhibit deeper level understanding of dynamic reversible chemical reactions?

Science.gov (United States)

Wheeldon, R.; Atkinson, R.; Dawes, A.; Levinson, R.

2012-07-01

Background and purpose : Chemistry examinations can favour the deployment of algorithmic procedures like Le Chatelier's Principle (LCP) rather than reasoning using chemical principles. This study investigated the explanatory resources which high school students use to answer equilibrium problems and whether the marks given for examination answers require students to use approaches beyond direct application of LCP. Sample : The questionnaire was administered to 162 students studying their first year of advanced chemistry (age 16/17) in three high achieving London high schools. Design and methods : The students' explanations of reversible chemical systems were inductively coded to identify the explanatory approaches used and interviews with 13 students were used to check for consistency. AS level examination questions on reversible reactions were analysed to identify the types of explanations sought and the students' performance in these examinations was compared to questionnaire answers. Results : 19% of students used a holistic explanatory approach: when the rates of forward and reverse reactions are correctly described, recognising their simultaneous and mutually dependent nature. 36% used a mirrored reactions approach when the connected nature of the forward and reverse reactions is identified, but not their mutual dependency. 42% failed to recognize the interdependence of forward and reverse reactions (reactions not connected approach). Only 4% of marks for AS examination questions on reversible chemical systems asked for responses which went beyond either direct application of LCP or recall of equilibrium knowledge. 37% of students attained an A grade in their AS national examinations. Conclusions : Examinations favour the application of LCP making it possible to obtain the highest grade with little understanding of reversible chemical systems beyond a direct application of this algorithm. Therefore students' understanding may be attenuated so that they are

Time-reversal asymmetry: polarization and analyzing power in nuclear reactions

International Nuclear Information System (INIS)

Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.

1984-01-01

Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers in the inverse reactions, initiated by polarized protons at the same center-of-mass energies, show significant differences. This implies the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show smaller differences. A discussion of instrumental asymmetries is presented

Mass transfer with complex reversible chemical reactions—II. parallel reversible chemical reactions

OpenAIRE

Versteeg, G.F.; Kuipers, J.A.M.; Beckum, F.P.H. van; Swaaij, W.P.M. van

1990-01-01

An absorption model has been developed which can be used to calculate rapidly absorption rates for the phenomenon mass transfer accompanied by multiple complex parallel reversible chemical reactions. This model can be applied for the calculation of the mass transfer rates, enhancement factors and concentration profiles for a wide range of processes and conditions, for both film and penetration model. With the aid of this mass transfer model it is demonstrated that the absorption rates in syst...

Single-molecule stochastic times in a reversible bimolecular reaction

Science.gov (United States)

Keller, Peter; Valleriani, Angelo

2012-08-01

In this work, we consider the reversible reaction between reactants of species A and B to form the product C. We consider this reaction as a prototype of many pseudobiomolecular reactions in biology, such as for instance molecular motors. We derive the exact probability density for the stochastic waiting time that a molecule of species A needs until the reaction with a molecule of species B takes place. We perform this computation taking fully into account the stochastic fluctuations in the number of molecules of species B. We show that at low numbers of participating molecules, the exact probability density differs from the exponential density derived by assuming the law of mass action. Finally, we discuss the condition of detailed balance in the exact stochastic and in the approximate treatment.

Efficacy of AquatainTM, a monomolecular surface film, against the malaria vectors Anopheles stephensi and An. gambiae s.s. in the laboratory

NARCIS (Netherlands)

Bukhari, S.T.; Knols, B.G.J.

2009-01-01

Monomolecular films are used for mosquito control because of their asphyxiating effect on larvae and pupae. Compared with other films, Aquatain mosquito formulation (AMFTM) has an improved spreading ability and flexibility on a water surface. In the laboratory, AMFTM showed larvicidal, pupicidal,

The Forward-Reverse Algorithm for Stochastic Reaction Networks

KAUST Repository

Bayer, Christian

2015-01-07

In this work, we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which we solve a set of deterministic optimization problems where the SRNs are replaced by the classical ODE rates; then, during the second phase, the Monte Carlo version of the EM algorithm is applied starting from the output of the previous phase. Starting from a set of over-dispersed seeds, the output of our two-phase method is a cluster of maximum likelihood estimates obtained by using convergence assessment techniques from the theory of Markov chain Monte Carlo.

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Reversible logic gates based on enzyme-biocatalyzed reactions and realized in flow cells: a modular approach.

Science.gov (United States)

Fratto, Brian E; Katz, Evgeny

2015-05-18

Reversible logic gates, such as the double Feynman gate, Toffoli gate and Peres gate, with 3-input/3-output channels are realized using reactions biocatalyzed with enzymes and performed in flow systems. The flow devices are constructed using a modular approach, where each flow cell is modified with one enzyme that biocatalyzes one chemical reaction. The multi-step processes mimicking the reversible logic gates are organized by combining the biocatalytic cells in different networks. This work emphasizes logical but not physical reversibility of the constructed systems. Their advantages and disadvantages are discussed and potential use in biosensing systems, rather than in computing devices, is suggested. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

KAUST Repository

Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

2016-01-01

In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem

Computer Program NIKE

DEFF Research Database (Denmark)

Spanget-Larsen, Jens

2014-01-01

FORTRAN source code for program NIKE (PC version of QCPE 343). Sample input and output for two model chemical reactions are appended: I. Three consecutive monomolecular reactions, II. A simple chain mechanism......FORTRAN source code for program NIKE (PC version of QCPE 343). Sample input and output for two model chemical reactions are appended: I. Three consecutive monomolecular reactions, II. A simple chain mechanism...

Enzymatic reactions in reversed micelles

NARCIS (Netherlands)

Hilhorst, M.H.

1984-01-01

It has been recognised that enzymes in reversed micelles have potential for application in chemical synthesis. Before these expectations will be realised many problems must be overcome. This thesis deals with some of them.
In Chapter 1 the present knowledge about reversed micelles and

Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

National Research Council Canada - National Science Library

McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

2005-01-01

...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

Mass transfer with complex chemical reactions in gas–liquid systems : two-step reversible reactions with unit stoichiometric and kinetic orders

NARCIS (Netherlands)

Vas Bhat, R.D.; Kuipers, J.A.M.; Versteeg, G.F.

2000-01-01

An absorption model to study gas–liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

The role of reversed kinematics and double kinematic solutions in nuclear reactions studies

International Nuclear Information System (INIS)

Kaplan, M.; Parker, W.E.; Moses, D.J.; Lacey, R.; Alexander, J.M.

1993-01-01

The advantages of reversed kinematics in nuclear reactions studies are discussed, with particular emphasis on the origin of double solutions in the reaction kinematics. This possibility for double solutions does not exist in normal kinematics, and provides the basis for a new method of imposing important experimental constraints on the uniqueness of fitting complex observations. By gating on one or the other of the two solutions, light particle kinematics can be greatly influenced in coincidence measurements. The power of the method is illustrated with data for the reaction 1030 MeV 121 Sb+ 27 Al, where charged particle emissions arise from several different sources. (orig.)

Mass transfer with complex chemical reactions in gas-liquid systems: two-step reversible reactions with unit stoichiometric and kinetic orders

NARCIS (Netherlands)

Vas bhat, R.D.; Kuipers, J.A.M.; Versteeg, Geert

2000-01-01

An absorption model to study gas¿liquid mass transfer accompanied by reversible two-step reactions in the liquid phase has been presented. This model has been used to determine mass transfer rates, enhancement factors and concentration profiles over a wide range of process conditions. Although

An Efficient Forward-Reverse EM Algorithm for Statistical Inference in Stochastic Reaction Networks

KAUST Repository

Bayer, Christian

2016-01-06

In this work [1], we present an extension of the forward-reverse algorithm by Bayer and Schoenmakers [2] to the context of stochastic reaction networks (SRNs). We then apply this bridge-generation technique to the statistical inference problem of approximating the reaction coefficients based on discretely observed data. To this end, we introduce an efficient two-phase algorithm in which the first phase is deterministic and it is intended to provide a starting point for the second phase which is the Monte Carlo EM Algorithm.

Formation of a Molecular Wire Using the Chemically Adsorbed Monomolecular Layer Having Pyrrolyl Groups

Directory of Open Access Journals (Sweden)

Kazufumi Ogawa

2011-01-01

Full Text Available A molecular wire containing polypyrrolyl conjugate bonds has been prepared by a chemical adsorption technique using 1,1,1-trichloro-12-pyrrolyl-1-siladodecane (PNN and an electrooxidative polymerization technique, and the conductivity of the molecular wire without any dopant has been measured by using AFM/STM at room temperature. When sample dimension measured was about 0.3 nm (thickness of the conductive portion in the PNN monomolecular layer ×100 μm (the average width of an electric path ×2 mm (the distance between Pt positive electrode and the AFM tip covered with Au, the conductivity of the polymerized PNN molecular wire at room temperature was larger than 1.6 × 105 S/cm both in an atmosphere and in a vacuum chamber of 10−5 Torr. The activation energy obtained by Arrhenius' plots was almost zero in the temperature range between 320 and 450 K.

Asymmetric effect of mechanical stress on the forward and reverse reaction catalyzed by an enzyme.

Directory of Open Access Journals (Sweden)

Collin Joseph

Full Text Available The concept of modulating enzymatic activity by exerting a mechanical stress on the enzyme has been established in previous work. Mechanical perturbation is also a tool for probing conformational motion accompanying the enzymatic cycle. Here we report measurements of the forward and reverse kinetics of the enzyme Guanylate Kinase from yeast (Saccharomyces cerevisiae. The enzyme is held in a state of stress using the DNA spring method. The observation that mechanical stress has different effects on the forward and reverse reaction kinetics suggests that forward and reverse reactions follow different paths, on average, in the enzyme's conformational space. Comparing the kinetics of the stressed and unstressed enzyme we also show that the maximum speed of the enzyme is comparable to the predictions of the relaxation model of enzyme action, where we use the independently determined dissipation coefficient [Formula: see text] for the enzyme's conformational motion. The present experiments provide a mean to explore enzyme kinetics beyond the static energy landscape picture of transition state theory.

On null tests of time-reversal invariance in scattering and reactions

International Nuclear Information System (INIS)

Conzett, H.E.

1993-01-01

There have been suggestions in the literature, both recently and in the more distant past, that, in the lowest-order Born approximation, time-reversal (T)-odd experimental observables in certain reactions are required by T-symmetry to vanish. These observables are the final-state spin-correlation coefficient C xy in the reaction e + e - → τ + τ - and the target analysing power A oy in the inclusive process ep → eX with a polarized proton target. These assertions are in direct conflict with a theorem that states that there can be no null-test of T-symmetry in such processes; that is, T-symmetry does not require any single observable to vanish. This talk addresses the resolution of that conflict

SIMULTANEOUS ABSORPTION AND DESORPTION WITH REVERSIBLE 1ST-ORDER CHEMICAL-REACTION - ANALYTICAL SOLUTION AND NEGATIVE ENHANCEMENT FACTORS

NARCIS (Netherlands)

WINKELMAN, JGM; BEENACKERS, AACM

The problem of ps absorption accompanied by a first-order reversible reaction, producing a volatile reaction product, is considered. A general analytical solution is developed for the film model, resulting in explicit relations for the concentration profiles in the film and for the mass transfer

Efficient Solar Energy Harvesting and Storage through a Robust Photocatalyst Driving Reversible Redox Reactions.

Science.gov (United States)

Zhou, Yangen; Zhang, Shun; Ding, Yu; Zhang, Leyuan; Zhang, Changkun; Zhang, Xiaohong; Zhao, Yu; Yu, Guihua

2018-06-14

Simultaneous solar energy conversion and storage is receiving increasing interest for better utilization of the abundant yet intermittently available sunlight. Photoelectrodes driving nonspontaneous reversible redox reactions in solar-powered redox cells (SPRCs), which can deliver energy via the corresponding reverse reactions, present a cost-effective and promising approach for direct solar energy harvesting and storage. However, the lack of photoelectrodes having both high conversion efficiency and high durability becomes a bottleneck that hampers practical applications of SPRCs. Here, it is shown that a WO 3 -decorated BiVO 4 photoanode, without the need of extra electrocatalysts, can enable a single-photocatalyst-driven SPRC with a solar-to-output energy conversion efficiency as high as 1.25%. This SPRC presents stable performance over 20 solar energy storage/delivery cycles. The high efficiency and stability are attributed to the rapid redox reactions, the well-matched energy level, and the efficient light harvesting and charge separation of the prepared BiVO 4 . This demonstrated device system represents a potential alternative toward the development of low-cost, durable, and easy-to-implement solar energy technologies. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

KAUST Repository

Vilanova, Pedro

2016-01-07

In this work, we present an extension of the forward-reverse representation introduced in Simulation of forward-reverse stochastic representations for conditional diffusions , a 2014 paper by Bayer and Schoenmakers to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the Expectation-Maximization algorithm to the phase I output. By selecting a set of over-dispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

Communication: Rate coefficients from quasiclassical trajectory calculations from the reverse reaction: The Mu + H2 reaction re-visited

Science.gov (United States)

Homayoon, Zahra; Jambrina, Pablo G.; Aoiz, F. Javier; Bowman, Joel M.

2012-07-01

In a previous paper [P. G. Jambrina et al., J. Chem. Phys. 135, 034310 (2011), 10.1063/1.3611400] various calculations of the rate coefficient for the Mu + H2 → MuH + H reaction were presented and compared to experiment. The widely used standard quasiclassical trajectory (QCT) method was shown to overestimate the rate coefficients by several orders of magnitude over the temperature range 200-1000 K. This was attributed to a major failure of that method to describe the correct threshold for the reaction owing to the large difference in zero-point energies (ZPE) of the reactant H2 and product MuH (˜0.32 eV). In this Communication we show that by performing standard QCT calculations for the reverse reaction and then applying detailed balance, the resulting rate coefficient is in very good agreement with the other computational results that respect the ZPE, (as well as with the experiment) but which are more demanding computationally.

Modified lignin: Preparation and use in reversible gel via Diels-Alder reaction.

Science.gov (United States)

Zhou, Wanpeng; Zhang, Hui; Chen, Fangeng

2018-02-01

In this study, popular soda lignin was modified with either furan or maleimide ring, and the modified lignins were subjected to reversible Diels-Alder reaction. A new process was proposed to prepare the functionalized lignin. A long chain was introduced to the hydroxyl groups of lignin, and then either the furan or maleimide ring was added to the other end of the chain. The test results confirmed that either the furan ring or the maleimide ring was bound to lignin. Furan- and maleimide-functionalized lignins were also combined to generate crosslinking via Diels-Alder [4+2] cycloaddition reaction. Under appropriate conditions, the formation of a gel was identified, which reverted to liquid state after retro Diels-Alder reaction upon heating at 120°C. This study reveals the significant versatility and potential of the developed strategy for the utilization of lignin-based recyclable networks. Copyright © 2017 Elsevier B.V. All rights reserved.

Kinetics and thermochemistry of the reversible gas phase reaction HONO+NH3->3N-HONO studied by infrared diode laser spectroscopy

DEFF Research Database (Denmark)

Pagsberg, P.; Ratajczak, E.; Sillesen, A.

1994-01-01

The kinetics of the reversible reaction HONO+NH3 reversible H3N-HONO (1) was studied by monitoring trans-HONO relaxation kinetics. The rate of approach towards equilibrium was studied as a function of the ammonia concentration to obtain values of the rate constants for the forward and reverse rea...

On the graph and systems analysis of reversible chemical reaction networks with mass action kinetics

NARCIS (Netherlands)

Rao, Shodhan; Jayawardhana, Bayu; Schaft, Arjan van der

2012-01-01

Motivated by the recent progresses on the interplay between the graph theory and systems theory, we revisit the analysis of reversible chemical reaction networks described by mass action kinetics by reformulating it using the graph knowledge of the underlying networks. Based on this formulation, we

Lecithin-cholesterol acyltransferase (LCAT) catalyzes transacylation of intact cholesteryl esters. Evidence for the partial reversal of the forward LCAT reaction

International Nuclear Information System (INIS)

Sorci-Thomas, M.; Babiak, J.; Rudel, L.L.

1990-01-01

Lecithin-cholesterol acyltransferase (LCAT) catalyzes the intravascular synthesis of lipoprotein cholesteryl esters by converting cholesterol and lecithin to cholesteryl ester and lysolecithin. LCAT is unique in that it catalyzes sequential reactions within a single polypeptide sequence. In this report we find that LCAT mediates a partial reverse reaction, the transacylation of lipoprotein cholesteryl oleate, in whole plasma and in a purified, reconstituted system. As a result of the reverse transacylation reaction, a linear accumulation of [3H]cholesterol occurred during incubations of plasma containing high density lipoprotein labeled with [3H]cholesteryl oleate. When high density lipoprotein labeled with cholesteryl [14C]oleate was also included in the incubation the labeled fatty acyl moiety remained in the cholesteryl [14C]oleate pool showing that the formation of labeled cholesterol did not result from hydrolysis of the doubly labeled cholesteryl esters. The rate of release of [3H]cholesterol was only about 10% of the forward rate of esterification of cholesterol using partially purified human LCAT and was approximately 7% in whole monkey plasma. Therefore, net production of cholesterol via the reverse LCAT reaction would not occur. [3H]Cholesterol production from [3H]cholesteryl oleate was almost completely inhibited by a final concentration of 1.4 mM 5,5'-dithiobis(nitrobenzoic acid) during incubation with either purified LCAT or whole plasma. Addition of excess lysolecithin to the incubation system did not result in the formation of [14C]oleate-labeled lecithin, showing that the reverse reaction found here for LCAT was limited to the last step of the reaction. To explain these results we hypothesize that LCAT forms a [14C]oleate enzyme thioester intermediate after its attack on the cholesteryl oleate molecule

Influence of surface chemistry on the structural organization of monomolecular protein layers adsorbed to functionalized aqueous interfaces

DEFF Research Database (Denmark)

Lösche, M.; Piepenstock, M.; Diederich, A.

1993-01-01

The molecular organization of streptavidin (SA) bound to aqueous surface monolayers of biotin-functionalized lipids and binary lipid mixtures has been investigated with neutron reflectivity and electron and fluorescence microscopy. The substitution of deuterons (2H) for protons (1H), both...... in subphase water molecules and in the alkyl chains of the lipid surface monolayer, was utilized to determine the interface structure on the molecular length scale. In all cases studied, the protein forms monomolecular layers underneath the interface with thickness values of apprx 40 ANG . A systematic...... dependence of the structural properties of such self-assembled SA monolayers on the surface chemistry was observed: the lateral protein density depends on the length of the spacer connecting the biotin moiety and its hydrophobic anchor. The hydration of the lipid head groups in the protein-bound state...

Nanoscale control of reversible chemical reaction between fullerene C60 molecules using scanning tunneling microscope.

Science.gov (United States)

Nakaya, Masato; Kuwahara, Yuji; Aono, Masakazu; Nakayama, Tomonobu

2011-04-01

The nanoscale control of reversible chemical reactions, the polymerization and depolymerization between C60 molecules, has been investigated. Using a scanning tunneling microscope (STM), the polymerization and depolymerization can be controlled at designated positions in ultrathin films of C60 molecules. One of the two chemical reactions can be selectively induced by controlling the sample bias voltage (V(s)); the application of negative and positive values of V(s) results in polymerization and depolymerization, respectively. The selectivity between the two chemical reactions becomes extremely high when the thickness of the C60 film increases to more than three molecular layers. We conclude that STM-induced negative and positive electrostatic ionization are responsible for the control of the polymerization and depolymerization, respectively.

Introduction to time reversal theory

International Nuclear Information System (INIS)

Henley, E.M.

1987-01-01

Theory and reaction mechanisms relevant to time reversal invariance are reviewed. Consequences of time reversal invariance are presented under the headings of CP tests, electromagnetic moments, weak emissions or absorptions, and scattering reactions. 8 refs., 4 figs

[Are there pseudophototropic reactions in biology? Part 4: On the reversibility of biologic/synthetic polymere systems (author's transl)].

Science.gov (United States)

Patschorke, J

1979-01-01

In further research on pseudophototropic behaviour in cellular membranes of halobacteria the reversibility of vinylmethylethermaleic anhydride-copolymeres with biological liquids is tested and the basic principles of different colour generating reactions are studied.

Thermomchromic Reaction-Induced Reversible Upconversion Emission Modulation for Switching Devices and Tunable Upconversion Emission Based on Defect Engineering of WO3:Yb3+,Er3+ Phosphor.

Science.gov (United States)

Ruan, Jiufeng; Yang, Zhengwen; Huang, Anjun; Zhang, Hailu; Qiu, Jianbei; Song, Zhiguo

2018-05-02

Reversible luminescence modulation of upconversion phosphors has the potential applications as photoswitches and optical memory and data storage devices. Previously, the photochromic reaction was extensively used for the realization of reversible luminescence modulation. It is very necessary to develop other approaches such as thermomchromic reaction to obtain the reversible upconversion luminescence modulation. In this work, the WO 3 :Yb 3+ ,Er 3+ phosphors with various colors were prepared at various temperatures, exhibiting tunable upconversion luminescence attributed to the formation of oxygen vacancies in the host. Upon heat treatment in the reducing atmosphere or air, the WO 3 :Yb 3+ ,Er 3+ phosphors show a reversible thermomchromic property. The reversible upconversion luminescence modulation of WO 3 :Yb 3+ ,Er 3+ phosphors was observed based on thermomchromic reaction. Additionally, the upconversion luminescence modulation is maintained after several cycles, indicating its excellent stability. The WO 3 :Yb 3+ ,Er 3+ phosphors with reversible upconversion luminescence and excellent reproducibility have potential applications as the photoswitches and optical memory and data storage devices.

I + (H2O)2 → HI + (H2O)OH Forward and Reverse Reactions. CCSD(T) Studies Including Spin-Orbit Coupling.

Science.gov (United States)

Wang, Hui; Li, Guoliang; Li, Qian-Shu; Xie, Yaoming; Schaefer, Henry F

2016-03-03

The potential energy profile for the atomic iodine plus water dimer reaction I + (H2O)2 → HI + (H2O)OH has been explored using the "Gold Standard" CCSD(T) method with quadruple-ζ correlation-consistent basis sets. The corresponding information for the reverse reaction HI + (H2O)OH → I + (H2O)2 is also derived. Both zero-point vibrational energies (ZPVEs) and spin-orbit (SO) coupling are considered, and these notably alter the classical energetics. On the basis of the CCSD(T)/cc-pVQZ-PP results, including ZPVE and SO coupling, the forward reaction is found to be endothermic by 47.4 kcal/mol, implying a significant exothermicity for the reverse reaction. The entrance complex I···(H2O)2 is bound by 1.8 kcal/mol, and this dissociation energy is significantly affected by SO coupling. The reaction barrier lies 45.1 kcal/mol higher than the reactants. The exit complex HI···(H2O)OH is bound by 3.0 kcal/mol relative to the asymptotic limit. At every level of theory, the reverse reaction HI + (H2O)OH → I + (H2O)2 proceeds without a barrier. Compared with the analogous water monomer reaction I + H2O → HI + OH, the additional water molecule reduces the relative energies of the entrance stationary point, transition state, and exit complex by 3-5 kcal/mol. The I + (H2O)2 reaction is related to the valence isoelectronic bromine and chlorine reactions but is distinctly different from the F + (H2O)2 system.

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Enzyme-lipid complex. Koso-shishitsu fukugotai

Energy Technology Data Exchange (ETDEWEB)

Okahata, Y; Ijiro, K [Tokyo Inst. of Technology., Tokyo (Japan)

1990-08-01

Enzyme, as unstable against organic solvent, being to be designed not to be quenched, organic solvent was tried to be made soluble by making enzyme-lipid complex. By mixing aqueous solution of enzyme with aqueous dispersion liquid of lipid, white powder was obtaind. Enzyme has monomolecular film through which reaction substance passes. Lipase-lipid complex, of which monomolecular film is qualified by hydrogen and other soft linkages, homogeneously dissolves in organic solvent and has a high activity, not given by the conventional qualification method. That activity being applied, asymmetrical esterificating reaction of alcohol could be done in organic solvent, containing high concentration reactive substance. While substance selectivity, not known in water, was obtained. Through reaction of amine with amino acid dielectrics in isooctane solvent by {alpha}-chymotrypsin-lipid complex, was indicated an exact substance selectivity. Enzyme-lipid complex dissolving in organic solvent, monomolecular film can be formed without being quenched on aqueous surface, which film can be utilized as sensor film. 10 refs., 5 figs. 1 tab.

Reversible alkyne insertion in the benzannulation reaction of Fischer carbene complexes with alkynes

Energy Technology Data Exchange (ETDEWEB)

Waters, M.L.; Bos, M.E.; Wulff, W.D. [Univ. of Chicago, IL (United States)

1995-12-31

The benzannulation reaction of Fischer carbene complexes with alkynes to give phenols is highly regioselective with terminal alkynes, and reasonably regioselective with internal alkynes. This has been attributed to steric factors in intermediates, where one form is favored due to close contact between the R substituent and a cis-CO ligand. Whether alkyne insertion is kinetically or thermodynamically controlled has not been determined. The authors now have evidence from regioselectivity studies that alkyne insertion into the metal-carbon bond is reversible. Implications of these results and further mechanistic considerations will be presented.

TR-ESR Investigation on Reaction of Vitamin C with Excited Triplet of 9,10-phenanthrenequinone in Reversed Micelle Solutions

Science.gov (United States)

Xu, Xin-sheng; Shi, Lei; Liu, Yi; Ji, Xue-han; Cui, Zhi-feng

2011-04-01

Time-resolved electron spin resonance has been used to study quenching reactions between the antioxidant Vitamin C (VC) and the triplet excited states of 9,10-phenanthrenequinone (PAQ) in ethylene glycol-water (EG-H2O) homogeneous and inhomogeneous reversed micelle solutions. Reversed micelle solutions were used to be the models of physiological environment of biological cell and tissue. In PAQ/EG-H2O homogeneous solution, the excited triplet of PAQ (3PAQ*) abstracts hydrogen atom from solvent EG. In PAQ/VC/EG-H2O solution, 3PAQ* abstracts hydrogen atom not only from solvent EG but also from VC. The quenching rate constant of 3PAQ* by VC is close to the diffusion-controlled value of 1.41 × 108 L/(mol ·s). In hexadecyltrimethylammonium bromide (CTAB)/EG-H2O and aerosol OT (AOT)/EG-H2O reversed micelle solutions, 3PAQ* and VC react around the water-oil interface of the reversed micelle. Exit of 3PAQ* from the lipid phase slows down the quenching reaction. For Triton X-100 (TX-100)/EG-H2O reversed micelle solution, PAQ and VC coexist inside the hydrophilic polyethylene glycol core, and the quenching rate constant of 3PAQ* by VC is larger than those in AOT/EG-H2O and CTAB/EG-H2O reversed micelle solutions, even a little larger than that in EG-H2O homogeneous solution. The strong emissive chemically induced dynamic electron polarization of As.- resulted from the effective TM spin polarization transfer in hydrogen abstraction of 3PAQ* from VC.

A Key Role of Xanthophylls That Are Not Embedded in Proteins in Regulation of the Photosynthetic Antenna Function in Plants, Revealed by Monomolecular Layer Studies.

Science.gov (United States)

Welc, Renata; Luchowski, Rafal; Grudzinski, Wojciech; Puzio, Michal; Sowinski, Karol; Gruszecki, Wieslaw I

2016-12-29

The main physiological function of LHCII (light-harvesting pigment-protein complex of photosystem II), the largest photosynthetic antenna complex of plants, is absorption of light quanta and transfer of excitation energy toward the reaction centers, to drive photosynthesis. However, under strong illumination, the photosynthetic apparatus faces the danger of photodegradation and therefore excitations in LHCII have to be down-regulated, e.g., via thermal energy dissipation. One of the elements of the regulatory system, operating in the photosynthetic apparatus under light stress conditions, is a conversion of violaxanthin, the xanthophyll present under low light, to zeaxanthin, accumulated under strong light. In the present study, an effect of violaxanthin and zeaxanthin on the molecular organization and the photophysical properties of LHCII was studied in a monomolecular layer system with application of molecular imaging (atomic force microscopy, fluorescence lifetime imaging microscopy) and spectroscopy (UV-Vis absorption, FTIR, fluorescence spectroscopy) techniques. The results of the experiments show that violaxanthin promotes the formation of supramolecular LHCII structures preventing dissipative excitation quenching while zeaxanthin is involved in the formation of excitonic energy states able to quench chlorophyll excitations in both the higher (B states) and lower (Q states) energy levels. The results point to a strategic role of xanthophylls that are not embedded in a protein environment, in regulation of the photosynthetic light harvesting activity in plants.

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

Science.gov (United States)

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

S-factor measurement of the 13C(p,γ)14N reaction in reverse kinematics

International Nuclear Information System (INIS)

Genard, G; Terwagne, G; Descouvemont, P

2010-01-01

We measure the S-factor of the 13 C(p,γ) 14 N reaction in reverse kinematics for energies ranging from 561 down to 225 keV with a low background experimental setup. The results are compared with previous measurements and an R-matrix treatment is applied to the data in order to obtain the properties of the 511 keV resonance that dominates the cross section at low energies.

A meson-exchange isobar model for the {pi}{sup +}d {r_reversible} pp reaction

Energy Technology Data Exchange (ETDEWEB)

Canton, L.; Cattapan, G.; Dortmans, P.J.; Pisent, G. [Istituto Nazionale di Fisica Nucleare, Padua (Italy); Svenne, J.P. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics]|[Winnipeg Inst. for Theoretical Physics, Winnipeg, MB (Canada)

1994-10-10

A broad set of observables are calculated for the {pi}{sup +} d {r_reversible} pp reaction with a relatively simple meson-exchange isobar model. The comparison between the calculated results and experimental data (including spin observables), shows that the model gives an overall phenomenologically acceptable description of the reaction around the {Delta} resonance. The effects due to the inclusion of Galilei invariant (pseudovector) recoil term in the {pi}NN vertex, of relativistic corrections to the {rho}-exchange component of the {Delta}N transition potential, and of NN final state interaction in the {pi}{sup +}d {yields} p+p process are also discussed. It is estimated that the model is sufficiently simple to be extended to the case of pion absorption on other light nuclei, in particular {sup 3}He (or tritium). 32 refs., 13 figs.

General theory of the multistage geminate reactions of the isolated pairs of reactants. II. Detailed balance and universal asymptotes of kinetics.

Science.gov (United States)

Kipriyanov, Alexey A; Doktorov, Alexander B

2014-10-14

The analysis of general (matrix) kinetic equations for the mean survival probabilities of any of the species in a sample (or mean concentrations) has been made for a wide class of the multistage geminate reactions of the isolated pairs. These kinetic equations (obtained in the frame of the kinetic approach based on the concept of "effective" particles in Paper I) take into account various possible elementary reactions (stages of a multistage reaction) excluding monomolecular, but including physical and chemical processes of the change in internal quantum states carried out with the isolated pairs of reactants (or isolated reactants). The general basic principles of total and detailed balance have been established. The behavior of the reacting system has been considered on macroscopic time scales, and the universal long-term kinetics has been determined.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Plant Acyl-CoA:Lysophosphatidylcholine Acyltransferases (LPCATs) Have Different Specificities in Their Forward and Reverse Reactions*

Science.gov (United States)

Lager, Ida; Yilmaz, Jenny Lindberg; Zhou, Xue-Rong; Jasieniecka, Katarzyna; Kazachkov, Michael; Wang, Peng; Zou, Jitao; Weselake, Randall; Smith, Mark A.; Bayon, Shen; Dyer, John M.; Shockey, Jay M.; Heinz, Ernst; Green, Allan; Banas, Antoni; Stymne, Sten

2013-01-01

Acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT) enzymes have central roles in acyl editing of phosphatidylcholine (PC). Plant LPCAT genes were expressed in yeast and characterized biochemically in microsomal preparations of the cells. Specificities for different acyl-CoAs were similar for seven LPCATs from five different species, including species accumulating hydroxylated acyl groups in their seed oil, with a preference for C18-unsaturated acyl-CoA and low activity with palmitoyl-CoA and ricinoleoyl (12-hydroxyoctadec-9-enoyl)-CoA. We showed that Arabidopsis LPCAT1 and LPCAT2 enzymes catalyzed the acylation and de-acylation of both sn positions of PC, with a preference for the sn-2 position. When acyl specificities of the Arabidopsis LPCATs were measured in the reverse reaction, sn-2-bound oleoyl, linoleoyl, and linolenoyl groups from PC were transferred to acyl-CoA to a similar extent. However, a ricinoleoyl group at the sn-2-position of PC was removed 4–6-fold faster than an oleoyl group in the reverse reaction, despite poor utilization in the forward reaction. The data presented, taken together with earlier published reports on in vivo lipid metabolism, support the hypothesis that plant LPCAT enzymes play an important role in regulating the acyl-CoA composition in plant cells by transferring polyunsaturated and hydroxy fatty acids produced on PC directly to the acyl-CoA pool for further metabolism or catabolism. PMID:24189065

Controlling Solid–Liquid Conversion Reactions for a Highly Reversible Aqueous Zinc–Iodine Battery

Energy Technology Data Exchange (ETDEWEB)

Pan, Huilin; Li, Bin; Mei, Donghai; Nie, Zimin; Shao, Yuyan; Li, Guosheng; Li, Xiaohong S.; Han, Kee Sung; Muller, Karl T.; Sprenkle, Vincent L.; Liu, Jun

2017-10-30

Aqueous rechargeable batteries are desirable for many energy storage applications due to their low cost and high safety. However, low capacity and short cycle life are the significant obstacles to their practical applications. Here, we demonstrate a highly reversible aqueous zinc-iodine battery using encapsulated iodine in microporous active carbon fibers (ACFs) as cathode materials through the rational control of solid-liquid conversion reactions. The experiments and density function theory (DFT) calculations were employed to investigate the effects of solvents and properties of carbon hosts, e.g. pore size, surface chemistries, on the adsorption of iodine species. The rational manipulation of the competition between the adsorption in carbon and solvation in electrolytes for iodine species is responsible for the high reversibility and cycling stability. The zinc-iodine batteries deliver a high capacity of 180 mAh g-1 at 1C and a stable cycle life over 3000 cycles with ~90% capacity retention as well as negligible self-discharge. We believe the principles for stabilizing the zinc-iodine system could provide new insight into conversion systems such as Li-S systems.

Chemiluminescence from an oxidation reaction of rhodamine B with cerium(IV) in a reversed micellar medium of cetyltrimethylammonium chloride in 1-hexanol-cyclohexane/water.

Science.gov (United States)

Hasanin, Tamer H A; Tsunemine, Yusuke; Tsukahara, Satoshi; Okamoto, Yasuaki; Fujiwara, Terufumi

2011-01-01

The chemiluminescence (CL) emission, observed when rhodamine B (RB) in 1-hexanol-cyclohexane was mixed with cerium(IV) sulfate in sulfuric acid dispersed in a reversed micellar medium of cetyltrimethylammonium chloride (CTAC) in 1-hexanol-cyclohexane/water, was investigated using a flow-injection system. The CL emission from the oxidation reaction of RB with Ce(IV) was found to be stronger in the CTAC reversed micellar solution compared with an aqueous solution. Bearing on the enhancement effect of the CTAC reverse micelles on the RB-Ce(IV) CL, several studies including stopped-flow, fluorescence and electron spin resonance (ESR) spectrometries were performed. Rapid spectral changes of an intermediate in the RB-Ce(IV) reaction in the aqueous and reversed micellar solutions were successfully observed using a stopped-flow method. The effect of the experimental variables, i.e., oxidant concentration, sulfuric acid concentration, the mole fraction of 1-hexanol, water-to-surfactant molar concentration ratio, flow rate, upon the CL intensity was evaluated. Under the experimental conditions optimized for a flow-injection determination of RB based on the new reversed micellar-mediated CL reaction with Ce(IV), a detection limit of 0.08 µmol dm(-3) RB was achieved, and a linear calibration graph was obtained with a dynamic range from 0.5 to 20 µmol dm(-3). The relative standard deviation (n = 6) obtained at an RB concentration of 3 µmol dm(-3) was 3%.

An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

KAUST Repository

Bayer, Christian

2016-02-20

© 2016 Taylor & Francis Group, LLC. ABSTRACT: In this work, we present an extension of the forward–reverse representation introduced by Bayer and Schoenmakers (Annals of Applied Probability, 24(5):1994–2032, 2014) to the context of stochastic reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, that is, SRNs conditional on their values in the extremes of given time intervals. We then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve a set of deterministic optimization problems where the SRNs are replaced by their reaction-rate ordinary differential equations approximation; then, during phase II, we apply the Monte Carlo version of the expectation-maximization algorithm to the phase I output. By selecting a set of overdispersed seeds as initial points in phase I, the output of parallel runs from our two-phase method is a cluster of approximate maximum likelihood estimates. Our results are supported by numerical examples.

Relation between the 16O(α,γ)20Ne capture reaction and its reverse 20Ne(γ,α)16O photodisintegration reaction in stars and in the lab

International Nuclear Information System (INIS)

Mohr, P.; Angulo, C.; Descouvemont, P.

2005-01-01

The astrophysical reaction rates of the 16 O(α,γ) 20 Ne capture reaction and its reverse 20 Ne(γ,α) 16 O photodisintegration reaction are dominated by a few narrow resonances. Only at very low temperatures direct capture plays a significant role. Usually the reaction rate of photodisintegration reactions is calculated from the reaction rate of the corresponding capture reaction using the detailed balanced theorem. This is only valid for nuclei which are thermalized. The reaction rates of the 16 O(α,γ) 20 Ne capture reaction in the lab and under stellar conditions are identical. However, for the inverse 20 Ne(γ,α) 16 O photodisintegration reaction one finds a significant contribution of the thermally populated first excited state at E x = 1634 keV in 20 Ne. Consequently, the reaction rates of the 20 Ne(γ,α) 16 O photodisintegration reaction are different in the lab and under stellar conditions. It is shown that the detailed balance theorem remains valid for the reaction rates under stellar conditions. Photodisintegration rates in the lab have been measured recently using a quasi-thermal photon spectrum from bremsstrahlung, and a quasi-thermal photon spectrum with superior quality has been suggested using high-energy synchrotron radiation. (author)

Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

DEFF Research Database (Denmark)

Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

2005-01-01

Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

Enhanced reversibility and durability of a solid oxide Fe-air redox battery by carbothermic reaction derived energy storage materials.

Science.gov (United States)

Zhao, Xuan; Li, Xue; Gong, Yunhui; Huang, Kevin

2014-01-18

The recently developed solid oxide metal-air redox battery is a new technology capable of high-rate chemistry. Here we report that the performance, reversibility and stability of a solid oxide iron-air redox battery can be significantly improved by nanostructuring energy storage materials from a carbothermic reaction.

Nuclear reaction studies using inverse kinematics

International Nuclear Information System (INIS)

Shapira, D.

1985-01-01

Reaction studies with reversed kinematics refer to studies of nuclear reactions induced by a heavy projectile colliding with lighter target nuclei. The technique of using reversed kinematics is costly in terms of the available center-of-mass energy. Most of the projectile's energy goes into forward motion of the reaction products in the laboratory system. Examples are presented where the use of reversed kinematics techniques has provided new information on certain reaction processes. A list of kinematic properties and advantages they may afford is shown. Clearly the possible studies listed can be done without using reversed kinematics but because of the difficulty associated with some of these studies they were never performed until more energetic heavier beams have become available and the reversed kinematics technique was utilized

The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A↔C↔B + B

Energy Technology Data Exchange (ETDEWEB)

Kipriyanov, Alexey A.; Kipriyanov, Alexander A.; Doktorov, Alexander B. [Voevodsky Institute of Chemical Kinetics and Combustion, Siberian Branch of the Russian Academy of Sciences, Novosibirsk 630090, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

2016-04-14

Specific two-stage reversible reaction A + A↔C↔B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

Neural Network Control of CSTR for Reversible Reaction Using Reverence Model Approach

Directory of Open Access Journals (Sweden)

Duncan ALOKO

2007-01-01

Full Text Available In this work, non-linear control of CSTR for reversible reaction is carried out using Neural Network as design tool. The Model Reverence approach in used to design ANN controller. The idea is to have a control system that will be able to achieve improvement in the level of conversion and to be able to track set point change and reject load disturbance. We use PID control scheme as benchmark to study the performance of the controller. The comparison shows that ANN controller out perform PID in the extreme range of non-linearity.This paper represents a preliminary effort to design a simplified neutral network control scheme for a class of non-linear process. Future works will involve further investigation of the effectiveness of thin approach for the real industrial chemical process

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

Time reversal tests in polarized neutron reactions

International Nuclear Information System (INIS)

Asahi, Koichiro; Bowman, J.D.; Crawford, B.

1998-01-01

This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). In recent years the nuclear weak interaction has been studied in the compound nucleus via parity violation. The observed parity-violating effects are strongly enhanced by nuclear structure. The predictions are that the interaction of polarized neutrons with polarized nuclear targets could be also used to perform sensitive tests of time-reversal-violation because of the nuclear enhancements. The author has designed experiments to search for time-reversal violation in neutron-nucleus interactions. He has also developed techniques to polarize neutrons with laser-polarized 3 He gas targets. Using the polarized 3 He neutron spin filter, he has performed two experiments at LANSCE: an absolute neutron beam polarization measurement with an accuracy of 0.2--0.3% and a neutron spin-rotation measurement on a 139 La sample

On the feasibility of producing secondary radioactive nuclear beams using reactions in reversed geometries at HI-13 tandem accelerator

International Nuclear Information System (INIS)

Bai Xixiang; Liu Weiping

1993-01-01

Some of (p,n),(d,p),(d,n) and (d, 3 He) reactions involving heavy-ions in reversed geometries are proposed for producing the kinematically compressed beams of ions such as 6 He, 7 Be, 8 Li, 11 C, 12 B, 13 N, 15 O and 17 F. A simple facility being constructed to produce and utilize these beams is briefly described

On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

Energy Technology Data Exchange (ETDEWEB)

Plante, Ianik, E-mail: ianik.plante-1@nasa.gov [Wyle Science, Technology & Engineering, 1290 Hercules, Houston, TX 77058 (United States); Devroye, Luc, E-mail: lucdevroye@gmail.com [School of Computer Science, McGill University, 3480 University Street, Montreal H3A 0E9 (Canada)

2015-09-15

Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well.

On the Green's function of the partially diffusion-controlled reversible ABCD reaction for radiation chemistry codes

International Nuclear Information System (INIS)

Plante, Ianik; Devroye, Luc

2015-01-01

Several computer codes simulating chemical reactions in particles systems are based on the Green's functions of the diffusion equation (GFDE). Indeed, many types of chemical systems have been simulated using the exact GFDE, which has also become the gold standard for validating other theoretical models. In this work, a simulation algorithm is presented to sample the interparticle distance for partially diffusion-controlled reversible ABCD reaction. This algorithm is considered exact for 2-particles systems, is faster than conventional look-up tables and uses only a few kilobytes of memory. The simulation results obtained with this method are compared with those obtained with the independent reaction times (IRT) method. This work is part of our effort in developing models to understand the role of chemical reactions in the radiation effects on cells and tissues and may eventually be included in event-based models of space radiation risks. However, as many reactions are of this type in biological systems, this algorithm might play a pivotal role in future simulation programs not only in radiation chemistry, but also in the simulation of biochemical networks in time and space as well

The general theory of multistage geminate reactions of isolated pairs of reactants. III. Two-stage reversible dissociation in geminate reaction A + A ↔ C ↔ B + B.

Science.gov (United States)

Kipriyanov, Alexey A; Kipriyanov, Alexander A; Doktorov, Alexander B

2016-04-14

Specific two-stage reversible reaction A + A ↔ C ↔ B + B of the decay of species C reactants by two independent transition channels is considered on the basis of the general theory of multistage reactions of isolated pairs of reactants. It is assumed that at the initial instant of time, the reacting system contains only reactants C. The employed general approach has made it possible to consider, in the general case, the inhomogeneous initial distribution of reactants, and avoid application of model concepts of a reaction system structure (i.e., of the structure of reactants and their molecular mobility). Slowing of multistage reaction kinetics as compared to the kinetics of elementary stages is established and physically interpreted. To test approximations (point approximation) used to develop a universal kinetic law, a widely employed specific model of spherical particles with isotropic reactivity diffusing in solution is applied. With this particular model as an example, ultimate kinetics of chemical conversion of reactants is investigated. The question concerning the depths of chemical transformation at which long-term asymptotes are reached is studied.

The Concentration Dependence of the (Delta)s Term in the Gibbs Free Energy Function: Application to Reversible Reactions in Biochemistry

Science.gov (United States)

Gary, Ronald K.

2004-01-01

The concentration dependence of (delta)S term in the Gibbs free energy function is described in relation to its application to reversible reactions in biochemistry. An intuitive and non-mathematical argument for the concentration dependence of the (delta)S term in the Gibbs free energy equation is derived and the applicability of the equation to…

Features of E-Z-photoisomerization reversible reaction of 4-styrylpyridine crown-containing complexes with different cations

International Nuclear Information System (INIS)

Fedorov, Yu.V.; Shepel', N.Eh.; Chernikova, E.Yu.; Fedorova, O.A.; Gulakova, E.N.; Avakyan, V.G.; Jonushauskas, G.

2008-01-01

E-Z-Photoisomerization reversible reaction of crown-containing 4-styrylpyridine in the presence of alkali metal perchlorates (Ca 2+ , Mg 2+ , Ba 2+ ) gifted in the formation of complexes with crown-ether fragments, as well as heavy metal perchlorates (Hg 2+ , Cd 2+ ) gifted in the coordination with nitrogen atom of heterocyclic residuum has been studied. Effect of complexing on the photoisomerization is determined by electron spectroscopy and NMR 1 H, structures of the formed Z-isomers are established. The possibility of the E-Z-isomerization control with the use of supramolecular complexing is confirmed by the investigations [ru

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Performance and cost of energy transport and storage systems for dish applications using reversible chemical reactions

Science.gov (United States)

Schredder, J. M.; Fujita, T.

1984-01-01

The use of reversible chemical reactions for energy transport and storage for parabolic dish networks is considered. Performance and cost characteristics are estimated for systems using three reactions (sulfur-trioxide decomposition, steam reforming of methane, and carbon-dioxide reforming of methane). Systems are considered with and without storage, and in several energy-delivery configurations that give different profiles of energy delivered versus temperature. Cost estimates are derived assuming the use of metal components and of advanced ceramics. (The latter reduces the costs by three- to five-fold). The process that led to the selection of the three reactions is described, and the effects of varying temperatures, pressures, and heat exchanger sizes are addressed. A state-of-the-art survey was performed as part of this study. As a result of this survey, it appears that formidable technical risks exist for any attempt to implement the systems analyzed in this study, especially in the area of reactor design and performance. The behavior of all components and complete systems under thermal energy transients is very poorly understood. This study indicates that thermochemical storage systems that store reactants as liquids have efficiencies below 60%, which is in agreement with the findings of earlier investigators.

Chemical kinetics and reaction mechanism

International Nuclear Information System (INIS)

Jung, Ou Sik; Park, Youn Yeol

1996-12-01

This book is about chemical kinetics and reaction mechanism. It consists of eleven chapters, which deal with reaction and reaction speed on reaction mechanism, simple reaction by rate expression, reversible reaction and simultaneous reaction, successive reaction, complicated reaction mechanism, assumption for reaction mechanism, transition state theory, successive reaction and oscillating reaction, reaction by solution, research method high except kinetics on reaction mechanism, high reaction of kinetics like pulsed radiolysis.

Dynamic Modeling of Reversible Methanolysis of Jatropha curcas Oil to Biodiesel

Science.gov (United States)

Syam, Azhari M.; Hamid, Hamidah A.; Yunus, Robiah; Rashid, Umer

2013-01-01

Many kinetics studies on methanolysis assumed the reactions to be irreversible. The aim of the present work was to study the dynamic modeling of reversible methanolysis of Jatropha curcas oil (JCO) to biodiesel. The experimental data were collected under the optimal reaction conditions: molar ratio of methanol to JCO at 6 : 1, reaction temperature of 60°C, 60 min of reaction time, and 1% w/w of catalyst concentration. The dynamic modeling involved the derivation of differential equations for rates of three stepwise reactions. The simulation study was then performed on the resulting equations using MATLAB. The newly developed reversible models were fitted with various rate constants and compared with the experimental data for fitting purposes. In addition, analysis of variance was done statistically to evaluate the adequacy and quality of model parameters. The kinetics study revealed that the reverse reactions were significantly slower than forward reactions. The activation energies ranged from 6.5 to 44.4 KJ mol−1. PMID:24363616

Artificial Self-Sufficient P450 in Reversed Micelles

Directory of Open Access Journals (Sweden)

Teruyuki Nagamune

2010-04-01

Full Text Available Cytochrome P450s are heme-containing monooxygenases that require electron transfer proteins for their catalytic activities. They prefer hydrophobic compounds as substrates and it is, therefore, desirable to perform their reactions in non-aqueous media. Reversed micelles can stably encapsulate proteins in nano-scaled water pools in organic solvents. However, in the reversed micellar system, when multiple proteins are involved in a reaction they can be separated into different micelles and it is then difficult to transfer electrons between proteins. We show here that an artificial self-sufficient cytochrome P450, which is an enzymatically crosslinked fusion protein composed of P450 and electron transfer proteins, showed micelle-size dependent catalytic activity in a reversed micellar system. Furthermore, the presence of thermostable alcohol dehydrogenase promoted the P450-catalyzed reaction due to cofactor regeneration.

Recoil halogen reactions in liquid and frozen aqueous solutions of biomolecules

International Nuclear Information System (INIS)

Arsenault, L.J.; Blotcky, A.J.; Firouzbakht, M.L.; Rack, E.P.; Nebraska Univ., Omaha

1982-01-01

Reactions of recoil 38 Cl, 80 Br and 128 I have been studied in crystalline systems of 5-halouracil, 5-halo-2'-deoxyuridine and 5-halouridine as well as liquid and frozen aqueous solutions of these halogenated biomolecules. In all systems expect crystalline 5-iuodouracil the major product was the radio-labelled halide ion. There was no evidence for other halogen inorganic species. The major labelled organic product was the parent molecule. A recoil atom tracer technique was developed to acquire site information of the biomolecule solutes in the liquid and frozen aqueous systems. For all liquid and frozen aqueous systems, the halogenated biomolecules tended to aggregate. For liquid systems, the tendency for aggregation diminished as the solute concentration approached zero, where the probable state of the solute approached a monomolecular dispersion. Unlike the liquid state, the frozen ice lattice demonstated a ''caging effect'' for the solute aggregates which resulted in constant product yields over the whole concentration range. (orig.)

Fiber-Optic Bio-sniffer (Biochemical Gas Sensor) Using Reverse Reaction of Alcohol Dehydrogenase for Exhaled Acetaldehyde.

Science.gov (United States)

Iitani, Kenta; Chien, Po-Jen; Suzuki, Takuma; Toma, Koji; Arakawa, Takahiro; Iwasaki, Yasuhiko; Mitsubayashi, Kohji

2018-02-23

Volatile organic compounds (VOCs) exhaled in breath have huge potential as indicators of diseases and metabolisms. Application of breath analysis for disease screening and metabolism assessment is expected since breath samples can be noninvasively collected and measured. In this research, a highly sensitive and selective biochemical gas sensor (bio-sniffer) for gaseous acetaldehyde (AcH) was developed. In the AcH bio-sniffer, a reverse reaction of alcohol dehydrogenase (ADH) was employed for reducing AcH to ethanol and simultaneously consuming a coenzyme, reduced form of nicotinamide adenine dinucleotide (NADH). The concentration of AcH can be quantified by fluorescence detection of NADH that was consumed by reverse reaction of ADH. The AcH bio-sniffer was composed of an ultraviolet light-emitting diode (UV-LED) as an excitation light source, a photomultiplier tube (PMT) as a fluorescence detector, and an optical fiber probe, and these three components were connected with a bifurcated optical fiber. A gas-sensing region of the fiber probe was developed with a flow-cell and an ADH-immobilized membrane. In the experiment, after optimization of the enzyme reaction conditions, the selectivity and dynamic range of the AcH bio-sniffer were investigated. The AcH bio-sniffer showed a short measurement time (within 2 min) and a broad dynamic range for determination of gaseous AcH, 0.02-10 ppm, which encompassed a typical AcH concentration in exhaled breath (1.2-6.0 ppm). Also, the AcH bio-sniffer exhibited a high selectivity to gaseous AcH based on the specificity of ADH. The sensor outputs were observed only from AcH-contained standard gaseous samples. Finally, the AcH bio-sniffer was applied to measure the concentration of AcH in exhaled breath from healthy subjects after ingestion of alcohol. As a result, a significant difference of AcH concentration between subjects with different aldehyde dehydrogenase type 2 (ALDH2) phenotypes was observed. The AcH bio-sniffer can be

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

Current status and future prospect of space and time reversal symmetry violation on low energy neutron reactions

International Nuclear Information System (INIS)

Masuda, Yasuhiro

1993-01-01

In this report, the papers on symmetry violation under space reflection and time reversal and neutron spin, neutron spin rotation and P-violation, parity nonconservation in neutron capture reaction, some advantage of the search for CP-violation in neutron scattering, dynamic polarization of 139 La target, alexandrite laser for optical pumping, polarized 3 He system for T- and P-violation neutron experiments, control of neutron spin in T-violation neutron experiment, symmetry regarding time and space and angular distribution and angular correlation of radiation and particle beams, T-violation due to low temperature nuclear polarization and axion exploration using nuclear transition are collected. (K.I.)

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

OpenAIRE

Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

2004-01-01

We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

Directory of Open Access Journals (Sweden)

FIGUEIREDO Luiz Tadeu Moraes

1997-01-01

Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

Science.gov (United States)

Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

2011-12-01

Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

DEFF Research Database (Denmark)

Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

2012-01-01

To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

PdZnAl Catalysts for the Reactions of Water-Gas-Shift, Methanol Steam Reforming, and Reverse-Water-Gas-Shift

Energy Technology Data Exchange (ETDEWEB)

Dagle, Robert A.; Platon, Alexandru; Datye, Abhaya K.; Vohs, John M.; Wang, Yong; Palo, Daniel R.

2008-03-07

Pd/ZnO/Al2O3 catalysts were studied for water-gas-shift (WGS), methanol steam reforming, and reverse-water-gas-shift (RWGS) reactions. WGS activity was found to be dependent on the Pd:Zn ratio with a maximum activity obtained at approximately 0.50, which was comparable to that of a commercial Pt-based catalyst. The catalyst stability was demonstrated for 100 hours time-on-stream at a temperature of 3600C without evidence of metal sintering. WGS reaction rates were approximately 1st order with respect to CO concentration, and kinetic parameters were determined to be Ea = 58.3 kJ mol-1 and k0 = 6.1x107 min-1. During methanol steam reforming, the CO selectivities were observed to be lower than the calculated equilibrium values over a range of temperatures and steam/carbon ratios studied while the reaction rate constants were approximately of the same magnitude for both WGS and methanol steam reforming. These results indicate that although Pd/ZnO/Al2O3 are active WGS catalysts, WGS is not involved in methanol steam reforming. RWGS rate constants are on the order of about 20 times lower than that of methanol steam reforming, suggesting that RWGS reaction could be one of the sources for small amount of CO formation in methanol steam reforming.

Characterization of ion implanted silicon by the electrolytic reverse current

International Nuclear Information System (INIS)

Hueller, J.; Pham, M.T.

1977-01-01

The current voltage behaviour of ion implanted silicon electrodes in HF electrolyte is investigated. The electrolytic reverse current, i.e. the reaction rate of the minority carrier limited reactions is found to increase. The current increase depends on the implanted dose and layer stripping. Reason for the increased reverse current can be referred to radiation damage acting as generation centres for minority carriers. Measurement of the electrolytic reverse current can be used for determining damage profiles. Layer stripping is carried out by anodic dissolution in the same electrolyte. The sensitivity of this new method for characterizing ion implanted silicon layers lies at 10 11 to 10 12 atoms/cm 2 . (author)

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study

NARCIS (Netherlands)

Verhagen, C. E.; Wierenga, E. A.; Buffing, A. A.; Chand, M. A.; Faber, W. R.; Das, P. K.

1997-01-01

Borderline leprosy patients often undergo acute changes in immune reactivity that manifest as reversal reaction (RR) in the course of the disease. RR is associated with an exacerbated local delayed-type cellular immune response to Mycobacterium leprae and is responsible for severe tissue damage. We

Efficacy of aquatain, a monomolecular film, for the control of malaria vectors in rice paddies.

Directory of Open Access Journals (Sweden)

Tullu Bukhari

Full Text Available BACKGROUND: Rice paddies harbour a large variety of organisms including larvae of malaria mosquitoes. These paddies are challenging for mosquito control because their large size, slurry and vegetation make it difficult to effectively apply a control agent. Aquatain, a monomolecular surface film, can be considered a suitable mosquito control agent for such breeding habitats due to its physical properties. The properties allow Aquatain to self-spread over a water surface and affect multiple stages of the mosquito life cycle. METHODOLOGY/PRINCIPAL FINDINGS: A trial based on a pre-test/post-test control group design evaluated the potential of Aquatain as a mosquito control agent at Ahero rice irrigation scheme in Kenya. After Aquatain application at a dose of 2 ml/m(2 on rice paddies, early stage anopheline larvae were reduced by 36%, and late stage anopheline larvae by 16%. However, even at a lower dose of 1 ml/m(2 there was a 93.2% reduction in emergence of anopheline adults and 69.5% reduction in emergence of culicine adults. No pupation was observed in treated buckets that were part of a field bio-assay carried out parallel to the trial. Aquatain application saved nearly 1.7 L of water in six days from a water surface of 0.2 m(2 under field conditions. Aquatain had no negative effect on rice plants as well as on a variety of non-target organisms, except backswimmers. CONCLUSIONS/SIGNIFICANCE: We demonstrated that Aquatain is an effective agent for the control of anopheline and culicine mosquitoes in irrigated rice paddies. The agent reduced densities of aquatic larval stages and, more importantly, strongly impacted the emergence of adult mosquitoes. Aquatain also reduced water loss due to evaporation. No negative impacts were found on either abundance of non-target organisms, or growth and development of rice plants. Aquatain, therefore, appears a suitable mosquito control tool for use in rice agro-ecosystems.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Characterization of excited-state reactions with instant spectra of fluorescence kinetics

International Nuclear Information System (INIS)

Tomin, Vladimir I.; Ushakou, Dzmitryi V.

2015-01-01

Comprehensible knowledge of the excited-state proton transfer processes in organic compounds is overwhelmingly important not only for physics, but also chemistry and Life Sciences, since they play a key role in main processes of photosynthesis and functioning of biological organisms. Moreover compounds with Excited-State Intramolecular Proton Transfer (ESIPT) are in the focus of the interest of scientists throughout the world, because dual fluorescence spectra of such objects corresponding to two forms of molecular structure (normal and photoproduct) are very sensitive to characteristics of molecular microenvironment. This property allows to use such substances as fluorescent probes for diverse applications in chemistry and Life Sciences. But at the same time studying of proton transfer processes is not simple, because this process is characterized by extremely fast times (on picoseconds time scale and less order) and very often contribution of reverse reactions is essentially complicates an interpretation of observed properties of dual fluorescence. Hence, understanding of a role of reversible reactions is crucial for a comprehensive description of all processes accompanying excited state reactions. We discuss new approach for treatment ESIPT reaction on the basis of experimentally measured instant spectra of dual fluorescence and temporal behavior of ratiometric signal of normal to tautomer form intensities. Simple analytical expressions show in transparent way how to distinguish a degree of reverse reaction contribution to ratiometric signal. A validation of the approach under consideration is fulfilled with two different flavonols – 3-hydroxyflavone and 4′-(Dimethylamino)-3-hydroxyflavone – representing two extreme cases in affecting reversible reaction on dual emission. A comparing of new approach and traditional method when we analyze kinetics of separate the N* and T* fluorescence bands decays, has been carried out. - Highlights: • The excited

Characterization of excited-state reactions with instant spectra of fluorescence kinetics

Energy Technology Data Exchange (ETDEWEB)

Tomin, Vladimir I., E-mail: tomin@apsl.edu.pl; Ushakou, Dzmitryi V.

2015-10-15

Comprehensible knowledge of the excited-state proton transfer processes in organic compounds is overwhelmingly important not only for physics, but also chemistry and Life Sciences, since they play a key role in main processes of photosynthesis and functioning of biological organisms. Moreover compounds with Excited-State Intramolecular Proton Transfer (ESIPT) are in the focus of the interest of scientists throughout the world, because dual fluorescence spectra of such objects corresponding to two forms of molecular structure (normal and photoproduct) are very sensitive to characteristics of molecular microenvironment. This property allows to use such substances as fluorescent probes for diverse applications in chemistry and Life Sciences. But at the same time studying of proton transfer processes is not simple, because this process is characterized by extremely fast times (on picoseconds time scale and less order) and very often contribution of reverse reactions is essentially complicates an interpretation of observed properties of dual fluorescence. Hence, understanding of a role of reversible reactions is crucial for a comprehensive description of all processes accompanying excited state reactions. We discuss new approach for treatment ESIPT reaction on the basis of experimentally measured instant spectra of dual fluorescence and temporal behavior of ratiometric signal of normal to tautomer form intensities. Simple analytical expressions show in transparent way how to distinguish a degree of reverse reaction contribution to ratiometric signal. A validation of the approach under consideration is fulfilled with two different flavonols – 3-hydroxyflavone and 4′-(Dimethylamino)-3-hydroxyflavone – representing two extreme cases in affecting reversible reaction on dual emission. A comparing of new approach and traditional method when we analyze kinetics of separate the N* and T* fluorescence bands decays, has been carried out. - Highlights: • The excited

Electrochemical transformation of trichloroethylene in aqueous solution by electrode polarity reversal.

Science.gov (United States)

Rajic, Ljiljana; Fallahpour, Noushin; Yuan, Songhu; Alshawabkeh, Akram N

2014-12-15

Electrode polarity reversal is evaluated for electrochemical transformation of trichloroethylene (TCE) in aqueous solution using flow-through reactors with mixed metal oxide electrodes and Pd catalyst. The study tests the hypothesis that optimizing electrode polarity reversal will generate H2O2 in Pd presence in the system. The effect of polarity reversal frequency, duration of the polarity reversal intervals, current intensity and TCE concentration on TCE removal rate and removal mechanism were evaluated. TCE removal efficiencies under 6 cycles h(-1) were similar in the presence of Pd catalyst (50.3%) and without Pd catalyst (49.8%), indicating that Pd has limited impact on TCE degradation under these conditions. The overall removal efficacies after 60 min treatment under polarity reversal frequencies of 6, 10, 15, 30 and 90 cycles h(-1) were 50.3%, 56.3%, 69.3%, 34.7% and 23.4%, respectively. Increasing the frequency of polarity reversal increases TCE removal as long as sufficient charge is produced during each cycle for the reaction at the electrode. Electrode polarity reversal shifts oxidation/reduction and reduction/oxidation sequences in the system. The optimized polarity reversal frequency (15 cycles h(-1) at 60 mA) enables two reaction zones formation where reduction/oxidation occurs at each electrode surface. Published by Elsevier Ltd.

In Situ Insight into Reversible O2 Gas-Solid Reactions

DEFF Research Database (Denmark)

Wegeberg, Christina

2016-01-01

Non-porous crystalline solids containing a series of cationic tetracobalt complexes reversibly, selectively and stoichiometrically chemisorb dioxygen in temperature/O2 partial pressure induced processes involving the oxidation of cobalt with concurrent reduction of two equivalents of sorbed O2 to...

Dual kinetic curves in reversible electrochemical systems.

Directory of Open Access Journals (Sweden)

Michael J Hankins

Full Text Available We introduce dual kinetic chronoamperometry, in which reciprocal relations are established between the kinetic curves of electrochemical reactions that start from symmetrical initial conditions. We have performed numerical and experimental studies in which the kinetic curves of the electron-transfer processes are analyzed for a reversible first order reaction. Experimental tests were done with the ferrocyanide/ferricyanide system in which the concentrations of each component could be measured separately using the platinum disk/gold ring electrode. It is shown that the proper ratio of the transient kinetic curves obtained from cathodic and anodic mass transfer limited regions give thermodynamic time invariances related to the reaction quotient of the bulk concentrations. Therefore, thermodynamic time invariances can be observed at any time using the dual kinetic curves for reversible reactions. The technique provides a unique possibility to extract the non-steady state trajectory starting from one initial condition based only on the equilibrium constant and the trajectory which starts from the symmetrical initial condition. The results could impact battery technology by predicting the concentrations and currents of the underlying non-steady state processes in a wide domain from thermodynamic principles and limited kinetic information.

Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Cesare Bonacina

2010-01-01

Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

Quantifying fluctuations in reversible enzymatic cycles and clocks

Science.gov (United States)

Wierenga, Harmen; ten Wolde, Pieter Rein; Becker, Nils B.

2018-04-01

Biochemical reactions are fundamentally noisy at a molecular scale. This limits the precision of reaction networks, but it also allows fluctuation measurements that may reveal the structure and dynamics of the underlying biochemical network. Here, we study nonequilibrium reaction cycles, such as the mechanochemical cycle of molecular motors, the phosphorylation cycle of circadian clock proteins, or the transition state cycle of enzymes. Fluctuations in such cycles may be measured using either of two classical definitions of the randomness parameter, which we show to be equivalent in general microscopically reversible cycles. We define a stochastic period for reversible cycles and present analytical solutions for its moments. Furthermore, we associate the two forms of the randomness parameter with the thermodynamic uncertainty relation, which sets limits on the timing precision of the cycle in terms of thermodynamic quantities. Our results should prove useful also for the study of temporal fluctuations in more general networks.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Rapid Hydrogen Shift Reactions in Acyl Peroxy Radicals

DEFF Research Database (Denmark)

Knap, Hasse Christian; Jørgensen, Solvejg

2017-01-01

-shift with X = 6, 7, 8, or 9) in the hydroperoxy acyl peroxy radicals, this H-shift is a reversible reaction and it scrambles between two peroxides, hydroperoxy acyl peroxy and peroxy peroxoic acid radicals. The forward reaction rate constants of the 1,X-OOH H-shift reactions are estimated to be above 103 s–1...... with transition state theory corrected with Eckart quantum tunnelling correction. The ratio between the forward and reverse reaction rate constant of the 1,X-OOH H-shift reactions is around ∼105. Therefore, the equilibrium is pushed toward the production of peroxy peroxoic acid radicals. These very fast 1,X-OOH H......We have used quantum mechanical chemical calculations (CCSD(T)-F12a/cc-pVDZ-F12//M06-2X/aug-cc-pVTZ) to investigate the hydrogen shift (H-shift) reactions in acyl peroxy and hydroperoxy acyl peroxy radicals. We have focused on the H-shift reactions from a hydroperoxy group (OOH) (1,X-OOH H...

Luminescence quenching by reversible ionization or exciplex formation/dissociation.

Science.gov (United States)

Ivanov, Anatoly I; Burshtein, Anatoly I

2008-11-20

The kinetics of fluorescence quenching by both charge transfer and exciplex formation is investigated, with an emphasis on the reversibility and nonstationarity of the reactions. The Weller elementary kinetic scheme of bimolecular geminate ionization and the Markovian rate theory are shown to lead to identical results, provided the rates of the forward and backward reactions account for the numerous recontacts during the reaction encounter. For excitation quenching by the reversible exciplex formation, the Stern-Volmer constant is specified in the framework of the integral encounter theory. The bulk recombination affecting the Stern-Volmer quenching constant makes it different for pulse excited and stationary luminescence. The theory approves that the free energy gap laws for ionization and exciplex formation are different and only the latter fits properly the available data (for lumiflavin quenching by aliphatic amines and aromatic donors) in the endergonic region.

Recycling tires? Reversible crosslinking of poly(butadiene).

Science.gov (United States)

Trovatti, Eliane; Lacerda, Talita M; Carvalho, Antonio J F; Gandini, Alessandro

2015-04-01

Furan-modified poly(butadiene) prepared by the thiol-ene click reaction is crosslinked with bismaleimides through the Diels-Alder reaction, giving rise to a novel recyclable elastomer. This is possible because of the thermal reversibility of the adducts responsible for the formation of the network. The use of this strategy provides the possibility to produce recyclable tires. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Requirements for DNA strand transfer during reverse transcription in mutant HIV-1 virions

NARCIS (Netherlands)

Berkhout, B.; van Wamel, J.; Klaver, B.

1995-01-01

Retroviruses convert their RNA genome into a DNA form by means of reverse transcription. According to the current model of reverse transcription, two strand transfer reactions are needed to synthesize a full-length DNA genome. Because reverse transcription is initiated close to the 5' end of the RNA

The effect of catalyst support on the RWGS reaction

International Nuclear Information System (INIS)

Laosiripojana, N.; Sutthisripok, W.

2004-01-01

'Full text:' Methane steam reforming is generally applied in order to produce synthesis gas mainly consist of hydrogen and carbon monoxide for later utilization in SOFC. This reaction is always carried out with the water gas shift reaction over a catalyst at elevated temperatures resulting in some carbon dioxide production. The CO/CO2 production selectivity strongly depends on the influence of water gas shift reaction. It was observed that the reactivity of this reaction depended on the type of support material. Stabilities, activities, and kinetics of the reverse water gas shift reaction (RWGS) for commercial nickel on CeO2, ZrO2, CeO2-ZrO2, TiO2, MgO, and Al2O3 supports were studied in order to observe the influence of the support on this reaction. According to the experiment, the activities of Ni/CeO2 toward the reverse water gas shift reaction (RWGS) were very high, and reached equilibrium level at approximately 600 o C (where the conversion of CO2 was closed to 1). Other oxide supports provided lower activities toward this reaction. It was observed that the activity of Ni/Al2O3 toward this reaction was the lowest. The kinetics of this reaction was also studied. Carbon dioxide presented positive effect on the reverse water gas shift reaction. The reaction orders in carbon dioxide were observed to be positive partial value between 0-1. It slightly decreased with increasing temperature for Ni/ CeO2 and Ni/CeO2-ZrO2, whereas it seemed to be independent of the operating temperature for other materials in the range of conditions studied. Hydrogen also showed positive effect on the reverse water gas shift reaction for all materials. The reaction order in hydrogen for all materials was observed to be the positive value and less than one for the range of conditions studied. The approximate values for all catalysts were between 0.45-0.65, and seemed to be independent of the operating temperature. The estimated values of the apparent activation energy for RWGS reaction

How decision reversibility affects motivation.

Science.gov (United States)

Bullens, Lottie; van Harreveld, Frenk; Förster, Jens; Higgins, Tory E

2014-04-01

The present research examined how decision reversibility can affect motivation. On the basis of extant findings, it was suggested that 1 way it could affect motivation would be to strengthen different regulatory foci, with reversible decision making, compared to irreversible decision making, strengthening prevention-related motivation relatively more than promotion-related motivation. If so, then decision reversibility should have effects associated with the relative differences between prevention and promotion motivation. In 5 studies, we manipulated the reversibility of a decision and used different indicators of regulatory focus motivation to test these predictions. Specifically, Study 1 tested for differences in participants' preference for approach versus avoidance strategies toward a desired end state. In Study 2, we used speed and accuracy performance as indicators of participants' regulatory motivation, and in Study 3, we measured global versus local reaction time performance. In Study 4, we approached the research question in a different way, making use of the value-from-fit hypothesis (Higgins, 2000, 2002). We tested whether a fit between chronic regulatory focus and focus induced by the reversibility of the decision increased participants' subjective positive feelings about the decision outcome. Finally, in Study 5, we tested whether regulatory motivation, induced by decision reversibility, also influenced participants' preference in specific product features. The results generally support our hypothesis showing that, compared to irreversible decisions, reversible decisions strengthen a prevention focus more than a promotion focus. Implications for research on decision making are discussed.

HIV-1 reverse transcription initiation: a potential target for novel antivirals?

NARCIS (Netherlands)

Abbink, Truus E. M.; Berkhout, Ben

2008-01-01

Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

Science.gov (United States)

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

On the ambiguity of the reaction rate constants in multivariate curve resolution for reversible first-order reaction systems.

Science.gov (United States)

Schröder, Henning; Sawall, Mathias; Kubis, Christoph; Selent, Detlef; Hess, Dieter; Franke, Robert; Börner, Armin; Neymeyr, Klaus

2016-07-13

If for a chemical reaction with a known reaction mechanism the concentration profiles are accessible only for certain species, e.g. only for the main product, then often the reaction rate constants cannot uniquely be determined from the concentration data. This is a well-known fact which includes the so-called slow-fast ambiguity. This work combines the question of unique or non-unique reaction rate constants with factor analytic methods of chemometrics. The idea is to reduce the rotational ambiguity of pure component factorizations by considering only those concentration factors which are possible solutions of the kinetic equations for a properly adapted set of reaction rate constants. The resulting set of reaction rate constants corresponds to those solutions of the rate equations which appear as feasible factors in a pure component factorization. The new analysis of the ambiguity of reaction rate constants extends recent research activities on the Area of Feasible Solutions (AFS). The consistency with a given chemical reaction scheme is shown to be a valuable tool in order to reduce the AFS. The new methods are applied to model and experimental data. Copyright © 2016 Elsevier B.V. All rights reserved.

Compound nucleus studies withy reverse kinematics

International Nuclear Information System (INIS)

Moretto, L.G.

1985-06-01

Reverse kinematics reactions are used to demonstrate the compound nucleus origin of intermediate mass particles at low energies and the extension of the same mechanism at higher energies. No evidence has appeared in our energy range for liquid-vapor equilibrium or cold fragmentation mechanisms. 11 refs., 12 figs

Reverse micelles as suitable microreactor for increased biohydrogen production

Energy Technology Data Exchange (ETDEWEB)

Pandey, Anjana [Nanotechnology and Molecular Biology Laboratory, Centre of Biotechnology, University of Allahabad, Allahabad 211002 (India); Pandey, Ashutosh [Centre of Energy Studies, MNNIT, Allahabad 211004 (India)

2008-01-15

Reverse micelles have been shown to act as efficient microreactors for enzymic reactions and whole cell entrapment in organic (non-aqueous) media wherein the reactants are protected from denaturation by the surrounding organic solvent. These micelles are thermodynamically stable, micrometer sized water droplets dispersed in an organic phase by a surfactant. It has been observed that when whole cells of photosynthetic bacteria (Rhodopseudomonas sphaeroides or Rhodobacter sphaeroides 2.4.1) are entrapped inside these reverse micelles, the H{sub 2} production enhanced from 25 to 35 folds. That is, 1.71mmol(mgprotein){sup -1}h{sup -1} in case of R. sphaeroides which is 25 fold higher in benzene-sodium lauryl sulfate reverse micelles. Whereas, in case of R. sphaeroides 2.4.1 the H{sub 2} production was increased by 35 fold within AOT-isooctane reverse micelles i.e. 11.5mmol(mgprotein){sup -1}h{sup -1}. The observations indicate that the entrapment of whole cells of microbes within reverse micelles provides a novel and efficient technique to produce hydrogen by the inexhaustible biological route. The two microorganisms R. sphaeroides 2.4.1 (a photosynthetic bacteria) and Citrobacter Y19 (a facultative anaerobic bacteria) together are also entrapped within AOT-isooctane and H{sub 2} production was measured i.e. 69mmol(mgprotein){sup -1}h{sup -1}. The nitrogenase enzyme responsible for hydrogen production by R. sphaeroides/R. sphaeroides 2.4.1 cells is oxygen sensitive, and very well protected within reverse micelles by the use of combined approach of two cells (R. sphaeroides 2.4.1 and Citrobacter Y19). In this case glucose present in the medium of Citrobacter Y19 serves double roles in enhancing the sustained production rate of hydrogen. Firstly, it quenches the free O{sub 2}liberated as a side product of reaction catalyzed by nitrogenase, which is O{sub 2} labile. Secondly, organic acid produced by this reaction is utilized by the Citrobacter Y19 as organic substrate in

Experimental study of line reversal symmetry in the reactions anti pp→π-π+ and π+p→pπ+ at 6 GeV/c

International Nuclear Information System (INIS)

Stein, N.A.

1977-01-01

The differential cross sections were measured for several two body and quasi-two body baryon exchange scattering channels at 6 GeV/c in a spark chamber-counter experiment utilizing the Brookhaven National Laboratory Multi-Particle Spectrometer. Among these is a comparison study of anti pp→π - π + and its line reversed partner π + p→pπ + in the range t/sub min/ > t > -1.5 (GeV/c) 2 . For the first time structure analogous to the striking dip in the backward elastic scattering reaction at t approx. -0.15 (GeV/c) 2 is observed in the annihilation reaction. The structure which appears as a break in the t slope at t approx. -0.40 (GeV/c) 2 and perhaps a shallow dip at that point, demonstrates the strong role played by absorption in these channels

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

Science.gov (United States)

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

Photochemical reactions in dehydrated photosynthetic organisms, leaves, chloroplasts and photosystem II particles: reversible reduction of pheophytin and chlorophyll and oxidation of {beta}-carotene

Energy Technology Data Exchange (ETDEWEB)

Shuvalov, Vladimir A.; Heber, Ulrich

2003-11-01

Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q{sub A} in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of {beta}-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of {beta}-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680{sup -} or Car{sup +} in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q{sub A} reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680{sup +} with consequent recombination of

Photochemical reactions in dehydrated photosynthetic organisms, leaves, chloroplasts and photosystem II particles: reversible reduction of pheophytin and chlorophyll and oxidation of β-carotene

International Nuclear Information System (INIS)

Shuvalov, Vladimir A.; Heber, Ulrich

2003-01-01

Photoreactions of dehydrated leaves, isolated broken chloroplasts and PSII membrane fragments of spinach (Spinacia oleracea) were studied at different air humidities and compared with photoreactions of dry fronds of a fern, Polypodium vulgare, and a dry lichen, Parmelia sulcata, which in contrast to spinach are insensitive to photoinactivation in the dry state. Even in very dry air, P700 in the reaction center of photosystem I of dry leaves was oxidized, and the primary quinone acceptor Q A in the reaction center of photosystem II was photoreduced by low light. These reactions were only very slowly reversed in the dark and saturated under low light intensity. Light-minus-dark difference absorption spectra of the dry leaves, isolated chloroplasts and PSII membrane fragments measured at higher light intensities revealed absorbance changes of β-carotene at 500 nm (light-dependent bleaching) and 980 nm (light-dependent band formation) and bleaching of chlorophyll at 436 and 680 nm with appearance of bands at 450 and 800 nm. Decrease of chlorophyll fluorescence upon strong illumination indicated photoaccumulation of a quencher. All these changes were kinetically related and readily reversible. They are interpreted to show light-induced oxidation of β-carotene (Car) and reduction of chlorophyll-680 (Chl-680) in the reaction center of photosystem II of the dried leaves, chloroplasts and photosystem II particles. The fluorescence quencher was suggested to be Chl-680 - or Car + in close proximity to P680, the primary electron donor. Appreciable photoaccumulation of reduced pheophytin was only observed in dry leaves after Q A reduction had been lost during heat treatment of hydrated leaves prior to dehydration. The observations are interpreted to show light-dependent cyclic electron flow within the reaction center of photosystem II in which Chl-680 (or Pheo) is reduced by P680* and Car is oxidized by P680 + with consequent recombination of Car + and Chl-680 - (or Pheo

Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

Directory of Open Access Journals (Sweden)

Raden Wasito

2015-05-01

Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

Remendable Polymeric Materials Using Reversible Covalent Bonds

Science.gov (United States)

2008-12-01

response in poly(ethylene-co-methacrylic acid ) copolymers. Journal of The Royal Society Interface, 4, 405-411. Kavitha, A. A., and N. K. Singha...2007: A tailor-made polymethacrylate bearing a reactive diene in reversible diels-alder reaction. J. Polym. Sci. A Polym. Chem., 45, 4441-4449

Reversible S-nitrosylation in an engineered azurin

Energy Technology Data Exchange (ETDEWEB)

Tian, Shiliang; Liu, Jing; Cowley, Ryan E.; Hosseinzadeh, Parisa; Marshall, Nicholas M.; Yu, Yang; Robinson, Howard; Nilges, Mark J.; Blackburn, Ninian J.; Solomon, Edward I.; Lu, Yi

2016-04-25

S-Nitrosothiols are known as reagents for NO storage and transportation and as regulators in many physiological processes. Although the S-nitrosylation catalysed by haem proteins is well known, no direct evidence of S-nitrosylation in copper proteins has been reported. Here, we report reversible insertion of NO into a copper–thiolate bond in an engineered copper centre in Pseudomonas aeruginosa azurin by rational design of the primary coordination sphere and tuning its reduction potential by deleting a hydrogen bond in the secondary coordination sphere. The results not only provide the first direct evidence of S-nitrosylation of Cu(II)-bound cysteine in metalloproteins, but also shed light on the reaction mechanism and structural features responsible for stabilizing the elusive Cu(I)–S(Cys)NO species. The fast, efficient and reversible S-nitrosylation reaction is used to demonstrate its ability to prevent NO inhibition of cytochrome bo3 oxidase activity by competing for NO binding with the native enzyme under physiologically relevant conditions.

Nonequilibrium thermodynamics and a fluctuation theorem for individual reaction steps in a chemical reaction network

International Nuclear Information System (INIS)

Pal, Krishnendu; Das, Biswajit; Banerjee, Kinshuk; Gangopadhyay, Gautam

2015-01-01

We have introduced an approach to nonequilibrium thermodynamics of an open chemical reaction network in terms of the propensities of the individual elementary reactions and the corresponding reverse reactions. The method is a microscopic formulation of the dissipation function in terms of the relative entropy or Kullback-Leibler distance which is based on the analogy of phase space trajectory with the path of elementary reactions in a network of chemical process. We have introduced here a fluctuation theorem valid for each opposite pair of elementary reactions which is useful in determining the contribution of each sub-reaction on the nonequilibrium thermodynamics of overall reaction. The methodology is applied to an oligomeric enzyme kinetics at a chemiostatic condition that leads the reaction to a nonequilibrium steady state for which we have estimated how each step of the reaction is energy driven or entropy driven to contribute to the overall reaction. (paper)

Organocatalytic aza-Michael/retro-aza-Michael reaction: pronounced chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction.

Science.gov (United States)

Cai, Yong-Feng; Li, Li; Luo, Meng-Xian; Yang, Ke-Fang; Lai, Guo-Qiao; Jiang, Jian-Xiong; Xu, Li-Wen

2011-05-01

A detailed experimental investigation of an aza-Michael reaction of aniline and chalcone is presented. A series of Cinchona alkaloid-derived organocatalysts with different functional groups were prepared and used in the aza-Michael and retro-aza-Michael reaction. There was an interesting finding that a complete reversal of stereoselectivity when a benzoyl group was introduced to the cinchonine and cinchonidine. The chirality amplification vs. time proceeds in the quinine-derived organocatalyst containing silicon-based bulky group, QN-TBS, -catalyzed aza-Michael reaction under solvent-free conditions. In addition, we have demonstrated for the first time that racemization was occurred in suitable solvents under mild conditions due to retro-aza-Michael reaction of the Michael adduct of aniline with chalcone. These indicate the equilibrium of retro-aza-Michael reaction and aza-Michael reaction produce the happening of chirality amplification in aza-Michael reaction and racemization via retro-aza-Michael reaction under different conditions, which would be beneficial to the development of novel chiral catalysts for the aza-Michael reactions. Copyright © 2011 Wiley-Liss, Inc.

Reaction Formulation: A Bibliography.

Science.gov (United States)

Pedrini, D. T.; Pedrini, Bonnie C.

Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol

NARCIS (Netherlands)

Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; Van Den Berg, Albert; Olthuis, Wouter; Pascual-García, César

2017-01-01

The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used

Scandium(III) catalysis of transimination reactions. Independent and constitutionally coupled reversible processes.

Science.gov (United States)

Giuseppone, Nicolas; Schmitt, Jean-Louis; Schwartz, Evan; Lehn, Jean-Marie

2005-04-20

Sc(OTf)(3) efficiently catalyzes the self-sufficient transimination reaction between various types of C=N bonds in organic solvents, with turnover frequencies up to 3600 h(-)(1) and rate accelerations up to 6 x 10(5). The mechanism of the crossover reaction in mixtures of amines and imines is studied, comparing parallel individual reactions with coupled equilibria. The intrinsic kinetic parameters for isolated reactions cannot simply be added up when several components are mixed, and the behavior of the system agrees with the presence of a unique mediator that constitutes the core of a network of competing reactions. In mixed systems, every single amine or imine competes for the same central hub, in accordance with their binding affinity for the catalyst metal ion center. More generally, the study extends the basic principles of constitutional dynamic chemistry to interconnected chemical transformations and provides a step toward dynamic systems of increasing complexity.

Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

Science.gov (United States)

Mo, Yiqun; Wan, Rong; Zhang, Qunwei

2012-01-01

Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

Mitsuda's reactions: induced by BCG in the normal Rhesus ("Macacca mulatta"

Directory of Open Access Journals (Sweden)

M. J. Pereira Filho

1955-12-01

Full Text Available The reversals of Mitsuda's reactions induced by BCG have been objected to based on the possiblem interference of other determination causes of the phenomenon: tuberculous primo-infections, communicants of unsuspected leprosy, revearsals due to other causes, such as anti-diphteric and anti-tetanic vaccination, etc. In order to study the problem, we have used Rhesus monkeys (Macaca mulatta, which were reared in isolation, in an attempt to avoid the referred to interferences. Prior to the experiments, all animals were tested and found negative to radiograph, tuberculin and lepromin tests and were then submitted to the application of BCG vaccine (from 1 to 3 days old, in different doses and by different via. At different times, after the application of BCG, they were again submitted to the radiographic, tuberculin and lepromin tests. In the tables I to IV the experiences were summarised. From the experiments, the following conclusions were reached: 1 - From 12 Rhesus that received BCG 11 showed reversals of the Mitsuda reaction (91.7%. 2 - These reverseals took place both in tests effected shortly after BCG (from 6 days to 2 months, and tests effected much later (from 7 to 12 months after BCG. 3 - Some differences were found in the results, according to the dosis and the application via of the BCG. a - The testicular and peritonela via (0,02g were the only that determined strong positive Mitsuda's reactions (+++. b - By oral via, animals that received high dosis (0.6g and 1.2 g, there resulted uniform and regular reversals, even though of low intensity (+; but from those who got small doses (0.2 g. one showed no reversals in all tests, and the other presented reversals in the 2nd and 3rd tests only, also with low positivity (+. 4 In the 2nd and 3rd Mitsuda's reactions in the same animals, positivity was always precocious (generally within 48 hours, one getting the impression that there occurs a sensibilization of the animal body by the antigen with

Moessbauer spectroscopy study on the hydrothermal transformation α-FeOOH → α-Fe2O3

International Nuclear Information System (INIS)

Barb, D.; Diamandescu, L.; Mihaila-Tarabsanu, D.; Rusi, A.; Moraria, M.

1990-01-01

The reaction kinetics of the hydrothermal transformation α-FeOOH→α-Fe 2 O 3 was studied by means of Moessbauer spectroscopy. From the reaction isotherms, a monomolecular, first order reaction was found to characterise the hydrothermal transformation of alpha oxihydroxide to the alpha iron oxide. The rate constant as well as the activation energy of this process were determined. No intermediate phases were identified in the hydrothermal samples. The thermodynamic properties of the hydrothermal system α-FeOOH→α-Fe 2 O 3 in correlation with Moessbauer spectroscopy data are discussed. (orig.)

A primordial and reversible TCA cycle in a facultatively chemolithoautotrophic thermophile.

Science.gov (United States)

Nunoura, Takuro; Chikaraishi, Yoshito; Izaki, Rikihisa; Suwa, Takashi; Sato, Takaaki; Harada, Takeshi; Mori, Koji; Kato, Yumiko; Miyazaki, Masayuki; Shimamura, Shigeru; Yanagawa, Katsunori; Shuto, Aya; Ohkouchi, Naohiko; Fujita, Nobuyuki; Takaki, Yoshihiro; Atomi, Haruyuki; Takai, Ken

2018-02-02

Inorganic carbon fixation is essential to sustain life on Earth, and the reductive tricarboxylic acid (rTCA) cycle is one of the most ancient carbon fixation metabolisms. A combination of genomic, enzymatic, and metabolomic analyses of a deeply branching chemolithotrophic Thermosulfidibacter takaii ABI70S6 T revealed a previously unknown reversible TCA cycle whose direction was controlled by the available carbon source(s). Under a chemolithoautotrophic condition, a rTCA cycle occurred with the reverse reaction of citrate synthase (CS) and not with the adenosine 5'-triphosphate-dependent citrate cleavage reactions that had been regarded as essential for the conventional rTCA cycle. Phylometabolic evaluation suggests that the TCA cycle with reversible CS may represent an ancestral mode of the rTCA cycle and raises the possibility of a facultatively chemolithomixotrophic origin of life. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

Reconstitution of wild type viral DNA in simian cells transfected with early and late SV40 defective genomes.

Science.gov (United States)

O'Neill, F J; Gao, Y; Xu, X

1993-11-01

The DNAs of polyomaviruses ordinarily exist as a single circular molecule of approximately 5000 base pairs. Variants of SV40, BKV and JCV have been described which contain two complementing defective DNA molecules. These defectives, which form a bipartite genome structure, contain either the viral early region or the late region. The defectives have the unique property of being able to tolerate variable sized reiterations of regulatory and terminus region sequences, and portions of the coding region. They can also exchange coding region sequences with other polyomaviruses. It has been suggested that the bipartite genome structure might be a stage in the evolution of polyomaviruses which can uniquely sustain genome and sequence diversity. However, it is not known if the regulatory and terminus region sequences are highly mutable. Also, it is not known if the bipartite genome structure is reversible and what the conditions might be which would favor restoration of the monomolecular genome structure. We addressed the first question by sequencing the reiterated regulatory and terminus regions of E- and L-SV40 DNAs. This revealed a large number of mutations in the regulatory regions of the defective genomes, including deletions, insertions, rearrangements and base substitutions. We also detected insertions and base substitutions in the T-antigen gene. We addressed the second question by introducing into permissive simian cells, E- and L-SV40 genomes which had been engineered to contain only a single regulatory region. Analysis of viral DNA from transfected cells demonstrated recombined genomes containing a wild type monomolecular DNA structure. However, the complete defectives, containing reiterated regulatory regions, could often compete away the wild type genomes. The recombinant monomolecular genomes were isolated, cloned and found to be infectious. All of the DNA alterations identified in one of the regulatory regions of E-SV40 DNA were present in the recombinant

Redox behavior of transition metal ions in zeolites 6. Reversibility of the reduction reaction in silver zeolites

Energy Technology Data Exchange (ETDEWEB)

Jacobs, P A; Uytterhoeven, J B; Beyer, H K

1977-01-01

Degassing above 573/sup 0/K of Ag-Y or Ag-mordenite previously reduced by hydrogen at 623/sup 0/K resulted in hydrogen evolution, the amount of hydrogen increasing to a maximum at about 873/sup 0/K. No hydrogen was evolved when the zeolite was reduced by hydrazine or hydroxylamine, indicating that hydrogen is formed by reaction between silver metal and hydroxyl groups formed in the reduction step (i.e., the reverse of the reduction step). Consumption of hydroxyl groups was proven by IR studies of pyridine chemisorption which occurs entirely as pyridinium ions on Broensted sites or reduced samples but with increasing formation of pyridine on Lewis acid sites as the degassing temperature increases; formation of silver(I) ions was proven by carbon monoxide complexation. Silver metal outside the zeolite pores was not affected by the degassing, and the amount of hydrogen evolved upon degassing decreased with increasing number of reduction-degassing cycles, probably as a result of dehydroxylation or sintering. Spectra, graphs, tables, and 21 references.

LSM-YSZ Reactions in Different Atmospheres

DEFF Research Database (Denmark)

Chen, Ming; Liu, Yi-Lin; Hagen, Anke

2009-01-01

-powder reaction. LSM reacts differently with YSZ in different atmospheres. In air, m-ZrO2 (monoclinic) is formed; while in N2, SrZrO3 and/or La2Zr2O7 are formed depending on the initial LSM/YSZ ratio. The reactions are reversible with varying P(O2) i.e. treating the sample in air after the heat treatment in N2...

Studying protein assembly with reversible Brownian dynamics of patchy particles

International Nuclear Information System (INIS)

Klein, Heinrich C. R.; Schwarz, Ulrich S.

2014-01-01

Assembly of protein complexes like virus shells, the centriole, the nuclear pore complex, or the actin cytoskeleton is strongly determined by their spatial structure. Moreover, it is becoming increasingly clear that the reversible nature of protein assembly is also an essential element for their biological function. Here we introduce a computational approach for the Brownian dynamics of patchy particles with anisotropic assemblies and fully reversible reactions. Different particles stochastically associate and dissociate with microscopic reaction rates depending on their relative spatial positions. The translational and rotational diffusive properties of all protein complexes are evaluated on-the-fly. Because we focus on reversible assembly, we introduce a scheme which ensures detailed balance for patchy particles. We then show how the macroscopic rates follow from the microscopic ones. As an instructive example, we study the assembly of a pentameric ring structure, for which we find excellent agreement between simulation results and a macroscopic kinetic description without any adjustable parameters. This demonstrates that our approach correctly accounts for both the diffusive and reactive processes involved in protein assembly

Studying protein assembly with reversible Brownian dynamics of patchy particles

Energy Technology Data Exchange (ETDEWEB)

Klein, Heinrich C. R. [Institute for Theoretical Physics, Heidelberg University, 69120 Heidelberg (Germany); Schwarz, Ulrich S., E-mail: ulrich.schwarz@bioquant.uni-heidelberg.de [Institute for Theoretical Physics, Heidelberg University, 69120 Heidelberg (Germany); BioQuant, Heidelberg University, 69120 Heidelberg (Germany)

2014-05-14

Assembly of protein complexes like virus shells, the centriole, the nuclear pore complex, or the actin cytoskeleton is strongly determined by their spatial structure. Moreover, it is becoming increasingly clear that the reversible nature of protein assembly is also an essential element for their biological function. Here we introduce a computational approach for the Brownian dynamics of patchy particles with anisotropic assemblies and fully reversible reactions. Different particles stochastically associate and dissociate with microscopic reaction rates depending on their relative spatial positions. The translational and rotational diffusive properties of all protein complexes are evaluated on-the-fly. Because we focus on reversible assembly, we introduce a scheme which ensures detailed balance for patchy particles. We then show how the macroscopic rates follow from the microscopic ones. As an instructive example, we study the assembly of a pentameric ring structure, for which we find excellent agreement between simulation results and a macroscopic kinetic description without any adjustable parameters. This demonstrates that our approach correctly accounts for both the diffusive and reactive processes involved in protein assembly.

Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle

DEFF Research Database (Denmark)

Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

1999-01-01

A reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for detection of bovine respiratory syncytial virus (BRSV) in lung tissue of naturally and experimentally infected cattle. Primers were selected from the gene coding the F fusion protein, which is relatively conserved......, in addition, 10 animals that were negative with the ELISA were positive with the RT-PCR assay. These results indicates that the RT-PCR assay can be a sensitive, reliable alternative to conventional diagnostic procedures....... among BRSV isolates. The RT-PCR assay was highly specific, it yielded positive reactions only when performed on BRSV-infected cell cultures or tissues. The detection limit of the RT-PCR assay was assessed as 5 TCID50. BRSV was detected in tissues of the respiratory tract and in the tracheobroncheal...

Leprosy reactions in postelimination stage: the Bangladesh experience.

Science.gov (United States)

Mowla, M R; Ara, S; Mizanur Rahman, A F M; Tripura, S P; Paul, S

2017-04-01

Leprosy reactions are immunologically mediated conditions and a major cause of disability before, during and after multidrug therapy (MDT). Little data have been published on the epidemiology of leprosy reactions in Bangladesh. To describe the pattern and prevalence of leprosy reactions in the postelimination stage. A descriptive retrospective cross-sectional study was carried out in Chittagong Medical College Hospital using the registered records of patients in the period between 2004 and 2013. Of the 670 patients with leprosy, 488 (73.38%) were males and 182 (27.37%) were females. The prevalence of reaction was in 300 (44.78%) patients with a male:female ratio of 3.55 : 1. The age-specific cumulative reaction cases at >40 years were 115 (38.33%) among all age groups. The prevalence of reaction was found to be in 166 (55.33%) patients for the reversal reaction, 49 (16.57%) for the erythema nodosum leprosum (ENL) and 85 (28.33%) for the neuritis. Borderline tuberculoid was most common (106, 35.33%)in the reversal reaction group, while lepromatous leprosy was most common (37, 12.33%) in ENL group. More than half of the patients (169, 56.33%) had reactions at the time of presentations, while 85 (28.33%) and 46 (15.33%) patients developed reaction during and after MDT, respectively. The reversal reaction group presented with ≥six skin lesions in 96 (57.83%) patients and ≥two nerve function impairments (NFIs) in 107 (64.46%) patients. The ENL was present chiefly as papulo-nodular lesions in 45 (91.84%) patients followed by pustule-necrotic lesions in four (8.16%), neuritis in 33 (67.35%), fever in 24 (48.98%), lymphadenitis in six (12.24%), arthritis in five (10.20%) and iritis in two (4.08%). Bacterial index ≥3 had been demonstrated in 34 (60.71%) patients in ENL group. The incidence of leprosy reaction seemed to be more than three times common in borderline tuberculoid (52.33%) group than in lepromatous leprosy (14%) group. Reactions with NFI and disability

Relationship between thermodynamic driving force and one-way fluxes in reversible processes.

Directory of Open Access Journals (Sweden)

Daniel A Beard

Full Text Available Chemical reaction systems operating in nonequilibrium open-system states arise in a great number of contexts, including the study of living organisms, in which chemical reactions, in general, are far from equilibrium. Here we introduce a theorem that relates forward and reverse fluxes and free energy for any chemical process operating in a steady state. This relationship, which is a generalization of equilibrium conditions to the case of a chemical process occurring in a nonequilibrium steady state in dilute solution, provides a novel equivalent definition for chemical reaction free energy. In addition, it is shown that previously unrelated theories introduced by Ussing and Hodgkin and Huxley for transport of ions across membranes, Hill for catalytic cycle fluxes, and Crooks for entropy production in microscopically reversible systems, are united in a common framework based on this relationship.

Price reactions when consumers are concerned about pro-social reputation

DEFF Research Database (Denmark)

Kahsay, Goytom Abraha; Andersen, Laura Mørch; Hansen, Lars Gårn

In this paper, we propose a reputation-signalling model of demand for consumer goods containing pro-social characteristics such as a ‘fair trade’ or ‘organic’ certification. We show that reputation signalling can reverse price reactions resembling the crowding-out of pre-existing motives for pro-......-social behavior seen in situations of volunteering and charitable giving. Finally, using a unique combination of questionnaire and purchase panel data, we present evidence of such reputation-driven reversal of price reactions in the Danish market for organic milk....

Pressure effects on enzyme reactions in mainly organic media: alpha-chymotrypsin in reversed micelles of Aerosol OT in octane.

Science.gov (United States)

Mozhaev, V V; Bec, N; Balny, C

1994-08-01

Biocatalytic transformations in reversed micelles formed by anionic surfactant Aerosol OT in octane have been studied at high pressures by an example of alpha-chymotrypsin-catalyzed hydrolysis of N-carbobenzoxy-L-tyrosine p-nitrophenyl ester and N-succinyl-L-phenylalanine p-nitroanilide. For the first time it has been found that the enzyme retains high activity in these water-in-oil microemulsions up to a pressure of 2 kbar. The value of the activation volume (delta V*) for the enzyme reactions shows a dependence on the water content in the system. When the size of the micellar aqueous inner cavity (as evaluated at 1 atm) approaches the molecular size of alpha-chymotrypsin, delta V* becomes significantly different from the value in aqueous solution and in the micelles with a larger size. Possibilities of regulating the enzyme activity by pressure in systems with a low content of water are discussed.

An integrated open framework for thermodynamics of reactions that combines accuracy and coverage.

Science.gov (United States)

Noor, Elad; Bar-Even, Arren; Flamholz, Avi; Lubling, Yaniv; Davidi, Dan; Milo, Ron

2012-08-01

The laws of thermodynamics describe a direct, quantitative relationship between metabolite concentrations and reaction directionality. Despite great efforts, thermodynamic data suffer from limited coverage, scattered accessibility and non-standard annotations. We present a framework for unifying thermodynamic data from multiple sources and demonstrate two new techniques for extrapolating the Gibbs energies of unmeasured reactions and conditions. Both methods account for changes in cellular conditions (pH, ionic strength, etc.) by using linear regression over the ΔG(○) of pseudoisomers and reactions. The Pseudoisomeric Reactant Contribution method systematically infers compound formation energies using measured K' and pK(a) data. The Pseudoisomeric Group Contribution method extends the group contribution method and achieves a high coverage of unmeasured reactions. We define a continuous index that predicts the reversibility of a reaction under a given physiological concentration range. In the characteristic physiological range 3μM-3mM, we find that roughly half of the reactions in Escherichia coli's metabolism are reversible. These new tools can increase the accuracy of thermodynamic-based models, especially in non-standard pH and ionic strengths. The reversibility index can help modelers decide which reactions are reversible in physiological conditions. Freely available on the web at: http://equilibrator.weizmann.ac.il. Website implemented in Python, MySQL, Apache and Django, with all major browsers supported. The framework is open-source (code.google.com/p/milo-lab), implemented in pure Python and tested mainly on Linux. ron.milo@weizmann.ac.il Supplementary data are available at Bioinformatics online.

An integrated open framework for thermodynamics of reactions that combines accuracy and coverage

Science.gov (United States)

Noor, Elad; Bar-Even, Arren; Flamholz, Avi; Lubling, Yaniv; Davidi, Dan; Milo, Ron

2012-01-01

Motivation: The laws of thermodynamics describe a direct, quantitative relationship between metabolite concentrations and reaction directionality. Despite great efforts, thermodynamic data suffer from limited coverage, scattered accessibility and non-standard annotations. We present a framework for unifying thermodynamic data from multiple sources and demonstrate two new techniques for extrapolating the Gibbs energies of unmeasured reactions and conditions. Results: Both methods account for changes in cellular conditions (pH, ionic strength, etc.) by using linear regression over the ΔG○ of pseudoisomers and reactions. The Pseudoisomeric Reactant Contribution method systematically infers compound formation energies using measured K′ and pKa data. The Pseudoisomeric Group Contribution method extends the group contribution method and achieves a high coverage of unmeasured reactions. We define a continuous index that predicts the reversibility of a reaction under a given physiological concentration range. In the characteristic physiological range 3μM–3mM, we find that roughly half of the reactions in Escherichia coli's metabolism are reversible. These new tools can increase the accuracy of thermodynamic-based models, especially in non-standard pH and ionic strengths. The reversibility index can help modelers decide which reactions are reversible in physiological conditions. Availability: Freely available on the web at: http://equilibrator.weizmann.ac.il. Website implemented in Python, MySQL, Apache and Django, with all major browsers supported. The framework is open-source (code.google.com/p/milo-lab), implemented in pure Python and tested mainly on Linux. Contact: ron.milo@weizmann.ac.il Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:22645166

Lipid oxidation. Part. 1. Effect of free carboxyl group on the decomposition of lipid hydroperoxide.

Science.gov (United States)

Pokorný, J; Rzepa, J; Janícek, G

1976-01-01

Hydroperoxido butyl oleate was decomposed by heating in excess palmitic acid at 60-120 degrees C. The decomposition followed the kinetics of a first order reaction with formation of both monomeric and oligomeric secondary products. The proportions of oligomers slightly increased with increasing reaction temperature and decreased with increasing concentration of hydroperoxide. The activation energy was 70.4 kJ/mol +/- 4.7 kJ/mol. The decomposition of hydroperoxides proceeded partially by monomolecular cleavage, partially by formation of esters with palmitic acid.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

International Nuclear Information System (INIS)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

1994-01-01

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

Energy Technology Data Exchange (ETDEWEB)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

1994-07-15

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

Science.gov (United States)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Classical swine fever virus detection: results of a real-time reverse transcription polymerase chain reaction ring trial conducted in the framework of the European network of excellence for epizootic disease diagnosis and control

DEFF Research Database (Denmark)

Hoffmann, Bernd; Blome, Sandra; Bonilauri, Paolo

2011-01-01

and specificity values. Nevertheless, some in-house systems had unspecific reactions or suboptimal sensitivity with only a single CSFV genotype. Follow-up actions involved either improvement of suboptimal assays or replacement of specific laboratory assays with the FLI protocol, with or without modifications......The current study reports on a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) ring trial for the detection of Classical swine fever virus (CSFV) genomic RNA undertaken by 10 European laboratories. All laboratories were asked to use their routine in-house real-time RT...

Dehydriding and rehydriding reactions of LiBH4

International Nuclear Information System (INIS)

Orimo, S.; Nakamori, Y.; Kitahara, G.; Miwa, K.; Ohba, N.; Towata, S.; Zuettel, A.

2005-01-01

Structural differences in LiBH 4 before and after the melting reaction at approximately 550-bar K were investigated to clarify the experimental method for the confirmation of reversible dehydriding and rehydriding reactions. Since the long-range order of LiBH 4 begins to disappear after the melting reaction was achieved, investigation of the atomistic vibrations of the [BH 4 ]-anion in LiBH 4 was found to be effective for the confirmation of the reversibility. In the present study, LiBH 4 was successively dehydrided (decomposed) into LiH and B under 1-bar MPa of hydrogen at 873-bar K, and then rehydrided (recombined) into LiBH 4 under 35-bar MPa of hydrogen at the same temperature (873-bar K). The temperatures at the beginning and ending of the dehydriding reaction are lowered, by approximately 30-bar K, for LiBH 4 substituted (or mixed) with Mg (atomic ratio of Li:Mg=9:1) as compared to those for LiBH 4 alone. This is similar to the tendency exhibited by LiNH 2

Direct catalytic asymmetric aldol-Tishchenko reaction.

Science.gov (United States)

Gnanadesikan, Vijay; Horiuchi, Yoshihiro; Ohshima, Takashi; Shibasaki, Masakatsu

2004-06-30

A direct catalytic asymmetric aldol reaction of propionate equivalent was achieved via the aldol-Tishchenko reaction. Coupling an irreversible Tishchenko reaction to a reversible aldol reaction overcame the retro-aldol reaction problem and thereby afforded the products in high enantio and diastereoselectivity using 10 mol % of the asymmetric catalyst. A variety of ketones and aldehydes, including propyl and butyl ketones, were coupled efficiently, yielding the corresponding aldol-Tishchenko products in up to 96% yield and 95% ee. Diastereoselectivity was generally below the detection limit of 1H NMR (>98:2). Preliminary studies performed to clarify the mechanism revealed that the aldol products were racemic with no diastereoselectivity. On the other hand, the Tishchenko products were obtained in a highly enantiocontrolled manner.

Crystallization features of ternary reversible reciprocal systems

International Nuclear Information System (INIS)

Tomashik, V.N.; Shcherbak, L.P.; Fejchuk, P.I.; Grytsiv, V.I.

2006-01-01

Some features of the primary crystallization of phases in ternary reversible reciprocal system are considered and discussed. The diagonal join CdTe-GeSe of the CdTe + GeSe = CdSe + GeTe ternary reciprocal system is studied to show that the features in primary and secondary heating and cooling curves in such systems under fully equilibrium conditions are not reproduced upon consecutive heating and cooling sessions, because of the existence of different amounts of the reagents and the reaction products in the mixture; the temperatures of each transformation lie in a range. Those who experimentally investigate other ternary and more complex reversible reciprocal systems should take this fact into account [ru

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

Science.gov (United States)

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Prediction of thermodynamically reversible hydrogen storage reactions utilizing Ca-M(M = Li, Na, K)-B-H systems: a first-principles study.

Science.gov (United States)

Guo, Yajuan; Ren, Ying; Wu, Haishun; Jia, Jianfeng

2013-12-01

Calcium borohydride is a potential candidate for onboard hydrogen storage because it has a high gravimetric capacity (11.5 wt.%) and a high volumetric hydrogen content (∼130 kg m(-3)). Unfortunately, calcium borohydride suffers from the drawback of having very strongly bound hydrogen. In this study, Ca(BH₄)₂ was predicted to form a destabilized system when it was mixed with LiBH₄, NaBH₄, or KBH₄. The release of hydrogen from Ca(BH₄)₂ was predicted to proceed via two competing reaction pathways (leading to CaB₆ and CaH₂ or CaB₁₂H₁₂ and CaH₂) that were found to have almost equal free energies. Using a set of recently developed theoretical methods derived from first principles, we predicted five new hydrogen storage reactions that are among the most attractive of those presently known. These combine high gravimetric densities (>6.0 wt.% H₂) with have low enthalpies [approximately 35 kJ/(mol(-1) H₂)] and are thermodynamically reversible at low pressure within the target window for onboard storage that is actively being considered for hydrogen storage applications. Thus, the first-principles theoretical design of new materials for energy storage in future research appears to be possible.

Test of time-reversal invariance at COSY (TRIC)

Energy Technology Data Exchange (ETDEWEB)

Eversheim, D., E-mail: evershei@hiskp.uni-bonn.de; Valdau, Yu. [University Bonn, Helmholtz Institut fuer Strahlen- und Kernphysik (Germany); Lorentz, B. [Forschungszentrum Juelich, Institut fuer Kernphysik (Germany)

2013-03-15

At the Cooler Synchrotron COSY a novel (P-even, T-odd) null test of time-reversal invariance to an accuracy of 10{sup - 6} is planned as an internal target transmission experiment. The parity conserving time-reversal violating observable is the total cross-section asymmetry A{sub y,xz}. This quantity is measured using a polarized proton beam with an energy of 135 MeV and an internal tensor polarized deuteron target from the PAX atomic beam source. The reaction rate will be measured by means of an integrating beam current transformer. Thus, in this experiment the cooler synchroton ring serves as ideal forward spectrometer, as a detector, and an accelerator.

Electrical characterization of single molecule and Langmuir–Blodgett monomolecular films of a pyridine-terminated oligo(phenylene-ethynylene derivative

Directory of Open Access Journals (Sweden)

Henrry M. Osorio

2015-05-01

Full Text Available Monolayer Langmuir–Blodgett (LB films of 1,4-bis(pyridin-4-ylethynylbenzene (1 together with the “STM touch-to-contact” method have been used to study the nature of metal–monolayer–metal junctions in which the pyridyl group provides the contact at both molecule–surface interfaces. Surface pressure vs area per molecule isotherms and Brewster angle microscopy images indicate that 1 forms true monolayers at the air–water interface. LB films of 1 were fabricated by deposition of the Langmuir films onto solid supports resulting in monolayers with surface coverage of 0.98 × 10−9 mol·cm−2. The morphology of the LB films that incorporate compound 1 was studied using atomic force microscopy (AFM. AFM images indicate the formation of homogeneous, monomolecular films at a surface pressure of transference of 16 mN·m−1. The UV–vis spectra of the Langmuir and LB films reveal that 1 forms two dimensional J-aggregates. Scanning tunneling microscopy (STM, in particular the “STM touch-to-contact” method, was used to determine the electrical properties of LB films of 1. From these STM studies symmetrical I–V curves were obtained. A junction conductance of 5.17 × 10−5 G0 results from the analysis of the pseudolinear (ohmic region of the I–V curves. This value is higher than that of the conductance values of LB films of phenylene-ethynylene derivatives contacted by amines, thiols, carboxylate, trimethylsilylethynyl or acetylide groups. In addition, the single molecule I–V curve of 1 determined using the I(s method is in good agreement with the I–V curve obtained for the LB film, and both curves fit well with the Simmons model. Together, these results not only indicate that the mechanism of transport through these metal–molecule–metal junctions is non-resonant tunneling, but that lateral interactions between molecules within the LB film do not strongly influence the molecule conductance. The results presented here

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Soft shell clams Mya arenaria with disseminated neoplasia demonstrate reverse transcriptase activity

Science.gov (United States)

House, M.L.; Kim, C.H.; Reno, P.W.

1998-01-01

Disseminated neoplasia (DN), a proliferative cell disorder of the circulatory system of bivalves, was first reported in oysters in 1969. Since that time, the disease has been determined to be transmissible through water-borne exposure, but the etiological agent has not been unequivocally identified. In order to determine if a viral agent, possibly a retrovirus, could be the causative agent of DN, transmission experiments were performed, using both a cell-free filtrate and a sucrose gradient-purified preparation of a cell-free filtrate of DN positive materials. Additionally, a PCR-enhanced reverse transcriptase assay was used to determine if reverse transcriptase was present in tissues or hemolymph from DN positive soft shell clams Mya arenaria. DN was transmitted to healthy clams by injection with whole DN cells, but not with cell-free flitrates prepared from either tissues from DN positive clams, or DN cells. The cell-free preparations from DN-positive tissues and hemolymph having high levels of DN cells in circulation exhibited positive reactions in the PCR-enhanced reverse transcriptase assay. Cell-free preparations of hemolymph from clams having low levels of DN (<0.1% of cells abnormal), hemocytes from normal soft shell clams, and normal soft shell clam tissues did not produce a positive reaction in the PCR enhanced reverse transcriptase assay.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

Science.gov (United States)

Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

Influence of polymerisation on the reversibility of low-energy proton exchange reactions by Para-Aminothiolphenol.

Science.gov (United States)

Balakrishnan, Divya; Lamblin, Guillaume; Thomann, Jean Sebastien; Guillot, Jerome; Duday, David; van den Berg, Albert; Olthuis, Wouter; Pascual-García, César

2017-11-13

The reversibility of redox processes is an important function for sensing and molecular electronic devices such as pH reporters or molecular switches. Here we report the electrochemical behaviour and redox reversibility of para-aminothiolphenol (PATP) after different polymerisation methods. We used electrochemical and photo-polymerisation in neutral buffers and plasma polymerisation in air to induce reversible redox states. The chemical stoichiometry and surface coverage of PATP in the polymerized layers were characterized by X-ray photoelectron spectroscopy (XPS), while cyclic voltammetry (CV) was used to measure the charge transfer, double layer capacitance and electrochemical rate of the layers during successive potential cycles. Our results show that the surface coverage of the redox active species is higher on electro-polymerised samples, however, after consecutive cycles all the methods converge to the same charge transfer, while the plasma polymerised samples achieve higher efficiency per molecule and UV polymerised samples have a higher electron transfer rate.

Confining Domains Lead to Reaction Bursts: Reaction Kinetics in the Plasma Membrane

Science.gov (United States)

Kalay, Ziya; Fujiwara, Takahiro K.; Kusumi, Akihiro

2012-01-01

Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity. PMID:22479350

Confining domains lead to reaction bursts: reaction kinetics in the plasma membrane.

Directory of Open Access Journals (Sweden)

Ziya Kalay

Full Text Available Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Directory of Open Access Journals (Sweden)

Cui Shang-jin

2010-05-01

Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Science.gov (United States)

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Pervaporation applied for dewatering of reaction mixture during esterification

OpenAIRE

Krasiński Andrzej; Wierzba Patrycja; Grudzień Agata; Hajmowicz Halina; Zawada Krzysztof; Synoradzki Ludwik

2016-01-01

In this work the esterification of diethyl tartrate was studied. The research was focused on the enhancement of reversible reaction yield, which is accomplished by dewatering of the reaction mixture. The removal of water shifts the equilibrium towards the main product. Pervaporation was applied for this purpose, and results were compared to distillation. The advantages and limitations of both processes are discussed. The experimental part consists of dewatering of mixture after the reaction h...

Transfer and breakup reactions at intermediate energies

International Nuclear Information System (INIS)

Stokstad, R.G.

1986-04-01

The origin of the quasi-elastic peak in peripheral heavy-ion reactions is discussed in terms of inelastic scattering and transfer reactions to unbound states of the primary projectile-like fragment. The situation is analogous to the use of reverse kinematics in fusion reactions, a technique in which the object of study is moving with nearly the beam velocity. It appears that several important features of the quasi-elastic peak may be explained by this approach. Projectile-breakup reactions have attractive features for the study of nuclear structure. They may also be used to determine the partition of excitation energy in peripheral reactions. At intermediate energies, neutron-pickup reactions leading to four-body final states become important. Examples of experiments are presented that illustrate these points. 15 refs., 14 figs

Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

Directory of Open Access Journals (Sweden)

C Coelho

2003-06-01

Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

Reference genes for reverse transcription quantitative PCR in canine brain tissue

NARCIS (Netherlands)

Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

2015-01-01

BACKGROUND: In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and

Effect of lateralized design on muscle and joint reaction forces for reverse shoulder arthroplasty.

Science.gov (United States)

Liou, William; Yang, Yang; Petersen-Fitts, Graysen R; Lombardo, Daniel J; Stine, Sasha; Sabesan, Vani J

2017-04-01

Manufacturers of reverse shoulder arthroplasty (RSA) implants have recently designed innovative implants to optimize performance in rotator cuff-deficient shoulders. These advancements are not without tradeoffs and can have negative biomechanical effects. The objective of this study was to develop an integrated finite element analysis-kinematic model to compare the muscle forces and joint reaction forces (JRFs) of 3 different RSA designs. A kinematic model of a normal shoulder joint was adapted from the Delft model and integrated with the well-validated OpenSim shoulder model. Static optimizations then allowed for calculation of the individual muscle forces, moment arms, and JRFs relative to net joint moments. Three-dimensional computer models of 3 RSA designs-humeral lateralized design (HLD), glenoid lateralized design, and Grammont design-were integrated, and parametric studies were performed. Overall, there were decreases in deltoid and rotator cuff muscle forces for all 3 RSA designs. These decreases were greatest in the middle deltoid of the HLD model for abduction and flexion and in the rotator cuff muscles under both internal rotation and external rotation. The JRFs in abduction and flexion decreased similarly for all RSA designs compared with the normal shoulder model, with the greatest decrease seen in the HLD model. These findings demonstrate that the design characteristics implicit in these modified RSA prostheses result in mechanical differences most prominently seen in the deltoid muscle and overall JRFs. Further research using this novel integrated model can help guide continued optimization of RSA design and clinical outcomes. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Reversal of liver fibrosis: From fiction to reality.

Science.gov (United States)

Zoubek, Miguel Eugenio; Trautwein, Christian; Strnad, Pavel

2017-04-01

In chronic liver diseases, an ongoing hepatocellular injury together with inflammatory reaction results in activation of hepatic stellate cells (HSCs) and increased deposition of extracellular matrix (ECM) termed as liver fibrosis. It can progress to cirrhosis that is characterized by parenchymal and vascular architectural changes together with the presence of regenerative nodules. Even at late stage, liver fibrosis is reversible and the underlying mechanisms include a switch in the inflammatory environment, elimination or regression of activated HSCs and degradation of ECM. While animal models have been indispensable for our understanding of liver fibrosis, they possess several important limitations and need to be further refined. A better insight into the liver fibrogenesis resulted in a large number of clinical trials aiming at reversing liver fibrosis, particularly in patients with non-alcoholic steatohepatitis. Collectively, the current developments demonstrate that reversal of liver fibrosis is turning from fiction to reality. Copyright © 2017. Published by Elsevier Ltd.

Chemical-looping combustion in a reverse-flow fixed bed reactor

International Nuclear Information System (INIS)

Han, Lu; Bollas, George M.

2016-01-01

A reverse-flow fixed bed reactor concept for CLC (chemical-looping combustion) is explored. The limitations of conventional fixed bed reactors, as applied to CLC, are overcome by reversing the gas flow direction periodically to enhance the mixing characteristics of the bed, thus improving oxygen carrier utilization and energy efficiency with respect to power generation. The reverse-flow reactor is simulated by a dusty-gas model and compared with an equivalent fixed bed reactor without flow reversal. Dynamic optimization is used to calculate conditions at which each reactor operates at maximum energy efficiency. Several cases studies illustrate the benefits of reverse-flow operation for the CLC with CuO and NiO oxygen carriers and methane and syngas fuels. The results show that periodic reversal of the flow during reduction improves the contact between the fuel and unconverted oxygen carrier, enabling the system to suppress unwanted catalytic reactions and axial temperature and conversion gradients. The operational scheme presented reduces the fluctuations of temperature during oxidation and increases the high-temperature heat produced by the process. CLC in a reverse-flow reactor has the potential to achieve higher energy efficiency than conventional fixed bed CLC reactors, when integrated with a downstream gas turbine of a combined cycle power plant. - Highlights: • Reverse-flow fixed bed CLC reactors for combined cycle power systems. • Dynamic optimization tunes operation of batch and transient CLC systems. • The reverse-flow CLC system provides stable turbine-ready gas stream. • Reverse-flow CLC fixed bed reactor has superior CO 2 capture and thermal efficiency.

From a Viewpoint of Clinical Settings: Pharmacoepidemiology as Reverse Translational Research (rTR).

Science.gov (United States)

Kawakami, Junichi

2017-01-01

Clinical pharmacology and pharmacoepidemiology research may converge in practise. Pharmacoepidemiology is the study of pharmacotherapy and risk management in patient groups. For many drugs, adverse reaction(s) that were not seen and/or clarified during research and development stages have been reported in the real world. Pharmacoepidemiology can detect and verify adverse drug reactions as reverse translational research. Recently, development and effective use of medical information databases (MID) have been conducted in Japan and elsewhere for the purpose of post-marketing safety of drugs. The Ministry of Health, Labour and Welfare, Japan has been promoting the development of 10-million scale database in 10 hospitals and hospital groups as "the infrastructure project of medical information database (MID-NET)". This project enables estimation of the frequency of adverse reactions, the distinction between drug-induced reactions and basal health-condition changes, and usefulness verification of administrative measures of drug safety. However, because the database information is different from detailed medical records, construction of methodologies for the detection and evaluation of adverse reactions is required. We have been performing database research using medical information system in some hospitals to establish and demonstrate useful methods for post-marketing safety. In this symposium, we aim to discuss the possibility of reverse translational research from clinical settings and provide an introduction to our research.

Reversible flowchart languages and the structured reversible program theorem

DEFF Research Database (Denmark)

Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

2008-01-01

Many irreversible computation models have reversible counterparts, but these are poorly understood at present. We introduce reversible flowcharts with an assertion operator and show that any reversible flowchart can be simulated by a structured reversible flowchart using only three control flow...... operators. Reversible flowcharts are r- Turing-complete, meaning that they can simuluate reversible Turing machines without garbage data. We also demonstrate the injectivization of classical flowcharts into reversible flowcharts. The reversible flowchart computation model provides a theoretical...

Electrically Reversible Redox-Switchable Polydopamine Films for Regulating Cell Behavior

International Nuclear Information System (INIS)

Tan, Guoxin; Liu, Yan; Wu, Yuxuan; Ouyang, Kongyou; Zhou, Lei; Yu, Peng; Liao, Jinwen; Ning, Chengyun

2017-01-01

Highlights: • The phenolic/quinone groups on polydopamine can redox-switchable reversible under electrical stimulation. • The quinone groups on PDA (oxidized PDA) enhanced cell spreading and proliferation. • The phenolic groups on PDA (reduced PDA) induced cell differentiation. - Abstract: Switchable surfaces that respond to external stimuli are important for regulating cell behavior. The results herein suggest that the redox process of polydopamine (PDA) is a switching reaction between oxidized polydopamine and reduced polydopamine, involving an interconversion of coupled two-proton (2H + ) and two-electron (2e − ) processes. The redox-switchable reversible surface potential arising from the potential-tunable redox reaction of the phenolic and quinone groups on PDA on titanium induced both cell adhesion and spreading. In vitro experiments demonstrated that the quinone groups on PDA greatly enhanced pre-osteoblasts MC3T3-E1 cell spreading and proliferation. Phenolic groups enhanced the induction of differentiation. The proposed methodology may allow further investigation of switchable surfaces for biological and medical applications.

Solid-phase synthesis of protein-polymers on reversible immobilization supports.

Science.gov (United States)

Murata, Hironobu; Carmali, Sheiliza; Baker, Stefanie L; Matyjaszewski, Krzysztof; Russell, Alan J

2018-02-27

Facile automated biomacromolecule synthesis is at the heart of blending synthetic and biologic worlds. Full access to abiotic/biotic synthetic diversity first occurred when chemistry was developed to grow nucleic acids and peptides from reversibly immobilized precursors. Protein-polymer conjugates, however, have always been synthesized in solution in multi-step, multi-day processes that couple innovative chemistry with challenging purification. Here we report the generation of protein-polymer hybrids synthesized by protein-ATRP on reversible immobilization supports (PARIS). We utilized modified agarose beads to covalently and reversibly couple to proteins in amino-specific reactions. We then modified reversibly immobilized proteins with protein-reactive ATRP initiators and, after ATRP, we released and analyzed the protein polymers. The activity and stability of PARIS-synthesized and solution-synthesized conjugates demonstrated that PARIS was an effective, rapid, and simple method to generate protein-polymer conjugates. Automation of PARIS significantly reduced synthesis/purification timelines, thereby opening a path to changing how to generate protein-polymer conjugates.

Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription.

Science.gov (United States)

Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof

2012-05-15

Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

Discovery of Rapid and Reversible Water Insertion in Rare Earth Sulfates: A New Process for Thermochemical Heat Storage.

Science.gov (United States)

Hatada, Naoyuki; Shizume, Kunihiko; Uda, Tetsuya

2017-07-01

Thermal energy storage based on chemical reactions is a prospective technology for the reduction of fossil-fuel consumption by storing and using waste heat. For widespread application, a critical challenge is to identify appropriate reversible reactions that occur below 250 °C, where abundant low-grade waste heat and solar energy might be available. Here, it is shown that lanthanum sulfate monohydrate La 2 (SO 4 ) 3 ⋅H 2 O undergoes rapid and reversible dehydration/hydration reactions in the temperature range from 50 to 250 °C upon heating/cooling with remarkably small thermal hysteresis (water is removed from, or inserted in La 2 (SO 4 ) 3 ⋅H 2 O with progressive change in hydration number x without phase change. It is also revealed that only a specific structural modification of La 2 (SO 4 ) 3 exhibits this reversible dehydration/hydration behavior. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Probing the RAFT process using a model reaction between alkoxyamine and dithioester

NARCIS (Netherlands)

Zhou, Y.

2012-01-01

A small-molecular model reaction was designed to probe the reversible addition–fragmentation chain transfer (RAFT) process. In this reaction, alkoxyamine releases radicals that react in situ with dithioester through the RAFT process, generating new radicals through the fragmentation of the

Modeling of uncertainties in biochemical reactions.

Science.gov (United States)

Mišković, Ljubiša; Hatzimanikatis, Vassily

2011-02-01

Mathematical modeling is an indispensable tool for research and development in biotechnology and bioengineering. The formulation of kinetic models of biochemical networks depends on knowledge of the kinetic properties of the enzymes of the individual reactions. However, kinetic data acquired from experimental observations bring along uncertainties due to various experimental conditions and measurement methods. In this contribution, we propose a novel way to model the uncertainty in the enzyme kinetics and to predict quantitatively the responses of metabolic reactions to the changes in enzyme activities under uncertainty. The proposed methodology accounts explicitly for mechanistic properties of enzymes and physico-chemical and thermodynamic constraints, and is based on formalism from systems theory and metabolic control analysis. We achieve this by observing that kinetic responses of metabolic reactions depend: (i) on the distribution of the enzymes among their free form and all reactive states; (ii) on the equilibrium displacements of the overall reaction and that of the individual enzymatic steps; and (iii) on the net fluxes through the enzyme. Relying on this observation, we develop a novel, efficient Monte Carlo sampling procedure to generate all states within a metabolic reaction that satisfy imposed constrains. Thus, we derive the statistics of the expected responses of the metabolic reactions to changes in enzyme levels and activities, in the levels of metabolites, and in the values of the kinetic parameters. We present aspects of the proposed framework through an example of the fundamental three-step reversible enzymatic reaction mechanism. We demonstrate that the equilibrium displacements of the individual enzymatic steps have an important influence on kinetic responses of the enzyme. Furthermore, we derive the conditions that must be satisfied by a reversible three-step enzymatic reaction operating far away from the equilibrium in order to respond to

The 8Li(α,n)11B reaction and primordial nucleosynthesis

International Nuclear Information System (INIS)

Boyd, R.N.

1992-01-01

The cross section for the 8 Li(α,n) 11 B reaction, of importance to synthesis of 11 B and heavier nuclides following the big bang, has been measured using the radioactive beam facility of The Institute of Physical and Chemical Reasearch (RIKEN). The reaction cross section was found to be about five times larger than that estimated from the time reversed reaction cross section. (author)

Reverse Algols

Science.gov (United States)

Leung, K. C.

1989-01-01

Reverse Algols, binary systems with a semidetached configuration in which the more massive component is in contact with the critical equipotential surface, are examined. Observational evidence for reverse Algols is presented and the parameters of seven reverse Algols are listed. The evolution of Algols and reverse Algols is discussed. It is suggested that, because reverse Algols represent the premass-reversal semidetached phase of close binary evolution, the evolutionary time scale between regular and reverse Algols is the ratio of the number of confirmed systems of these two Algol types.

Gas-Phase Photocatalytic Oxidation of Dimethylamine: The Reaction Pathway and Kinetics

Directory of Open Access Journals (Sweden)

Anna Kachina

2007-01-01

Full Text Available Gas-phase photocatalytic oxidation (PCO and thermal catalytic oxidation (TCO of dimethylamine (DMA on titanium dioxide was studied in a continuous flow simple tubular reactor. Volatile PCO products of DMA included ammonia, formamide, carbon dioxide, and water. Ammonia was further oxidized in minor amounts to nitrous oxide and nitrogen dioxide. Effective at 573 K, TCO resulted in the formation of ammonia, hydrogen cyanide, carbon monoxide, carbon dioxide, and water. The PCO kinetic data fit well to the monomolecular Langmuir-Hinshelwood model, whereas TCO kinetic behaviour matched the first-order process. No deactivation of the photocatalyst during the multiple long-run experiments was observed.

Redox reactions of neptunium in tributyl phosphate-dodecane mixtures

International Nuclear Information System (INIS)

Wehrey, F.

1989-01-01

In relation with the reprocessing of irradiated fuels, disproportionation and oxidation by nitric acid of pentavalent neptunium in tributyl phosphate-dodecane mixtures have been studied. The experimental part of this work is based on spectrophotometric measurements. The disproportionation of pentavalent neptunium in organic perchloric medium is a second order reaction with respect to neptunium V. The reaction rate is strongly influenced by the perchloric acid concentration and has a higher value than in an aqueous medium. The reverse reaction in nitric media is a first order with respect to tetravalent and hexavalent ions. The reaction rate is a function of the reverse of the square of the nitric acid concentration. The energy of activation is the same than in aqueous medium. The oxidation rate of pentavalent neptunium by nitric acid is increased by nitrous acid. When no nitrous acid is added to the mixture, the reaction revealed to be autocatalytic, possesses an induction period. When nitrous and nitric acids are in excess to neptunium the reaction is first order with respect to neptunium. The reaction rate depends on the concentration of nitric acid and is a linear function of the concentration of nitrous acid. In tributyl phosphate dodecane mixtures the reaction occurs spontaneously. It is not the case in aqueous media. The values of thermodynamical and kinetical constants determined in this work could be used in a modelization of the behavior of neptunium in the reprocessing of irradiated fuels, which has to eliminate this element among its tasks [fr

Mechanisms of gas phase decomposition of C-nitro compounds from quantum chemical data

International Nuclear Information System (INIS)

Khrapkovskii, Grigorii M; Shamov, Alexander G; Nikolaeva, E V; Chachkov, D V

2009-01-01

Data on the mechanisms of gas-phase monomolecular decomposition of nitroalkanes, nitroalkenes and nitroarenes obtained using modern quantum chemical methods are described systematically. The attention is focused on the discussion of multistage decomposition of nitro compounds to elementary experimentally observed products. Characteristic features of competition of different mechanisms and the effect of molecular structure on the change in the Arrhenius parameters of the primary reaction step are considered.

Mechanisms of gas phase decomposition of C-nitro compounds from quantum chemical data

Energy Technology Data Exchange (ETDEWEB)

Khrapkovskii, Grigorii M; Shamov, Alexander G; Nikolaeva, E V; Chachkov, D V [Kazan State Technological University, Kazan (Russian Federation)

2009-10-31

Data on the mechanisms of gas-phase monomolecular decomposition of nitroalkanes, nitroalkenes and nitroarenes obtained using modern quantum chemical methods are described systematically. The attention is focused on the discussion of multistage decomposition of nitro compounds to elementary experimentally observed products. Characteristic features of competition of different mechanisms and the effect of molecular structure on the change in the Arrhenius parameters of the primary reaction step are considered.

Phosphite radicals and their reactions. Examples of redox, substitution, and addition reactions

International Nuclear Information System (INIS)

Schaefer, K.; Asmus, K.D.

1980-01-01

Phosphite radicals HPO 3 - and PO 3 2 -, which exist in an acid-base equilibrium with pK = 5.75, are shown to take part in various types of reactions. In the absence of scavengers, they disappear mainly by second-order disproportionation and combination; a first-order contribution to the decay is also indicated. HPO 3 - and PO 3 2 - are good reductants toward electron acceptors such as tetranitromethane. In this reaction phosphate and C(NO 2 ) 3 - are formed. Phosphite radicals can, however, also act as good oxidants, e.g., toward thiols and thiolate ions. These reactions lead to the formation of RS. radicals which were identified either directly, as in the case of penicillamine, through the optical absorption of PenS. or more indirectly through equilibration of RS. with RS- to the optically absorbing RSSR-. disulfide radical anion. A homolytic substitution reaction (S/sub H/2) occurs in the reaction of the phosphite radicals with aliphatic disulfides, yielding RS. radicals and phosphate thioester RSPO 3 2 -. Lipoic acid, as an example of a cyclic disulfide, is reduced to the corresponding RSSR-. radical anion and also undergoes the S/sub H/2 reaction with about equal probability. An addition reaction is observed between phosphite radicals and molecular oxygen. The resulting peroxo phosphate radicals establish an acid-base equilibrium HPO 5 - . reversible PO 5 2- . + H+ with a pK = 3.4. Absolute rate constants were determined for all reactions discussed

The investigation on electrochemical reaction mechanism of CuF2 thin film with lithium

International Nuclear Information System (INIS)

Cui Yanhua; Xue Mingzhe; Zhou Yongning; Peng Shuming; Wang Xiaolin; Fu Zhengwen

2011-01-01

Crystalline CuF 2 thin films were prepared by pulsed laser deposition under room temperature. The physical and electrochemical properties of the as-deposited thin films have been investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), galvanostatic cycling and cyclic voltammetry (CV). Reversible capacity of 544 mAh g -1 was achieved in the potential range of 1.0-4.0 V. A reversible couple of redox peaks at 3.0 V and 3.7 V was firstly observed. By using ex situ XRD and TEM techniques, an insertion process followed by a fully conversion reaction to Cu and LiF was revealed in the lithium electrochemical reaction of CuF 2 thin film electrode. The reversible insertion reaction above 2.8 V could provide a capacity of about 125 mAh g -1 , which makes CuF 2 a potential cathode material for rechargeable lithium batteries.

Time-reversal symmetry breaking in quantum billiards

Energy Technology Data Exchange (ETDEWEB)

Schaefer, Florian

2009-01-26

The present doctoral thesis describes experimentally measured properties of the resonance spectra of flat microwave billiards with partially broken timereversal invariance induced by an embedded magnetized ferrite. A vector network analyzer determines the complex scattering matrix elements. The data is interpreted in terms of the scattering formalism developed in nuclear physics. At low excitation frequencies the scattering matrix displays isolated resonances. At these the effect of the ferrite on isolated resonances (singlets) and pairs of nearly degenerate resonances (doublets) is investigated. The hallmark of time-reversal symmetry breaking is the violation of reciprocity, i.e. of the symmetry of the scattering matrix. One finds that reciprocity holds in singlets; it is violated in doublets. This is modeled by an effective Hamiltonian of the resonator. A comparison of the model to the data yields time-reversal symmetry breaking matrix elements in the order of the level spacing. Their dependence on the magnetization of the ferrite is understood in terms of its magnetic properties. At higher excitation frequencies the resonances overlap and the scattering matrix elements fluctuate irregularly (Ericson fluctuations). They are analyzed in terms of correlation functions. The data are compared to three models based on random matrix theory. The model by Verbaarschot, Weidenmueller and Zirnbauer describes time-reversal invariant scattering processes. The one by Fyodorov, Savin and Sommers achieves the same for systems with complete time-reversal symmetry breaking. An extended model has been developed that accounts for partial breaking of time-reversal invariance. This extended model is in general agreement with the data, while the applicability of the other two models is limited. The cross-correlation function between forward and backward reactions determines the time-reversal symmetry breaking matrix elements of the Hamiltonian to up to 0.3 mean level spacings. Finally

Time-reversal symmetry breaking in quantum billiards

International Nuclear Information System (INIS)

Schaefer, Florian

2009-01-01

The present doctoral thesis describes experimentally measured properties of the resonance spectra of flat microwave billiards with partially broken timereversal invariance induced by an embedded magnetized ferrite. A vector network analyzer determines the complex scattering matrix elements. The data is interpreted in terms of the scattering formalism developed in nuclear physics. At low excitation frequencies the scattering matrix displays isolated resonances. At these the effect of the ferrite on isolated resonances (singlets) and pairs of nearly degenerate resonances (doublets) is investigated. The hallmark of time-reversal symmetry breaking is the violation of reciprocity, i.e. of the symmetry of the scattering matrix. One finds that reciprocity holds in singlets; it is violated in doublets. This is modeled by an effective Hamiltonian of the resonator. A comparison of the model to the data yields time-reversal symmetry breaking matrix elements in the order of the level spacing. Their dependence on the magnetization of the ferrite is understood in terms of its magnetic properties. At higher excitation frequencies the resonances overlap and the scattering matrix elements fluctuate irregularly (Ericson fluctuations). They are analyzed in terms of correlation functions. The data are compared to three models based on random matrix theory. The model by Verbaarschot, Weidenmueller and Zirnbauer describes time-reversal invariant scattering processes. The one by Fyodorov, Savin and Sommers achieves the same for systems with complete time-reversal symmetry breaking. An extended model has been developed that accounts for partial breaking of time-reversal invariance. This extended model is in general agreement with the data, while the applicability of the other two models is limited. The cross-correlation function between forward and backward reactions determines the time-reversal symmetry breaking matrix elements of the Hamiltonian to up to 0.3 mean level spacings. Finally

The chemiluminescence of luminol in aqueous solutions, a pulse radiolytic study

International Nuclear Information System (INIS)

Lind, J.

1980-01-01

The mechanism of chemiluminescence was studied when the luminol radical and superoxide were generated simultaneously. Hydroperoxide was formed at the first reaction step with a pKa value between 11 and 12. The dissociated form was found to undergo a monomolecular reaction leading to light generation and having a rate constant > 2 x 10 5 s -1 . The protonated form had the rate constant of approx. 2000 s -1 and formed a product which absorbed around 390 nm without light emission. The reaction of the two-electron oxidation product of luminol, 5-aminophthalazine-1, 4 dione (azaquinone), with hydrogenperoxide was stoichiometrically equivalent to the recombination of superoxide with the luminol radical. The pulseradiolytic generation of the chlorinedioxide radical ClO 2 in aqueous solution of sodium chlorite is described, and the oxidation of luminol by ClO 2 in two steps is reported: 1. Radical adducts are formed. 2. The reaction of ClO 2 x radical with the adduct to form azaquinone. The chemiluminescent reaction between the azaquinone and hydrogenperoxide consists of a second order reaction between HO 2 and the azaquinone to form a hydroperoxide followed by a monomolecular rearrangement of the dissociated form of the latter. Its acidbase equilibrium has a pKa of 10.6. A nitrogencentered structure is ascribed to the hydroperoxide formed by cross-recombination of the luminolradical and superoxide while the reaction between HO 2 and azaquinone yields a carboncentered hydroperoxide. The existence of two different emitters is evidenced by the following observations. 1. A slight difference in chemiluminescence spectra. 2. The formation of an endproduct with pKa approx. 10.2 in the luminolradical superoxide system. 3. The formation of an endproduct which acts as an efficient radial scavenger in the luminol radical superoxide system. (G.B.)

Managing Reverse Logistics or Reversing Logistics Management?

OpenAIRE

Brito, Marisa

2004-01-01

textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse logistics. The thesis brings insights on reverse logistics decision-making and it lays down theoretical principles for reverse logistics as a research field.In particular it puts together a framework ...

Computational reverse shoulder prosthesis model: Experimental data and verification.

Science.gov (United States)

Martins, A; Quental, C; Folgado, J; Ambrósio, J; Monteiro, J; Sarmento, M

2015-09-18

The reverse shoulder prosthesis aims to restore the stability and function of pathological shoulders, but the biomechanical aspects of the geometrical changes induced by the implant are yet to be fully understood. Considering a large-scale musculoskeletal model of the upper limb, the aim of this study is to evaluate how the Delta reverse shoulder prosthesis influences the biomechanical behavior of the shoulder joint. In this study, the kinematic data of an unloaded abduction in the frontal plane and an unloaded forward flexion in the sagittal plane were experimentally acquired through video-imaging for a control group, composed of 10 healthy shoulders, and a reverse shoulder group, composed of 3 reverse shoulders. Synchronously, the EMG data of 7 superficial muscles were also collected. The muscle force sharing problem was solved through the minimization of the metabolic energy consumption. The evaluation of the shoulder kinematics shows an increase in the lateral rotation of the scapula in the reverse shoulder group, and an increase in the contribution of the scapulothoracic joint to the shoulder joint. Regarding the muscle force sharing problem, the musculoskeletal model estimates an increased activity of the deltoid, teres minor, clavicular fibers of the pectoralis major, and coracobrachialis muscles in the reverse shoulder group. The comparison between the muscle forces predicted and the EMG data acquired revealed a good correlation, which provides further confidence in the model. Overall, the shoulder joint reaction force was lower in the reverse shoulder group than in the control group. Copyright © 2015 Elsevier Ltd. All rights reserved.

Renewable synthesis-gas-production. Do hydrocarbons in the reactant flow of the reverse water-gas shift reaction cause coke formation?

Energy Technology Data Exchange (ETDEWEB)

Wolf, A.; Kern, C.; Jess, A. [Bayreuth Univ. (Germany). Dept. of Chemical Engineering

2013-11-01

In a two-step synthetic fuel production process based on carbon dioxide and renewable hydrogen, the best possible selectivity towards liquid hydrocarbons (Hc) shall be implemented. The process consists of a combination of the Reverse Water-Gas Shift reaction and the Fischer-Tropsch synthesis. To achieve this goal, gaseous short-chained Hc from the FTS reactor are recycled in the RWGS unit. In this paper, challenges coming up with the implementation of a recycle loop are discussed. First of all, it has to be examined whether Hc are converted under conditions present in the RWGS reactor. The coking caused by the recycle of Hc is regarded, including thermal coking in the heating zone of the reactor and catalytic coking in the catalyst bed. Coking of course is unwanted, as it deactivates the catalyst. The scope of this work is to find out to which extent and under which conditions gaseous Hc can be recycled. Therefore, experiments were carried out in both, a quartz glass reactor using a commercial Ni-catalyst at ambient pressure and in a pressurized steel reactor (without catalyst) to examine coking during the thermal decomposition of Hc. The catalytic experiments at atmospheric pressure showed that a recycle of CH{sub 4} did not cause coking up to a ratio of CH{sub 4}/CO{sub 2} below one. For these conditions, long term stability was proved. The reaction rates of the CH{sub 4} conversion were below those of the RWGS reaction. However, replacing CH{sub 4} by C{sub 3}H{sub 8} leads to thermal and catalytic coking. Catalytic coking hits the maximum level at about 700 C and decreases for higher temperatures and, thus is not regarded as a problem for the RWGS reactor. In contrast to that, thermal coking raises with higher temperatures, but it can be supressed efficiently with additional injection of H{sub 2}O, which of course shifts the equilibrium towards the undesired reactant side. (orig.)

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

The spallation in reverse kinematics: what for a coincidence measurement?

International Nuclear Information System (INIS)

Ducret, J.E.

2006-07-01

The Spaladin installation has been designed to study spallation reactions in reverse kinematics. Furthermore, the heavy and light fragments are detected by coincidence which allows us to get an instantaneous picture of the reaction at a level of accuracy better than that obtained through inclusive measurement. The first part is dedicated to the theoretical description of the different mechanisms involved in the spallation reactions. In the second part we describe the Spaladin installation and report some results on the reaction: Fe 56 + p at an energy of 1 GeV/nucleon. In the third part we expose the performance of the installation through its simulation with the Geant-IV model. We present a study about the sensitivity of the Spaladin installation to theoretical predictions. The fourth part is dedicated to the future experiments that will be performed with the Spaladin installation. (A.C.)

Reversible Redox Chemistry of Azo Compounds for Sodium-Ion Batteries.

Science.gov (United States)

Luo, Chao; Xu, Gui-Liang; Ji, Xiao; Hou, Singyuk; Chen, Long; Wang, Fei; Jiang, Jianjun; Chen, Zonghai; Ren, Yang; Amine, Khalil; Wang, Chunsheng

2018-03-05

Sustainable sodium-ion batteries (SSIBs) using renewable organic electrodes are promising alternatives to lithium-ion batteries for the large-scale renewable energy storage. However, the lack of high-performance anode material impedes the development of SSIBs. Herein, we report a new type of organic anode material based on azo group for SSIBs. Azobenzene-4,4'-dicarboxylic acid sodium salt is used as a model to investigate the electrochemical behaviors and reaction mechanism of azo compound. It exhibits a reversible capacity of 170 mAh g -1 at 0.2C. When current density is increased to 20C, the reversible capacities of 98 mAh g -1 can be retained for 2000 cycles, demonstrating excellent cycling stability and high rate capability. The detailed characterizations reveal that azo group acts as an electrochemical active site to reversibly bond with Na + . The reversible redox chemistry between azo compound and Na ions offer opportunities for developing long-cycle-life and high-rate SSIBs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

Directory of Open Access Journals (Sweden)

Marcos Lázaro Moreli

2004-10-01

Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

Science.gov (United States)

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Reversed rainbow with a nonlocal metamaterial

Energy Technology Data Exchange (ETDEWEB)

Morgado, Tiago A., E-mail: tiago.morgado@co.it.pt; Marcos, João S.; Silveirinha, Mário G., E-mail: mario.silveirinha@co.it.pt [Department of Electrical Engineering, Instituto de Telecomunicações, University of Coimbra, 3030 Coimbra (Portugal); Costa, João T. [CST AG, Bad Nauheimer Strasse 19, 64289 Darmstadt (Germany); Costa, Jorge R. [Instituto de Telecomunicações and Instituto Universitário de Lisboa (ISCTE-IUL), 1649-026 Lisboa (Portugal); Fernandes, Carlos A. [Instituto de Telecomunicações, and Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal)

2014-12-29

One of the intriguing potentials of metamaterials is the possibility to realize a nonlocal electromagnetic reaction, such that the effective medium response at a given point is fundamentally entangled with the macroscopic field distribution at long distances. Here, it is experimentally and numerically verified that a microwave nonlocal metamaterial formed by crossed metallic wires enables a low-loss broadband anomalous material response such that the refractive index decreases with frequency. Notably, it is shown that an electromagnetic beam refracted by our metamaterial prism creates a reversed microwave rainbow.

Optimization and kinetic studies of sea mango (Cerbera odollam) oil for biodiesel production via supercritical reaction

International Nuclear Information System (INIS)

Ang, Gaik Tin; Ooi, San Nee; Tan, Kok Tat; Lee, Keat Teong; Mohamed, Abdul Rahman

2015-01-01

Highlights: • Sea mango oil as feedstock for biodiesel via non-catalytic supercritical reaction. • Extracted sea mango oil with high FFA could produce high yield of FAME. • Employment of Response Surface Methodology for optimization of FAME. • Kinetic study for reversible transesterification and esterification reactions. - Abstract: Sea mango (Cerbera odollam) oil, which is rich in free fatty acids, was utilized to produce fatty acid methyl esters (FAME) via supercritical transesterification reaction. Sea mango oil was extracted from seeds and was subsequently reacted with methanol in a batch-type supercritical reactor. Response surface methodology (RSM) analysis was used to optimize important parameters, including reaction temperature, reaction time and the molar ratio of methanol to oil. The optimum conditions were found as 380 °C, 40 min and 45:1 mol/mol, respectively, to achieve 78% biodiesel content. The first kinetic modelling of FAME production from sea mango oil incorporating reversible transesterification and reversible esterification was verified simultaneously. The kinetic parameters, including reaction rate constants, k, the pre-exponential constant, A, and the activation energy, Ea, for transesterification and esterification were determined using an ordinary differential equation (ODE45) solver. The highest activation energy of 40 kJ/mol and the lowest reaction rate constant of 2.50 × 10 −5 dm 3 /mol s verified that the first stepwise reaction of TG to produce DG was the rate-limiting step

The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

NARCIS (Netherlands)

Oude Essink, B. B.; Berkhout, B.

1999-01-01

Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

Why has reversal of the actin-myosin cross-bridge cycle not been observed experimentally?

KAUST Repository

Loiselle, D. S.; Tran, K.; Crampin, E. J.; Curtin, N. A.

2010-01-01

We trace the history of attempts to determine whether the experimentally observed diminution of metabolic energy expenditure when muscles lengthen during active contraction is consistent with reversibility of biochemical reactions and, in particular

Factors involved in the paradox of reverse epidemiology.

Science.gov (United States)

Martín-Ponce, Esther; Santolaria, Francisco; Alemán-Valls, María-Remedios; González-Reimers, Emilio; Martínez-Riera, Antonio; Rodríguez-Gaspar, Melchor; Rodríguez-Rodríguez, Eva

2010-08-01

The hypothesis of reverse epidemiology holds that some cardiovascular risk factors, such as obesity, hypercholesterolemia and hypertension, in the elderly or in some chronic diseases are not harmful but permit better survival. However, this phenomenon is controversial and the underlying reasons are poorly understood. To search for factors simultaneously linked to reverse epidemiology and to short or long term survival. We included 400 patients, older than 60 years, hospitalized in a general internal medicine unit; 61 died in hospital and 338 were followed up by telephone. Obesity, higher blood pressure and serum cholesterol, besides being related to lower mortality both in hospital and after discharge, were associated with better nutrition and functional capacity, less intense acute phase reaction and organ dysfunction, and lower incidence of high-mortality diseases such as dementia, pneumonia, sepsis or cancer. These associations may explain why obesity and other reverse epidemiology data are inversely related to mortality. Weight loss was related to mortality independently of BMI. Patients with BMI under 30 kg/m(2) who died in hospital showed more weight loss than those who survived; the lower the BMI, the greater the weight loss. In contrast, patients with BMI over 30 kg/m(2) who died in hospital gained more weight than those who survived; the higher the BMI, the greater the weight gain. In patients over 60 years of age admitted to an internal medicine ward, obesity did not show independent survival value, being displaced by other nutritional parameters, functional capacity, acute phase reaction, organ dysfunction and diseases with poor prognosis. Copyright 2009 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Radioimmunoassay method for determination of 3, 3', 5'-triiodothyronine (reverse - T3)

International Nuclear Information System (INIS)

Kosowicz, J.

1979-01-01

To introduce radioimmunoassay, 3, 3', 5'-triiodothyronine (reverse-T 3 ) was coupled to bovine serum albumin by the carbodiimide technique and rabbits were immunized with the conjugates obtained. The immunizations were performed by multiple site intradermal injections at places in which cornynebacterium parvum was previously injected to enhance immunologic reaction. After 3 months the rabbits raised antisera to reverse-T 3 of a high titer and specificity. To obtain labelled 125 I-reverse T 3 , 3,3'-diiodothyronine was used. Iodination was performed by the chloramine T technique and the iodination mixture was subjected to gel filtration on Sephadex G-25 (fine) column. The purified monolabelled 125 I-reverse T 3 had a specific activity of 3,000 milli Curie/mg. The reverse T 3 radioimmunoassay of a high sensitivity (ca 2 pg/tube) was introduced in the clinical studies and facilitated direct determination of reverse T 3 in sera without the need of plasma extractions. The interference of serum proteins (TBG) was avoided by adding 8-anilino-1-naphtalene sulfonic acid to serum samples. Separation of free from antibody bound antigens was achieved by polyethylene glycol precipitation or immunoprecipitation. (author)

Reverse Logistics

OpenAIRE

Kulikova, Olga

2016-01-01

This thesis was focused on the analysis of the concept of reverse logistics and actual reverse processes which are implemented in mining industry and finding solutions for the optimization of reverse logistics in this sphere. The objective of this paper was the assessment of the development of reverse logistics in mining industry on the example of potash production. The theoretical part was based on reverse logistics and mining waste related literature and provided foundations for further...

Pyrene-Containing ortho-Oligo(phenylene)ethynylene Foldamer as a Ratiometric Probe Based on Circularly Polarized Luminescence.

Science.gov (United States)

Reiné, Pablo; Justicia, Jose; Morcillo, Sara P; Abbate, Sergio; Vaz, Belen; Ribagorda, María; Orte, Ángel; Álvarez de Cienfuegos, Luis; Longhi, Giovanna; Campaña, Araceli G; Miguel, Delia; Cuerva, Juan M

2018-04-20

In this manuscript, we report the first synthesis of an organic monomolecular emitter, which behaves as a circularly polarized luminescence (CPL)-based ratiometric probe. The enantiopure helical ortho-oligo(phenylene)ethynylene ( o-OPE) core has been prepared by a new and efficient macrocyclization reaction. The combination of such o-OPE helical skeleton and a pyrene couple leads to two different CPL emission features in a single structure whose ratio linearly responds to silver(I) concentration.

Reversible exciplex formation followed charge separation.

Science.gov (United States)

Petrova, M V; Burshtein, A I

2008-12-25

The reversible exciplex formation followed by its decomposition into an ion pair is considered, taking into account the subsequent geminate and bulk ion recombination to the triplet and singlet products (in excited and ground states). The integral kinetic equations are derived for all state populations, assuming that the spin conversion is performed by the simplest incoherent (rate) mechanism. When the forward and backward electron transfer is in contact as well as all dissociation/association reactions of heavy particles, the kernels of integral equations are specified and expressed through numerous reaction constants and characteristics of encounter diffusion. The solutions of these equations are used to specify the quantum yields of the excited state and exciplex fluorescence induced by pulse or stationary pumping. In the former case, the yields of the free ions and triplet products are also found, while in the latter case their stationary concentrations are obtained.

Time asymmetry: Polarization and analyzing power in the nuclear reactions

International Nuclear Information System (INIS)

Rioux, C.; Roy, R.; Slobodrian, R.J.; Conzett, H.E.

1983-01-01

Measurements of the proton polarization in the reactions 7 Li( 3 He, p vector) 9 Be and 9 Be( 3 He, p vector) 11 B and of the analyzing powers of the inverse reactions, initiated by polarized protons at the same c.m. energies, show significant differences which imply the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction 2 H( 3 He, p vector) 4 He and its inverse have also been investigated and show some smaller differences. A discussion of the instrumental asymmetries is presented. (orig.)

Cascade enzymatic reactions for efficient carbon sequestration.

Science.gov (United States)

Xia, Shunxiang; Zhao, Xueyan; Frigo-Vaz, Benjamin; Zheng, Wenyun; Kim, Jungbae; Wang, Ping

2015-04-01

Thermochemical processes developed for carbon capture and storage (CCS) offer high carbon capture capacities, but are generally hampered by low energy efficiency. Reversible cascade enzyme reactions are examined in this work for energy-efficient carbon sequestration. By integrating the reactions of two key enzymes of RTCA cycle, isocitrate dehydrogenase and aconitase, we demonstrate that intensified carbon capture can be realized through such cascade enzymatic reactions. Experiments show that enhanced thermodynamic driving force for carbon conversion can be attained via pH control under ambient conditions, and that the cascade reactions have the potential to capture 0.5 mol carbon at pH 6 for each mole of substrate applied. Overall it manifests that the carbon capture capacity of biocatalytic reactions, in addition to be energy efficient, can also be ultimately intensified to approach those realized with chemical absorbents such as MEA. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reversibility of oxidation and aggregation of impurity in the system of potassium halide monocrystal-phosphite molecular centre

International Nuclear Information System (INIS)

Lebedev, A.V.; Bogdanova, T.G.; Vasil'ev, I.A.; Mel'nikova, I.N.

1980-01-01

Thermo- and radiation-stimulated reversible reaction of oxidation and aggregation of phosphorus in the composition of phosphite molecular centre in the matrix of potassium iodide are studied. It is shown that in the process of isothermal annealing and γ-radiolysis in the matrix of potassium iodide destruction of phosphite molecular centre takes place. It is established that it is accompanied by oxidation of trivalent phosphorus and aggregation of the formed phosphorus-oxygen anions. Reduction of the initial phosphite centre during the sample hardening is explained by the reverse reaction as a result of which electron-exceeding centres of the base are destructed and reduction of phosphorus takes place

A Near-Infrared Photothermal Effect-Responsive Drug Delivery System Based on Indocyanine Green and Doxorubicin-Loaded Polymeric Micelles Mediated by Reversible Diels-Alder Reaction.

Science.gov (United States)

Li, Hui; Li, Junjie; Ke, Wendong; Ge, Zhishen

2015-10-01

Near-infrared light (NIR) possesses great advantages for light-responsive controllable drug release, such as deep tissue penetration and low damage to healthy tissues. Herein, a NIR-responsive drug delivery system is developed based on a NIR dye, indocyanine green (ICG), and anticancer drug, doxorubicin (DOX)-loaded thermoresponsive block copolymer micelles, in which the drug release can be controlled via NIR irradiation. First, block copolymers, poly(oligo(ethylene glycol) methacrylate)-block-poly(furfuryl methacrylate) (POEGMA-b-PFMA), are synthesized by sequential reversible addition-fragmentation chain-transfer (RAFT) polymerization, followed by modification with N-octyl maleimide through Diels-Alder (DA) reaction to produce POEGMA-b-POMFMA. The self-assembly of POEGMA-b-POMFMA by nano-precipitation in aqueous solution affords the polymeric micelles which are used to simultaneously encapsulate ICG and DOX. Upon irradiation by NIR light (805 nm), the loaded DOX is released rapidly from the micelles due to partial retro DA reaction and local temperature increase-induced faster drug diffusion by the photothermal effect. Cytotoxicity evaluation and intracellular distribution observation demonstrate significant synergistic effects of NIR-triggered drug release, photothermal, and chemotherapy toward cancer cells under NIR irradiation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

Directory of Open Access Journals (Sweden)

Boissière-Michot Florence

2009-04-01

Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

Hydrogen-deuterium exchange reaction of 2-methylpyridine catalyzed by several fatty acids

International Nuclear Information System (INIS)

Hirata, Hirohumi; Fukuzumi, Kazuo.

1976-01-01

Hydrogen-deuterium exchange reaction of 2-methylpyridine has been studied by using several fatty acids as catalysts. The reaction was carried out in a sealed pyrex tube at 120 0 C, and the contents of the products were determined by mass spectrometry. Reaction of 2-methylpyridine with monodeuteroacetic acid (1 : 1, mol/mol) arrived at a equilibrium (d 0 reversible d 1 reversible d 2 reversible d 3 ) in 2 hr (d 0 41%, d 1 42%, d 2 15%, d 3 2%). No exchange was observed for the reaction of pyridine with monodeuteroacetic acid. The conversion-time curves of typical series reactions (d 0 → d 1 → d 2 → d 3 ) were obtained for the fatty acid catalyzed exchange in deuterium oxide. The effect of the fatty acid RCO 2 H (substrate : fatty acid : D 2 O=1 : 0.86 : 27.6, mol/mol/mol) on the conversion was in the order of R; C 1 --C 3 4 --C 10 , where the reaction mixtures were homogeneous in the case of C 1 --C 3 and were heterogeneous in the case of C 4 --C 10 . The effects of the initial concentration of the substrates and the catalysts (RCO 2 H) on the total conversion were studied by using some fatty acids (R; C 2 , C 4 and C 9 ) in deuterium oxide (for 2 hr). The total conversion of the substrate increases with increasing the concentration of the acids. The total conversion decreases in the case of R=C 9 , but, increases in the case of R=C 2 with increasing the concentration of the substrate. In the case of reactions with low concentrations of the substrate, the reactivity was in the order of C 9 >C 4 >C 2 , while with high concentrations, the reactivity was in the order of C 4 >C 2 >C 9 and C 9 >C 4 >C 2 with high and low concentrations of the acids, respectively. A possible reaction mechanism was proposed and discussed. (auth.)

Reciprocity theory of homogeneous reactions

Science.gov (United States)

Agbormbai, Adolf A.

1990-03-01

The reciprocity formalism is applied to the homogeneous gaseous reactions in which the structure of the participating molecules changes upon collision with one another, resulting in a change in the composition of the gas. The approach is applied to various classes of dissociation, recombination, rearrangement, ionizing, and photochemical reactions. It is shown that for the principle of reciprocity to be satisfied it is necessary that all chemical reactions exist in complementary pairs which consist of the forward and backward reactions. The backward reaction may be described by either the reverse or inverse process. The forward and backward processes must satisfy the same reciprocity equation. Because the number of dynamical variables is usually unbalanced on both sides of a chemical equation, it is necessary that this balance be established by including as many of the dynamical variables as needed before the reciprocity equation can be formulated. Statistical transformation models of the reactions are formulated. The models are classified under the titles free exchange, restricted exchange and simplified restricted exchange. The special equations for the forward and backward processes are obtained. The models are consistent with the H theorem and Le Chatelier's principle. The models are also formulated in the context of the direct simulation Monte Carlo method.

Natural Plant Alkaloid (Emetine Inhibits HIV-1 Replication by Interfering with Reverse Transcriptase Activity

Directory of Open Access Journals (Sweden)

Ana Luiza Chaves Valadão

2015-06-01

Full Text Available Ipecac alkaloids are secondary metabolites produced in the medicinal plant Psychotria ipecacuanha. Emetine is the main alkaloid of ipecac and one of the active compounds in syrup of Ipecac with emetic property. Here we evaluated emetine’s potential as an antiviral agent against Human Immunodeficiency Virus. We performed in vitro Reverse Transcriptase (RT Assay and Natural Endogenous Reverse Transcriptase Activity Assay (NERT to evaluate HIV RT inhibition. Emetine molecular docking on HIV-1 RT was also analyzed. Phenotypic assays were performed in non-lymphocytic and in Peripheral Blood Mononuclear Cells (PBMC with HIV-1 wild-type and HIV-harboring RT-resistant mutation to Nucleoside Reverse Transcriptase Inhibitors (M184V. Our results showed that HIV-1 RT was blocked in the presence of emetine in both models: in vitro reactions with isolated HIV-1 RT and intravirion, measured by NERT. Emetine revealed a strong potential of inhibiting HIV-1 replication in both cellular models, reaching 80% of reduction in HIV-1 infection, with low cytotoxic effect. Emetine also blocked HIV-1 infection of RT M184V mutant. These results suggest that emetine is able to penetrate in intact HIV particles, and bind and block reverse transcription reaction, suggesting that it can be used as anti-HIV microbicide. Taken together, our findings provide additional pharmacological information on the potential therapeutic effects of emetine.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

Science.gov (United States)

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Rapid purification of radioiodinated peptides with Sep-Pak reversed phase cartridges and HPLC

International Nuclear Information System (INIS)

Miller, J.J.; Schultz, G.S.; Levy, R.S.

1984-01-01

A simple, rapid method is described for the purification of radioiodinated peptides for use in radioimmuno- and in radioreceptor assays. Iodinated reaction mixtures are applied directly onto Sep-Pak disposable, reversed phase cartridges equilibrated with phosphate buffer. Unreacted 125-iodide and other non-peptide reaction components are eluted with buffer. The peptide fraction is then eluted with 70% buffer:30% acetonitrile. The peptide fraction is further purified by reversed phase high pressure liquid chromatography to separate the native peptide and the mono- and diiodo-derivatives. In this study the method is used to prepare 125-iodide-labeled monoiodo-leucine enkephalin and monoiodo-angiotensin II, which are free of the parent peptides and diiodo-derivatives and are of maximum obtainable specific radioactivity. The usefulness of these labeled peptides in radioimmuno- and radioreceptor assays is demonstrated by their binding to specific antibodies and receptors, respectively. (author)

Modular rate laws for enzymatic reactions: thermodynamics, elasticities and implementation.

Science.gov (United States)

Liebermeister, Wolfram; Uhlendorf, Jannis; Klipp, Edda

2010-06-15

Standard rate laws are a key requisite for systematically turning metabolic networks into kinetic models. They should provide simple, general and biochemically plausible formulae for reaction velocities and reaction elasticities. At the same time, they need to respect thermodynamic relations between the kinetic constants and the metabolic fluxes and concentrations. We present a family of reversible rate laws for reactions with arbitrary stoichiometries and various types of regulation, including mass-action, Michaelis-Menten and uni-uni reversible Hill kinetics as special cases. With a thermodynamically safe parameterization of these rate laws, parameter sets obtained by model fitting, sampling or optimization are guaranteed to lead to consistent chemical equilibrium states. A reformulation using saturation values yields simple formulae for rates and elasticities, which can be easily adjusted to the given stationary flux distributions. Furthermore, this formulation highlights the role of chemical potential differences as thermodynamic driving forces. We compare the modular rate laws to the thermodynamic-kinetic modelling formalism and discuss a simplified rate law in which the reaction rate directly depends on the reaction affinity. For automatic handling of modular rate laws, we propose a standard syntax and semantic annotations for the Systems Biology Markup Language. An online tool for inserting the rate laws into SBML models is freely available at www.semanticsbml.org. Supplementary data are available at Bioinformatics online.

Symmetry Relations in Chemical Kinetics Arising from Microscopic Reversibility

Science.gov (United States)

Adib, Artur B.

2006-01-01

It is shown that the kinetics of time-reversible chemical reactions having the same equilibrium constant but different initial conditions are closely related to one another by a directly measurable symmetry relation analogous to chemical detailed balance. In contrast to detailed balance, however, this relation does not require knowledge of the elementary steps that underlie the reaction, and remains valid in regimes where the concept of rate constants is ill defined, such as at very short times and in the presence of low activation barriers. Numerical simulations of a model of isomerization in solution are provided to illustrate the symmetry under such conditions, and potential applications in protein folding or unfolding are pointed out.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

Science.gov (United States)

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.

Science.gov (United States)

Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui

2017-07-05

Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Time asymmetry: Polarization and analyzing power in the nuclear reactions

Energy Technology Data Exchange (ETDEWEB)

Rioux, C.; Roy, R.; Slobodrian, R.J. (Laval Univ., Quebec City (Canada). Lab. de Physique Nucleaire); Conzett, H.E. (California Univ., Berkeley (USA). Lawrence Berkeley Lab.)

1983-02-28

Measurements of the proton polarization in the reactions /sup 7/Li(/sup 3/He, p vector)/sup 9/Be and /sup 9/Be(/sup 3/He, p vector)/sup 11/B and of the analyzing powers of the inverse reactions, initiated by polarized protons at the same c.m. energies, show significant differences which imply the failure of the polarization-analyzing-power theorem and, prima facie, of time-reversal invariance in these reactions. The reaction /sup 2/H(/sup 3/He, p vector)/sup 4/ He and its inverse have also been investigated and show some smaller differences. A discussion of the instrumental asymmetries is presented.

Transesterification of oil mixtures catalyzed by microencapsulated cutinase in reversed micelles.

Science.gov (United States)

Badenes, Sara M; Lemos, Francisco; Cabral, Joaquim M S

2010-03-01

Recombinant cutinase from Fusarium solani pisi was used to catalyze the transesterification reaction between a mixture of triglycerides (oils) and methanol in reversed micelles of bis(2-ethylhexyl) sodium sulfosuccinate (AOT) in isooctane for the purposes of producing biodiesel. The use of a bi-phase lipase-catalyzed system brings advantages in terms of catalyst re-use and the control of water activity in the medium and around the enzyme micro-environment. Small-scale batch studies were performed to study the influence of the initial enzyme and alcohol concentrations, and the substrates molar ratio. Conversions in excess of 75 were obtained with reaction times under 24 h, which makes this enzymatic process highly competitive when compared to similar lipase catalyzed reactions for biodiesel production using methanol.

Regio-, Diastereo-, and Enantioselective Nitroso-Diels-Alder Reaction of 1,3-Diene-1-carbamates Catalyzed by Chiral Phosphoric Acids.

Science.gov (United States)

Pous, Jonathan; Courant, Thibaut; Bernadat, Guillaume; Iorga, Bogdan I; Blanchard, Florent; Masson, Géraldine

2015-09-23

Chiral phosphoric acid-catalyzed asymmetric nitroso-Diels-Alder reaction of nitrosoarenes with carbamate-dienes afforded cis-3,6-disubstituted dihydro-1,2-oxazines in high yields with excellent regio-, diastereo-, and enantioselectivities. Interestingly, we observed that the catalyst is able not only to control the enantioselectivity but also to reverse the regioselectivity of the noncatalyzed nitroso-Diels-Alder reaction. The regiochemistry reversal and asynchronous concerted mechanism were confirmed by DFT calculations.

Kinetic analysis of enzyme systems with suicide substrate in the presence of a reversible competitive inhibitor, tested by simulated progress curves.

Science.gov (United States)

Moruno-Dávila, M A; Garrido-del Solo, C; García-Moreno, M; Havsteen, B H; Garcia-Sevilla, F; Garcia-Cánovas, F; Varón, R

2001-02-01

The use of suicide substrates remains a very important and useful method in enzymology for studying enzyme mechanisms and designing potential drugs. Suicide substrates act as modified substrates for the target enzymes and bind to the active site. Therefore the presence of a competitive reversible inhibitor decreases the rate of substrate-induced inactivation and protects the enzyme from this inactivation. This lowering on the inactivation rate has evident physiological advantages, since it allows the easy acquisition of experimental data and facilitates kinetic data analysis by providing another variable (inhibitor concentration). However despite the importance of the simultaneous action of a suicide substrate and a competitive reversible inhibition, to date no corresponding kinetic analysis has been carried out. Therefore we present a general kinetic analysis of a Michaelis-Menten reaction mechanism with double inhibition caused by both, a suicide substrate and a competitive reversible inhibitor. We assume rapid equilibrium of the reversible reaction steps involved, while the time course equations for the reaction product have been derived with the assumption of a limiting enzyme. The goodness of the analytical solutions has been tested by comparison with the simulated curves obtained by numerical integration. A kinetic data analysis to determine the corresponding kinetic parameters from the time progress curve of the product is suggested. In conclusion, we present a complete kinetic analysis of an enzyme reaction mechanism as described above in an attempt to fill a gap in the theoretical treatment of this type of system.

Reversible and Irreversible Binding of Nanoparticles to Polymeric Surfaces

Directory of Open Access Journals (Sweden)

Wolfgang H. Binder

2009-01-01

Full Text Available Reversible and irreversible binding of CdSe-nanoparticles and nanorods to polymeric surfaces via a strong, multiple hydrogen bond (= Hamilton-receptor/barbituric acid is described. Based on ROMP-copolymers, the supramolecular interaction on a thin polymer film is controlled by living polymerization methods, attaching the Hamilton-receptor in various architectures, and concentrations. Strong binding is observed with CdSe-nanoparticles and CdSe-nanorods, whose surfaces are equipped with matching barbituric acid-moieties. Addition of polar solvents, able to break the hydrogen bonds leads to the detachment of the nanoparticles from the polymeric film. Irreversible binding is observed if an azide/alkine-“click”-reaction is conducted after supramolecular recognition of the nanoparticles on the polymeric surface. Thus reversible or irreversible attachment of the nanosized objects can be achieved.

Unified path integral approach to theories of diffusion-influenced reactions

Science.gov (United States)

Prüstel, Thorsten; Meier-Schellersheim, Martin

2017-08-01

Building on mathematical similarities between quantum mechanics and theories of diffusion-influenced reactions, we develop a general approach for computational modeling of diffusion-influenced reactions that is capable of capturing not only the classical Smoluchowski picture but also alternative theories, as is here exemplified by a volume reactivity model. In particular, we prove the path decomposition expansion of various Green's functions describing the irreversible and reversible reaction of an isolated pair of molecules. To this end, we exploit a connection between boundary value and interaction potential problems with δ - and δ'-function perturbation. We employ a known path-integral-based summation of a perturbation series to derive a number of exact identities relating propagators and survival probabilities satisfying different boundary conditions in a unified and systematic manner. Furthermore, we show how the path decomposition expansion represents the propagator as a product of three factors in the Laplace domain that correspond to quantities figuring prominently in stochastic spatially resolved simulation algorithms. This analysis will thus be useful for the interpretation of current and the design of future algorithms. Finally, we discuss the relation between the general approach and the theory of Brownian functionals and calculate the mean residence time for the case of irreversible and reversible reactions.

Reversible bulk-phase change of anthroyl compounds for photopatterning based on photodimerization in the molten state and thermal back reaction.

Science.gov (United States)

Kihara, Hideyuki; Yoshida, Masaru

2013-04-10

As new organic materials for rewritable photopatterning, 2-anthroyl and 9-anthroyl ester compounds were synthesized. Their bulk-phase changes (we use "bulk-phase change" as complete phase change in a mass of a material neither in a surface nor in a small quantity in this study) triggered by photodimerization under melting conditions (melt-photodimerization) and subsequent thermal back reactions were investigated. All the anthroyl compounds exhibited melting points lower than ca. 160 °C, and they were nearly quantitatively converted to the corresponding photodimers by UV irradiation at temperatures of ∼5 °C higher than their respective melting points. We found that there were two kinds of bulk-phase change behaviors through the photoreaction. Two of the anthroyl compounds remained isotropic and lost fluidity during the melt-photodimerization. The obtained photodimers exhibited robust solid-state amorphous phases at room temperature. In contrast, the other three anthroyl compounds showed crystallization during the melt-photodimerization. The resulting photodimers changed from isotropic to crystalline phases, even at high temperature. Various experiments revealed that the bulk phase of the photodimers was affected not by the existence of regioisomers but by their fluidity at the photoirradiation temperature. The latter three photodimers retained enough fluidity, reflecting their high molecular mobilities at the photoirradiation temperature at which the isothermal crystallization occurred. The other two products were not able to crystallize due to low fluidity, resulting in amorphous phases. We also found that all the photodimers reverted to the corresponding monomers by thermal back reaction and recovered their initial photochemical and thermal properties. Using these reversible bulk-phase changes of the anthroyl compounds, we successfully demonstrated rewritable photopatterning in not only negative images but also positive ones, based on the optical contrast

Isotopic study on mechanism for skeletal isomerization of n-butane over solid acids

International Nuclear Information System (INIS)

Suzuki, Tetsuo; Okuhara, Toshio

2000-01-01

Reaction mechanism for skeletal isomerization of n-butane over typical strong solid acids were investigated by using 1,4- 13 C 2 -n-butane. We used FI MASS for the analysis of 13 C distribution to get the parent pattern. 13 C-distribution of isobutane formed at 423 K over SO 3 2- /ZrO 2 (SZ) and Cs 2.5 H 0.5 PW 12 O 40 (Cs2.5) were close to binomial distributions, indicating that the isomerization proceeded mainly via a bimolecular mechanism on these catalysts. On the other hand, at 523 K over Cs2.5, the isotopic distribution pattern in isobutane was quite different from the binomial one; the fraction of 13 C 2 -isobutane was much greater than the binomial distribution. This result demonstrates that an intramolecular (monomolecular) rearrangement became significant at 523 K over Cs2.5. The contribution of monomolecular pathway was higher on Cs2.5 than on SZ. We presumed that the contribution of mechanism is related to the acidic property and the dehydrogenation ability of the catalyst. (S.Y.)

Diversity-Oriented Syntheses by Combining CuAAC and Stereoselective INCIC Reactions with Peptides

DEFF Research Database (Denmark)

Wang, Yuanyuan; Madsen, Anders; Diness, Frederik

2017-01-01

Cascade reactions proceeding through peptide-derived N-carbamoyl iminium ions are reported. Two new reactions of N-carbamoyl iminium ions are described, including a stereoselective double cyclization generating N,N′-aminals and an acid-promoted auto-oxidation. Mechanistic investigations revealed...... that the N,N′-aminal formation is reversible under strongly acidic conditions. Both of these new reactions proved to be completely orthogonal to subsequent CuAAC chemistry. The reactions were performed in solution and on solid support. The robustness and high stereoselectivity of the methodology holds great...

Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS

OpenAIRE

Batista, Mariana Dias [UNIFESP; Porro, Adriana Maria [UNIFESP; Maeda, Solange Miki [UNIFESP; Gomes, Elimar Elias [UNIFESP; Yoshioka, Marcia Cristina Naomi [UNIFESP; Enokihara, Mílvia Maria Simões e Silva [UNIFESP; Tomimori, Jane [UNIFESP

2008-01-01

We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.

Leprosy reversal reaction as immune reconstitution inflammatory syndrome in patients with AIDS.

Science.gov (United States)

Batista, Mariana D; Porro, Adriana M; Maeda, Solange M; Gomes, Elimar E; Yoshioka, Márcia C N; Enokihara, Mílvia M S S; Tomimori, Jane

2008-03-15

We report 2 instances in which reactional borderline leprosy manifested itself as an immune reconstitution phenomenon in patients with acquired immunodeficiency syndrome. We discuss the clinical, laboratory-based, histopathologic, and immunohistochemical characteristics of both patients. Furthermore, we review similar reports from the literature.

Reversible Thermoset Adhesives

Science.gov (United States)

Mac Murray, Benjamin C. (Inventor); Tong, Tat H. (Inventor); Hreha, Richard D. (Inventor)

2016-01-01

Embodiments of a reversible thermoset adhesive formed by incorporating thermally-reversible cross-linking units and a method for making the reversible thermoset adhesive are provided. One approach to formulating reversible thermoset adhesives includes incorporating dienes, such as furans, and dienophiles, such as maleimides, into a polymer network as reversible covalent cross-links using Diels Alder cross-link formation between the diene and dienophile. The chemical components may be selected based on their compatibility with adhesive chemistry as well as their ability to undergo controlled, reversible cross-linking chemistry.

Thermally reversible cross-linked poly(ether-urethanes

Directory of Open Access Journals (Sweden)

V. Gaina

2013-07-01

Full Text Available Cross-linked poly(ether-urethanes were prepared by Diels-Alder (DA reaction of the furan-containing poly(ether-urethane to bismaleimides and showed thermal reversibility evidenced by differential scanning calorimetry and attenuated total reflectance in conjunction with Fourier transform infrared spectroscopy (ATR-FTIR. The furan-containing poly(ether-urethanes were synthesized by the polyaddition reaction of 1,6-hexamethylene diisocyanate (HMDI or 4,4'- dibenzyl diisocyanate (DBDI to poly(tetramethylene ether glycol (PTMEG having Mn = 250, 650, 1000, 1500 and 2000 and 2-[N,N-bis(2-methyl-2-hydroxyethylamino]furfuryl as chain extender by the solution prepolymer method. The molar ratio of isocyanate: PTMEG:chain extender varied from 2:1:1 to 4:1:3, which produces a molar concentration of furyl group ranging between 3.65•10–4 and 1.25•10–3 mol/g.

A new strategy to inhibit the excision reaction catalysed by HIV-1 reverse transcriptase: compounds that compete with the template–primer

Science.gov (United States)

Cruchaga, Carlos; Anso, Elena; Font, María; Martino, Virginia S.; Rouzaut, Ana; Martinez-Irujo, Juan J.

2007-01-01

Inhibitors of the excision reaction catalysed by HIV-1 RT (reverse transcriptase) represent a promising approach in the fight against HIV, because these molecules would interfere with the main mechanism of resistance of this enzyme towards chain-terminating nucleotides. Only a limited number of compounds have been demonstrated to inhibit this reaction to date, including NNRTIs (non-nucleoside RT inhibitors) and certain pyrophosphate analogues. We have found previously that 2GP (2-O-galloylpunicalin), an antiviral compound extracted from the leaves of Terminalia triflora, was able to inhibit both the RT and the RNase H activities of HIV-1 RT without affecting cell proliferation or viability. In the present study, we show that 2GP also inhibited the ATP- and PPi-dependent phosphorolysis catalysed by wild-type and AZT (3′-azido-3′-deoxythymidine)-resistant enzymes at sub-micromolar concentrations. Kinetic and direct-binding analysis showed that 2GP was a non-competitive inhibitor against the nucleotide substrate, whereas it competed with the binding of RT to the template–primer (Kd=85 nM). As expected from its mechanism of action, 2GP was active against mutations conferring resistance to NNRTIs and AZT. The combination of AZT with 2GP was highly synergistic when tested in the presence of pyrophosphate, indicating that the inhibition of RT-catalysed phosphorolysis was responsible for the synergy found. Although other RT inhibitors that compete with the template–primer have been described, this is the first demonstration that these compounds can be used to block the excision of chain terminating nucleotides, providing a rationale for their combination with nucleoside analogues. PMID:17355225

Zero field reversal probability in thermally assisted magnetization reversal

Science.gov (United States)

Prasetya, E. B.; Utari; Purnama, B.

2017-11-01

This paper discussed about zero field reversal probability in thermally assisted magnetization reversal (TAMR). Appearance of reversal probability in zero field investigated through micromagnetic simulation by solving stochastic Landau-Lifshitz-Gibert (LLG). The perpendicularly anisotropy magnetic dot of 50×50×20 nm3 is considered as single cell magnetic storage of magnetic random acces memory (MRAM). Thermally assisted magnetization reversal was performed by cooling writing process from near/almost Curie point to room temperature on 20 times runs for different randomly magnetized state. The results show that the probability reversal under zero magnetic field decreased with the increase of the energy barrier. The zero-field probability switching of 55% attained for energy barrier of 60 k B T and the reversal probability become zero noted at energy barrier of 2348 k B T. The higest zero-field switching probability of 55% attained for energy barrier of 60 k B T which corespond to magnetif field of 150 Oe for switching.

Test of parity and time reversal invariance with low energy polarized neutrons

International Nuclear Information System (INIS)

Masaike, Akira

1996-01-01

Measurements of helicity asymmetries in slow neutron reactions on nuclei have been performed by transmission and capture γ-ray detection. Large enhancements of parity-violation effects have been observed on p-wave resonances of various medium and heavy nuclei. The weak matrix elements in hadron reactions have been deduced from these experimental results. Neutron spin precession near the p-wave resonance has been measured. In recent years violation of time reversal invariance is being searched for in the neutron reactions in which large enhancements of the parity violation effects have been observed. The measurement of the term σ n ·(k n x I) in a neutron reaction using polarized neutrons and a polarized target is an example of the test of T-violation. Polarizations of the neutron and lanthanum nucleus for these experiments are also presented. (author)

Reversal of a Suspected Paradoxical Reaction to Zopiclone with Flumazenil

DEFF Research Database (Denmark)

Jordahn, Zarah; Andersen, Cheme; Aaberg, Anne Marie Roust

2016-01-01

We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA), the pat......We describe the care for an elderly woman who was admitted to the intensive care unit (ICU) to receive noninvasive ventilation for acute exacerbation of chronic obstructive pulmonary disease. After administration of the sleeping pill zopiclone, a nonbenzodiazepine receptor agonist (NBRA...... indicates that zopiclone induced behavioral changes resembling a paradoxical reaction to benzodiazepines and these symptoms may be treated with flumazenil....

Reverse Osmosis

Indian Academy of Sciences (India)

many applications, one of which is desalination of seawater. The inaugural Nobel Prize in Chemistry was awarded in 1901 to van 't Hoff for his seminal work in this area. The present article explains the principle of osmosis and reverse osmosis. Osmosis and Reverse Osmosis. As the name suggests, reverse osmosis is the ...

Reverse microemulsion synthesis of layered gadolinium hydroxide nanoparticles

Science.gov (United States)

Xu, Yadong; Suthar, Jugal; Egbu, Raphael; Weston, Andrew J.; Fogg, Andrew M.; Williams, Gareth R.

2018-02-01

A reverse microemulsion approach has been explored for the synthesis of layered gadolinium hydroxide (LGdH) nanoparticles in this work. This method uses oleylamine as a multifunctional agent, acting as surfactant, oil phase and base. 1-butanol is additionally used as a co-surfactant. A systematic study of the key reaction parameters was undertaken, including the volume ratio of surfactant (oleylamine) to water, the reaction time, synthesis temperature, and the amount of co-surfactant (1-butanol) added. It proved possible to obtain pristine LGdH materials at temperatures of 120 °C or below with an oleylamine: water ratio of 1:4. Using larger amounts of surfactant or higher temperatures caused the formation of Gd(OH)3, either as the sole product or as a major impurity phase. The LGdH particles produced have sizes of ca. 200 nm, with this size being largely independent of temperature or reaction time. Adjusting the amount of 1-butanol co-surfactant added permits the size to be varied between 200 and 300 nm.

Mixed-mode chromatography with zwitterionic phosphopeptidomimetic selectors from Ugi multicomponent reaction

NARCIS (Netherlands)

Gargano, Andrea F G; Leek, Tomas; Lindner, Wolfgang; Lämmerhofer, Michael

2013-01-01

In the present contribution a novel Ugi multicomponent reaction (MCR) was used to generate zwitterionic chromatographic selectors with capability for application in mixed-mode chromatography featuring complementary selectivities in reversed-phase (RP) and hydrophilic interaction liquid

Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

DEFF Research Database (Denmark)

Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

2006-01-01

oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

Versatile Dual Photoresponsive System for Precise Control of Chemical Reactions.

Science.gov (United States)

Xu, Can; Bing, Wei; Wang, Faming; Ren, Jinsong; Qu, Xiaogang

2017-08-22

A versatile method for photoregulation of chemical reactions was developed through a combination of near-infrared (NIR) and ultraviolet (UV) light sensitive materials. This regulatory effect was achieved through photoresponsive modulation of reaction temperature and pH values, two prominent factors influencing reaction kinetics. Photothermal nanomaterial graphene oxide (GO) and photobase reagent malachite green carbinol base (MGCB) were selected for temperature and pH regulation, respectively. Using nanocatalyst- and enzyme-mediated chemical reactions as model systems, we demonstrated the feasibility and high efficiency of this method. In addition, a photoresponsive, multifunctional "Band-aid"-like hydrogel platform was presented for programmable wound healing. Overall, this simple, efficient, and reversible system was found to be effective for controlling a wide variety of chemical reactions. Our work may provide a method for remote and sustainable control over chemical reactions for industrial and biomedical applications.

Reverse transcription-polymerase chain reaction (RT-PCR based detection and economic impact of foot-and-mouth disease in District Faisalabad, Pakistan during the year 2015

Directory of Open Access Journals (Sweden)

W. Ali

2017-06-01

Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.

Deviation from the kinetic law of mass action for reactions induced by binary encounters in liquid solutions

International Nuclear Information System (INIS)

Doktorov, Alexander B; Kipriyanov, Alexey A

2007-01-01

In considering the irreversible chemical reaction A+B→ C+B in liquid solutions two many-particle approaches to the derivation of binary non-Markovian kinetic equations are compared: simple superposition decoupling and a method of extracting 'pair' channels from three-particle correlation evolution. It is shown that both methods provide an almost identical description of this reaction. However, in studies of reversible reactions in liquid solutions only the channel extraction method gives a correct physically clear description of the reaction though it consists of a sequence of steps: the development of integral encounter theory (IET), effective pairs approximation (EPA), modified encounter theory (MET), and the final regular form (RF) of kinetic equations. It is shown that the rate equations often encountered in the literature correspond to the independence of transient channels of 'scattering' in the bimolecular reversible reaction (A+B -B), while the independent transient channel of 'decay' in the reversible reactionA+B -C is defined solely by time integral convolution. In the general case transient channels in non-Markovian theory are not independent, and their interference manifests itself as a non-Markovian inhomogeneous source in binary non-Markovian kinetic equations in regular form. Based on the derived equations new universal kinetics (independent of models) of chemical equilibrium attainment have been obtained. It is shown that these kinetics can differ essentially from the kinetics corresponding to the kinetic law of mass action of formal chemical kinetics

Reversible insertion of carbon dioxide into Pt(II)-hydroxo bonds.

Science.gov (United States)

Lohr, Tracy L; Piers, Warren E; Parvez, Masood

2013-10-01

The reactivity of three monomeric diimine Pt(II) hydroxo complexes, (NN)Pt(OH)R (NN = bulky diimine ligand; R = OH, ; R = C6H5, ; R = CH3, ) towards carbon dioxide has been investigated. Insertion into the Pt-OH bonds was found to be facile and reversible at low temperature for all compounds; the reaction with bis-hydroxide gives an isolable κ(2)-carbonato compound , with elimination of water.

Redox-induced reversible luminescence switching of cerium-doped upconversion nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Huang, Yanan [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xiao, Qingbo, E-mail: qbxiao2011@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Wang, Jian [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Xi, Yonglan [Laboratory for Agricultural Wastes Treatment and Recycling Institute of Agricultural Resources and Environment, Jiangsu Academy of Agricultural Science, Nanjing 210014 (China); Li, Fujin [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Feng, Yamin [College of Sciences, Shanghai University, Shanghai 200444 (China); International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China); Shi, Liyi [College of Sciences, Shanghai University, Shanghai 200444 (China); Lin, Hongzhen, E-mail: hzlin2010@sinano.ac.cn [International Laboratory for Adaptive Bio-nanotechnology, Suzhou Institute of Nano-tech and Nano-bionics (SINANO), Chinese Academy of Science, Suzhou 215123 (China)

2016-05-15

Smart upconversion nanophosphors (UCNPs) that can be reversibly switched between two or more luminescent states by certain external stimuli have attracted considerable attention due to their great potential in biological applications. Here we report for the first time a type of redox-switchable UCNPs by codoping NaGdF{sub 4}:Yb/Er nanorods with the redox-active Ce{sup 3+}/Ce{sup 4+} ion pairs. A reversible switching of their UC luminescence intensity was observed upon the variation of the surrounding redox environments. We show solid proof that the luminescence switching is caused by the tailoring of the NaGdF{sub 4} host crystal structure in response to changing redox state of the codoped cerium ions. A proof-of-concept example is further demonstrated by using these UCNPs for probing the dynamical variation of redox environments in biological tissues. - Highlights: • Synthesis of upconversion nanoparticles doped with Ce{sup 3+}/Ce{sup 4+} ions. • The precise and reversible modification of crystal structure by redox reactions. • Tuning the upconversion luminescence by tailoring the crystal structure.

Solar energy powered microbial fuel cell with a reversible bioelectrode.

Science.gov (United States)

Strik, David P B T B; Hamelers, Hubertus V M; Buisman, Cees J N

2010-01-01

The solar energy powered microbial fuel cell is an emerging technology for electricity generation via electrochemically active microorganisms fueled by solar energy via in situ photosynthesized metabolites from algae, cyanobacteria, or living higher plants. A general problem with microbial fuel cells is the pH membrane gradient which reduces cell voltage and power output. This problem is caused by acid production at the anode, alkaline production at the cathode, and the nonspecific proton exchange through the membrane. Here we report a solution for a new kind of solar energy powered microbial fuel cell via development of a reversible bioelectrode responsible for both biocatalyzed anodic and cathodic electron transfer. Anodic produced protons were used for the cathodic reduction reaction which held the formation of a pH membrane gradient. The microbial fuel cell continuously generated electricity and repeatedly reversed polarity dependent on aeration or solar energy exposure. Identified organisms within biocatalyzing biofilm of the reversible bioelectrode were algae, (cyano)bacteria and protozoa. These results encourage application of solar energy powered microbial fuel cells.

Determination of the energetics of the UDP-glucose pyrophosphorylase reaction by positional isotope exchange inhibition

International Nuclear Information System (INIS)

Hester, L.S.; Raushel, F.M.

1987-01-01

A method has been developed for obtaining qualitative information about enzyme-catalyzed reactions by measuring the inhibitory effects of added substrates on positional isotope exchange rates. It has been demonstrated for ordered kinetic mechanisms that an increase in the concentration of the second substrate to add to the enzyme will result in a linear increase in the ratio of the chemical and positional isotope exchange rates. The slopes and intercepts from these plots can be used to determine the partitioning ratios of binary and ternary enzyme complexes. The method has been applied to the reaction catalyzed by UDP-glucose pyrophosphorylase. A positional isotope exchange reaction was measured within oxygen-18-labeled UTP as a function of variable glucose 1-phosphate concentration in the forward reaction. In the reverse reaction, a positional isotope exchange reaction was measured within oxygen-18-labeled UDP-glucose as a function of increasing pyrophosphate concentration. The results have been interpreted to indicate that the interconversion of the ternary central complexes is fast relative to product dissociation in either direction. In the forward direction, the release of UDP-glucose is slower than the release of pyrophosphate. The release of glucose 1-phosphate is slower than the release of UTP in the reverse reaction

Recent developments in Cope-type hydroamination reactions of hydroxylamine and hydrazine derivatives.

Science.gov (United States)

Beauchemin, André M

2013-11-07

Cope-type hydroaminations are versatile for the direct amination of alkenes, alkynes and allenes using hydroxylamines and hydrazine derivatives. These reactions occur via a concerted, 5-membered cyclic transition state that is the microscopic reverse of the Cope elimination. This article focuses on recent developments, including intermolecular variants, directed reactions, and asymmetric variants using aldehydes as tethering catalysts, and their applications in target-oriented synthesis.

Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hamed Rezaeejam

2015-01-01

Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

Random attractors for stochastic lattice reversible Gray-Scott systems with additive noise

Directory of Open Access Journals (Sweden)

Hongyan Li

2015-10-01

Full Text Available In this article, we prove the existence of a random attractor of the stochastic three-component reversible Gray-Scott system on infinite lattice with additive noise. We use a transformation of addition involved with Ornstein-Uhlenbeck process, for proving the pullback absorbing property and the pullback asymptotic compactness of the reaction diffusion system with cubic nonlinearity.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

Science.gov (United States)

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

The influence of the "cage effect" on the mechanism of reversible bimolecular multistage chemical reactions in solutions.

Science.gov (United States)

Doktorov, Alexander B

2015-08-21

Manifestations of the "cage effect" at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a "cage complex." Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the "cage effect" leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

Characterizing multistationarity regimes in biochemical reaction networks.

Directory of Open Access Journals (Sweden)

Irene Otero-Muras

Full Text Available Switch like responses appear as common strategies in the regulation of cellular systems. Here we present a method to characterize bistable regimes in biochemical reaction networks that can be of use to both direct and reverse engineering of biological switches. In the design of a synthetic biological switch, it is important to study the capability for bistability of the underlying biochemical network structure. Chemical Reaction Network Theory (CRNT may help at this level to decide whether a given network has the capacity for multiple positive equilibria, based on their structural properties. However, in order to build a working switch, we also need to ensure that the bistability property is robust, by studying the conditions leading to the existence of two different steady states. In the reverse engineering of biological switches, knowledge collected about the bistable regimes of the underlying potential model structures can contribute at the model identification stage to a drastic reduction of the feasible region in the parameter space of search. In this work, we make use and extend previous results of the CRNT, aiming not only to discriminate whether a biochemical reaction network can exhibit multiple steady states, but also to determine the regions within the whole space of parameters capable of producing multistationarity. To that purpose we present and justify a condition on the parameters of biochemical networks for the appearance of multistationarity, and propose an efficient and reliable computational method to check its satisfaction through the parameter space.

Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

Science.gov (United States)

Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

2014-01-01

Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

Simultaneous detection of viruses and Toxoplasma gondii in cerebrospinal fluid specimens by multiplex polymerase chain reaction-based reverse hybridization assay.

Science.gov (United States)

Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe

2009-04-01

The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.

Managing Reverse Logistics or Reversing Logistics Management?

NARCIS (Netherlands)

M.P. de Brito (Marisa)

2004-01-01

textabstractIn the past, supply chains were busy fine-tuning the logistics from raw material to the end customer. Today an increasing flow of products is going back in the chain. Thus, companies have to manage reverse logistics as well.This thesis contributes to a better understanding of reverse

Safety analysis of switching between reductive and oxidative conditions in a reaction coupling reverse flow reactor.

NARCIS (Netherlands)

van Sint Annaland, M.; Kuipers, J.A.M.; van Swaaij, Willibrordus Petrus Maria

2001-01-01

A new reverse flow reactor is developed where endothermic reactants (propane dehydrogenation) and exothermic reactants (fuel combustion) are fed sequentially to a monolithic catalyst, while periodically alternating the inlet and outlet positions. Upon switching from reductive to oxidative conditions

Visual but not motor processes predict simple visuomotor reaction time of badminton players.

Science.gov (United States)

Hülsdünker, Thorben; Strüder, Heiko K; Mierau, Andreas

2018-03-01

The athlete's brain exhibits significant functional adaptations that facilitate visuomotor reaction performance. However, it is currently unclear if the same neurophysiological processes that differentiate athletes from non-athletes also determine performance within a homogeneous group of athletes. This information can provide valuable help for athletes and coaches aiming to optimize existing training regimes. Therefore, this study aimed to identify the neurophysiological correlates of visuomotor reaction performance in a group of skilled athletes. In 36 skilled badminton athletes, electroencephalography (EEG) was used to investigate pattern reversal and motion onset visual-evoked potentials (VEPs) as well as visuomotor reaction time (VMRT) during a simple reaction task. Stimulus-locked and response-locked event-related potentials (ERPs) in visual and motor regions as well as the onset of muscle activation (EMG onset) were determined. Correlation and multiple regression analyses identified the neurophysiological parameters predicting EMG onset and VMRT. For pattern reversal stimuli, the P100 latency and age best predicted EMG onset (r = 0.43; p = .003) and VMRT (r = 0.62; p = .001). In the motion onset experiment, EMG onset (r = 0.80; p badminton players while motor-related processes, although differentiating athletes from non-athletes, are not associated simple with visuomotor reaction performance.

Reversible structural modulation of Fe-Pt bimetallic surfaces and its effect on reactivity.

Science.gov (United States)

Ma, Teng; Fu, Qiang; Su, Hai-Yan; Liu, Hong-Yang; Cui, Yi; Wang, Zhen; Mu, Ren-Tao; Li, Wei-Xue; Bao, Xin-He

2009-05-11

Tunable surface: The surface structure of the Fe-Pt bimetallic catalyst can be reversibly modulated between the iron-oxide-rich Pt surface and the Pt-skin structure with subsurface Fe via alternating reduction and oxidation treatments (see figure). The regenerated active Pt-skin structure is active in reactions involving CO and/or O.

Quantum theory of exchange reactions: Use of nonorthogonal bases and coordinates

International Nuclear Information System (INIS)

Stechel, E.B.; Schmalz, T.G.; Light, J.C.

1979-01-01

A general approach to quantum scattering theory of exchange reactions utilizing nonorthogonal (''over-complete'') basis sets and nonorthogonal coordinates is presented. The method is shown to resolve many of the formal and practical difficulties attending earlier theories. Although the inspiration came from the early and accurate work on the collinear H+H 2 reaction by Diestler possible applications include electron transfer processes as well as chemical exchange reactions. The mathematics is formulated in detail and the solution is presented in terms of the R-matrix propagation method preserving all the symmetries of the physical process, i.e., conservation of flux and microscopic reversibility

Inelastic Branch of the Stellar Reaction $^{14}$O$(\\alpha,p)^{17}$F

CERN Multimedia

Hass, M; Van duppen, P L E

2002-01-01

We propose to use the upgraded REX-ISOLDE beam energy to study the astrophysically important $^{14}$O($\\alpha$, p)$^{17}$F reaction in time reverse kinematics. In particular, we will use the highly efficient miniball + CD detection system to measure the previously undetermined inelastic proton branch of the 1$^-$ state at 6.15 MeV in $^{18}$Ne. This state dominates the reaction rate under X-ray burster conditions.

Niobium(V) chloride as catalyst in Diels-Alder reaction of furan ring

International Nuclear Information System (INIS)

Santos, Deborah A. dos; Rodrigues, Ludmila R.; Arpini, Bruno H.; Lacerda Junior, Valdemar; Greco, Sandro J.; Santos, Reginaldo B. dos; Neto, Alvaro C.; Castro, Eustaquio V.R. de

2014-01-01

According to the relevant literature, the Diels-Alder reaction of furan without a catalyst can last several weeks and shows a low yield due to the diene’s low reactivity. The use of Lewis acid catalysts or high pressures is described as an effective method for improving the reaction yields. This paper describes our recent study on the use of niobium pentachloride as the catalyst in Diels-Alder reactions between furan and several reactive dienophiles, among which methyl acrylate showed good yields, especially at lower temperatures. Other dienophiles have shown lower yields because of problems such as byproduct formation and the high reversibility of the reaction. (author)

Niobium(V) chloride as catalyst in Diels-Alder reaction of furan ring

Energy Technology Data Exchange (ETDEWEB)

Santos, Deborah A. dos; Rodrigues, Ludmila R.; Arpini, Bruno H.; Lacerda Junior, Valdemar; Greco, Sandro J.; Santos, Reginaldo B. dos; Neto, Alvaro C.; Castro, Eustaquio V.R. de, E-mail: vljuniorqui@gmail.com [Universidade Federal do Espirito Santo (UFES), Vitoria, ES (Brazil). Dept. de Quimica; Romao, Wanderson [Instituto Federal de Educacao, Ciencia e Tecnologia (IFES), Vila Velha, ES (Brazil)

2014-05-15

According to the relevant literature, the Diels-Alder reaction of furan without a catalyst can last several weeks and shows a low yield due to the diene’s low reactivity. The use of Lewis acid catalysts or high pressures is described as an effective method for improving the reaction yields. This paper describes our recent study on the use of niobium pentachloride as the catalyst in Diels-Alder reactions between furan and several reactive dienophiles, among which methyl acrylate showed good yields, especially at lower temperatures. Other dienophiles have shown lower yields because of problems such as byproduct formation and the high reversibility of the reaction. (author)

Characterization of Pulse Reverses Electroforming on Hard Gold Coating.

Science.gov (United States)

Byoun, Young-Min; Noh, Young-Tai; Kim, Young-Geun; Ma, Seung-Hwan; Kim, Gwan-Hoon

2018-03-01

Effect of pulse reverse current (PRC) method on brass coatings electroplated from gold solution was investigated by various plating parameters such as plating duration, the anodic duty cycle, the anodic current density and the cathodic current density. The reversed current results in a significant change in the morphology of electrodeposits, improvement of the overall current efficiency and reduction of deposit porosity. With longer pulses, hemispherical surface features are generated, while larger grains result from shorter pulse widths. The porosity of the plated samples is found to decrease compared with results at the same time-average plating rate obtained from DC or Pulse plating. A major impediment to reducing gold later thickness is the corrosion of the underlying substrate, which is affected by the porosity of the gold layer. Both the morphology and the hydrogen evolution reaction have significant impact on porosity. PRC plating affect hydrogen gold and may oxidize hydrogen produced during the cathodic portion of the waveform. Whether the dissolution of gold and oxidation of hydrogen occur depends on the type of plating bath and the plating conditions adapted. In reversed pulse plating, the amount of excess near-surface cyanide is changed after the cathodic current is applied, and the oxidation of gold under these conditions has not been fully addressed. The effects of the current density, pulse-reverse ratio and brightener concentration of the electroplating process were investigated and optimized for suitable performance.

A Reverse Stroop Task with Mouse Tracking

Science.gov (United States)

Yamamoto, Naohide; Incera, Sara; McLennan, Conor T.

2016-01-01

In a reverse Stroop task, observers respond to the meaning of a color word irrespective of the color in which the word is printed—for example, the word red may be printed in the congruent color (red), an incongruent color (e.g., blue), or a neutral color (e.g., white). Although reading of color words in this task is often thought to be neither facilitated by congruent print colors nor interfered with incongruent print colors, this interference has been detected by using a response method that does not give any bias in favor of processing of word meanings or processing of print colors. On the other hand, evidence for the presence of facilitation in this task has been scarce, even though this facilitation is theoretically possible. By modifying the task such that participants respond to a stimulus color word by pointing to a corresponding response word on a computer screen with a mouse, the present study investigated the possibility that not only interference but also facilitation would take place in a reverse Stroop task. Importantly, in this study, participants’ responses were dynamically tracked by recording the entire trajectories of the mouse. Arguably, this method provided richer information about participants’ performance than traditional measures such as reaction time and accuracy, allowing for more detailed (and thus potentially more sensitive) investigation of facilitation and interference in the reverse Stroop task. These trajectories showed that the mouse’s approach toward correct response words was significantly delayed by incongruent print colors but not affected by congruent print colors, demonstrating that only interference, not facilitation, was present in the current task. Implications of these findings are discussed within a theoretical framework in which the strength of association between a task and its response method plays a critical role in determining how word meanings and print colors interact in reverse Stroop tasks. PMID:27199881

Development of mRNA-based body fluid identification using reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Satoh, Tetsuya; Kouroki, Seiya; Ogawa, Keita; Tanaka, Yorika; Matsumura, Kazutoshi; Iwase, Susumu

2018-04-25

Identifying body fluids from forensic samples can provide valuable evidence for criminal investigations. Messenger RNA (mRNA)-based body fluid identification was recently developed, and highly sensitive parallel identification using reverse transcription polymerase chain reaction (RT-PCR) has been described. In this study, we developed reverse transcription loop-mediated isothermal amplification (RT-LAMP) as a simple, rapid assay for identifying three common forensic body fluids, namely blood, semen, and saliva, and evaluated its specificity and sensitivity. Hemoglobin beta (HBB), transglutaminase 4 (TGM4), and statherin (STATH) were selected as marker genes for blood, semen, and saliva, respectively. RT-LAMP could be performed in a single step including both reverse transcription and DNA amplification under an isothermal condition within 60 min, and detection could be conveniently performed via visual fluorescence. Marker-specific amplification was performed in each assay, and no cross-reaction was observed among five representative forensically relevant body fluids. The detection limits of the assays were 0.3 nL, 30 nL, and 0.3 μL for blood, semen, and saliva, respectively, and their sensitivities were comparable with those of RT-PCR. Furthermore, RT-LAMP assays were applicable to forensic casework samples. It is considered that RT-LAMP is useful for body fluid identification.

Structural features in the HIV-1 repeat region facilitate strand transfer during reverse transcription

NARCIS (Netherlands)

Berkhout, B.; Vastenhouw, N. L.; Klasens, B. I.; Huthoff, H.

2001-01-01

Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer is facilitated by terminal repeat (R) elements in the viral genome. This strand-transfer reaction depends on base pairing between the cDNA of the 5'R and the 3'R. There

Chemical reaction surface vibrational frequencies evaluated in curvilinear internal coordinates: Application to H + CH(4) H(2) + CH(3).

Science.gov (United States)

Banks, Simon T; Clary, David C

2009-01-14

We consider the general problem of vibrational analysis at nonglobally optimized points on a reduced dimensional reaction surface. We discuss the importance of the use of curvilinear internal coordinates to describe molecular motion and derive a curvilinear projection operator to remove the contribution of nonzero gradients from the Hessian matrix. Our projection scheme is tested in the context of a two-dimensional quantum scattering calculation for the reaction H + CH(4) --> H(2) + CH(3) and its reverse H(2) + CH(3) --> H + CH(4). Using zero-point energies calculated via rectilinear and curvilinear projections we construct two two-dimensional, adiabatically corrected, ab initio reaction surfaces for this system. It is shown that the use of curvilinear coordinates removes unphysical imaginary frequencies observed with rectilinear projection and leads to significantly improved thermal rate constants for both the forward and reverse reactions.

Reverse genetics with animal viruses. NSV reverse genetics

International Nuclear Information System (INIS)

Mebatsion, T.

2005-01-01

New strategies to genetically manipulate the genomes of several important animal pathogens have been established in recent years. This article focuses on the reverse genetics techniques, which enables genetic manipulation of the genomes of non-segmented negative-sense RNA viruses. Recovery of a negative-sense RNA virus entirely from cDNA was first achieved for rabies virus in 1994. Since then, reverse genetic systems have been established for several pathogens of medical and veterinary importance. Based on the reverse genetics technique, it is now possible to design safe and more effective live attenuated vaccines against important viral agents. In addition, genetically tagged recombinant viruses can be designed to facilitate serological differentiation of vaccinated animals from infected animals. The approach of delivering protective immunogens of different pathogens using a single vector was made possible with the introduction of the reverse genetics system, and these novel broad-spectrum vaccine vectors have potential applications in improving animal health in developing countries. (author)

Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

Science.gov (United States)

Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

2012-02-01

Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

Science.gov (United States)

Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

2017-02-01

Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

Significance of detecting circulating hepatocellular carcinoma cells in peripheral blood of hepatocellular carcinoma patients by nested reverse transcription-polymerase chain reaction and its clinical value: a retrospective study.

Science.gov (United States)

Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun

2014-01-01

Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating

Evaluating viral interference between Influenza virus and Newcastle disease virus using real-time reverse transcription–polymerase chain reaction in chicken eggs

Directory of Open Access Journals (Sweden)

Ge Shengqiang

2012-07-01

Full Text Available Abstract Background Simultaneous and sequential allantoic cavity inoculations of Specific-pathogen-free (SPF chicken eggs with Influenza virus (AIV and Newcastle disease virus (NDV demonstrated that the interaction of AIV and NDV during co-infection was variable. Our research revisited the replication interference potential of AIV and NDV using real-time reverse transcription–polymerase chain reaction (real-time RT-PCR for AIV and NDV to specifically detect the viral genomes in mixed infections. Results Data from this survey showed that when different doses of NDV (Lasota or F48E8 and AIV (F98 or H5N1 were simultaneously inoculated into embryonating chicken eggs (ECE, interference with the growth of NDV occurred, while interference with the growth of AIV did not occur. When equal amount of the two viruses were sequentially employed, the degree of interference was dependent upon the time of superinfection and the virulence of virus. Conclusion AIV have a negative impact on NDV growth if they are inoculated simultaneously or sequentially and that the degree of interference depended upon the quantity and relative virulence of the virus strains used; however, interference with AIV was not observed. Only if NDV were inoculated at an earlier time will NDV able to interfere with the growth of AIV.

Comparison between histopathologic features of leprosy in reaction lesions in HIV coinfected and non-coinfected patients.

Science.gov (United States)

Pires, Carla Andréa Avelar; Miranda, Mario Fernando Ribeiro de; Bittencourt, Maraya de Jesus Semblano; Brito, Arival Cardoso de; Xavier, Marília Brasil

2015-01-01

Leprosy and HIV are diseases that have a major impact on public health in Brazil. Patients coinfected with both diseases, appear to be at higher risk to develop leprosy reactions. The aim of this study is to describe the histopathological aspects of cutaneous lesions during reactional states in a group of patients with HIV-leprosy coinfection, compared to patients with leprosy, without coinfection. Two groups were established: group 1 comprised of 40 patients coinfected with HIV-leprosy; group 2, comprised of 107 patients with leprosy only. Patients presenting reactional states of leprosy had their lesions biopsied and comparatively evaluated. Reversal reaction was the most frequent feature in both groups, with dermis edema as the most common histopathological finding. Giant cells were seen in all group 1 histopathological examinations. Dermis edema was the most common finding in patients with erythema nodosum leprosum. Few histopathological differences were found in both groups, with reversal reaction as the most significant one, although this fact should be analyzed considering the predominant BT clinical form in the coinfected group and BB form in the group without HIV. Larger prospective studies in patients with HIV-leprosy coinfection are needed to confirm and broaden these results.

The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

International Nuclear Information System (INIS)

Doktorov, Alexander B.

2015-01-01

Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants

The influence of the “cage effect” on the mechanism of reversible bimolecular multistage chemical reactions in solutions

Energy Technology Data Exchange (ETDEWEB)

Doktorov, Alexander B., E-mail: doktorov@kinetics.nsc.ru [Voevodsky Institute of Chemical Kinetics & Combustion, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia and Novosibirsk State University, Novosibirsk 630090 (Russian Federation)

2015-08-21

Manifestations of the “cage effect” at the encounters of reactants are theoretically treated by the example of multistage reactions in liquid solutions including bimolecular exchange reactions as elementary stages. It is shown that consistent consideration of quasi-stationary kinetics of multistage reactions (possible only in the framework of the encounter theory) for reactions proceeding near reactants contact can be made on the basis of the concepts of a “cage complex.” Though mathematically such a consideration is more complicated, it is more clear from the standpoint of chemical notions. It is established that the presence of the “cage effect” leads to some important effects not inherent in reactions in gases or those in solutions proceeding in the kinetic regime, such as the appearance of new transition channels of reactant transformation that cannot be caused by elementary event of chemical conversion for the given mechanism of reaction. This results in that, for example, rate constant values of multistage reaction defined by standard kinetic equations of formal chemical kinetics from experimentally measured kinetics can differ essentially from real values of these constants.

Irradiation effects on properties of reverse osmosis membrane based on cross-linked aromatic polyamide

International Nuclear Information System (INIS)

Nakase, Yoshiaki; Yanagi, Tadashi; Uemura, Tadahiro.

1994-01-01

In order to develop a membrane suitable for reverse osmotic condensation of radioactive liquid wastes, a new cross-linked aromatic polyamide composite reverse osmosis membrane (ROM) was irradiated in water or in wet system, and its mechanical and some thermal properties, and the separation performance for inorganic salt were investigated. A membrane was degraded by irradiation more severely in wet system than in dry system, probably due to the reaction with OH-radicals. In the separation performance for NaCl, the salt rejection of the membrane was kept over 88% until irradiation reached 2MGy, maintaining about 90% of its original water flux. (author)

Simultaneous determination of Cr(iii) and Cr(vi) using reversed-phased ion-pairing liquid chromatography with dynamic reaction cell inductively coupled plasma mass spectrometry

Science.gov (United States)

Wolf, R.E.; Morrison, J.M.; Goldhaber, M.B.

2007-01-01

A method for the simultaneous determination of Cr(iii) and Cr(vi) species in waters, soil leachates and synthetic bio-fluids is described. The method uses reversed-phase ion-pairing liquid chromatography to separate the chromium species and a dynamic reaction cell (DRC??) equipped ICP-MS for detection of chromium. Separation of the chromium species is carried out in less than 2 min. Cr(iii) is complexed with ethylenediaminetetraacetic acid (EDTA) prior to separation by mixing samples with the mobile phase containing 2.0 mM tetrabutylammonium hydroxide (TBAOH), 0.5 mM EDTA (dipotassium salt), and 5% (vol/vol) methanol, adjusted to pH 7.6. The interfering 40Ar 12C+ background peak at mass 52 was reduced by over four orders of magnitude to less than 200 cps by using 0.65 mL min-1 ammonia as a reaction gas and an RPq setting on the DRC of 0.75. Method detection limits (MDLs) of 0.09 ??g L-1 for Cr(iii) and 0.06 ??g L-1 for Cr(vi) were obtained based on peak areas at mass 52 for 50 ??L injections of low level spikes. Reproducibility at 2 ??g L-1 was 3% RSD for 5 replicate injections. The tolerance of the method to various levels of common cations and anions found in natural waters and to matrix constituents found in soil leachates and simulated gastric and lung fluids was tested by performing spike recovery calculations for a variety of samples. ?? The Royal Society of Chemistry.

Trapping of superoxido cobalt and peroxido dicobalt species formed reversibly from CoII and O2.

Science.gov (United States)

Corona, Teresa; Padamati, Sandeep K; Acuña-Parés, Ferran; Duboc, Carole; Browne, Wesley R; Company, Anna

2017-08-22

The formation and spectroscopic characterization of a superoxido cobalt(iii) and a peroxido dicobalt(iii) species formed in the temperature dependent reversible reaction of a cobalt(ii) precursor with O 2 is described. The electronic nature of each species is explored in their reactivity with organic substrates.

Dynamical barrier and isotope effects in the simplest substitution reaction via Walden inversion mechanism

Science.gov (United States)

Zhao, Zhiqiang; Zhang, Zhaojun; Liu, Shu; Zhang, Dong H.

2017-02-01

Reactions occurring at a carbon atom through the Walden inversion mechanism are one of the most important and useful classes of reactions in chemistry. Here we report an accurate theoretical study of the simplest reaction of that type: the H+CH4 substitution reaction and its isotope analogues. It is found that the reaction threshold versus collision energy is considerably higher than the barrier height. The reaction exhibits a strong normal secondary isotope effect on the cross-sections measured above the reaction threshold, and a small but reverse secondary kinetic isotope effect at room temperature. Detailed analysis reveals that the reaction proceeds along a path with a higher barrier height instead of the minimum-energy path because the umbrella angle of the non-reacting methyl group cannot change synchronously with the other reaction coordinates during the reaction due to insufficient energy transfer from the translational motion to the umbrella mode.

Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Gusti Ayu Yuniati Kencana

2013-07-01

Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

Development of a Rapid Detection Method for Potato virus X by Reverse Transcription Loop-Mediated Isothermal Amplification

Directory of Open Access Journals (Sweden)

Joojin Jeong

2015-09-01

Full Text Available The primary step for efficient control of viral diseases is the development of simple, rapid, and sensitive virus detection. Reverse transcription loop-mediated isothermal amplification (RT-LAMP has been used to detect viral RNA molecules because of its simplicity and high sensitivity for a number of viruses. RT-LAMP for the detection of Potato virus X (PVX was developed and compared with conventional reverse transcription polymerase chain reaction (RT-PCR to demonstrate its advantages over RT-PCR. RT-LAMP reactions were conducted with or without a set of loop primers since one out of six primers showed PVX specificity. Based on real-time monitoring, RT-LAMP detected PVX around 30 min, compared to 120 min for RT-PCR. By adding a fluorescent reagent during the reaction, the extra step of visualization by gel electrophoresis was not necessary. RT-LAMP was conducted using simple inexpensive instruments and a regular incubator to evaluate whether RNA could be amplified at a constant temperature instead of using an expensive thermal cycler. This study shows the potential of RT-LAMP for the diagnosis of viral diseases and PVX epidemiology because of its simplicity and rapidness compared to RT-PCR.

Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Faggioli, F; Pasquini, G; Barba, M

1998-09-01

The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

Exchange reaction between hydrogen and deuterium. II - Proposal for an heterogeneous initiation mechanism of gaseous phase reactions

Energy Technology Data Exchange (ETDEWEB)

Marteau, Chantal; Gaillard-Cusin, Francoise; James, Henri [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures

1978-05-01

Investigation of experimental data related to evolution period exhibited by H/sub 2/-D/sub 2/ exchange process requires to take into account the variation against time of every atomic species -adsorbed or not- implied in the reaction mechanism. The formation of first chain carriers involves: - chemisorption of either gaseous reactant on the surface active centres (..sigma..), e.g.: ..sigma.. + 1/2 H/sub 2/ reversible ..sigma..H; - consecutive generation of atomic species through hetero-homogeneous transfer between chemisorbed species (..sigma..H) and gaseous molecules: ..sigma..H+H/sub 2/..--> sigma..+H/sub 2/+H/sup 0/, ..sigma..H+D/sub 2/..--> sigma..+HD+D/sup 0/. Therefore, it can be shown that the heterogeneous initiation process of a gas phase reaction identifies to a chain linear mechanism. Such an heterogeneous sequence conditions the further proceeding of the homogeneous chain reaction; both evolutions being kinematically connected. Rate constant of hydrogen adsorption on silica glass: ksub(a1) approximately 10/sup 14/ exp(-47/RT)Isup(0,5).molesup(-0,5).S/sup -1/ has been evaluated.

Technical advances in neutron polarimetry and studies of the (p,n) reaction in /sup 13/C

Energy Technology Data Exchange (ETDEWEB)

Videla, N G

1985-01-01

The asymmetry in the /sup 4/He(p,n vector)/sup 4/He reaction has been measured at three different incident neutron energies: 19.40; 22.85 and 27.31 MeV, and 120/sup 0/ from forward direction. Values of the asymmetry have been used to calculate the polarization of fast neutrons produced in the /sup 13/C(p,n vector)/sup 13/N. The /sup 13/C(p,n vector)/sup 13/N reaction was studied as part of a program being undertaken at the University of Manitoba Cyclotron Laboratory to study (p,n) reactions linking isobaric analog states of mirror nuclei in the energy range of 22 to 50 MeV. The study involves a comparison of the proton analyzing power A(theta), in the reaction /sup 13/C(vector p,n)/sup 13/N to the neutron polarization in the inverse reaction /sup 13/C(p,n vector)/sup 13/N. The importance of the comparison between these two observables is based in Conzett's theorem for time reversed reactions, the theorem states that the proton analyzing power in the reaction /sup 13/C(vector p,n)/sup 13/N is equal to the neutron polarization in the reaction /sup 13/C(p,n vector)/sup 13/N provided the reaction proceeds between members of an isospin doublet and when charge symmetry and time reversal invariance hold exactly. However, isospin symmetry is broken by the Coulomb interaction. So comparison of these two observables should yield information of the breaking of isospin by the Coulomb force.

Direct single-molecule dynamic detection of chemical reactions.

Science.gov (United States)

Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng

2018-02-01

Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.

An algebra of reversible computation.

Science.gov (United States)

Wang, Yong

2016-01-01

We design an axiomatization for reversible computation called reversible ACP (RACP). It has four extendible modules: basic reversible processes algebra, algebra of reversible communicating processes, recursion and abstraction. Just like process algebra ACP in classical computing, RACP can be treated as an axiomatization foundation for reversible computation.

On thermodynamic and microscopic reversibility

International Nuclear Information System (INIS)

Crooks, Gavin E

2011-01-01

The word 'reversible' has two (apparently) distinct applications in statistical thermodynamics. A thermodynamically reversible process indicates an experimental protocol for which the entropy change is zero, whereas the principle of microscopic reversibility asserts that the probability of any trajectory of a system through phase space equals that of the time reversed trajectory. However, these two terms are actually synonymous: a thermodynamically reversible process is microscopically reversible, and vice versa

DNA effects upon the reaction between acetonitrile pentacyanoferrate (II) and ruthenium pentammine pyrazine: Kinetic and thermodynamic evidence of the interaction of DNA with anionic species

International Nuclear Information System (INIS)

Grueso, E.; Prado-Gotor, R.; Lopez, M.; Gomez-Herrera, C.; Sanchez, F.

2005-01-01

The kinetics of the reaction between ruthenium pentaammine pyrazine and acetonitrile pentacyanoferrate (II) to obtain the binuclear anionic complex [Fe(CN) 5 pzRu(NH 3 ) 5 ] - , and the reverse (dissociation) process, have been studied in solutions containing DNA. The results corresponding to this reaction and those corresponding to the reverse (dissociation) process show a clear influence of DNA on their kinetics. The results can be interpreted using a modified Pseudophase Model. From the results obtained for the dissociation reaction one can conclude that the binuclear anionic complex [Fe(CN) 5 pzRu(NH 3 ) 5 ] - interacts with DNA

Formation of Reversible Solid Electrolyte Interface on Graphite Surface from Concentrated Electrolytes

Energy Technology Data Exchange (ETDEWEB)

Lu, Dongping; Tao, Jinhui; Yan, Pengfei; Henderson, Wesley A.; Li, Qiuyan; Shao, Yuyan; Helm, Monte L.; Borodin, Oleg; Graff, Gordon L.; Polzin, Bryant; Wang, Chong-Min; Engelhard, Mark; Zhang, Ji-Guang; De Yoreo, James J.; Liu, Jun; Xiao, Jie

2017-02-10

Interfacial phenomena have always been key determinants for the performance of energy storage technologies. The solid electrolyte interfacial (SEI) layer, pervasive on the surfaces of battery electrodes for numerous chemical couples, directly affects the ion transport, charge transfer and lifespan of the entire energy system. Almost all SEI layers, however, are unstable resulting in the continuous consumption of the electrolyte. Typically, this leads to the accumulation of degradation products on/restructuring of the electrode surface and thus increased cell impedance, which largely limits the long-term operation of the electrochemical reactions. Herein, a completely new SEI formation mechanism has been discovered, in which the electrolyte components reversibly self-assemble into a protective surface coating on a graphite electrode upon changing the potential. In contrast to the established wisdom regarding the necessity of employing the solvent ethylene carbonate (EC) to form a protective SEI layer on graphite, a wide range of EC-free electrolytes are demonstrated for the reversible intercalation/deintercalation of Li+ cations within a graphite lattice, thereby providing tremendous flexibility in electrolyte tailoring for battery couples. This novel finding is broadly applicable and provides guidance for how to control interfacial reactions through the relationship between ion aggregation and solvent decomposition at polarized interfaces.

Core--strategy leading to high reversible hydrogen storage capacity for NaBH4.

Science.gov (United States)

Christian, Meganne L; Aguey-Zinsou, Kondo-François

2012-09-25

Owing to its high storage capacity (10.8 mass %), sodium borohydride (NaBH(4)) is a promising hydrogen storage material. However, the temperature for hydrogen release is high (>500 °C), and reversibility of the release is unachievable under reasonable conditions. Herein, we demonstrate the potential of a novel strategy leading to high and stable hydrogen absorption/desorption cycling for NaBH(4) under mild pressure conditions (4 MPa). By an antisolvent precipitation method, the size of NaBH(4) particles was restricted to a few nanometers (hydrogen at 400 °C. Further encapsulation of these nanoparticles upon reaction of nickel chloride at their surface allowed the synthesis of a core--shell nanostructure, NaBH(4)@Ni, and this provided a route for (a) the effective nanoconfinement of the melted NaBH(4) core and its dehydrogenation products, and (b) reversibility and fast kinetics owing to short diffusion lengths, the unstable nature of nickel borohydride, and possible modification of reaction paths. Hence at 350 °C, a reversible and steady hydrogen capacity of 5 mass % was achieved for NaBH(4)@Ni; 80% of the hydrogen could be desorbed or absorbed in less than 60 min, and full capacity was reached within 5 h. To the best of our knowledge, this is the first time that such performances have been achieved with NaBH(4). This demonstrates the potential of the strategy in leading to major advancements in the design of effective hydrogen storage materials from pristine borohydrides.

Reversibility of female sterilization.

Science.gov (United States)

Siegler, A M; Hulka, J; Peretz, A

1985-04-01

The discussion considers the current status of reversibility of sterilization in the US and describes clinical and experimental efforts for developing techniques designed for reversibility. It focuses on regret following sterilization, reversal potential of current sterilization techniques, patient selection, current reversal techniques, results of sterilization procedures, experimental approaches to reversal of current techniques of sterilization, and sterilization procedures devised for reversibility, in humans and in animals. Request is the 1st stage of reversal, but a request for sterilization reversal (SR) does not always mean regret for a decision made at the time. Frequently it is a wish to restore fertility because life circumstances have changed after a sterilization that was ppropriate at the time it was performed. Schwyhart and Kutner reviewed 22 studies published between 1949-69 in which they found that the percentage of patients regretting the procedure ranged from 1.3-15%. Requests for reversal remain low in most countries, but if sterilization becomes a more popular method of contraception, requests will also increase. The ideal operation considered as a reversaible method of sterilization should include an easy, reliable outpatient method of tubal occlusion with miniml risk or patient discomfort that subsequently could be reversed without the need for a major surgical intervention. Endoscopic methods have progressed toward the 1st objective. A recent search of the literature uncovered few series of SR of more than 50 cases. The 767 operations found were analyzed with regard to pregnancy outcome. The precent of live births varied from 74-78.8%, and the occurance of tubal pregnancies ranged from 1.7-6.5%. All of the confounding variables in patient selection and small numbers of reported procedures preclude any conclusion about the different techniques or the number of operations that give a surgeon a level of expertise. Few authors classify their

Protein interfacial structure and nanotoxicology

Energy Technology Data Exchange (ETDEWEB)

White, John W. [Research School of Chemistry, Australian National University, Canberra (Australia)], E-mail: jww@rsc.anu.edu.au; Perriman, Adam W.; McGillivray, Duncan J.; Lin, J.-M. [Research School of Chemistry, Australian National University, Canberra (Australia)

2009-02-21

Here we briefly recapitulate the use of X-ray and neutron reflectometry at the air-water interface to find protein structures and thermodynamics at interfaces and test a possibility for understanding those interactions between nanoparticles and proteins which lead to nanoparticle toxicology through entry into living cells. Stable monomolecular protein films have been made at the air-water interface and, with a specially designed vessel, the substrate changed from that which the air-water interfacial film was deposited. This procedure allows interactions, both chemical and physical, between introduced species and the monomolecular film to be studied by reflectometry. The method is briefly illustrated here with some new results on protein-protein interaction between {beta}-casein and {kappa}-casein at the air-water interface using X-rays. These two proteins are an essential component of the structure of milk. In the experiments reported, specific and directional interactions appear to cause different interfacial structures if first, a {beta}-casein monolayer is attacked by a {kappa}-casein solution compared to the reverse. The additional contrast associated with neutrons will be an advantage here. We then show the first results of experiments on the interaction of a {beta}-casein monolayer with a nanoparticle titanium oxide sol, foreshadowing the study of the nanoparticle 'corona' thought to be important for nanoparticle-cell wall penetration.

Protein interfacial structure and nanotoxicology

International Nuclear Information System (INIS)

White, John W.; Perriman, Adam W.; McGillivray, Duncan J.; Lin, J.-M.

2009-01-01

Here we briefly recapitulate the use of X-ray and neutron reflectometry at the air-water interface to find protein structures and thermodynamics at interfaces and test a possibility for understanding those interactions between nanoparticles and proteins which lead to nanoparticle toxicology through entry into living cells. Stable monomolecular protein films have been made at the air-water interface and, with a specially designed vessel, the substrate changed from that which the air-water interfacial film was deposited. This procedure allows interactions, both chemical and physical, between introduced species and the monomolecular film to be studied by reflectometry. The method is briefly illustrated here with some new results on protein-protein interaction between β-casein and κ-casein at the air-water interface using X-rays. These two proteins are an essential component of the structure of milk. In the experiments reported, specific and directional interactions appear to cause different interfacial structures if first, a β-casein monolayer is attacked by a κ-casein solution compared to the reverse. The additional contrast associated with neutrons will be an advantage here. We then show the first results of experiments on the interaction of a β-casein monolayer with a nanoparticle titanium oxide sol, foreshadowing the study of the nanoparticle 'corona' thought to be important for nanoparticle-cell wall penetration.

Systematics of complex fragment emission from La induced reactions at E/A = 47 MeV

International Nuclear Information System (INIS)

Kehoe, W.L.; Mignerey, A.C.; Bradley, S.

1989-03-01

Complex fragment (Z > 2) emission was studied in the reverse kinematics reactions of 139 La on 27 Al and /sup nat./Cu at a bombarding energy of E/A = 47 MeV. Experimental results from inclusive and coincidence measurements for two- and three-fold complex fragments events are presented. Measured cross sections and Z 1 -Z 2 correlations show a predominately binary-decay process for the La + Al reaction, while the La + Cu reaction is dominated by multi-body decay. 18 refs., 9 figs., 1 tab

Reactions of modulated molecular beams with pyrolytic graphite IV. Water vapor

International Nuclear Information System (INIS)

Olander, D.R.; Acharya, T.R.; Ullman, A.Z.

1977-01-01

The reaction of water vapor with the prism plane face of anneal pyrolytic graphite was investigated by modulated molecular beam--mass spectrometry methods. The equivalent water vapor pressure of the beam was approx.2 x 10 -5 Torr and the graphite temperature was varied from 300 to 2500 0 K. The mechanism was deduced from three types of experiments: isotope exchange utilizing modulated H 2 O and steady D 2 O beams; measurements of the phase difference between H 2 O and neon reflected from the surface from a mixed primary beam of these species; and reaction of a modulated H 2 O beam to produce CO and H 2 . Based upon the isotope exchange experiments chemisorption of water on graphite was found to be dissociative and reversible. Incident water molecules chemisorbed with a sticking probability of 0.15 +- 0.02 to form the complexes C--OH and C--H. Recombination of the surface complexes reverses the adsorption step and is responsible for the isotope exchange properties of the graphite surface. This process is unactivated. Reaction to produce CO and H 2 also results from collisions of the primary surface complexes, but this step has an activation energy of 170 kJ/mole. This reaction yields bound complexes tentatively identified as C--O and H--C--H, which then decompose to produce the stable reaction products. All of the above steps exhibit characteristic times on the order of milliseconds, and are therefore detectable by the modulated beam method. All surface intermediates are strongly affected by solution and diffusion in the bulk of the solid

Analysis of phosphorus herbicides by ion-pairing reversed-phase liquid chromatography coupled to inductively coupled plasma mass spectrometry with octapole reaction cell.

Science.gov (United States)

Sadi, Baki B M; Vonderheide, Anne P; Caruso, Joseph A

2004-09-24

A reversed phase ion-pairing high performance liquid chromatographic (RPIP-HPLC) method is developed for the separation of two phosphorus herbicides, Glufosinate and Glyphosate as well as Aminomethylphosphonic acid (AMPA), the major metabolite of Glyphosate. Tetrabutylammonium hydroxide is used as the ion-pairing reagent in conjunction with an ammonium acetate/acetic acid buffering system at pH 4.7. An inductively coupled plasma mass spectrometer (ICP-MS) is coupled to the chromatographic system to detect the herbicides at m/z = 31P. Historically, phosphorus has been recognized as one of the elements difficult to analyze in argon plasma. This is due to its relatively high ionization potential (10.5 eV) as well as the inherent presence of the polyatomic interferences 14N16O1H+ and 15N16O+ overlapping its only isotope at m/z = 31. An octapole reaction cell is utilized to minimize the isobaric polyatomic interferences and to obtain the highest signal-to-background ratio. Detection limits were found to be in the low ppt range (25-32 ng/l). The developed method is successfully applied to the analysis of water samples collected from the Ohio River and spiked with a standard compounds at a level of 20 microg/l.

NUMERICAL TECHNIQUES TO SOLVE CONDENSATIONAL AND DISSOLUTIONAL GROWTH EQUATIONS WHEN GROWTH IS COUPLED TO REVERSIBLE REACTIONS (R823186)

Science.gov (United States)

Noniterative, unconditionally stable numerical techniques for solving condensational anddissolutional growth equations are given. Growth solutions are compared to Gear-code solutions forthree cases when growth is coupled to reversible equilibrium chemistry. In all cases, ...

Constraining the reversing and non-reversing modes of the geodynamo. New insights from magnetostratigraphy.

Science.gov (United States)

Gallet, Y.; Pavlov, V.; Shatsillo, A.; Hulot, G.

2015-12-01

Constraining the evolution in the geomagnetic reversal frequency over hundreds of million years is not a trivial matter. Beyond the fact that there are long periods without reversals, known as superchrons, and periods with many reversals, the way the reversal frequency changes through time during reversing periods is still debated. A smooth evolution or a succession of stationary segments have both been suggested to account for the geomagnetic polarity time scale since the Middle-Late Jurassic. Sudden changes from a reversing mode to a non-reversing mode of the geodynamo may also well have happened, the switch between the two modes having then possibly been controlled by the thermal conditions at the core-mantle boundary. There is, nevertheless, a growing set of magnetostratigraphic data, which could help decipher a proper interpretation of the reversal history, in particular in the early Paleozoic and even during the Precambrian. Although yielding a fragmentary record, these data reveal the occurrence of both additional superchrons and periods characterized by extremely high, not to say extraordinary, magnetic reversal frequencies. In this talk, we will present a synthesis of these data, mainly obtained from Siberia, and discuss their implication for the magnetic reversal behavior over the past billion years.

Comparison between histopathologic features of leprosy in reaction lesions in HIV coinfected and non-coinfected patients*

Science.gov (United States)

Pires, Carla Andréa Avelar; de Miranda, Mario Fernando Ribeiro; Bittencourt, Maraya de Jesus Semblano; de Brito, Arival Cardoso; Xavier, Marília Brasil

2015-01-01

BACKGROUND Leprosy and HIV are diseases that have a major impact on public health in Brazil. Patients coinfected with both diseases, appear to be at higher risk to develop leprosy reactions. OBJECTIVE The aim of this study is to describe the histopathological aspects of cutaneous lesions during reactional states in a group of patients with HIV-leprosy coinfection, compared to patients with leprosy, without coinfection. METHODS Two groups were established: group 1 comprised of 40 patients coinfected with HIV-leprosy; group 2, comprised of 107 patients with leprosy only. Patients presenting reactional states of leprosy had their lesions biopsied and comparatively evaluated. RESULTS Reversal reaction was the most frequent feature in both groups, with dermis edema as the most common histopathological finding. Giant cells were seen in all group 1 histopathological examinations. Dermis edema was the most common finding in patients with erythema nodosum leprosum. CONCLUSION Few histopathological differences were found in both groups, with reversal reaction as the most significant one, although this fact should be analyzed considering the predominant BT clinical form in the coinfected group and BB form in the group without HIV. Larger prospective studies in patients with HIV-leprosy coinfection are needed to confirm and broaden these results. PMID:25672296

Real-time zymography and reverse zymography: a method for detecting activities of matrix metalloproteinases and their inhibitors using FITC-labeled collagen and casein as substrates.

Science.gov (United States)

Hattori, Shunji; Fujisaki, Hitomi; Kiriyama, Tomomi; Yokoyama, Tsukao; Irie, Shinkichi

2002-02-01

Zymography and reverse zymography are widely used techniques for identifying the proteolytic activity of enzymes and the presence of protease inhibitors in polyacrylamide gels. In the current studies, we utilized a fluorescein-isothiocyanate-labeled substrate to develop novel zymographic and reverse zymographic methods for detecting matrix metalloproteinases and tissue inhibitors of the metalloproteinases, respectively. Using a transilluminator, the results can be observed visually without stopping the enzymatic reaction. For this reason, we have named these methods real-time zymography and real-time reverse zymography. These methods have the following advantages compared with conventional protocols: (1) because the reaction can be repeatedly monitored on the polyacrylamide gels, optimization of the incubation time can be achieved without preliminary analyses; (2) higher sensitivity is achieved with a lower amount of substrate than with conventional methods; (3) a semi-quantitative analysis of matrix metalloproteinases is possible. An additional advantage of the real-time reverse zymography is that, because the fluorescence detection is specific for substrate digestion, the inhibitor bands can be easily distinguished from contaminating proteins.

Reverse microemulsion prepared Ni–Pt catalysts for methane cracking to produce COx-free hydrogen

KAUST Repository

Zhou, Lu

2017-09-08

A monodispersed 15 nm Ni9Pt1 catalyst synthesized via a reverse microemulsion method, shows a lower activation energy than both Ni and Pt catalysts during the methane cracking reaction. Thanks to the synergic effect of Ni–Pt alloy, this catalyst presents a stable H2 formation rate at 700 °C, and forms carbon nanotubes, anchoring the catalyst particles on top.

Reverse microemulsion prepared Ni–Pt catalysts for methane cracking to produce COx-free hydrogen

KAUST Repository

Zhou, Lu; Harb, Moussab; Enakonda, Linga Reddy; Al Mana, Noor; Hedhili, Mohamed N.; Basset, Jean-Marie

2017-01-01

A monodispersed 15 nm Ni9Pt1 catalyst synthesized via a reverse microemulsion method, shows a lower activation energy than both Ni and Pt catalysts during the methane cracking reaction. Thanks to the synergic effect of Ni–Pt alloy, this catalyst presents a stable H2 formation rate at 700 °C, and forms carbon nanotubes, anchoring the catalyst particles on top.

Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

Science.gov (United States)

Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

2011-07-01

Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

An efficient forward–reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

KAUST Repository

Bayer, Christian; Moraes, Alvaro; Tempone, Raul; Vilanova, Pedro

2016-01-01

then employ this SRN bridge-generation technique to the statistical inference problem of approximating reaction propensities based on discretely observed data. To this end, we introduce a two-phase iterative inference method in which, during phase I, we solve

An efficient forward-reverse expectation-maximization algorithm for statistical inference in stochastic reaction networks

KAUST Repository

Vilanova, Pedro

2016-01-01

reaction networks (SRNs). We apply this stochastic representation to the computation of efficient approximations of expected values of functionals of SRN bridges, i.e., SRNs conditional on their values in the extremes of given time-intervals. We then employ

Gaseous exchange reaction of deuterium between hydrogen and water on hydrophobic catalyst supporting platinum

International Nuclear Information System (INIS)

Izawa, Hirozumi; Isomura, Shohei; Nakane, Ryohei.

1979-01-01

The deuterium exchange reaction between hydrogen and water in the gas phase where the fed hydrogen gas is saturated with water vapor is studied experimentally by use of the proper hydrophobic catalysts supporting platinum. It is found that the activities of those catalysts for this reaction system are very high compared with the other known ones for the systems in which gas and liquid should coexist on catalyst surfaces, and that the apparent catalytic activity becomes larger as the amount of platinum supported on a catalyst particle increases. By analyses of the data the following informations are obtained. The exchange reaction can be expressed by a first order reversible reaction kinetics. The pore diffusion in the catalyst particles has significant effect on the overall reaction mechanisms. (author)

Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli

International Nuclear Information System (INIS)

Hu, S.C.; Court, D.L.; Zweig, M.; Levin, J.G.

1986-01-01

The organization of the murine leukemia virus (MuLV) pol gene was investigated by expressing molecular clones containing AKR MuLV reverse transcriptase or endonuclease or both gene segments in Escherichia coli and generating specific antisera against the expressed bacterial proteins. Reaction of these antisera with detergent-disrupted virus precipitated and 80-kilodalton (kDa) protein, the MuLV reverse transcriptase, and a 46-kDa protein which we believe is the viral endonuclease. A third (50-kDa) protein, related to reverse transcriptase, was also precipitated. Bacterial extracts of clones expressing reverse transcriptase and endonuclease sequences competed with the viral 80- and 46-kDa proteins, respectively. These results demonstrate that the antisera are specific for viral reverse transcriptase and endonuclease. Immunoprecipitation of AKR MuLV with antisera prepared against a bacterial protein containing only endonuclease sequences led to the observation that reverse transcriptase and endonuclease can be associated as a complex involving a disulfide bond(s)

Reversible calcium alloying enables a practical room-temperature rechargeable calcium-ion battery with a high discharge voltage

Science.gov (United States)

Wang, Meng; Jiang, Chunlei; Zhang, Songquan; Song, Xiaohe; Tang, Yongbing; Cheng, Hui-Ming

2018-06-01

Calcium-ion batteries (CIBs) are attractive candidates for energy storage because Ca2+ has low polarization and a reduction potential (-2.87 V versus standard hydrogen electrode, SHE) close to that of Li+ (-3.04 V versus SHE), promising a wide voltage window for a full battery. However, their development is limited by difficulties such as the lack of proper cathode/anode materials for reversible Ca2+ intercalation/de-intercalation, low working voltages (performance. Here, we report a CIB that can work stably at room temperature in a new cell configuration using graphite as the cathode and tin foils as the anode as well as the current collector. This CIB operates on a highly reversible electrochemical reaction that combines hexafluorophosphate intercalation/de-intercalation at the cathode and a Ca-involved alloying/de-alloying reaction at the anode. An optimized CIB exhibits a working voltage of up to 4.45 V with capacity retention of 95% after 350 cycles.

Strand transfer and elongation of HIV-1 reverse transcription is facilitated by cell factors in vitro.

Directory of Open Access Journals (Sweden)

David Warrilow

Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.

Interfacial Reaction Dependent Performance of Hollow Carbon Nanosphere – Sulfur Composite as a Cathode for Li-S Battery

International Nuclear Information System (INIS)

Zheng, Jianming; Yan, Pengfei; Gu, Meng; Wagner, Michael J.; Hays, Kevin A.; Chen, Junzheng; Li, Xiaohong; Wang, Chongmin; Zhang, Ji-Guang; Liu, Jun; Xiao, Jie

2015-01-01

Lithium-sulfur (Li-S) battery is a promising energy storage system due to its high energy density, cost effectiveness, and environmental friendliness of sulfur. However, there are still a number of technical challenges, such as low Coulombic efficiency and poor long-term cycle life, impeding the commercialization of Li-S battery. The electrochemical performance of Li-S battery is closely related with the interfacial reactions occurring between hosting substrate and active sulfur species, which are poorly conducting at fully oxidized and reduced states. Here, we correlate the relationship between the performance and interfacial reactions in the Li-S battery system, using a hollow carbon nanosphere (HCNS) with highly graphitic character as hosting substrate for sulfur. With an appropriate amount of sulfur loading, HCNS/S composite exhibits excellent electrochemical performance because of the fast interfacial reactions between HCNS and the polysulfides. However, further increase of sulfur loading leads to increased formation of highly resistive insoluble reaction products (Li 2 S 2 /Li 2 S), which limits the reversibility of the interfacial reactions and results in poor electrochemical performances. These findings demonstrate the importance of the interfacial reaction reversibility in the whole electrode system on achieving high capacity and long cycle life of sulfur cathode for Li-S batteries.

Interfacial Reaction Dependent Performance of Hollow Carbon Nanosphere – Sulfur Composite as a Cathode for Li-S Battery

Energy Technology Data Exchange (ETDEWEB)

Zheng, Jianming; Yan, Pengfei; Gu, Meng [Pacific Northwest National Laboratory, Richland, WA (United States); Wagner, Michael J.; Hays, Kevin A. [The George Washington University, Washington, DC (United States); Chen, Junzheng; Li, Xiaohong; Wang, Chongmin; Zhang, Ji-Guang; Liu, Jun; Xiao, Jie, E-mail: jie.xiao@pnnl.gov [Pacific Northwest National Laboratory, Richland, WA (United States)

2015-05-26

Lithium-sulfur (Li-S) battery is a promising energy storage system due to its high energy density, cost effectiveness, and environmental friendliness of sulfur. However, there are still a number of technical challenges, such as low Coulombic efficiency and poor long-term cycle life, impeding the commercialization of Li-S battery. The electrochemical performance of Li-S battery is closely related with the interfacial reactions occurring between hosting substrate and active sulfur species, which are poorly conducting at fully oxidized and reduced states. Here, we correlate the relationship between the performance and interfacial reactions in the Li-S battery system, using a hollow carbon nanosphere (HCNS) with highly graphitic character as hosting substrate for sulfur. With an appropriate amount of sulfur loading, HCNS/S composite exhibits excellent electrochemical performance because of the fast interfacial reactions between HCNS and the polysulfides. However, further increase of sulfur loading leads to increased formation of highly resistive insoluble reaction products (Li{sub 2}S{sub 2}/Li{sub 2}S), which limits the reversibility of the interfacial reactions and results in poor electrochemical performances. These findings demonstrate the importance of the interfacial reaction reversibility in the whole electrode system on achieving high capacity and long cycle life of sulfur cathode for Li-S batteries.

Mechanism of the transition from orthorhombic to tetragonal YBa 2Cu 3O 7- x. Investigation of a reversible topotactic reaction in the electron microscope

Science.gov (United States)

Müller, J.-H.; Gruehn, R.

The phase transition from orthorhombic to tetragonal could be observed (in situ) with High-Resolution Transmission Electron Microscopy (HRTEM). In superconducting samples of YBa 2Cu 3O 7- x ( x=0.09) twinned areas were found which changed from orthorhombic to tetragonal symmetry upon electron irradiation parallel to the long c axis. In opposition to annealing experiments the length of the c-axis remained unchanged. The transition was reversible in the high vacuum of the electron microscope. Therefore we surmise that this reaction has no reductive character (no perceptible loss of oxygen). Within the tetragonal structure one can assume a statistical sharing (“disorder”) of oxygen by the metal atoms. The transition could also be explained by a migration of oxygen to the surface. After finishing the irradiation experiment and waiting for several minutes, the oxygen seems to occupy partially ordered positions resulting again in an orthorhombic symmetry. In some cases we could observed transition states of the structural transformation. A schematic model of the mechanism is depicted.

The retro Grignard addition reaction revisited: the reversible addition of benzyl reagents to ketones

DEFF Research Database (Denmark)

Christensen, Stig Holden; Holm, Torkil; Madsen, Robert

2014-01-01

transformation. The retro benzyl reaction was shown by the addition of benzylmagnesium chloride to di-tert-butyl ketone followed by exchange of both the benzyl and the ketone moiety with another substrate. Similar experiments were performed with phenylmagnesium bromide and tert-butylmagnesium chloride...

Chemical reaction networks as a model to describe UVC- and radiolytically-induced reactions of simple compounds.

Science.gov (United States)

Dondi, Daniele; Merli, Daniele; Albini, Angelo; Zeffiro, Alberto; Serpone, Nick

2012-05-01

When a chemical system is submitted to high energy sources (UV, ionizing radiation, plasma sparks, etc.), as is expected to be the case of prebiotic chemistry studies, a plethora of reactive intermediates could form. If oxygen is present in excess, carbon dioxide and water are the major products. More interesting is the case of reducing conditions where synthetic pathways are also possible. This article examines the theoretical modeling of such systems with random-generated chemical networks. Four types of random-generated chemical networks were considered that originated from a combination of two connection topologies (viz., Poisson and scale-free) with reversible and irreversible chemical reactions. The results were analyzed taking into account the number of the most abundant products required for reaching 50% of the total number of moles of compounds at equilibrium, as this may be related to an actual problem of complex mixture analysis. The model accounts for multi-component reaction systems with no a priori knowledge of reacting species and the intermediates involved if system components are sufficiently interconnected. The approach taken is relevant to an earlier study on reactions that may have occurred in prebiotic systems where only a few compounds were detected. A validation of the model was attained on the basis of results of UVC and radiolytic reactions of prebiotic mixtures of low molecular weight compounds likely present on the primeval Earth.

Sum Frequency Generation Studies of Hydrogenation Reactions on Platinum Nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Krier, James M. [Univ. of California, Berkeley, CA (United States)

2013-08-31

Sum Frequency Generation (SFG) vibrational spectroscopy is used to characterize intermediate species of hydrogenation reactions on the surface of platinum nanoparticle catalysts. In contrast to other spectroscopy techniques which operate in ultra-high vacuum or probe surface species after reaction, SFG collects information under normal conditions as the reaction is taking place. Several systems have been studied previously using SFG on single crystals, notably alkene hydrogenation on Pt(111). In this thesis, many aspects of SFG experiments on colloidal nanoparticles are explored for the first time. To address spectral interference by the capping agent (PVP), three procedures are proposed: UV cleaning, H2 induced disordering and calcination (core-shell nanoparticles). UV cleaning and calcination physically destroy organic capping while disordering reduces SFG signal through a reversible structural change by PVP.

Constrained approximation of effective generators for multiscale stochastic reaction networks and application to conditioned path sampling

Energy Technology Data Exchange (ETDEWEB)

Cotter, Simon L., E-mail: simon.cotter@manchester.ac.uk

2016-10-15

Efficient analysis and simulation of multiscale stochastic systems of chemical kinetics is an ongoing area for research, and is the source of many theoretical and computational challenges. In this paper, we present a significant improvement to the constrained approach, which is a method for computing effective dynamics of slowly changing quantities in these systems, but which does not rely on the quasi-steady-state assumption (QSSA). The QSSA can cause errors in the estimation of effective dynamics for systems where the difference in timescales between the “fast” and “slow” variables is not so pronounced. This new application of the constrained approach allows us to compute the effective generator of the slow variables, without the need for expensive stochastic simulations. This is achieved by finding the null space of the generator of the constrained system. For complex systems where this is not possible, or where the constrained subsystem is itself multiscale, the constrained approach can then be applied iteratively. This results in breaking the problem down into finding the solutions to many small eigenvalue problems, which can be efficiently solved using standard methods. Since this methodology does not rely on the quasi steady-state assumption, the effective dynamics that are approximated are highly accurate, and in the case of systems with only monomolecular reactions, are exact. We will demonstrate this with some numerics, and also use the effective generators to sample paths of the slow variables which are conditioned on their endpoints, a task which would be computationally intractable for the generator of the full system.

Effect of sulfur dioxide partial pressure on the reaction of iodine, sulfur dioxide and water

International Nuclear Information System (INIS)

Nakajima, Hayato; Imai, Yoshiyuki; Kasahara, Seiji; Kubo, Shinji; Onuki, Kaoru

2007-01-01

Effect of sulfur dioxide partial pressure on the reaction of iodine, sulfur dioxide and water, which is a unit reaction in the IS process for thermochemical hydrogen production, was studied experimentally at 323 K under iodine saturation. Quasi-equilibrium state was observed in the presence of sulfur dioxide gas at constant pressure. The composition of the poly-hydriodic acid solution formed was discussed assuming an ideal desulfurization by the reverse reaction of the Bunsen reaction. The value of HI/(HI+H 2 O) of the desulfurized solution was large at high sulfur dioxide pressure and reached the maximum of 15.7 ± 0.3 mol%. (author)

Reverse logistics - a framework

NARCIS (Netherlands)

M.P. de Brito (Marisa); R. Dekker (Rommert)

2002-01-01

textabstractIn this paper we define and compare Reverse Logistics definitions. We start by giving an understanding framework of Reverse Logistics: the why-what-how. By this means, we put in context the driving forces for Reverse Logistics, a typology of return reasons, a classification of

Tubal Ligation Reversal

Science.gov (United States)

... seal off the fallopian tubes, such as the Essure or Adiana systems, generally aren't reversible. Why ... electrocautery). Some types of sterilization, such as the Essure or Adiana systems, aren't considered reversible. Risks ...

A case of the tail wagging the dog? Reverse weathering and Earth's CO2 thermostat.

Science.gov (United States)

Higgins, J. A.

2017-12-01

Feedbacks between climate, the global carbon cycle, and the chemistry of seawater stabilize Earth's surface temperature on geologic timescales and are likely responsible for its habitability over billions of years of Earth history. The most important component of the geologic carbon cycle is the precipitation and burial of carbonate sediments. The amount of carbonate sediment produced depends, in turn, on the alkalinity generated during silicate weathering less the amount consumed during the formation of secondary clay minerals both on the continents and in the ocean. In marine enviroments this process, often referred to as reverse weathering, consumes seawater alkalinity (and cations) via reaction with degraded Al-silicate minerals. Because these reactions constitute a sink of seawater alkalinity, changes in the amount of reverse weathering will lead to imbalances between alkalinity sources and sinks. The net effect is that on timescales greater than the timescale of carbonate compensation (< 10 kyr), changes in reverse weathering will lead to changes in the rate of continental silicate weathering through the dependence of continental silicate weathering on atmospheric CO2 and climate. This mechanism is capable of changing rates of continental silicate weathering without changing either the rate of volcanic outgassing or the rate constant for continental silicate weathering (i.e. through mountain-building or the exposure of different rock types) and as a result represents a unique way of modulating the global carbon cycle and Earth's climate on geologic timescales.

A Simple Model to Access Equilibrium Constants of Reactions Type A ⇋ B Using Monte Carlo Simulation.

Directory of Open Access Journals (Sweden)

R. R. Farias, L. A. M. Cardoso, N. M. Oliveira Neto

2011-01-01

Full Text Available A simple theoretical model to describe equilibrium properties of homogeneous re-versible chemical reactions is proposed and applied to an A ⇋ B type reaction. Forthis purpose the equilibrium properties are analyzed by usual Monte Carlo simula-tion. It is shown that the equilibrium constant (Ke for this kind of reaction exhibitsdistinct characteristics for Eba 1, where Eba is the ratio be-tween the reverse and forward activation energies. For Eba 1 and increase(decrease the temperature our results recover the principle of Le Chˆtelier applied ato temperature effects. The special and interesting case is obtained for Eba = 1 sinceKe = 1 for all range of temperature. Another important parameter in our analysisis θA , defined as temperature measured with relation the activation energy of theforward reaction. For fixed values of Eba and for θA ≫ 1 the equilibrium constantapproaches 1, showing that all transitions are equally likely, no matter the differencein the energy barriers. The data obtained in our simulations show the well knownrelationship between Ke , Eb , Ea and kB T . Finally we argue that this theoreticalmodel can be applied to a family of homogeneous chemical reactions characterizedby the same Eba and θA showing the broad application of this stochastic model tostudy chemical reactions. Some of these results will be discussed in terms of collisiontheory.

Characterization and kinetic study of Diels-Alder reaction: Detailed study on N-phenylmaleimide and furan based benzoxazine with potential self-healing application

Directory of Open Access Journals (Sweden)

Z. Stirn

2016-07-01

Full Text Available The Diels-Alder reaction between N-phenylmaleimide and benzoxazine bearing furan group was investigated for the purpose of successful appliance of self-healing in benzoxazine polymer networks. The reaction as a function of temperature/time was performed in molten state and in a solution, where also the kinetic study was performed. The Diels-Alder reaction leads to a mixture of two diastereomers: endo presented at lower cyclo-reversion temperature and exo at higher. Therefore, the conversion rates and exo/endo ratio were studied in detail for both systems. For instance, in molten state the Diels-Alder reaction was triggered by the temperature of the melting point at 60 °C with exo/endo ratio preferable to the endo adduct. The study of the kinetics in a solution revealed that the Diels-Alder reaction followed typical bimolecular reversible second-order reaction. The activation energies were close to the previous literature data; 48.4 and 51.9 kJ·mol–1 for Diels-Alder reaction, and 91.0 and 102.3 kJ·mol–1 for retro-Diels-Alder reaction, in acetonitrile and chloroform, respectively. The reaction equilibrium in a solution is much more affected by the retro-Diels-Alder reaction than in a molten state. This study shows detailed investigation of DA reaction and provides beneficial knowledge for further use in self-healing polymer networks.

49 CFR 230.89 - Reverse gear.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Reverse gear. 230.89 Section 230.89 Transportation... Reversing Gear § 230.89 Reverse gear. (a) General provisions. Reverse gear, reverse levers, and quadrants... quadrant. Proper counterbalance shall be provided for the valve gear. (b) Air-operated power reverse gear...

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

Science.gov (United States)

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Reversible Communicating Processes

Directory of Open Access Journals (Sweden)

Geoffrey Brown

2016-02-01

Full Text Available Reversible distributed programs have the ability to abort unproductive computation paths and backtrack, while unwinding communication that occurred in the aborted paths. While it is natural to assume that reversibility implies full state recovery (as with traditional roll-back recovery protocols, an interesting alternative is to separate backtracking from local state recovery. For example, such a model could be used to create complex transactions out of nested compensable transactions where a programmer-supplied compensation defines the work required to "unwind" a transaction. Reversible distributed computing has received considerable theoretical attention, but little reduction to practice; the few published implementations of languages supporting reversibility depend upon a high degree of central control. The objective of this paper is to demonstrate that a practical reversible distributed language can be efficiently implemented in a fully distributed manner. We discuss such a language, supporting CSP-style synchronous communication, embedded in Scala. While this language provided the motivation for the work described in this paper, our focus is upon the distributed implementation. In particular, we demonstrate that a "high-level" semantic model can be implemented using a simple point-to-point protocol.

Conformational dependence of a protein kinase phosphate transfer reaction

Science.gov (United States)

Labute, Montiago; Henkelman, Graeme; Tung, Chang-Shung; Fenimore, Paul; McMahon, Ben

2007-03-01

Atomic motions and energetics for a phosphate transfer reaction catalyzed by the cAMP-dependent protein kinase have been calculated using plane-wave density functional theory, starting from structures of proteins crystallized in both the reactant conformation (RC) and the transition-state conformation (TC). In TC, we calculate that the reactants and products are nearly isoenergetic with a 20-kJ/mol barrier, whereas phosphate transfer is unfavorable by 120 kJ/mol in the RC, with an even higher barrier. Our results demonstrate that the phosphate transfer reaction occurs rapidly and reversibly in a particular conformation of the protein, and that the reaction can be gated by changes of a few tenths of an angstrom in the catalytic site [1]. [1] G.H. Henkelman, M.X. LaBute, C.-S. Tung, P.W. Fenimore, B.H. McMahon, Proc. Natl. Acad. Sci. USA vol. 102, no. 43:15347-15351 (2005).

Experimental test of exchange degeneracy in hypercharge exchange reactions

International Nuclear Information System (INIS)

Moffeit, K.C.

1978-10-01

Two pairs of line-reversed reactions π + P → K + Σ + , K - p → π - Σ + and π + p → K + Y* + (1385), K - p → π - Y* + (1385) provide an experimental test of exchange degeneracy in hypercharge exchange reactions. From their study it is concluded that in contrast to the lower energy data, the 11.5 results for the two pairs of reactions are consistent with exchange degeneracy predictions for both helicity-flip and nonflip amplitudes. The Y(1385) decay angular distributions indicate that the quark model and Stodolsky--Sakurai predictions are in agreement with the main features of the data. However, small violations are observed at small momentum transfer. While the Y(1385) vertex is helicity-flip dominated, the nonvanishing of T/sub 3/2 - 1/2/ and T/sub -3/2 1/2/ suggests some finite helicity nonflip contribution in the forward direction. 23 references

Surface-ionization field mass-spectrometry studies of nonequilibrium surface ionization

International Nuclear Information System (INIS)

Blashenkov, Nikolai M; Lavrent'ev, Gennadii Ya

2007-01-01

The ionization of polyatomic molecules on tungsten and tungsten oxide surfaces is considered for quasiequilibrium or essentially nonequilibrium conditions (in the latter case, the term nonequilibrium surface ionization is used for adsorbate ionization). Heterogeneous reactions are supposed to proceed through monomolecular decay of polyatomic molecules or fragments of multimolecular complexes. The nonequilibrium nature of these reactions is established. The dependences of the current density of disordered ions on the surface temperature, electric field strength, and ionized particle energy distribution are obtained in analytical form. Heterogeneous dissociation energies, the ionization potentials of radicals, and the magnitude of reaction departure from equilibrium are determined from experimental data, as are energy exchange times between reaction products and surfaces, the number of molecules in molecular complexes, and the number of effective degrees of freedom in molecules and complexes. In collecting the data a new technique relying on surface-ionization field mass-spectrometry was applied. (instruments and methods of investigation)

The Geomagnetic Field During a Reversal

Science.gov (United States)

Heirtzler, James R.

2003-01-01

By modifying the IGRF it is possible to learn what may happen to the geomagnetic field during a geomagnetic reversal. If the entire IGRF reverses then the declination and inclination only reverse when the field strength is zero. If only the dipole component of the IGRF reverses a large geomagnetic field remains when the dipole component is zero and he direction of the field at the end of the reversal is not exactly reversed from the directions at the beginning of the reversal.

Development of a low-level setup for gamma spectroscopy: Application for nuclear astrophysics using reverse kinematics

International Nuclear Information System (INIS)

Genard, G.; Nuttens, V.E.; Bouchat, V.; Terwagne, G.

2010-01-01

It is more and more necessary to improve the sensitivity of gamma-ray spectroscopy systems, especially in nuclear astrophysics. In the case of radiative proton capture reactions, one means is to avoid the reactions on the target impurities by using reverse kinematics. This technique is possible with the LARN accelerator and can provide very clean cross-section measurements. For that purpose, a hydrogen standard has been carried out by means of ion implantation in silicon. In addition, a low-level setup has been put in place on a new beam line of the accelerator. A high efficiency and high resolution germanium detector is used conjointly with a double shielding. A passive lead castle shielding system is used to reduce the natural radioactivity and an active shielding consisting of an anti-cosmic veto is provided by an anticoincidence between the plastic scintillator and the gamma-ray detector. The setup allows a reduction of 70% of the background interference and provides an approximately 200 fold sensitivity gain of between 600 and 3000 keV. Some other developments have also been carried out to optimize the setup. The entire setup and the reverse kinematics have been validated by measuring the cross-section of the 13 C(p,γ) 14 N and 15 N(p,γ) 16 O reactions that present some astrophysical interest.

Targeting miR-423-5p Reverses Exercise Training-Induced HCN4 Channel Remodeling and Sinus Bradycardia

DEFF Research Database (Denmark)

D'Souza, Alicia; Pearman, Charles M.; Wang, Yanwen

2017-01-01

-generation sequencing and quantitative real-time reverse transcription polymerase chain reaction showed remodeling of miRs in the sinus node of swim-trained mice. Computational predictions highlighted a prominent role for miR-423-5p. Interaction between miR-423-5p and HCN4 was confirmed by a dose-dependent reduction...

[Comparison of neostigmine induced reversal of rocuronium in different age children].

Science.gov (United States)

Liu, Jinzhu; Cheng, Zhaoyu

2016-03-15

To compare the effectiveness of neostigmine induced reversal of rocuronium in neonates, infants, young children and children. One hundred and sixty ASA I or II pediatric patients undergoings elective surgical procedures under total intravenous anesthesia were enrolled during July 2014 to April 2015 in Tianjin Children's Hospital. The patients were divided into four groups according to ages: neonate group, infant group, young children group and children group.Then control subgroup and neostigmine reversal subgroup including twenty patients were randomly selected from every different age groups by the method of random number table. After induction of anesthesia, 0.6 mg/kg rocuronium was administered, and 0.2 mg/kg maintenance doses given as required during period of operation. Neuromuscular block was monitored using acceleromyographic train of four (TOF). When T1/control returned to 15%, 0.03 mg/kg neostigmine and 0.01 mg/kg atropine were given to patients of reversal subgroups, and saline 0.1 ml/kg was given to patients of control subgroups. The recovery time of T25, T75, TR0.7, recovery index, blood pressure, heart rate and adverse reactions were observed and recorded. In control subgroups, the recovery time of T75 for neonates, infants, young children and children were (27.10±8.72), (16.70±6.35), (13.05±1.96), (14.40±3.08) min, respectively (F=25.052, P0.05). But the recovery time of T75, TR0.7 and recovery index in neonate group were longer than other age groups (all Procuronium are comparable in infant, young children and children. There are obviously reversal effects in all of age groups when neostigmine is given to antagonize rocuronium. Either spontaneous recovery time or reversal recovery time of neostigmine to rocuronium is longer for neonates than other age's children.

Amplitude analysis of Y*(1385) production in the line-reversed reactions: π+p → K+Y*(1385) and K-p → π-Y*(1385) at 7 and 11.5 GeV/c

International Nuclear Information System (INIS)

Ballam, J.; Bouchez, J.; Carroll, J.T.

1978-08-01

For the first time in one detector measurements were made of the complete decay angular distribution on Y* → Λπ, Λ → pπ - in the two line-reversed reactions: π + p → K + Y*(1385) and K - p → π - Y*(1385). The experiment was conducted in the SLAC 1 m rapid cycling bubble chamber (15 Hertz) triggered by electronic detectors and an online algorithm. The extended maximum likelihood method was used to obtain the transversity amplitudes of the Y *(1385). Results are in good agreement with both the quark model and Stodolsky-Sakurai model predictions. Finite helicity nonflip contributions at the Y*vertex observed in these data can be associated with double quark scattering in the forward direction. 15 references

Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

Science.gov (United States)

Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

2017-05-01

Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

2011-11-01

Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

Long-acting reversible contraception in the pediatric emergency department: clinical implications and common challenges.

Science.gov (United States)

Koyama, Atsuko; Dorfman, David H; Forcier, Michelle M

2015-04-01

Long-acting reversible contraception (LARC) is recommended as first-line contraception for adolescents and young adults. As the use of LARC increases, pediatric emergency medicine clinicians should be able to recognize different types of LARC and address their common adverse effects, adverse reactions, and complications. This continuing medical education activity provides an overview of LARC and will assist clinicians in the evaluation and management of patients with LARC-associated complaints.

EFFICIENCY OF DOMESTIC REVERSE OSMOSIS IN REMOVAL OF TRIHALOMETHANES FROM DRINKING WATER

Directory of Open Access Journals (Sweden)

S. Mazloomi ، R. Nabizadeh ، S. Nasseri ، K. Naddafi ، S. Nazmara ، A. H. Mahvi

2009-10-01

Full Text Available The reaction of disinfectants with natural organic matters existing in water lead to the formation of Disinfection By-Products. Potentially hazardous and carcinogenic characteristics of trihalomethanes (THMs are recognized. Thus removal of THMs or its precursors are necessary for human health. The aim of this study was to study the efficiency of domestic reverse osmosis (RO in removal of trihalomethanes from drinking water. A pilot scale of RO system with Polyamide membrane as Spiral-Wound, Tape wrapping module was used. Feed solution was made by using of pure chloroform. The samples containing chloroform were analyzed using a gas chromatograph equipped with a flame ionization detector. By increasing the flow, the removal rate of chloroform decreased and with declining removal of EC, the removal of chloroform declined too. In this research, at the worst condition, the efficiency of the pilot scale reverse osmosis reached to 80 % removal of chloroform.

Mechanistic study of the isotopic-exchange reaction between gaseous hydrogen and palladium hydride powder

International Nuclear Information System (INIS)

Outka, D.A.; Foltz, G.W.

1991-01-01

A detailed mechanism for the isotopic-exchange reaction between gaseous hydrogen and solid palladium hydride is developed which extends previous model for this reaction by specifically including surface reactions. The modeling indicates that there are two surface-related processes that contribute to the overall rate of exchange: the desorption of hydrogen from the surface and the exchange between surface hydrogen and bulk hydrogen. This conclusion is based upon measurements examining the effect of small concentrations of carbon monoxide were helpful in elucidating the mechanism. Carbon monoxide reversibly inhibits certain steps in the exchange; this slows the overall rate of exchange and changes the distribution of products from the reactor

Muscular activation during reverse and non-reverse chewing cycles in unilateral posterior crossbite.

Science.gov (United States)

Piancino, Maria Grazia; Farina, Dario; Talpone, Francesca; Merlo, Andrea; Bracco, Pietro

2009-04-01

The aim of this study was to characterize the kinematics and masseter muscle activation in unilateral posterior crossbite. Eighty-two children (8.6 +/- 1.3 yr of age) with unilateral posterior crossbite and 12 children (8.9 +/- 0.6 yr of age) with normal occlusion were selected for the study. Electromyography (EMG) and kinematics were concurrently recorded during mastication of a soft bolus and a hard bolus. The percentage of reverse cycles in the group of patients was 59.0 +/- 33.1% (soft bolus) and 69.7 +/- 29.7% (hard bolus) when chewing on the crossbite side. When chewing on the non-affected side, the number of reverse cycles was 16.7 +/- 24.5% (soft bolus) and 16.7 +/- 22.3% (hard bolus). The reverse cycles on the crossbite side were narrower with respect to the cycles on the non-affected side. Although both types of cycles in patients resulted in lower EMG activity of the masseter of the crossbite side than of the contralateral masseter, the activity of the non-affected side was larger for reverse than for non-reverse cycles. It was concluded that when chewing on the crossbite side, the masseter activity is reduced on the mastication side (crossbite) and is unaltered (non-reverse cycles) or increased (reverse) on the non-affected side.

Recurrence Relations for the Equilibrium Means of Distributions Arising in Chemical Reactions

Directory of Open Access Journals (Sweden)

E.K. Elsheikh

1997-12-01

Full Text Available In this paper we derive recurrence relations that describe how the equilibrium mean of the number molecules of a reactant varies with each of the parameters defining the initial state for four basic reversible chemical reactions. In essence, the relations provide a rationale for updating the equilibrium mean following the addition (or removal of a molecule of one of the types involved in the reaction, there being a relation for each type. With a new parameterization introduced for each reaction, the relations provide a convenient means of evaluating the means, variances and other important moments without any need to work out the underlying distributions. As an application, the relations are used to numerically assess-approximate expressions for the means and variances.

The Causes of Preference Reversal.

OpenAIRE

Tversky, Amos; Slovic, Paul; Kahneman, Daniel

1990-01-01

Observed preference reversal cannot be adequately explained by violations of independence, the reduction axiom, or transitivity. The primary cause of preference reversal is the failure of procedure invariance, especially the overpricing of low-probability, high-payoff bets. This result violates regret theory and generalized (nonindependent) utility models. Preference reversal and a new reversal involving time preferences are explained by scale compatibility, which implies that payoffs are wei...

Hydrogen isotope exchange reaction rates in tritium, hydrogen and deuterium mixed gases

International Nuclear Information System (INIS)

Uda, Tatsuhiko

1992-01-01

Hydrogen isotope exchange reaction rates in H 2 +T 2 , D 2 +T 2 and H 2 +D 2 +T 2 mixed gases, as induced by tritium decay and beta radiation, were experimentally measured by laser Raman spectrometry. Initially a glass cell was filled with T 2 gas to a pressure of 30-40 kPa, and an equivalent partial pressure of H 2 and/or D 2 was added. The first-order hydrogen isotope exchange reaction rates were 5.54x10 -2 h -1 for H 2 +T 2 mixed gas and 4.76x10 -2 h -1 for D 2 +T 2 . The actual HT producing rate was nearly equivalent to the rate of DT, but the reverse reaction rate of HT was faster than that of DT. The exchange reaction rates between H, D and T showed the isotope effect, HD>HT>DT. The hydrogen isotope exchange reaction rates observed were about twenty times larger than ion formation rates by beta radiation. This result suggests that a free radical chain reaction in hydrogen isotopes is occurring. (orig.)

Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

Science.gov (United States)

Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

2016-01-01

Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

Temperature and Pressure Dependence of the Reaction S plus CS (+M) -> CS2 (+M)

DEFF Research Database (Denmark)

Glarborg, Peter; Marshall, Paul; Troe, Juergen

2015-01-01

Experimental data for the unimolecular decomposition of CS2 from the literature are analyzed by unimolecular rate theory with the goal of obtaining rate constants for the reverse reaction S + CS (+M) -> CS2 (+M) over wide temperature and pressure ranges. The results constitute an important input...

Pervaporation applied for dewatering of reaction mixture during esterification

Directory of Open Access Journals (Sweden)

Krasiński Andrzej

2016-03-01

Full Text Available In this work the esterification of diethyl tartrate was studied. The research was focused on the enhancement of reversible reaction yield, which is accomplished by dewatering of the reaction mixture. The removal of water shifts the equilibrium towards the main product. Pervaporation was applied for this purpose, and results were compared to distillation. The advantages and limitations of both processes are discussed. The experimental part consists of dewatering of mixture after the reaction had reached the equilibrium, and was subsequently fed to the test rig equipped with a single zeolite membrane purchased from Pervatech B.V. Results show a significant conversion increase as a result of water removal by pervaporation. Compared to distillation no addition of organics is necessary to efficiently remove water above the azeotrope. Nevertheless, some limitations and issues which call for optimisation are pointed out. A simple numerical model is proposed to support design and sizing of the pervaporation system. Various modes of integrated system operation are also briefly discussed.

On the impedance of galvanic cells XXVII. The temperature-dependence of the kinetic parameters of the hydrogen electrode reaction on mercury in concentrated HI

NARCIS (Netherlands)

Dekker, B.G.; Sluyters-Rehbach, M.; Sluyters, J.H.

1969-01-01

The impedance of a dropping mercury electrode in 57% HI (7.6 M) was measured at temperatures between −35° and +25°C. In a certain potential and temperature region, two reactions were found to be proceeding simultaneously: the reversible Hg/HgI4−2 reaction and the irreversible H+/H2(Hg) reaction.

Probing cycle stability and reversibility in thermochemical energy storage – CaC_2O_4·H_2O as perfect match?

International Nuclear Information System (INIS)

Knoll, Christian; Müller, Danny; Artner, Werner; Welch, Jan M.; Werner, Andreas; Harasek, Michael; Weinberger, Peter

2017-01-01

Highlights: • CaC_2O_4·H_2O dehydration is fully reversible between 25 °C and 200 °C. • Isothermal cycling between hydrate and anhydrate phase can be triggered by the water vapour concentration. • High reaction rates and full reversibility demonstrated over 100 cycles. • Material shows no ageing effects or reactivity decrease. - Abstract: The dehydration and subsequent rehydration of calcium oxalate monohydrate has yet to find application in thermochemical energy storage. Unlike for many other salt hydrates, complete reversibility of the dehydration-rehydration reaction was observed. Additionally, it was found that the rehydration temperature is strongly affected by the water vapour concentration: Full reversibility is not only achieved at room-temperature, but, depending on the water vapour concentration, at up to 200 °C. This allows isothermal switching of the material between charging and discharging by a change of the H_2O-partial pressure. Cycle stability of the material was tested by a long-term stress experiment involving 100 charging and discharging cycles. No signs of material fatigue or reactivity loss were found. In-situ powder X-ray diffraction showed complete rehydration of the material within 300 s. The experimental findings indicate that the CaC_2O_4·H_2O/CaC_2O_4 system is perfectly suited for technical application as a thermochemical energy storage medium.

Effect of Ag additions on the β phase formation reaction in the Cu–9 wt.%Al–6 wt.%Mn alloy

Energy Technology Data Exchange (ETDEWEB)

Adorno, A.T., E-mail: atadorno@iq.unesp.br [Departamento de Físico-Química, Instituto de Química, UNESP, Caixa Postal 355, 14801-970 Araraquara, SP (Brazil); Carvalho, T.M. [Departamento de Físico-Química, Instituto de Química, UNESP, Caixa Postal 355, 14801-970 Araraquara, SP (Brazil); Silva, R.A.G. [Departamento de Ciências Exatas e da Terra, UNIFESP, 09972-270 Diadema, SP (Brazil); Santos, C.M.A.; Magdalena, A.G. [Departamento de Físico-Química, Instituto de Química, UNESP, Caixa Postal 355, 14801-970 Araraquara, SP (Brazil)

2015-09-15

Highlights: • The results suggest a multi-step process involving reversible reactions. • Ag solubilizes preferably at the Cu matrix. • Ag additions decrease the activation energy for the process. - Abstract: The influence of 4 and 5 wt.%Ag additions on the kinetics of β [T{sub 7}-(CuMn){sub 3}Al] phase formation reaction in the Cu–9 wt.%Al–6 wt.%Mn alloy was studied using differential scanning calorimetry (DSC), X-ray diffractometry (XRD) and scanning electron microscopy (SEM). The results indicate that the conversion dependence of the activation energy has a descending shape, suggesting a multi-step process involving reversible reactions. The presence of Ag facilitates the formation of the β phase. The results also showed that the Ag precipitates formation includes the dissolution of Mn and Al atoms, thus decreasing the partial fraction of these elements available to react.

Transfusion reaction in a case with the rare Bombay blood group

Directory of Open Access Journals (Sweden)

Hayedeh Javadzadeh Shahshahani

2013-01-01

Full Text Available Bombay phenotype is extremely rare in Caucasian with an incidence of 1 in 250,000. When individuals with the Bombay phenotype need blood transfusion, they can receive only autologous blood or blood from another Bombay blood group. Transfusing blood group O red cells to them can cause a fatal hemolytic transfusion reaction. In this study, we report a case with the rare Bombay blood group that was misdiagnosed as the O blood group and developed a hemolytic transfusion reaction. This highlights the importance of both forward and reverse typing in ABO blood grouping and standard cross-matching and performing standard pretransfusion laboratory tests in hospital blood banks.

Contribution to an effective design method for stationary reaction-diffusion patterns

International Nuclear Information System (INIS)

Szalai, István; Horváth, Judit; De Kepper, Patrick

2015-01-01

The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences

Contribution to an effective design method for stationary reaction-diffusion patterns

Energy Technology Data Exchange (ETDEWEB)

Szalai, István; Horváth, Judit [Laboratory of Nonlinear Chemical Dynamics, Institute of Chemistry, Eötvös Loránd University, P.O. Box 32, H-1518 Budapest 112 (Hungary); De Kepper, Patrick [Centre de Recherche Paul Pascal, CNRS, University of Bordeaux, 115, Avenue Schweitzer, F-33600 Pessac (France)

2015-06-15

The British mathematician Alan Turing predicted, in his seminal 1952 publication, that stationary reaction-diffusion patterns could spontaneously develop in reacting chemical or biochemical solutions. The first two clear experimental demonstrations of such a phenomenon were not made before the early 1990s when the design of new chemical oscillatory reactions and appropriate open spatial chemical reactors had been invented. Yet, the number of pattern producing reactions had not grown until 2009 when we developed an operational design method, which takes into account the feeding conditions and other specificities of real open spatial reactors. Since then, on the basis of this method, five additional reactions were shown to produce stationary reaction-diffusion patterns. To gain a clearer view on where our methodical approach on the patterning capacity of a reaction stands, numerical studies in conditions that mimic true open spatial reactors were made. In these numerical experiments, we explored the patterning capacity of Rabai's model for pH driven Landolt type reactions as a function of experimentally attainable parameters that control the main time and length scales. Because of the straightforward reversible binding of protons to carboxylate carrying polymer chains, this class of reaction is at the base of the chemistry leading to most of the stationary reaction-diffusion patterns presently observed. We compare our model predictions with experimental observations and comment on agreements and differences.

Using reactive artificial muscles to determine water exchange during reactions

International Nuclear Information System (INIS)

Otero, T F; Martínez, J G; Zaifoglu, B

2013-01-01

Artificial muscles based on films of conducting polymers translate film volume variations, driven by electrochemical reactions (Faradaic motors), into macroscopic movements with generation of mechanical energy. The reaction promotes exchange of counterions (anions here) and solvent molecules with the electrolyte. Attributing here both the film volume variation and the movement originated by these exchanges of ions and solvent, the described angles can be used to quantify the exchanged solvent. Different angles described by bending muscles consuming equal driving charges in electrolytes having the same cation and different anions were measured. The number of exchanged counterions is given by the consumed charge and the ion valence: this is a Faradaic reaction. The described angle fraction due to the exchanged anions is given by the number of anions and the crystallographic radius. Taking as reference the anion giving the shorter angle, whatever the consumed charge, the relative number of solvent molecules exchanged by the polymeric membrane during a reversible reaction was determined. Actuators and artificial muscles can be used as useful tools for, at least, an initial study of the solvent exchange during reactions in reactive gels. (paper)

Charged-particle induced thermonuclear reaction rates: a compilation for astrophysics

International Nuclear Information System (INIS)

Grama, Cornelia; Angulo, C.; Arnould, M.

2000-01-01

The rapidly growing wealth of nuclear data becomes less and less easily accessible to the astrophysics community. Mastering this volume of information and making it available in an accurate and usable form for incorporation into stellar evolution or nucleosynthesis models become urgent goals of prime necessity. we report on the results of the European network NACRE (Nuclear Astrophysics Compilation of REaction rates). The principal motivation for the setting-up of the NACRE network has been the necessity of building up a well-documented and detailed compilation of rates for charged-particle induced reactions on stable targets up to Si and on unstable nuclei of special significance in astrophysics. This work is meant to supersede the only existing compilation of reaction rates issued by Fowler and collaborators. The cross section data and/or resonance parameters for a total of 86 charged-particle induced reactions are given and the corresponding reaction rates are calculated and given in tabular form. When cross section data are not available in the whole needed range of energies, the theoretical predictions obtained in the framework of the Hauser-Feshbach model is used. Uncertainties are analyzed and realistic upper and lower bounds of the rates are determined. Reverse reaction rates and analytical approximations of the adopted rates are also provided. (authors)

Charged-particle induced thermonuclear reaction rates: a compilation for astrophysics

International Nuclear Information System (INIS)

Grama, Cornelia

1999-01-01

The rapidly growing wealth of nuclear data becomes less and less easily accessible to the astrophysics community. Mastering this volume of information and making it available in an accurate and usable form for incorporation into stellar evolution or nucleosynthesis models become urgent goals of prime necessity. We report on the results of the European network NACRE (Nuclear Astrophysics Compilation of REaction rates). The principal motivation for the setting-up of the NACRE network has been the necessity of building up a well-documented and detailed compilation of rates for charged -particle induced reactions on stable targets up to Si and on unstable nuclei of special significance in astrophysics. This work is meant to supersede the only existing compilation of reaction rates issued by Fowler and collaborators. The cross section data and/or resonance parameters for a total of 86 charged-particle induced reactions are given and the corresponding reaction rates are calculated and given in tabular form. When cross section data are not available in the whole needed range of energies the theoretical predictions obtained in the framework of the Hauser-Feshbach model are used. Uncertainties are analyzed and realistic upper and lower bounds of the rates are determined. Reverse reaction rates and analytical approximations of the adopted rates are also provided. (author)

Characteristic of the Pressurized Continuous Bunsen Reaction using HIx Solution

Directory of Open Access Journals (Sweden)

Kim Jong-Seok

2016-01-01

Full Text Available The Sulfur-Iodine thermochemical hydrogen production process (SI process consists of the Bunsen reaction section, the H2SO4 decomposition section and the HI decomposition section. The HIx solution (HI-I2-H2O could be recycled to Bunsen reaction section from the HI decomposition section in the operation of the integrated SI process. The phase separation characteristic of the Bunsen reaction using the HIx solution was similar to that of SO2-I2-H2O system. However, the amount of produced H2SO4 phase was too small. To solve this problem, the study was carried out by the pressurized continuous Bunsen reaction. Bunsen reactions were performed at variation of feed rate of SO2/O2 gas in 3 bar of atmosphere. Also, it was performed to check the effects of the residence time in the reservoir on the characteristics of Bunsen products. As the results, the concentration of H2SO4 and HI in Bunsen products was increased with increasing the amounts of SO2. When the residence time in the reservoir increased, the concentration of H2SO4 and HI in HIx phase was decreased by reverse Bunsen reaction.

The complex reaction kinetics of neptunium including redox and extraction process in 30% TBP-nitric acid system

International Nuclear Information System (INIS)

Hu Zhang; Zhan-yuan Liu; Xian-ming Zhou; Li Li

2017-01-01

In order to understand the complex and dynamic neptunium process chemistry in the TBP-HNO_3 system, the kinetics involved reversible redox reaction and extraction mass transfer was investigated. The results indicates that the mass transfer rate of Np(VI) is much faster than the redox reaction in aqueous solution. The concentrations of nitric acid and nitrous acid not only can change the Np(V) oxidation reaction and Np(VI) reduction reaction rate, but also can ultimately determine the distribution of neptunium extraction equilibrium. The variety of temperature can only influence the extraction equilibrium time, but cannot alter the equilibrium state of neptunium. (author)

The electrochemical Peltier heat of the standard hydrogen electrode reaction

International Nuclear Information System (INIS)

Fang Zheng; Wang Shaofen; Zhang Zhenghua; Qiu Guanzhou

2008-01-01

A method for measuring the electrochemical Peltier heat (EPH) of a single electrode reaction has been developed and an absolute scale is suggested to obtain EPH of the standard hydrogen electrode. The scale is based on φ 0 * = 0 and ΔS 0 * = 0 for any electrode reaction at zero Kelvin, in accord with the third law of thermodynamics. The relationships between entropy, enthalpy and free energy changes on this scale and on the conventional scale are derived. Calorimetric experiments were made on the Fe(CN) 6 3- /Fe(CN) 6 4- system at five different concentrations at 298.15 K, and EPH for the standard hydrogen electrode reaction is obtained. EPHs and the entropy change on the absolute scale for the studied redox are linearly related to concentration of electrolyte. The reversible electric work is almost concentration independent in the range of concentration studied

Time-dependent, many-body scattering theory and nuclear reaction applications

International Nuclear Information System (INIS)

Levin, F.S.

1977-01-01

The channel component state form of the channel coupling array theory of many-body scattering is briefly reviewed. These states obey a non-hermitian matrix equation whose exact solution yields the Schroedinger eigenstates, eigenvalues and scattering amplitudes. A time-dependent formulation of the theory is introduced in analogy to the time-dependent Schrodinger equation and several consequences of the development are noted. These include an interaction picture, a single (matrix) S operator, and the usual connection between the t = 0 time-dependent and the time-independent scattering states. Finally, the channel component states (psi/sub j/) are shown to have the useful property that only psi/sub j/ has (two-body) outgoing waves in channel j: psi/sub m/, m not equal to j, is asymptotically zero in two-body channel j. This formalism is then considered as a means for direct nuclear reaction analysis. Typical bound state approximations are introduced and it is shown that a DWBA amplitude occurs in only one channel. The non-time-reversal invariance of the approximate theory is noted. Results of calculations based on a realistic model for two sets of light-ion induced, one-particle transfer reactions are discussed and compared with the coupled reaction channel (CRC) results using the CRC procedure of Cotanch and Vincent. Angular distributions for the two calculational methods are found to be similar in shape and magnitude. Higher ordercorrections are small as are time-reversal non-invariant effects. Post- and prior-type CRC calculations are seen to differ; the latter are closer to the full CRC results

Reverse logistics policy – differences between conservative and innovative reverse logistics management

Directory of Open Access Journals (Sweden)

Alena Klapalová

2013-01-01

Full Text Available One of the of the key barriers that hampers effective and efficient management of reverse flows detected within a number of empirical surveys and case studies focused on reverse logistics and/or return management is business (organisational policy, specifically lack of policy, deficiency in existing policy or inferior policy. Despite this fact, there is a gap in literature which would show some evidence from practice that innovative reverse logistics policy both can pay off and is associated with certain aspects of reverse logistics management. Such proof can have several implications. It can support the call for better understanding and more research of the linkages of reverse logistics with other corporate functions, promote the acceptation of strategic character of reverse logistics and stress the role of RL policy within the rest of overall corporate management.The aim of this paper is to contribute and to enrich the existing body of knowledge concerning the above-mentioned gap through presentation of survey results that was realized in 2012 among managers of 244 Czech firms. The results demonstrate the statistically significant association between the innovativeness of RL policy and profitability of firms, quality of RL planning, perception of RL importance, level of RL knowledge and perception of product innovation importance for firms’ competitiveness and frequency of product innovation. They also reveal statistically significant differences between firms with conservative and innovative RL policy and the perceived existence of some barriers to manage RL.

Geomagnetic Field During a Reversal

Science.gov (United States)

Heirtzler, J. R.

2003-01-01

It has frequently been suggested that only the geomagnetic dipole, rather than higher order poles, reverse during a geomagnetic field reversal. Under this assumption the geomagnetic field strength has been calculated for the surface of the Earth for various steps of the reversal process. Even without an eminent a reversal of the field, extrapolation of the present secular change (although problematic) shows that the field strength may become zero in some geographic areas within a few hundred years.

A molecular dynamics study of intramolecular proton transfer reaction of malonaldehyde in solution based upon a mixed quantum-classical approximation. II. Proton transfer reaction in non-polar solvent

Science.gov (United States)

Kojima, H.; Yamada, A.; Okazaki, S.

2015-05-01

The intramolecular proton transfer reaction of malonaldehyde in neon solvent has been investigated by mixed quantum-classical molecular dynamics (QCMD) calculations and fully classical molecular dynamics (FCMD) calculations. Comparing these calculated results with those for malonaldehyde in water reported in Part I [A. Yamada, H. Kojima, and S. Okazaki, J. Chem. Phys. 141, 084509 (2014)], the solvent dependence of the reaction rate, the reaction mechanism involved, and the quantum effect therein have been investigated. With FCMD, the reaction rate in weakly interacting neon is lower than that in strongly interacting water. However, with QCMD, the order of the reaction rates is reversed. To investigate the mechanisms in detail, the reactions were categorized into three mechanisms: tunneling, thermal activation, and barrier vanishing. Then, the quantum and solvent effects were analyzed from the viewpoint of the reaction mechanism focusing on the shape of potential energy curve and its fluctuations. The higher reaction rate that was found for neon in QCMD compared with that found for water solvent arises from the tunneling reactions because of the nearly symmetric double-well shape of the potential curve in neon. The thermal activation and barrier vanishing reactions were also accelerated by the zero-point energy. The number of reactions based on these two mechanisms in water was greater than that in neon in both QCMD and FCMD because these reactions are dominated by the strength of solute-solvent interactions.

Supercritical fluid reverse micelle separation

Science.gov (United States)

Fulton, J.L.; Smith, R.D.

1993-11-30

A method of separating solute material from a polar fluid in a first polar fluid phase is provided. The method comprises combining a polar fluid, a second fluid that is a gas at standard temperature and pressure and has a critical density, and a surfactant. The solute material is dissolved in the polar fluid to define the first polar fluid phase. The combined polar and second fluids, surfactant, and solute material dissolved in the polar fluid is maintained under near critical or supercritical temperature and pressure conditions such that the density of the second fluid exceeds the critical density thereof. In this way, a reverse micelle system defining a reverse micelle solvent is formed which comprises a continuous phase in the second fluid and a plurality of reverse micelles dispersed in the continuous phase. The solute material is dissolved in the polar fluid and is in chemical equilibrium with the reverse micelles. The first polar fluid phase and the continuous phase are immiscible. The reverse micelles each comprise a dynamic aggregate of surfactant molecules surrounding a core of the polar fluid. The reverse micelle solvent has a polar fluid-to-surfactant molar ratio W, which can vary over a range having a maximum ratio W[sub o] that determines the maximum size of the reverse micelles. The maximum ratio W[sub o] of the reverse micelle solvent is then varied, and the solute material from the first polar fluid phase is transported into the reverse micelles in the continuous phase at an extraction efficiency determined by the critical or supercritical conditions. 27 figures.

Suppression of the stellar enhancement factor and the reaction 85Rb(p,n)85Sr

International Nuclear Information System (INIS)

Rauscher, T.; Kiss, G. G.; Gyuerky, Gy.; Simon, A.; Fueloep, Zs.; Somorjai, E.

2009-01-01

It is shown that a Coulomb suppression of the stellar enhancement factor occurs in many endothermic reactions at and far from stability. Contrary to common assumptions, reaction measurements for astrophysics with minimal impact of stellar enhancement should be preferably performed for those reactions instead of their reverses, despite of their negative Q value. As a demonstration, the cross section of the astrophysically relevant 85 Rb(p,n) 85 Sr reaction has been measured by activation between 2.16≤E c.m. ≤3.96 MeV and the astrophysical reaction rates at p process temperatures for (p,n) as well as (n,p) are directly inferred from the data. Additionally, our results confirm a previously derived modification of a global optical proton potential. The presented arguments are also relevant for other α- and proton-induced reactions in the p, rp, and νp processes.

Exploring the Reaction Pathways of Bioglycerol Hydrodeoxygenation to Propene over Molybdena-Based Catalysts.

Science.gov (United States)

Zacharopoulou, Vasiliki; Vasiliadou, Efterpi S; Lemonidou, Angeliki A

2018-01-10

The one-step reaction of glycerol with hydrogen to form propene selectively is a particularly challenging catalytic pathway that has not yet been explored thoroughly. Molybdena-based catalysts are active and selective to C-O bond scission; propene is the only product in the gas phase under the standard reaction conditions, and further hydrogenation to propane is impeded. Within this context, this work focuses on the exploration of the reaction pathways and the investigation of various parameters that affect the catalytic performance, such as the role of hydrogen on the product distribution and the effect of the catalyst pretreatment step. Under a hydrogen atmosphere, propene is produced primarily via 2-propenol, whereas under an inert atmosphere propanal and glycerol dissociation products are formed mainly. The reaction most likely proceeds through a reverse Mars-van Krevelen mechanism as partially reduced Mo species drive the reaction to the formation of the desired product. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Long-Duration Spaceflight Increases Depth Ambiguity of Reversible Perspective Figures

Science.gov (United States)

Clément, Gilles; Allaway, Heather C. M.; Demel, Michael; Golemis, Adrianos; Kindrat, Alexandra N.; Melinyshyn, Alexander N.; Merali, Tahir; Thirsk, Robert

2015-01-01

The objective of this study was to investigate depth perception in astronauts during and after spaceflight by studying their sensitivity to reversible perspective figures in which two-dimensional images could elicit two possible depth representations. Other ambiguous figures that did not give rise to a perception of illusory depth were used as controls. Six astronauts and 14 subjects were tested in the laboratory during three sessions for evaluating the variability of their responses in normal gravity. The six astronauts were then tested during four sessions while on board the International Space Station for 5–6 months. They were finally tested immediately after return to Earth and up to one week later. The reaction time decreased throughout the sessions, thus indicating a learning effect. However, the time to first percept reversal and the number of reversals were not different in orbit and after the flight compared to before the flight. On Earth, when watching depth-ambiguous perspective figures, all subjects reported seeing one three-dimensional interpretation more often than the other, i.e. a ratio of about 70–30%. In weightlessness this asymmetry gradually disappeared and after 3 months in orbit both interpretations were seen for the same duration. These results indicate that the perception of “illusory” depth is altered in astronauts during spaceflight. This increased depth ambiguity is attributed to the lack of the gravitational reference and the eye-ground elevation for interpreting perspective depth cues. PMID:26146839

Long-Duration Spaceflight Increases Depth Ambiguity of Reversible Perspective Figures.

Directory of Open Access Journals (Sweden)

Gilles Clément

Full Text Available The objective of this study was to investigate depth perception in astronauts during and after spaceflight by studying their sensitivity to reversible perspective figures in which two-dimensional images could elicit two possible depth representations. Other ambiguous figures that did not give rise to a perception of illusory depth were used as controls. Six astronauts and 14 subjects were tested in the laboratory during three sessions for evaluating the variability of their responses in normal gravity. The six astronauts were then tested during four sessions while on board the International Space Station for 5-6 months. They were finally tested immediately after return to Earth and up to one week later. The reaction time decreased throughout the sessions, thus indicating a learning effect. However, the time to first percept reversal and the number of reversals were not different in orbit and after the flight compared to before the flight. On Earth, when watching depth-ambiguous perspective figures, all subjects reported seeing one three-dimensional interpretation more often than the other, i.e. a ratio of about 70-30%. In weightlessness this asymmetry gradually disappeared and after 3 months in orbit both interpretations were seen for the same duration. These results indicate that the perception of "illusory" depth is altered in astronauts during spaceflight. This increased depth ambiguity is attributed to the lack of the gravitational reference and the eye-ground elevation for interpreting perspective depth cues.

Development of a reverse transcriptase loop-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples

NARCIS (Netherlands)

Adams, Emily R.; Schoone, Gerard J.; Ageed, Al Farazdag; El Safi, Sayda; Schallig, Henk D. F. H.

2010-01-01

Here we describe a generic, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP) assay, for the identification of Leishmania species from clinical samples. LAMP is an isothermal reaction recently developed as a point-of-care diagnostic tool. Primers were designed in the conserved

r-Universal reversible logic gates

International Nuclear Information System (INIS)

Vos, A de; Storme, L

2004-01-01

Reversible logic plays a fundamental role both in ultra-low power electronics and in quantum computing. It is therefore important to know which reversible logic gates can be used as building block for the reversible implementation of an arbitrary boolean function and which cannot

Reversible switching in self-assembled monolayers of azobenzene thiolates on Au (111) probed by threshold photoemission

Energy Technology Data Exchange (ETDEWEB)

Heinemann, Nils, E-mail: heinemann@physik.uni-kiel.de [Institut fuer Experimentelle und Angewandte Physik, Christian-Albrechts-Universitaet zu Kiel, Leibnizstr. 19, 24098 Kiel (Germany); Grunau, Jan; Leissner, Till; Andreyev, Oleksiy; Kuhn, Sonja; Jung, Ulrich [Institut fuer Experimentelle und Angewandte Physik, Christian-Albrechts-Universitaet zu Kiel, Leibnizstr. 19, 24098 Kiel (Germany); Zargarani, Dordaneh; Herges, Rainer [Otto-Diels-Institut fuer Organische Chemie, Christian-Albrechts-Universitaet zu Kiel, Otto-Hahn-Platz 4, 24098 Kiel (Germany); Magnussen, Olaf; Bauer, Michael [Institut fuer Experimentelle und Angewandte Physik, Christian-Albrechts-Universitaet zu Kiel, Leibnizstr. 19, 24098 Kiel (Germany)

2012-06-19

Highlights: Black-Right-Pointing-Pointer Photoelectron spectroscopy of liquid phase prepared SAMs of azobenzene derivative. Black-Right-Pointing-Pointer Photo-induced reversible switching in densely packed SAM is monitored. Black-Right-Pointing-Pointer Maximum density of switched molecules in SAM is derived from photoemission data. Black-Right-Pointing-Pointer Switching reaction only enabled at defects sites within the molecular layer. - Abstract: The reversible photo- and thermally activated isomerization of the molecular switch 3-(4-(4-Hexyl-phenylazo)-phenoxy)-propane-1-thiol (ABT, short for AzoBenzeneThiol) deposited by self-assembly from solution on Au (111) was studied using laser-based photoelectron spectroscopy. Differences in the molecular dipole moment characteristic for the trans and the cis isomer of ABT were monitored via changes in the sample work function, accessible by detection of the threshold energy for photoemission. A quantitative analysis of our data shows that the fraction of molecules within the densely packed monolayer that undergoes a switching process is of the order of 1%. This result indicates the relevance of substrate and film defects required to overcome the steric or electronic hindrance of the isomerization reaction in a densely packed monolayer.

Quantum reverse hypercontractivity

Energy Technology Data Exchange (ETDEWEB)

Cubitt, Toby [Department of Computer Science, University College London, London, United Kingdom and Centre for Quantum Information and Foundations, DAMTP, University of Cambridge, Cambridge (United Kingdom); Kastoryano, Michael [NBIA, Niels Bohr Institute, University of Copenhagen, 2100 Copenhagen (Denmark); Montanaro, Ashley [School of Mathematics, University of Bristol, Bristol (United Kingdom); Temme, Kristan [Institute for Quantum Information and Matter, California Institute of Technology, Pasadena, California 91125 (United States)

2015-10-15

We develop reverse versions of hypercontractive inequalities for quantum channels. By generalizing classical techniques, we prove a reverse hypercontractive inequality for tensor products of qubit depolarizing channels. We apply this to obtain a rapid mixing result for depolarizing noise applied to large subspaces and to prove bounds on a quantum generalization of non-interactive correlation distillation.

A new reversible Mg3Ag–H2 system for hydrogen storage

International Nuclear Information System (INIS)

Si, T.Z.; Zhang, J.B.; Liu, D.M.; Zhang, Q.A.

2013-01-01

Highlights: •Mg 3 Ag compound with high-purity was prepared by hydrogen metallurgy. •Mg 3 Ag is first employed for reversible hydrogen storage with altered thermodynamics. •The enhanced cyclic stability is due to the prevention of MgH 2 sintering by MgAg. -- Abstract: For the first time, the compound Mg 3 Ag was employed as a medium for hydrogen storage. It has been demonstrated that the hydriding/dehydriding process of Mg 3 Ag is reversible through the reaction Mg 3 Ag + 2H 2 ↔ 2MgH 2 + MgAg with obtaining altered thermodynamics. An enhanced cycling stability is also achieved by the capacity retention of 95% after 30 cycles, much higher than 70% for the pure Mg sample, which can be explained that the agglomeration and sintering of the resulting MgH 2 are efficiently prevented by the formation of hard and brittle MgAg phase upon multi-cycling

Plasma current sustained by fusion charged particles in a field reversed configuration

International Nuclear Information System (INIS)

Berk, H.L.; Momota, H.; Tajima, T.

1987-04-01

The distribution of energetic charged particles generated by thermonuclear fusion reactions in a field reversed configuration (FRC) are studied analytically and numerically. A fraction of the charged fusion products escapes directly while the others are trapped to form a directed particle flow parallel to the plasma current. It is shown that the resultant current density produced by these fusion charged particles can be comparable to background plasma current density that produces the original field reversed configuration in a D- 3 He reactor. Self-consistent equilibria arising from the currents of the background plasma and proton fusion products are constructed where the Larmor radius of the fusion product is of arbitrary size. Reactor relevant parameters are examined, such as how the fusion reactivity rate varies as a result of supporting the pressure associated with the fusion products. We also model the synchrotron emission from various pressure profiles and quantitatively show how synchrotron losses vary with different pressure profiles in an FRC configuration

Introduction to reversible computing

CERN Document Server

Perumalla, Kalyan S

2013-01-01

Few books comprehensively cover the software and programming aspects of reversible computing. Filling this gap, Introduction to Reversible Computing offers an expanded view of the field that includes the traditional energy-motivated hardware viewpoint as well as the emerging application-motivated software approach. Collecting scattered knowledge into one coherent account, the book provides a compendium of both classical and recently developed results on reversible computing. It explores up-and-coming theories, techniques, and tools for the application of rever

A Study on Reverse Logistics

OpenAIRE

Reddy, Dhananjaya

2011-01-01

In the competitive world of manufacturing, companies are often searching for new ways to improve their process, customer satisfaction and stay ahead in the game with their competitors. Reverse logistics has been considered a strategy to bring these things to life for the past decade or so. This thesis work tries to shed some light on the basics of reverse logistics and how reverse logistics can be used as a management strategy. This paper points out the fundamentals of reverse logistics and l...

Reverse screening methods to search for the protein targets of chemopreventive compounds

Science.gov (United States)

Huang, Hongbin; Zhang, Guigui; Zhou, Yuquan; Lin, Chenru; Chen, Suling; Lin, Yutong; Mai, Shangkang; Huang, Zunnan

2018-05-01

This article is a systematic review of reverse screening methods used to search for the protein targets of chemopreventive compounds or drugs. Typical chemopreventive compounds include components of traditional Chinese medicine, natural compounds and Food and Drug Administration (FDA)-approved drugs. Such compounds are somewhat selective but are predisposed to bind multiple protein targets distributed throughout diverse signaling pathways in human cells. In contrast to conventional virtual screening, which identifies the ligands of a targeted protein from a compound database, reverse screening is used to identify the potential targets or unintended targets of a given compound from a large number of receptors by examining their known ligands or crystal structures. This method, also known as in silico or computational target fishing, is highly valuable for discovering the target receptors of query molecules from terrestrial or marine natural products, exploring the molecular mechanisms of chemopreventive compounds, finding alternative indications of existing drugs by drug repositioning, and detecting adverse drug reactions and drug toxicity. Reverse screening can be divided into three major groups: shape screening, pharmacophore screening and reverse docking. Several large software packages, such as Schrödinger and Discovery Studio; typical software/network services such as ChemMapper, PharmMapper, idTarget and INVDOCK; and practical databases of known target ligands and receptor crystal structures, such as ChEMBL, BindingDB and the Protein Data Bank (PDB), are available for use in these computational methods. Different programs, online services and databases have different applications and constraints. Here, we conducted a systematic analysis and multilevel classification of the computational programs, online services and compound libraries available for shape screening, pharmacophore screening and reverse docking to enable non-specialist users to quickly learn and

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

Science.gov (United States)

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

Contribution to the study of isotopic exchange of oxygen between nickel oxide and the gases arising from the oxidation reaction of carbon monoxide; Contribution a l'etude de l'echange isotopique de l'oxygene entre l'oxyde de nickel et les gaz de la reaction d'oxydation de l'oxyde de carbone

Energy Technology Data Exchange (ETDEWEB)

Bailly, J C [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1967-12-01

The 3 isotopic reactions of oxygen: C{sup 18}O + Ni{sup 16}O {r_reversible} C{sup 16}O + Ni{sup 18}O, {sup 16}O{sup 18}O + Ni{sup 16}O {r_reversible} {sup 16}O{sub 2} + Ni{sup 18}O, and C{sup 16}O{sup 18}O + Ni{sup 16}O {r_reversible} C{sup 16}O{sub 2} + Ni{sup 18}O between CO, CO{sub 2}, O{sub 2} and NiO are studied using a mass spectrometer. The isotopic gaseous mixtures are prepared from oxygen-18 enriched water. A first order kinetic law has been found for these reactions in the gaseous phase, and the activation energies have been determined. Only CO and CO{sub 2} exchange oxygen, at room temperature, but only with part of the oxide surface. Gaseous O{sub 2} reacts with the whole surface at 250 C, the slow step of the exchange process, in the gaseous phase, being certainly the mobility of oxygen ions on the surface of NiO. (author) [French] Les 3 reactions d'echange isotopique de l'oxygene: C{sup 18}O + Ni{sup 16}O {r_reversible} C{sup 16}O + Ni{sup 18}O, {sup 16}O{sup 18}O + Ni{sup 16}O {r_reversible} {sup 16}O{sub 2} + Ni{sup 18}O, et C{sup 16}O{sup 18}O + Ni{sup 16}O {r_reversible} C{sup 16}O{sub 2} + Ni{sup 18}O entre l'oxyde de carbone, l'oxygene gazeux, le gaz carbonique et l'oxyde de nickel sont etudiees par spectrometrie de masse. Les melanges isotopiques gazeux sont prepares a partir d'une eau enrichie en isotope 18 de l'oxygene. Une loi cinetique du premier ordre a ete trouvee pour les trois reactions d'echange en phase gazeuse, et des energies d'activation de ces reactions ont ete determinees. Seuls CO et CO{sub 2} echangent l'oxygene, des la temperature ambiante, mais avec une fraction seulement de la surface de l'oxyde. O{sub 2} gazeux reagit avec toute la surface du solide a 250 C, l'etape lente du processus d'echange en phase gazeuse etant vraisemblablement liee a la mobilite des ions oxygene superficiels de NiO. (auteur)

Exploratory urinary metabolomics of type 1 leprosy reactions.

Science.gov (United States)

Mayboroda, Oleg A; van Hooij, Anouk; Derks, Rico; van den Eeden, Susan J F; Dijkman, Karin; Khadge, Saraswoti; Thapa, Pratibha; Kunwar, Chhatra B; Hagge, Deanna A; Geluk, Annemieke

2016-04-01

Leprosy is an infectious disease caused by Mycobacterium leprae that affects the skin and nerves. Although curable with multidrug therapy, leprosy is complicated by acute inflammatory episodes called reactions, which are the major causes of irreversible neuropathy in leprosy that occur before, during, and even after treatment. Early diagnosis and prompt treatment of reactions reduces the risk of permanent disability. This exploratory study investigated whether urinary metabolic profiles could be identified that correlate with early signs of reversal reactions (RR). A prospective cohort of leprosy patients with and without reactions and endemic controls was recruited in Nepal. Urine-derived metabolic profiles were measured longitudinally. Thus, a conventional area of biomarker identification for leprosy was extended to non-invasive urine testing. It was found that the urinary metabolome could be used to discriminate endemic controls from untreated patients with mycobacterial disease. Moreover, metabolic signatures in the urine of patients developing RR were clearly different before RR onset compared to those at RR diagnosis. This study indicates that urinary metabolic profiles are promising host biomarkers for the detection of intra-individual changes during acute inflammation in leprosy and could contribute to early treatment and prevention of tissue damage. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Consistent post-reaction vibrational energy redistribution in DSMC simulations using TCE model

Science.gov (United States)

Borges Sebastião, Israel; Alexeenko, Alina

2016-10-01

The direct simulation Monte Carlo (DSMC) method has been widely applied to study shockwaves, hypersonic reentry flows, and other nonequilibrium flow phenomena. Although there is currently active research on high-fidelity models based on ab initio data, the total collision energy (TCE) and Larsen-Borgnakke (LB) models remain the most often used chemistry and relaxation models in DSMC simulations, respectively. The conventional implementation of the discrete LB model, however, may not satisfy detailed balance when recombination and exchange reactions play an important role in the flow energy balance. This issue can become even more critical in reacting mixtures involving polyatomic molecules, such as in combustion. In this work, this important shortcoming is addressed and an empirical approach to consistently specify the post-reaction vibrational states close to thermochemical equilibrium conditions is proposed within the TCE framework. Following Bird's quantum-kinetic (QK) methodology for populating post-reaction states, the new TCE-based approach involves two main steps. The state-specific TCE reaction probabilities for a forward reaction are first pre-computed from equilibrium 0-D simulations. These probabilities are then employed to populate the post-reaction vibrational states of the corresponding reverse reaction. The new approach is illustrated by application to exchange and recombination reactions relevant to H2-O2 combustion processes.

Study of the p + p → π+ + d reaction close to threshold

International Nuclear Information System (INIS)

Drochner, M.; Kemmerling, G.; Zwoll, K.; Frekers, D.; Garske, W.; Klimala, W.; Kolev, D.; Tsenov, R.; Kutsarova, T.

1996-01-01

The p + p → π + + d reaction has been studied at excess energies between 0.275 MeV and 3.86 MeV. The experiments were performed with the external proton beam of the COoler SYnchrotron (COSY) in Julich. Differential and total cross sections were measured employing a high resolution magnetic spectrometer with nearly 4π acceptance in the centre of the mass system. The values of the total cross sections are - when corrected for the Coulomb effects - in agreement with the results obtained from the time reversed reactions as well as from isospin related reactions. The measured anisotropies between 0.008 and 0.29 indicate that the p-wave is not negligible even so close to threshold. The s-wave and p-wave contributions at threshold are deduced. (author)

Reaction mixtures formed by nitrite and selected sulfa-drugs showed mutagenicity in acidic medium

Directory of Open Access Journals (Sweden)

Claudia Trossero

2009-01-01

Full Text Available Nitrite, which is present in preserved meat and can be produced in the oral cavity by reduction of nitrate taken from vegetables, could react in stomach with nitrosatable drugs, giving genotoxic-carcinogenic N-nitroso compounds (NOC. The mutagenicity of reaction mixtures formed by sodium nitrite and selected sulfa-drugs (sulfathiazole, HST; phtalylsulfathiazole, PhST; complex Co(II-sulfathiazole, Co(II-ST in acidic medium was evaluated using the Salmonella typhimurium reverse mutation assay (Ames test, with TA98 and TA 100 strains. The reactions were carried out at room temperature, with a mole ratio [nitrite]/[sulfa-drug] > 1. The three reaction mixtures showed mutagenic effects in the considered range.

Measurement of exclusive hypercharge-exchange reactions at 35 to 140 GeV/c

International Nuclear Information System (INIS)

Arenton, M. W.; Ayres, D.S.; Cohen, D.

1978-07-01

Data on the reactions π + p → K + Σ + and π + p → K + Y* + were obtained using the Fermilab Single Arm Spectrometer Facility at incident π + momenta of 35, 70, and 140 GeV/c for momentum transfers vertical bar t vertical bar less than or approximately equal to 1 GeV 2 . The line-reversed reactions K - p → π - Σ + and K - p → π - Y* + were also studied at 70 GeV/c with the same apparatus in order to test exchange degeneracy of the K*(890) and K**(1420) trajectories. Preliminary results on the first set of reactions at 70 GeV/c are presented and found to be in qualitative agreement with the model of Navelet and Stevens

Sulfur Poisoning of the Water Gas Shift Reaction on Anode Supported Solid Oxide Fuel Cells

DEFF Research Database (Denmark)

Hagen, Anke

2013-01-01

resistance increased both in the high and low frequency region, which indicates a strong poisoning of the water gas shift reaction and thus a lack of hydrogen fuel in addition to the poisoning of the electrochemical hydrogen oxidation. All poisoning effects are reversible under the applied operating...

Optimized reversible binary-coded decimal adders

DEFF Research Database (Denmark)

Thomsen, Michael Kirkedal; Glück, Robert

2008-01-01

Abstract Babu and Chowdhury [H.M.H. Babu, A.R. Chowdhury, Design of a compact reversible binary coded decimal adder circuit, Journal of Systems Architecture 52 (5) (2006) 272-282] recently proposed, in this journal, a reversible adder for binary-coded decimals. This paper corrects and optimizes...... their design. The optimized 1-decimal BCD full-adder, a 13 × 13 reversible logic circuit, is faster, and has lower circuit cost and less garbage bits. It can be used to build a fast reversible m-decimal BCD full-adder that has a delay of only m + 17 low-power reversible CMOS gates. For a 32-decimal (128-bit....... Keywords: Reversible logic circuit; Full-adder; Half-adder; Parallel adder; Binary-coded decimal; Application of reversible logic synthesis...

Charged particle induced thermonuclear reaction rates: a compilation for astrophysics

International Nuclear Information System (INIS)

Grama, C.

1999-01-01

We report on the results of the European network NACRE (Nuclear Astrophysics Compilation of REaction rates). The principal reason for setting up the NACRE network has been the necessity of building up a well-documented and detailed compilation of rates for charged-particle induced reactions on stable targets up to Si and on unstable nuclei of special significance in astrophysics. This work is meant to supersede the only existing compilation of reaction rates issued by Fowler and collaborators. The main goal of NACRE network was the transparency in the procedure of calculating the rates. More specifically this compilation aims at: 1. updating the experimental and theoretical data; 2. distinctly identifying the sources of the data used in rate calculation; 3. evaluating the uncertainties and errors; 4. providing numerically integrated reaction rates; 5. providing reverse reaction rates and analytical approximations of the adopted rates. The cross section data and/or resonance parameters for a total of 86 charged-particle induced reactions are given and the corresponding reaction rates are calculated and given in tabular form. Uncertainties are analyzed and realistic upper and lower bounds of the rates are determined. The compilation is concerned with the reaction rates that are large enough for the target lifetimes shorter than the age of the Universe, taken equal to 15 x 10 9 y. The reaction rates are provided for temperatures lower than T = 10 10 K. In parallel with the rate compilation a cross section data base has been created and located at the site http://pntpm.ulb.ac.be/nacre..htm. (authors)

Separation and determination of synthetic impurities of difloxacin by reversed-phase high-performance liquid chromatography.

Science.gov (United States)

Rao, R Nageswara; Nagaraju, V

2004-11-19

A simple and rapid reversed-phase high-performance liquid chromatographic method for separation and determination of process-related impurities of difloxacin (DFL) was developed. The separation was achieved on a reversed-phase C(18) column using methanol-water-acetic acid (78:21.9:0.1, v/v/v) as a mobile solvent at a flow rate of 1.0 ml/min at 28 degrees C using UV detection at 230 nm. It was linear over a range of 0.03 x 10(-6) to 1.60 x 10(-6)g for process related impurities and 0.05 x 10(-6) to 2.40 x 10(-6)g for difloxacin. The detection limits were 0.009 x 10(-6) to 0.024 x 10(-6)g for all the compounds examined. The recoveries were found to be in the range of 97.6-102.0% for impurities as well as difloxacin. The precision and robustness of the method were evaluated. It was used for not only quality assurance, but also monitoring the synthetic reactions involved in the process development work of difloxacin. The method was found to be specific, precise and reliable for the determination of unreacted levels of raw materials, intermediates in the reaction mixtures and the finished products of difloxacin.

What do reversible programs compute?

DEFF Research Database (Denmark)

Axelsen, Holger Bock; Glück, Robert

2011-01-01

Reversible computing is the study of computation models that exhibit both forward and backward determinism. Understanding the fundamental properties of such models is not only relevant for reversible programming, but has also been found important in other fields, e.g., bidirectional model...... transformation, program transformations such as inversion, and general static prediction of program properties. Historically, work on reversible computing has focussed on reversible simulations of irreversible computations. Here, we take the viewpoint that the property of reversibility itself should...... are not strictly classically universal, but that they support another notion of universality; we call this RTM-universality. Thus, even though the RTMs are sub-universal in the classical sense, they are powerful enough as to include a self-interpreter. Lifting this to other computation models, we propose r...

Fundamentals of reversible flowchart languages

DEFF Research Database (Denmark)

Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

2016-01-01

Abstract This paper presents the fundamentals of reversible flowcharts. They are intended to naturally represent the structure and control flow of reversible (imperative) programming languages in a simple computation model, in the same way classical flowcharts do for conventional languages......, structured reversible flowcharts are as expressive as unstructured ones, as shown by a reversible version of the classic Structured Program Theorem. We illustrate how reversible flowcharts can be concretized with two example programming languages, complete with syntax and semantics: a low-level unstructured...... language and a high-level structured language. We introduce concrete tools such as program inverters and translators for both languages, which follow the structure suggested by the flowchart model. To further illustrate the different concepts and tools brought together in this paper, we present two major...

Magnetic reversals from planetary dynamo waves

DEFF Research Database (Denmark)

Sheyko, Andrey; Finlay, Chris; Jackson, Andrew

2016-01-01

A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a magnetohydrodynamic process that takes ...... to kinematic dynamo waves. Because our results are relevant in a regime of low viscosity and high magnetic diffusivity, and with geophysically appropriate boundary conditions, this form of dynamo wave may also be involved in geomagnetic reversals.......A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a magnetohydrodynamic process that takes...... place in Earth's core, but the precise mechanism is debated. The majority of numerical geodynamo simulations that exhibit reversals operate in a regime in which the viscosity of the fluid remains important, and in which the dynamo mechanism primarily involves stretching and twisting of field lines...

Entropy methods for reaction-diffusion equations: slowly growing a-priori bounds

KAUST Repository

Desvillettes, Laurent; Fellner, Klemens

2008-01-01

In the continuation of [Desvillettes, L., Fellner, K.: Exponential Decay toward Equilibrium via Entropy Methods for Reaction-Diffusion Equations. J. Math. Anal. Appl. 319 (2006), no. 1, 157-176], we study reversible reaction-diffusion equations via entropy methods (based on the free energy functional) for a 1D system of four species. We improve the existing theory by getting 1) almost exponential convergence in L1 to the steady state via a precise entropy-entropy dissipation estimate, 2) an explicit global L∞ bound via interpolation of a polynomially growing H1 bound with the almost exponential L1 convergence, and 3), finally, explicit exponential convergence to the steady state in all Sobolev norms.

Sonic and microwaves assisted redox reactions of the hydrolysates of protein for the preparation of rechargeable battery

International Nuclear Information System (INIS)

Hussain, Z.; Khatak, K.; Sardar, A.

2016-01-01

Long recharging time is one of the serious limitations of batteries. One of the best solutions for quick redox reactions via the use of microwave and sound-assisted reversible redox reaction is presented in this work. A wireless charged prototype battery based on the redox reactions of hydrolyzed waste protein was designed. The effect of experimental conditions like time of charging, nature of media and strength of the acid on the voltage of this prototype battery was investigated. The experimental data was explained on the basis of the previous work on protein peptides and amino acids by various workers. (author)

Solvent- and ligand-induced switch of selectivity in gold(I-catalyzed tandem reactions of 3-propargylindoles

Directory of Open Access Journals (Sweden)

Roberto Sanz

2011-06-01

Full Text Available The selectivity of our previously described gold-catalyzed tandem reaction, 1,2-indole migration followed by aura-iso-Nazarov cyclization, of 3-propargylindoles bearing (heteroaromatic substituents at both the propargylic and terminal positions, was reversed by the proper choice of the catalyst and the reaction conditions. Thus, 3-(inden-2-ylindoles, derived from an aura-Nazarov cyclization (instead of an aura-iso-Nazarov cyclization, were obtained in moderate to good yields from a variety of 3-propargylindoles.

Acute physical exercise under hypoxia improves sleep, mood and reaction time.

Science.gov (United States)

de Aquino-Lemos, Valdir; Santos, Ronaldo Vagner T; Antunes, Hanna Karen Moreira; Lira, Fabio S; Luz Bittar, Irene G; Caris, Aline V; Tufik, Sergio; de Mello, Marco Tulio

2016-02-01

This study aimed to assess the effect of two sessions of acute physical exercise at 50% VO2peak performed under hypoxia (equivalent to an altitude of 4500 m for 28 h) on sleep, mood and reaction time. Forty healthy men were randomized into 4 groups: Normoxia (NG) (n = 10); Hypoxia (HG) (n = 10); Exercise under Normoxia (ENG) (n = 10); and Exercise under Hypoxia (EHG) (n = 10). All mood and reaction time assessments were performed 40 min after awakening. Sleep was reassessed on the first day at 14 h after the initiation of hypoxia; mood and reaction time were measured 28 h later. Two sessions of acute physical exercise at 50% VO2peak were performed for 60 min on the first and second days after 3 and 27 h, respectively, after starting to hypoxia. Improved sleep efficiency, stage N3 and REM sleep and reduced wake after sleep onset were observed under hypoxia after acute physical exercise. Tension, anger, depressed mood, vigor and reaction time scores improved after exercise under hypoxia. We conclude that hypoxia impairs sleep, reaction time and mood. Acute physical exercise at 50% VO2peak under hypoxia improves sleep efficiency, reversing the aspects that had been adversely affected under hypoxia, possibly contributing to improved mood and reaction time.

Study of spallation residues of gold at 0.8 GeV/N in reverse kinematics

International Nuclear Information System (INIS)

Tassan-Got, L.; Mustapha, B.; Rejmund, F.

2000-01-01

Spallation residue cross-sections of gold have been measured in reverse kinematics. For the first time isotopic distributions have been obtained for such a heavy nucleus at a level of accuracy of 10 %. When compared to model calculations the results appear to be very sensitive to the distribution of excitation energy in the fast step of the reaction. This allows an insight on the mechanism of the energy and momentum deposition. (authors)

Missing Photos, Suffering Withdrawal, or Finding Freedom? How Experiences of Social Media Non-Use Influence the Likelihood of Reversion

Directory of Open Access Journals (Sweden)

Eric P. S. Baumer

2015-11-01

Full Text Available This article examines social media reversion, when a user intentionally ceases using a social media site but then later resumes use of the site. We analyze a convenience sample of survey data from people who volunteered to stay off Facebook for 99 days but, in some cases, returned before that time. We conduct three separate analyses to triangulate on the phenomenon of reversion: simple quantitative predictors of reversion, factor analysis of adjectives used by respondents to describe their experiences of not using Facebook, and statistical topic analysis of free-text responses. Significant factors predicting either increased or decreased likelihood of reversion include, among others, prior use of Facebook, experiences associated with perceived addiction, issues of social boundary negotiation such as privacy and surveillance, use of other social media, and friends’ reactions to non-use. These findings contribute to the growing literature on technology non-use by demonstrating how social media users negotiate, both with each other and with themselves, among types and degrees of use and non-use.

The influence of the "cage" effect on the mechanism of reversible bimolecular multistage chemical reactions proceeding from different sites in solutions.

Science.gov (United States)

Doktorov, Alexander B

2016-08-28

Manifestations of the "cage" effect at the encounters of reactants have been theoretically treated on the example of multistage reactions (including bimolecular exchange reactions as elementary stages) proceeding from different active sites in liquid solutions. It is shown that for reactions occurring near the contact of reactants, consistent consideration of quasi-stationary kinetics of such multistage reactions (possible in the framework of the encounter theory only) can be made on the basis of chemical concepts of the "cage complex," just as in the case of one-site model described in the literature. Exactly as in the one-site model, the presence of the "cage" effect gives rise to new channels of reactant transformation that cannot result from elementary event of chemical conversion for the given reaction mechanism. Besides, the multisite model demonstrates new (as compared to one-site model) features of multistage reaction course.

Nitrile group as infrared probe for the characterization of the conformation of bovine serum albumin solubilized in reverse micelles.

Science.gov (United States)

Xue, Luyan; Zou, Feixue; Zhao, Yin; Huang, Xirong; Qu, Yinbo

2012-11-01

Infrared spectroscopy is a powerful technique for structure characterization. For a protein hosted in a reversed micellar medium, the spectral features of the protein are always interfered by the IR absorption bands of the medium in addition to the congestion in their IR spectra. Fortunately, there is a transparent window in the 2500-2200 cm(-1) region. Incorporation of a vibrational probe with IR absorption frequencies in this region into proteins represents a promising strategy for the study of the conformation of a protein in a reverse micelle. In the present work, we incorporated 4-cyanobenzyl group (CN) into bovine serum albumin (BSA) via cysteine alkylation reactions under mild conditions. Circular dichroism spectroscopy showed that the CN modified BSA (CNBSA) could retain its conformation. When CNBSA was hosted in AOT reverse micelle, it was found that the nitrile group on BSA was sensitive to the conformational change of BSA induced by urea as an additive in the reverse micelle. The peak splitting of nitrile group was also observed when the size of AOT reverse micelle and the concentration of an electrolyte were varied. Obviously, the shift of the IR absorption peak and/or peak splitting of nitrile group on BSA are correlated with the change of BSA conformation in AOT reverse micelle. So we conclude that the nitrile infrared probe can be used to study protein conformation in a reverse micelle. Copyright © 2012 Elsevier B.V. All rights reserved.

Squatting-Related Tibiofemoral Shear Reaction Forces and a Biomechanical Rationale for Femoral Component Loosening

Directory of Open Access Journals (Sweden)

Ashvin Thambyah

2014-01-01

Full Text Available Previous gait studies on squatting have described a rapid reversal in the direction of the tibiofemoral joint shear reaction force when going into a full weight-bearing deep knee flexion squat. The effects of such a shear reversal have not been considered with regard to the loading demand on knee implants in patients whose activities of daily living require frequent squatting. In this paper, the shear reversal effect is discussed and simulated in a finite element knee implant-bone model, to evaluate the possible biomechanical significance of this effect on femoral component loosening of high flexion implants as reported in the literature. The analysis shows that one of the effects of the shear reversal was a switch between large compressive and large tensile principal strains, from knee extension to flexion, respectively, in the region of the anterior flange of the femoral component. Together with the known material limits of cement and bone, this large mismatch in strains as a function of knee position provides new insight into how and why knee implants may fail in patients who perform frequent squatting.

Theoretical studies of the reactions of HCN with atomic hydrogen

International Nuclear Information System (INIS)

Bair, R.A.; Dunning, T.H. Jr.

1985-01-01

A comprehensive theoretical study has been made of the energetics of the important pathways involved in the reaction of hydrogen atoms with hydrogen cyanide. For each reaction ab initio GVB-CI calculations were carried out to determine the structures and vibrational frequencies of the reactants, transition states, and products; then POL-CI calculations were carried out to more accurately estimate the electronic contribution to the energetics of the reactions. The hydrogen abstraction reaction is calculated to be endoergic by 24 kcal/mol [expt. ΔH (0 K) = 16--19 kcal/mol] with a barrier of 31 kcal/mol in the forward direction and 6 kcal/mol in the reverse direction. For the hydrogen addition reactions, addition to the carbon atom is calculated to be exoergic by 19 kcal/mol with a barrier of 11 kcal/mol, while addition to the nitrogen center is essentially thermoneutral with a barrier of 17 kcal/mol. Calculations were also carried out on the isomerization reactions of the addition products. The cis→trans isomerization of HCNH has a barrier of only 10 kcal/mol with the trans isomer being more stable by 5 kcal/mol. The (1,2)-hydrogen migration reaction, converting H 2 CN to trans-HCNH, is endoergic by only 14 kcal/mol, but the calculated barrier for the transfer is 52 kcal/mol. The energy of the migration pathway thus lies above that of the dissociation--recombination pathway

A functional language for describing reversible logic

DEFF Research Database (Denmark)

Thomsen, Michael Kirkedal

2012-01-01

Reversible logic is a computational model where all gates are logically reversible and combined in circuits such that no values are lost or duplicated. This paper presents a novel functional language that is designed to describe only reversible logic circuits. The language includes high....... Reversibility of descriptions is guaranteed with a type system based on linear types. The language is applied to three examples of reversible computations (ALU, linear cosine transformation, and binary adder). The paper also outlines a design flow that ensures garbage- free translation to reversible logic...... circuits. The flow relies on a reversible combinator language as an intermediate language....

The Effect of Structured Decision-Making Techniques and Gender on Student Reaction and Quality of Written Documents.

Science.gov (United States)

Neal, Joan; Echternacht, Lonnie

1995-01-01

Experimental groups used four decision-making techniques--reverse brainstorming (RS), dialectical inquiry (DI), devil's advocacy (DA), and consensus--in evaluating writing assignments. Control group produced a better quality document. Student reaction to negative features of RS, DI, and DA were not significant. (SK)

Geomagnetic Reversals during the Phanerozoic.

Science.gov (United States)

McElhinny, M W

1971-04-09

An antalysis of worldwide paleomagnetic measurements suggests a periodicity of 350 x 10(6) years in the polarity of the geomagnetic field. During the Mesozoic it is predominantly normal, whereas during the Upper Paleozoic it is predominantly reversed. Although geomagnetic reversals occur at different rates throughout the Phanerozoic, there appeaars to be no clear correlation between biological evolutionary rates and reversal frequency.

Radioimmunological determination of reverse triiodo thyronine in unextracted serum and serum dialysates

International Nuclear Information System (INIS)

Laurberg, P.; Weeke, J.

1977-01-01

A sensitive radioimmunoassay for measurements of 3,3,5-triiodothyronine (reverse T3,rT3) in small amounts of unextracted serum is described. The interference of rT3 binding proteins in serum was precluded by addition of 8-anilinol-naphthalene sulphonic acid (ANS). The cross reaction of T4 with the rT3 anti-serum varied with the concentration of T4 in the samples. At 50 per cent inhibition of I 125 rT3 binding, the T4 cross reaction was 0.075% (mol/mol). All values were corrected for T4 cross reaction. By the present method total rT3 averaged 0.37 nmol/l in thirty-two normal subjects. Higher values (0.81-1.98 nmol/l) were obtained in seventeen thyrotoxic patients, while the rT3 was very low (<=0.046 nmol/l) in ten patients with severe primary hypothyroidism. A modification of the total rT3 assay was used for measurements of rT3 in serum dialysates (free rT3). The sensitivity was 0.46 pmol/l. This sensitivity did not allow detection of free rT3 in all normal subjects. (Auth.)

Resveratrol reverses morphine-induced neuroinflammation in morphine-tolerant rats by reversal HDAC1 expression

Directory of Open Access Journals (Sweden)

Ru-Yin Tsai

2016-06-01

Conclusion: Resveratrol restores the antinociceptive effect of morphine by reversing morphine infusion-induced spinal cord neuroinflammation and increase in TNFR1 expression. The reversal of the morphine-induced increase in TNFR1 expression by resveratrol is partially due to reversal of the morphine infusion-induced increase in HDAC1 expression. Resveratrol pretreatment can be used as an adjuvant in clinical pain management for patients who need long-term morphine treatment or with neuropathic pain.

Metal hydrides: an innovative and challenging conversion reaction anode for lithium-ion batteries

Directory of Open Access Journals (Sweden)

Luc Aymard

2015-08-01

Full Text Available The state of the art of conversion reactions of metal hydrides (MH with lithium is presented and discussed in this review with regard to the use of these hydrides as anode materials for lithium-ion batteries. A focus on the gravimetric and volumetric storage capacities for different examples from binary, ternary and complex hydrides is presented, with a comparison between thermodynamic prediction and experimental results. MgH2 constitutes one of the most attractive metal hydrides with a reversible capacity of 1480 mA·h·g−1 at a suitable potential (0.5 V vs Li+/Li0 and the lowest electrode polarization (2, TiH2, complex hydrides Mg2MHx and other Mg-based hydrides. The reversible conversion reaction mechanism of MgH2, which is lithium-controlled, can be extended to others hydrides as: MHx + xLi+ + xe− in equilibrium with M + xLiH. Other reaction paths—involving solid solutions, metastable distorted phases, and phases with low hydrogen content—were recently reported for TiH2 and Mg2FeH6, Mg2CoH5 and Mg2NiH4. The importance of fundamental aspects to overcome technological difficulties is discussed with a focus on conversion reaction limitations in the case of MgH2. The influence of MgH2 particle size, mechanical grinding, hydrogen sorption cycles, grinding with carbon, reactive milling under hydrogen, and metal and catalyst addition to the MgH2/carbon composite on kinetics improvement and reversibility is presented. Drastic technological improvement in order to the enhance conversion process efficiencies is needed for practical applications. The main goals are minimizing the impact of electrode volume variation during lithium extraction and overcoming the poor electronic conductivity of LiH. To use polymer binders to improve the cycle life of the hydride-based electrode and to synthesize nanoscale composite hydride can be helpful to address these drawbacks. The development of high-capacity hydride anodes should be inspired by the emergent

Metal hydrides: an innovative and challenging conversion reaction anode for lithium-ion batteries.

Science.gov (United States)

Aymard, Luc; Oumellal, Yassine; Bonnet, Jean-Pierre

2015-01-01

The state of the art of conversion reactions of metal hydrides (MH) with lithium is presented and discussed in this review with regard to the use of these hydrides as anode materials for lithium-ion batteries. A focus on the gravimetric and volumetric storage capacities for different examples from binary, ternary and complex hydrides is presented, with a comparison between thermodynamic prediction and experimental results. MgH2 constitutes one of the most attractive metal hydrides with a reversible capacity of 1480 mA·h·g(-1) at a suitable potential (0.5 V vs Li(+)/Li(0)) and the lowest electrode polarization (lithium are subsequently detailed for MgH2, TiH2, complex hydrides Mg2MH x and other Mg-based hydrides. The reversible conversion reaction mechanism of MgH2, which is lithium-controlled, can be extended to others hydrides as: MH x + xLi(+) + xe(-) in equilibrium with M + xLiH. Other reaction paths-involving solid solutions, metastable distorted phases, and phases with low hydrogen content-were recently reported for TiH2 and Mg2FeH6, Mg2CoH5 and Mg2NiH4. The importance of fundamental aspects to overcome technological difficulties is discussed with a focus on conversion reaction limitations in the case of MgH2. The influence of MgH2 particle size, mechanical grinding, hydrogen sorption cycles, grinding with carbon, reactive milling under hydrogen, and metal and catalyst addition to the MgH2/carbon composite on kinetics improvement and reversibility is presented. Drastic technological improvement in order to the enhance conversion process efficiencies is needed for practical applications. The main goals are minimizing the impact of electrode volume variation during lithium extraction and overcoming the poor electronic conductivity of LiH. To use polymer binders to improve the cycle life of the hydride-based electrode and to synthesize nanoscale composite hydride can be helpful to address these drawbacks. The development of high-capacity hydride anodes should

Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

Directory of Open Access Journals (Sweden)

Winny Xie

2013-12-01

Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

Expression of dopamine receptors in the subthalamic nucleus of the rat: characterization using reverse transcriptase-polymerase chain reaction and autoradiography

International Nuclear Information System (INIS)

Flores, G.; Liang, J.J.; Sierra, A.; Martinez-Fong, D.; Quirion, R.; Aceves, J.; Srivastava, L.K.

1999-01-01

We analysed the expression of dopamine receptor subtypes in the subthalamic nucleus by means of reverse transcriptase-polymerase chain reaction. We also studied, using autoradiography, all pharmacologically characterized dopamine receptors in four subregions of the subthalamic nucleus. For comparison, dopamine receptor subtypes were also evaluated in brain regions where they are more abundant and well characterized. The radioligands used were: [ 3 H]SCH-23390, [ 3 H]emonapride and [ 3 H]2-dipropylamino-7-hydroxy-1,2,3,4-tetrahydronaphthalene for dopamine D 1 , D 2 and D 3 receptors, respectively; and [ 3 H]YM-09151-2 in the presence of raclopride for dopamine D 4 receptors. Finally, we also evaluated the effect of unilateral 6-hydroxydopamine injection into the medial forebrain bundle on dopamine receptor levels expressed in the ipsilateral subthalamic nucleus. The lesion was estimated by decrease in the binding of [ 3 H]WIN-35428, a specific dopamine transporter label. D 1 , D 2 and D 3 receptor messenger RNAs and binding sites were present in the subthalamic nucleus, but no messenger RNA for D 4 receptors was found, although specific binding sites for these receptors were observed. As compared to the intact side, the 6-hydroxydopamine lesion did not change D 1 receptors, increased D 2 receptors, and decreased D 3 receptors and the dopamine transporter. The results suggest that postsynaptic D 1 , D 2 or D 3 receptors can mediate the effect of dopamine on subthalamic nucleus neuronal activity. D 4 receptors would mediate exclusively presynaptic effects.These results reinforce the idea that dopamine receptors in the subthalamic nucleus may play an important role in the physiology of the basal ganglia and in the pathophysiology of Parkinson's disease. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

Temperature-controlled cross-linking of silver nanoparticles with Diels-Alder reaction and its application on antibacterial property

International Nuclear Information System (INIS)

Liu, Lian; Yang, Pengfei; Li, Junying; Zhang, Zhiliang; Yu, Xi; Lu, Ling

2017-01-01

Highlights: • Silver nanoparticles were functionalized by furan groups. • The DA reaction of furan with bismaleimide was used to cross-link the particles. • The reverse cross-linking could be controlled by temperature. • The antibacterial activity of silvers could be adjusted by the cross-linking. - Abstract: Sliver nanoparticles (AgNPs) were synthesized and functionalized with furan group on their surface, followed by the reverse Diels-Alder (DA) reaction with bismaleimide to vary the particle size, so as to give different antibacterial activities. These nanoparticles were characterized using Scanning Electron Microscope (SEM), X-Ray Diffraction (XRD), Ultraviolet-Visible (UV–vis), Nanoparticle Size Analyzer and X-Ray Photoelectron Spectroscopy (XPS). It was found that the cross-linking reaction with bismaleimide had a great effect on the size of AgNPs. The size of the AgNPs could be controlled by the temperature of DA/r-DA equilibrium. The antibacterial activity was assessed using the inhibition zone diameter by introducing the particles into a media containing Escherichia coli, Listeria monocytogenes, and Staphylococcus aureus, respectively. It was found that these particles were effective bactericides. Furthermore, the antibacterial activity of the nanoparticles decreased orderly as the particle size enlarged.

Temperature-controlled cross-linking of silver nanoparticles with Diels-Alder reaction and its application on antibacterial property

Energy Technology Data Exchange (ETDEWEB)

Liu, Lian; Yang, Pengfei, E-mail: ypf@qlu.edu.cn; Li, Junying; Zhang, Zhiliang; Yu, Xi; Lu, Ling

2017-05-01

Highlights: • Silver nanoparticles were functionalized by furan groups. • The DA reaction of furan with bismaleimide was used to cross-link the particles. • The reverse cross-linking could be controlled by temperature. • The antibacterial activity of silvers could be adjusted by the cross-linking. - Abstract: Sliver nanoparticles (AgNPs) were synthesized and functionalized with furan group on their surface, followed by the reverse Diels-Alder (DA) reaction with bismaleimide to vary the particle size, so as to give different antibacterial activities. These nanoparticles were characterized using Scanning Electron Microscope (SEM), X-Ray Diffraction (XRD), Ultraviolet-Visible (UV–vis), Nanoparticle Size Analyzer and X-Ray Photoelectron Spectroscopy (XPS). It was found that the cross-linking reaction with bismaleimide had a great effect on the size of AgNPs. The size of the AgNPs could be controlled by the temperature of DA/r-DA equilibrium. The antibacterial activity was assessed using the inhibition zone diameter by introducing the particles into a media containing Escherichia coli, Listeria monocytogenes, and Staphylococcus aureus, respectively. It was found that these particles were effective bactericides. Furthermore, the antibacterial activity of the nanoparticles decreased orderly as the particle size enlarged.

Principles of a reversible programming language

DEFF Research Database (Denmark)

Yokoyama, Tetsuo; Axelsen, Holger Bock; Glück, Robert

2008-01-01

The principles of reversible programming languages are explicated and illustrated with reference to the design of a high-level imperative language, Janus. The fundamental properties for such languages include backward as well as forward determinism and reversible updates of data. The unique design...... languages, and demonstrate this for Janus. We show the practicality of the language by implementation of a reversible fast Fourier transform. Our results indicate that the reversible programming paradigm has fundamental properties that are relevant to many different areas of computer science....... features of the language include explicit post-condition assertions, direct access to an inverse semantics and the possibility of clean (i.e., garbage-free) computation of injective functions. We suggest the clean simulation of reversible Turing machines as a criterion for computing strength of reversible...

Electron transfer reactions, cyanide and O2 binding of truncated hemoglobin from Bacillus subtilis

International Nuclear Information System (INIS)

Fernandez, Esther; Larsson, Jonas T.; McLean, Kirsty J.; Munro, Andrew W.; Gorton, Lo; Wachenfeldt, Claes von; Ferapontova, Elena E.

2013-01-01

The truncated hemoglobin from Bacillus subtilis (trHb-Bs) possesses a surprisingly high affinity for oxygen and resistance to (auto)oxidation; its physiological role in the bacterium is not understood and may be connected with its very special redox and ligand binding reactions. Electron transfer reactions of trHb-Bs were electrochemically studied in solution and at graphite electrodes. Spectrophotometrical potentiometric titration and direct electrochemical measurements gave a heme iron redox potential of −103 ± 4 mV and −108 ± 2 mV vs. NHE, at pH 7, respectively. The redox potential of the heme in trHb-Bs shifted −59 mV per pH unit at pH higher than 7, consistently with a 1e − /1 H + – transfer reaction. The heterogeneous rate constant k s for a quasi-reversible 1e − – 1H + – transfer reaction between graphite and trHb-Bs was 10.1 ± 2.3 s −1 . Upon reversible cyanide binding the k s doubled, while the redox potential of heme shifted 21 mV negatively, presumably reflecting changes in redox activity and in vivo signaling functions of trHb-Bs associated with ligand binding. Bioelectrocatalytic reduction of O 2 catalyzed by trHb-Bs was one of the most efficient hitherto reported for Hbs, with an apparent catalytic rate constant, k cat , of 56 ± 6 s −1 . The results obtained are of particular interest for applications of trHb in environmental biosensing and toxicity screening

‘Picking People to Hate’: Reversible reversals in stand-up comedy

DEFF Research Database (Denmark)

Keisalo, Marianna Päivikki

2017-01-01

Generally speaking, ritual reversals mean switching to the opposite of what is considered ‘the normal order’. Such reversals can occur, for example, in terms of social hierarchies in rites of passage, in action in carnival, or in the framing of action as ritual or performance. For comedic figures...... cultural grounds and show how the study of comedic performance can offer insights into the semiotics of performance more broadly....

Periodicity and Immortality in Reversible Computing

OpenAIRE

Kari , Jarkko; Ollinger , Nicolas

2008-01-01

Additional material available on the web at http://www.lif.univ-mrs.fr/~nollinge/rec/gnirut/; We investigate the decidability of the periodicity and the immortality problems in three models of reversible computation: reversible counter machines, reversible Turing machines and reversible one-dimensional cellular automata. Immortality and periodicity are properties that describe the behavior of the model starting from arbitrary initial configurations: immortality is the property of having at le...

The chemical foundations of nitroalkene fatty acid signaling through addition reactions with thiols.

Science.gov (United States)

Turell, Lucía; Steglich, Martina; Alvarez, Beatriz

2018-03-22

Nitroalkene fatty acids can be formed in vivo and administered exogenously. They exert pleiotropic signaling actions with cytoprotective and antiinflammatory effects. The presence of the potent electron withdrawing nitro group confers electrophilicity to the adjacent β-carbon. Thiols (precisely, thiolates) are strong nucleophiles and can react with nitroalkene fatty acids through reversible Michael addition reactions. In addition, nitroalkene fatty acids can undergo several other processes including metabolic oxidation, reduction, esterification, nitric oxide release and partition into hydrophobic compartments. The signaling actions of nitroalkenes are mainly mediated by reactions with critical thiols in regulatory proteins. Thus, the thio-Michael addition reaction provides a framework for understanding the molecular basis of the biological effects of nitroalkene fatty acids at the crossroads of thiol signaling and electrophilic lipid signaling. In this review, we describe the reactions of nitroalkene fatty acids in biological contexts. We focus on the Michael addition-elimination reaction with thiols and its mechanism, and extrapolate kinetic and thermodynamic considerations to in vivo settings. Copyright © 2018 Elsevier Inc. All rights reserved.

Pyrovanadolysis, a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate, Mn2+, and DNA Polymerase of Bacteriophage T7

NARCIS (Netherlands)

Akabayov, Barak; Kulczyk, Arkadiusz W.; Akabayov, Sabine R.; Theile, Christopher; McLaughlin, Larry W.; Beauchamp, Benjamin; van Oijen, Antoine M.; Richardson, Charles C.

2011-01-01

DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PPi). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry

Sensitive typing of reverse ABO blood groups with a waveguide-mode sensor.

Science.gov (United States)

Uno, Shigeyuki; Tanaka, Torahiko; Ashiba, Hiroki; Fujimaki, Makoto; Tanaka, Mutsuo; Hatta, Yoshihiro; Takei, Masami; Awazu, Koichi; Makishima, Makoto

2018-07-01

Portable, on-site blood typing methods will help provide life-saving blood transfusions to patients during an emergency or natural calamity, such as significant earthquakes. We have previously developed waveguide-mode (WM) sensors for forward ABO and Rh(D) blood typing and detection of antibodies against hepatitis B virus and hepatitis C virus. In this study, we evaluated a WM-sensor for reverse ABO blood typing. Since reverse ABO blood typing is a method for detection of antibodies against type A and type B oligosaccharide antigens on the surface of red blood cells (RBCs), we fixed a synthetic type A or type B trisaccharide antigen on the sensor chip of the WM sensor. We obtained significant changes in the reflectance spectra from a WM sensor on type A antigen with type B plasma and type O plasma and on type B antigen with type A plasma and type O plasma, and no spectrum changes on type A antigen or type B antigen with type AB plasma. Signal enhancement with the addition of a peroxidase reaction failed to increase the sensitivity for detection on oligosaccharide chips. By utilizing hemagglutination detection using regent type A and type B RBCs, we successfully determined reverse ABO blood groups with higher sensitivity compared to a method using oligosaccharide antigens. Thus, functionality of a portable device utilizing a WM sensor can be expanded to include reverse ABO blood typing and, in combination with forward ABO typing and antivirus antibody detection, may be useful for on-site blood testing in emergency settings. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

MODELS OF PROJECT REVERSE ENGINEERING

Directory of Open Access Journals (Sweden)

Віктор Володимирович ІВАНОВ

2017-03-01

Full Text Available Reverse engineering decided important scientific and technical problems of increasing the cost of the existing technical product by transforming it into a product with other features or design. Search ideas of the new application of existing products on the base of heuristic analysis were created. The concept of reverse engineering and its division into three types: conceptual, aggregate and complete was expanded. The use of heuristic methods for reverse engineering concept was showed. The modification model of Reverse engineering based on the model of РМВОК was developed. Our model includes two new phases: identification and transformation. At the identification phase, technical control is made. At the transformation phase, search heuristic idea of the new applied existing technical product was made. The model of execution phase that included heuristic methods, metrological equipment, and CAD/CAM/CAE program complex was created. The model that connected economic indicators of reverse engineering project was developed.

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

Science.gov (United States)

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

Garbage collection for reversible functional languages

DEFF Research Database (Denmark)

Mogensen, Torben Ægidius

2015-01-01

Reversible languages are programming languages where all programs can run both forwards and backwards. Reversible functional languages have been proposed that use symmetric pattern matching and data construction. To be reversible, these languages require linearity: Every variable must be used...

An improved stochastic algorithm for temperature-dependent homogeneous gas phase reactions

CERN Document Server

Kraft, M

2003-01-01

We propose an improved stochastic algorithm for temperature-dependent homogeneous gas phase reactions. By combining forward and reverse reaction rates, a significant gain in computational efficiency is achieved. Two modifications of modelling the temperature dependence (with and without conservation of enthalpy) are introduced and studied quantitatively. The algorithm is tested for the combustion of n-heptane, which is a reference fuel component for internal combustion engines. The convergence of the algorithm is studied by a series of numerical experiments and the computational cost of the stochastic algorithm is compared with the DAE code DASSL. If less accuracy is needed the stochastic algorithm is faster on short simulation time intervals. The new stochastic algorithm is significantly faster than the original direct simulation algorithm in all cases considered.

END-OF-USE PRODUCTS IN REVERSE LOGISTICS

OpenAIRE

Marta Starostka-Patyk

2007-01-01

Reverse logistics is a very useful tool for enterprises which have to deal with end-of-use products. Forward logistics is not able to manage them, because they show up on the beginning of reverse supply chain. That is the reason for growing importance of reverse flows. Reverse logistics is quite new logistics system. This paper presents the idea of reverse logistics and end-of-use products problems.

Tin and tin-titanium as catalyst components for reversible hydrogen storage of sodium aluminium hydride

Energy Technology Data Exchange (ETDEWEB)

Qi Jia Fu; Shik Chi Tsang [University of Reading, Reading (United Kingdom). Surface and Catalysis Research Centre, School of Chemistry

2006-10-15

This paper is concerned with the effects of adding tin and/or titanium dopant to sodium aluminium hydride for both dehydrogenation and re-hydrogenation reactions during their reversible storage of molecular hydrogen. Temperature programmed decomposition (TPD) measurements show that the dehydrogenation kinetics of NaAlH{sub 4} are significantly enhanced upon doping the material with 2 mol% of tributyltin hydride, Sn(Bu)3H but the tin catalyst dopant is shown to be inferior than titanium. On the other hand, in this preliminary work, a significant synergetic catalytic effect is clearly revealed in material co-doped with both titanium and tin catalysts which shows the highest reversible rates of dehydrogenation and re-hydrogenation (after their hydrogen depletion). The re-hydrogenation rates of depleted Sn/Ti/NaAlH{sub 4} evaluated at both 9.5 and 140 bars hydrogen are also found to be favourable compared to the Ti/NaAlH{sub 4}, which clearly suggest the importance of the catalyst choice. Basing on these results some mechanistic insights for the catalytic reversible dehydrogenation and re-hydrogenation processes of Sn/Ti/NaAlH{sub 4} are therefore made. 31 refs., 8 figs., 2 tabs.

Phosphopeptide Enrichment by Covalent Chromatography after Derivatization of Protein Digests Immobilized on Reversed-Phase Supports

Science.gov (United States)

Nika, Heinz; Nieves, Edward; Hawke, David H.; Angeletti, Ruth Hogue

2013-01-01

A rugged sample-preparation method for comprehensive affinity enrichment of phosphopeptides from protein digests has been developed. The method uses a series of chemical reactions to incorporate efficiently and specifically a thiol-functionalized affinity tag into the analyte by barium hydroxide catalyzed β-elimination with Michael addition using 2-aminoethanethiol as nucleophile and subsequent thiolation of the resulting amino group with sulfosuccinimidyl-2-(biotinamido) ethyl-1,3-dithiopropionate. Gentle oxidation of cysteine residues, followed by acetylation of α- and ε-amino groups before these reactions, ensured selectivity of reversible capture of the modified phosphopeptides by covalent chromatography on activated thiol sepharose. The use of C18 reversed-phase supports as a miniaturized reaction bed facilitated optimization of the individual modification steps for throughput and completeness of derivatization. Reagents were exchanged directly on the supports, eliminating sample transfer between the reaction steps and thus, allowing the immobilized analyte to be carried through the multistep reaction scheme with minimal sample loss. The use of this sample-preparation method for phosphopeptide enrichment was demonstrated with low-level amounts of in-gel-digested protein. As applied to tryptic digests of α-S1- and β-casein, the method enabled the enrichment and detection of the phosphorylated peptides contained in the mixture, including the tetraphosphorylated species of β-casein, which has escaped chemical procedures reported previously. The isolates proved highly suitable for mapping the sites of phosphorylation by collisionally induced dissociation. β-Elimination, with consecutive Michael addition, expanded the use of the solid-phase-based enrichment strategy to phosphothreonyl peptides and to phosphoseryl/phosphothreonyl peptides derived from proline-directed kinase substrates and to their O-sulfono- and O-linked β-N-acetylglucosamine (O

Reversal of subtidal dune asymmetries caused by seasonally reversing wind-driven currents in Torres Strait, northeastern Australia

Science.gov (United States)

Harris, Peter T.

1991-07-01

Large subtidal sand dunes (sandwaves) located in Adolphus Channel, Torres Strait, have been observed to reverse their asymmetric orientation between September-February. This has been attributed to a reversal in wind-driven currents, which flow westward during the SE trade season (April-November) and eastwards during the NW monsoon season [December-March: HARRIS (1989) Continental Shelf Research, 9, 981-1002]. Observations in September 1988 and February 1989 from another area of dunes in Torres Strait corroborate this asymmetry reversal pattern. The results indicate that such reversals may be common in Torres Strait and in other areas where subtidal bedforms are subject to modification by superimposed, seasonally reversing, wind-driven currents.

Lewis acid tuned facial stereodivergent HDA reactions using beta-substituted N-vinyloxazolidinones.

Science.gov (United States)

Gohier, Frédéric; Bouhadjera, Keltoum; Faye, Djibril; Gaulon, Catherine; Maisonneuve, Vincent; Dujardin, Gilles; Dhal, Robert

2007-01-18

The [4 + 2] acido-catalyzed heterocycloaddition between new beta-substituted N-vinyl-1,3-oxazolidin-2-ones (with R' = Me, Ar, CH2 Ar) and beta,gamma-unsaturated alpha-ketoesters (R = Ar) afforded heteroadducts with high levels of endo and facial selectivities. A complete reversal of facial differentiation was achieved by varying the Lewis acid, leading to the stereoselective formation of either endo-alpha or endo-beta adducts. [reaction: see text].

A Singular Perturbation Problem for Steady State Conversion of Methane Oxidation in Reverse Flow Reactor

Directory of Open Access Journals (Sweden)

Aang Nuryaman

2012-11-01

Full Text Available The governing equations describing the methane oxidation process in reverse flow reactor are given by a set of convective-diffusion equations with a nonlinear reaction term, where temperature and methane conversion are dependent variables. In this study, the process is assumed to be one-dimensional pseudo homogeneous model and takes place with a certain reaction rate in which the whole process of reactor is still workable. Thus, the reaction rate can proceed at a fixed temperature. Under this condition, we restrict ourselves to solve the equations for the conversion only. From the available data, it turns out that the ratio of the diffusion term to the reaction term is small. Hence, this ratio is considered as small parameter in our model and this leads to a singular perturbation problem. In the vicinity of small parameter in front of higher order term, the numerical difficulties will be found. Here, we present an analytical solution by means of matched asymptotic expansions. Result shows that, up to and including the first order of approximation, the solution is in agreement with the exact and numerical solutions of the boundary value problem.

Magnetic reversals from planetary dynamo waves.

Science.gov (United States)

Sheyko, Andrey; Finlay, Christopher C; Jackson, Andrew

2016-11-24

A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a magnetohydrodynamic process that takes place in Earth's core, but the precise mechanism is debated. The majority of numerical geodynamo simulations that exhibit reversals operate in a regime in which the viscosity of the fluid remains important, and in which the dynamo mechanism primarily involves stretching and twisting of field lines by columnar convection. Here we present an example of another class of reversing-geodynamo model, which operates in a regime of comparatively low viscosity and high magnetic diffusivity. This class does not fit into the paradigm of reversal regimes that are dictated by the value of the local Rossby number (the ratio of advection to Coriolis force). Instead, stretching of the magnetic field by a strong shear in the east-west flow near the imaginary cylinder just touching the inner core and parallel to the axis of rotation is crucial to the reversal mechanism in our models, which involves a process akin to kinematic dynamo waves. Because our results are relevant in a regime of low viscosity and high magnetic diffusivity, and with geophysically appropriate boundary conditions, this form of dynamo wave may also be involved in geomagnetic reversals.

Multiple reversal olfactory learning in honeybees

Directory of Open Access Journals (Sweden)

Theo Mota

2010-07-01

Full Text Available In multiple reversal learning, animals trained to discriminate a reinforced from a non-reinforced stimulus are subjected to various, successive reversals of stimulus contingencies (e.g. A+ vs. B-, A- vs. B+, A+ vs. B-. This protocol is useful to determine whether or not animals learn to learn and solve successive discriminations faster (or with fewer errors with increasing reversal experience. Here we used the olfactory conditioning of proboscis extension reflex to study how honeybees Apis mellifera perform in a multiple reversal task. Our experiment contemplated four consecutive differential conditioning phases involving the same odors (A+ vs. B- to A- vs. B+ to A+ vs. B- to A- vs. B+. We show that bees in which the weight of reinforced or non-reinforced stimuli was similar mastered the multiple olfactory reversals. Bees which failed the task exhibited asymmetric responses to reinforced and non-reinforced stimuli, thus being unable to rapidly reverse stimulus contingencies. Efficient reversers did not improve their successive discriminations but rather tended to generalize their choice to both odors at the end of conditioning. As a consequence, both discrimination and reversal efficiency decreasedalong experimental phases. This result invalidates a learning-to-learn effect and indicates that bees do not only respond to the actual stimulus contingencies but rather combine these with an average of past experiences with the same stimuli.  

Antiphase dual-color correlation in a reactant-product pair imparts ultrasensitivity in reaction-linked double-photoswitching fluorescence imaging.

Science.gov (United States)

Wan, Wei; Zhu, Ming-Qiang; Tian, Zhiyuan; Li, Alexander D Q

2015-04-08

A pair of reversible photochemical reactions correlates their reactant and product specifically, and such a correlation uniquely distinguishes their correlated signal from others that are not linked by this reversible reaction. Here a nanoparticle-shielded fluorophore is photodriven to undergo structural dynamics, alternating between a green-fluorescence state and a red-fluorescence state. As time elapses, the fluorophore can be in either state but not both at the same time. Thus, the red fluorescence is maximized while the green fluorescence is minimized and vice versa. Such an antiphase dual-color (AD) corelationship between the red and green fluorescence maxima as well as between their minima can be exploited to greatly improve the signal-to-noise ratio, thus enhancing the ultimate detection limit. Potential benefits of this correlation include elimination of all interferences originating from single-color dyes and signal amplification of AD photoswitching molecules by orders of magnitude.

Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

Science.gov (United States)

Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

2016-01-01

Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

Nasal reaction to changes in whole body temperature.

Science.gov (United States)

Lundqvist, G R; Pedersen, O F; Hilberg, O; Nielsen, B

1993-11-01

The changes in nasal patency following a 1.5 degrees C decrease or increase in whole body temperature were measured in 8 healthy young males, during and after 30 min of immersion in a 15 degrees C cold or a 40 degrees C warm bath, breathing air at the same temperature, in a cross-over experimental design. The nasal reactions were traced by consecutive measurements of changes in nasal cavity volumes by acoustic rhinometry. Swelling of the mucosa during cooling and an almost maximal shrinkage of the mucosa during heating were indicated by respectively a decrease and an increase in nasal cavity volumes. The reactions were determined predominantly by the whole body thermal balance, but were also influenced by the temperature of the inhaled air, either enhanced, reduced or temporarily reversed. The greatest change occurred in the nasal cavity, left or right, which differed most from the final state at the beginning of exposure due to the actual state of nasal cycle.

Colour break in reverse bicolour daffodils is associated with the presence of Narcissus mosaic virus

Directory of Open Access Journals (Sweden)

Davies Kevin M

2011-08-01

Full Text Available Abstract Background Daffodils (Narcissus pseudonarcissus are one of the world's most popular ornamentals. They also provide a scientific model for studying the carotenoid pigments responsible for their yellow and orange flower colours. In reverse bicolour daffodils, the yellow flower trumpet fades to white with age. The flowers of this type of daffodil are particularly prone to colour break whereby, upon opening, the yellow colour of the perianth is observed to be 'broken' into patches of white. This colour break symptom is characteristic of potyviral infections in other ornamentals such as tulips whose colour break is due to alterations in the presence of anthocyanins. However, reverse bicolour flowers displaying colour break show no other virus-like symptoms such as leaf mottling or plant stunting, leading some to argue that the carotenoid-based colour breaking in reverse bicolour flowers may not be caused by virus infection. Results Although potyviruses have been reported to cause colour break in other flower species, enzyme-linked-immunoassays with an antibody specific to the potyviral family showed that potyviruses were not responsible for the occurrence of colour break in reverse bicolour daffodils. Colour break in this type of daffodil was clearly associated with the presence of large quantities of rod-shaped viral particles of lengths 502-580 nm in tepals. Sap from flowers displaying colour break caused red necrotic lesions on Gomphrena globosa, suggesting the presence of potexvirus. Red necrotic lesions were not observed in this indicator plant when sap from reverse bicolour flowers not showing colour break was used. The reverse transcriptase polymerase reactions using degenerate primers to carla-, potex- and poty-viruses linked viral RNA with colour break and sequencing of the amplified products indicated that the potexvirus Narcissisus mosaic virus was the predominant virus associated with the occurrence of the colour break

Reversibility: An Engineer's Point of View

Energy Technology Data Exchange (ETDEWEB)

Berest, Pierre [LMS, ecole Polytechnique (France)

2012-07-01

Reversibility is the most consistent option in a democratic country. However reversibility may also have several drawbacks which must be identified and mitigated. Reversibility of a geological repository is a relatively new idea in France. The 1991 law dedicated to nuclear waste management considered reversibility as a possible option. Fifteen years later, the 2006 law mandated that a deep repository must be reversible and that the exact content of this notion should be defined by a new law to be discussed by the Parliament in 2015. Reversibility was not a concern put forward by engineers. It clearly originated from a societal demand sponsored and formulated by the Parliament. Since 1991, the exact meaning of this mandate progressively became more precise. In the early days, reversibility meant the technical and financial capability to retrieve the wastes from the repository, at least for some period of time after being emplaced. Progressively, a broader definition, suggested by Andra, was accepted: reversibility also means that a disposal facility should be operated in such a way that a stepwise decision-making process is possible. At each step, society must be able to decide to proceed to the next step, to pause or to reverse a step. Several benefits can be expected from a reversible repository. Some technical safety concerns may be only recognised after waste emplacement. Radioactive wastes may become a resource whose recoverability is desirable. Regulations may change, alternative waste treatment or better disposal techniques may be developed, or the need to modify a component of the facility may arise. Looking back at how chemical or domestic wastes were managed some 50 years ago easily underscores that it is not unreasonable to hope for significant advances in the future. For scientists and engineers, reversibility proves to have several other merits. To design and build a good repository, time is needed. The operator of a mine or of an oil field knows that

Phosphorus-31 NMR magnetization transfer measurements of metabolic reaction rates in the rat heart and kidney in vivo

International Nuclear Information System (INIS)

Koretsky, A.P.

1984-01-01

31 P NMR is a unique tool to study bioenergetics in living cells. The application of magnetization transfer techniques to the measurement of steady-state enzyme reaction rates provides a new approach to understanding the regulation of high energy phosphate metabolism. This dissertation is concerned with the measurement of the rates of ATP synthesis in the rat kidney and of the creatine kinase catalyzed reaction in the rat heart in situ. The theoretical considerations of applying magnetization transfer techniques to intact organs are discussed with emphasis on the problems associated with multiple exchange reactions and compartmentation of reactants. Experimental measurements of the ATP synthesis rate were compared to whole kidney oxygen consumption and Na + reabsorption rates to derive ATP/O values. The problems associated with ATP synthesis rate measurements in kidney, e.g. the heterogeneity of the inorganic phosphate resonance, are discussed and experiments to overcome these problems proposed. In heart, the forward rate through creatine kinase was measured to be larger than the reverse rate. To account for the difference in forward and reverse rates a model is proposed based on the compartmentation of a small pool of ATP

Highly Reversible Lithium-ions Storage of Molybdenum Dioxide Nanoplates for High Power Lithium-ion Batteries.

Science.gov (United States)

Liu, Xiaolin; Yang, Jun; Hou, Wenhua; Wang, Jiulin; Nuli, Yanna

2015-08-24

Herein, MoO2 nanoplates have been facilely prepared through a hydrothermal process by using MoO3 microbelts as the intercalation host. The obtained MoO2 nanoplates manifest excellent electrochemical properties when the discharge cutoff voltage is simply set at 1.0 V to preclude the occurrence of conversion reactions. Its initial reversible capacity reaches 251 mAh g(-1), which is larger than that of Li4Ti5O12 , at a current rate of 0.2 C. The average capacity decay is only 0.0465 mAh g(-1) per cycle, with a coulombic efficiency of 99.5% (from the 50th cycle onward) for 2000 cycles at 1 C. Moreover, this MoO2 electrode demonstrates an outstanding high power performance. When the current rate is increased from 0.2 to 50 C, about 54% of the capacity is retained. The superior electrochemical performance can be attributed to the metallic conductivity of MoO2, short Li(+) diffusion distance in the nanoplates, and reversible crystalline phase conversion of the addition-type reaction of MoO2. The prepared MoO2 nanoplates may hopefully replace their currently used analogues, such as Li4Ti5O12 , in high power lithium-ion batteries. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reversible and non-reversible enlargement of cerebral spinal fluid spaces in anorexia nervosa

International Nuclear Information System (INIS)

Artmann, H.; Grau, H.; Adelmann, M.; Schleiffer, R.

1985-01-01

Brain CT studies of 35 patients with anoxia nervosa confirmed the observations of other authors: cerebral dystrophic changes correlate with weight loss and the reversibility of these changes also correlates with the normalization of body weight. Other corroborated facts are: the most numerous and most pronounced enlargements are of the cortical sulci and the interhemispheric fissure, moderate widening affects the ventricles and the rarest and most insignificant changes are those of the cerebellum. The reversibility of the changes showed a parallel to the extent of the changes themselves and to the duration of improvement of the body weight. The reversibility of the enlargement of the cortical sulci and of the distances between the frontal horns of the lateral ventricles was more often significant than that of the abnormal measurements of the cella media. This difference is based on minimal early acquired brain damage which occurs in 60% of our patients. This high incidence of early acquired minimal brain disease in patients with anorexia nervosa is here discussed as a nonspecific predisposing factor. Although there is no exact explanation of the etiology of the reversible enlargement of cerenral spinal fluid (CSF) spaces in anorexia nervosa, the changes resemble those in alcoholics. The mechanisms of brain changes in alcoholism, as shown experimentally, seem to us to throw light on the probable mechanism of reversible dystrophic brain changes in anorexia nervosa. (orig.)

Reversible and non-reversible enlargement of cerebral spinal fluid spaces in anorexia nervosa

Energy Technology Data Exchange (ETDEWEB)

Artmann, H.; Grau, H.; Adelmann, M.; Schleiffer, R.

1985-07-01

Brain CT studies of 35 patients with anoxia nervosa confirmed the observations of other authors: cerebral dystrophic changes correlate with weight loss and the reversibility of these changes also correlates with the normalization of body weight. Other corroborated facts are: the most numerous and most pronounced enlargements are of the cortical sulci and the interhemispheric fissure, moderate widening affects the ventricles and the rarest and most insignificant changes are those of the cerebellum. The reversibility of the changes showed a parallel to the extent of the changes themselves and to the duration of improvement of the body weight. The reversibility of the enlargement of the cortical sulci and of the distances between the frontal horns of the lateral ventricles was more often significant than that of the abnormal measurements of the cella media. This difference is based on minimal early acquired brain damage which occurs in 60% of our patients. This high incidence of early acquired minimal brain disease in patients with anorexia nervosa is here discussed as a nonspecific predisposing factor. Although there is no exact explanation of the etiology of the reversible enlargement of cerenral spinal fluid (CSF) spaces in anorexia nervosa, the changes resemble those in alcoholics. The mechanisms of brain changes in alcoholism, as shown experimentally, seem to us to throw light on the probable mechanism of reversible dystrophic brain changes in anorexia nervosa.

Neutral Red and Ferroin as Reversible and Rapid Redox Materials for Redox Flow Batteries.

Science.gov (United States)

Hong, Jeehoon; Kim, Ketack

2018-04-17

Neutral red and ferroin are used as redox indicators (RINs) in potentiometric titrations. The rapid response and reversibility that are prerequisites for RINs are also desirable properties for the active materials in redox flow batteries (RFBs). This study describes the electrochemical properties of ferroin and neutral red as a redox pair. The rapid reaction rates of the RINs allow a cell to run at a rate of 4 C with 89 % capacity retention after the 100 th  cycle. The diffusion coefficients, electrode reaction rates, and solubilities of the RINs were determined. The electron-transfer rate constants of ferroin and neutral red are 0.11 and 0.027 cm s -1 , respectively, which are greater than those of the components of all-vanadium and Zn/Br 2 cells. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reversal agents in anaesthesia and critical care

Directory of Open Access Journals (Sweden)

Nibedita Pani

2015-01-01

Full Text Available Despite the advent of short and ultra-short acting drugs, an in-depth knowledge of the reversal agents used is a necessity for any anaesthesiologist. Reversal agents are defined as any drug used to reverse the effects of anaesthetics, narcotics or potentially toxic agents. The controversy on the routine reversal of neuromuscular blockade still exists. The advent of newer reversal agents like sugammadex have made the use of steroidal neuromuscular blockers like rocuronium feasible in rapid sequence induction situations. We made a review of the older reversal agents and those still under investigation for drugs that are regularly used in our anaesthesia practice.

Thermodynamic properties of an extremely rapid protein folding reaction.

Science.gov (United States)

Schindler, T; Schmid, F X

1996-12-24

The cold-shock protein CspB from Bacillus subtilis is a very small beta-barrel protein, which folds with a time constant of 1 ms (at 25 degrees C) in a U reversible N two-state reaction. To elucidate the energetics of this extremely fast reaction we investigated the folding kinetics of CspB as a function of both temperature and denaturant concentration between 2 and 45 degrees C and between 1 and 8 M urea. Under all these conditions unfolding and refolding were reversible monoexponential reactions. By using transition state theory, data from 327 kinetic curves were jointly analyzed to determine the thermodynamic activation parameters delta H H2O++, delta S H2O++, delta G H2O++, and delta C p H2O++ for unfolding and refolding and their dependences on the urea concentration. 90% of the total change in heat capacity and 96% of the change in the m value (m = d delta G/d[urea]) occur between the unfolded state and the activated state. This suggests that for CspB the activated state of folding is unusually well structured and almost equivalent to the native protein in its interactions with the solvent. As a consequence of this native-like activated state a strong temperature-dependent enthalpy/entropy compensation is observed for the refolding kinetics, and the barrier to refolding shifts from being largely enthalpic at low temperature to largely entropic at high temperature. This shift originates not from the changes in the folding protein chains itself, but from the changes in the protein-solvent interactions. We speculate that the absence of intermediates and the native-like activated state in the folding of CspB are correlated with the small size and the structural type of this protein. The stabilization of a small beta-sheet as in CspB requires extensive non-local interactions, and therefore incomplete sheets are unstable. As a consequence, the critical activated state is reached only very late in folding. The instability of partially folded structure is a means to

The misconception of mean-reversion

International Nuclear Information System (INIS)

Eliazar, Iddo I; Cohen, Morrel H

2012-01-01

The notion of random motion in a potential well is elemental in the physical sciences and beyond. Quantitatively, this notion is described by reverting diffusions—asymptotically stationary diffusion processes which are simultaneously (i) driven toward a reversion level by a deterministic force, and (ii) perturbed off the reversion level by a random white noise. The archetypal example of reverting diffusions is the Ornstein–Uhlenbeck process, which is mean-reverting. In this paper we analyze reverting diffusions and establish that: (i) if the magnitude of the perturbing noise is constant then the diffusion's stationary density is unimodal and the diffusion is mode-reverting; (ii) if the magnitude of the perturbing noise is non-constant then, in general, neither is the diffusion's stationary density unimodal, nor is the diffusion mode-reverting. In the latter case we further establish a result asserting when unimodality and mode-reversion do hold. In particular, we demonstrate that the notion of mean-reversion, which is fundamental in economics and finance, is a misconception—as mean-reversion is an exception rather than the norm. (fast track communication)

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

Science.gov (United States)

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Parkinson’s disease managing reversible neurodegeneration

Science.gov (United States)

Hinz, Marty; Stein, Alvin; Cole, Ted; McDougall, Beth; Westaway, Mark

2016-01-01

Traditionally, the Parkinson’s disease (PD) symptom course has been classified as an irreversible progressive neurodegenerative disease. This paper documents 29 PD and treatment-induced systemic depletion etiologies which cause and/or exacerbate the seven novel primary relative nutritional deficiencies associated with PD. These reversible relative nutritional deficiencies (RNDs) may facilitate and accelerate irreversible progressive neurodegeneration, while other reversible RNDs may induce previously undocumented reversible pseudo-neurodegeneration that is hiding in plain sight since the symptoms are identical to the symptoms being experienced by the PD patient. Documented herein is a novel nutritional approach for reversible processes management which may slow or halt irreversible progressive neurodegenerative disease and correct reversible RNDs whose symptoms are identical to the patient’s PD symptoms. PMID:27103805

Sorption properties and reversibility of Ti(IV) and Nb(V)-fluoride doped-Ca(BH4)2-MgH2 system

International Nuclear Information System (INIS)

Bonatto Minella, Christian; Garroni, Sebastiano; Pistidda, Claudio; Baró, Maria Dolors; Gutfleisch, Oliver; Klassen, Thomas; Dornheim, Martin

2015-01-01

Highlights: • Faster desorption reaction for doped materials vs. the pure composite system. • Kinetic improvement concerning re-hydrogenation reaction showed by the addition of NbF 5 . • Full characterization of the de-hydrogenation reaction pathway by means of both SR-PXD and 11 B{ 1 H} MAS-NMR. • Study of the evolution of the chemical state of the additives upon both milling and sorption reactions. - Abstract: In the last decade, alkaline and alkaline earth metal tetrahydroborates have been the focuses of the research due to their high gravimetric and volumetric hydrogen densities. Among them, Ca(BH 4 ) 2 and the Ca(BH 4 ) 2 + MgH 2 reactive hydride composites (RHC), were calculated to have the ideal thermodynamic properties which fall within the optimal range for mobile applications. In this study, the addition of NbF 5 or TiF 4 to the Ca(BH 4 ) 2 + MgH 2 reactive hydride composite system was attempted aiming to obtain a full reversible system with the simultaneous suppression of CaB 12 H 12 . Structural characterization of the specimens was performed by means of in-situ Synchrotron Radiation Powder X-ray diffraction (SR-PXD) and 11 B{ 1 H} Solid State Magic Angle Spinning-Nuclear Magnetic Resonance (MAS-NMR). The evolution of the chemical state of the Nb- and Ti-based additives was monitored by X-ray Absorption Near Edge Structure (XANES). The addition of NbF 5 or TiF 4 to the Ca(BH 4 ) 2 + MgH 2 system have not suppressed completely the formation of CaB 12 H 12 and only a slight improvement concerning the reversible reaction was displayed just in the case of Nb-doped composite material

Reversible machine code and its abstract processor architecture

DEFF Research Database (Denmark)

Axelsen, Holger Bock; Glück, Robert; Yokoyama, Tetsuo

2007-01-01

A reversible abstract machine architecture and its reversible machine code are presented and formalized. For machine code to be reversible, both the underlying control logic and each instruction must be reversible. A general class of machine instruction sets was proven to be reversible, building...

A Typology of Reverse Innovation

DEFF Research Database (Denmark)

von Zedtwitz, Max; Corsi, Simone; Søberg, Peder Veng

2015-01-01

secondary market introduction, this study expands the espoused definition of reverse innovation beyond its market-introduction focus with reversals in the flow of innovation in the ideation and product development phases. Recognizing that each phase can take place in different geographical locations...... taking place in an emerging country. This analytical framework allows recasting of current research at the intersection between innovation and international business. Of the 10 reverse innovation flows, six are new and have not been covered in the literature to date. The study addresses questions......’s portfolio of global innovation competence and capability. The implications for management are concerned with internal and external resistance to reverse innovation. Most significantly, while greater recognition and power of innovation in formerly subordinate organizational units is inconvenient to some...

Elements of a Reversible Object-Oriented Language

DEFF Research Database (Denmark)

Schultz, Ulrik Pagh; Axelsen, Holger Bock

2016-01-01

This paper presents initial ideas for the design and implementation of a reversible object-oriented language based on extending Janus with object-oriented concepts such as classes that encapsulate behavior and state, inheritance, virtual dispatching, as well as constructors. We show that virtual...... dispatching is a reversible decision mechanism easily translatable to a standard reversible programming model such as Janus, and we argue that reversible management of state can be accomplished using reversible constructors. The language is implemented in terms of translation to standard Janus programs....

Rapidly reversible redox transformation in nanophase manganese oxides at room temperature triggered by changes in hydration.

Science.gov (United States)

Birkner, Nancy; Navrotsky, Alexandra

2014-04-29

Chemisorption of water onto anhydrous nanophase manganese oxide surfaces promotes rapidly reversible redox phase changes as confirmed by calorimetry, X-ray diffraction, and titration for manganese average oxidation state. Surface reduction of bixbyite (Mn2O3) to hausmannite (Mn3O4) occurs in nanoparticles under conditions where no such reactions are seen or expected on grounds of bulk thermodynamics in coarse-grained materials. Additionally, transformation does not occur on nanosurfaces passivated by at least 2% coverage of what is likely an amorphous manganese oxide layer. The transformation is due to thermodynamic control arising from differences in surface energies of the two phases (Mn2O3 and Mn3O4) under wet and dry conditions. Such reversible and rapid transformation near room temperature may affect the behavior of manganese oxides in technological applications and in geologic and environmental settings.

Novel bio-electro-Fenton technology for azo dye wastewater treatment using microbial reverse-electrodialysis electrolysis cell

DEFF Research Database (Denmark)

Li, Xiaohu; Jin, Xiangdan; Zhao, Nannan

2017-01-01

Development of sustanaible technologies for treatment of azo dyes containing wastewaters has long been of great interest. In this study, we proposed an innovative concept of using microbial reverse-electrodialysis electrolysis cell (MREC) based Fenton process to treat azo dye wastewater. In such ......Development of sustanaible technologies for treatment of azo dyes containing wastewaters has long been of great interest. In this study, we proposed an innovative concept of using microbial reverse-electrodialysis electrolysis cell (MREC) based Fenton process to treat azo dye wastewater....... In such MREC-Fenton integrated process, the production of H2O2 which is the key reactant of fenton-reaction was driven by the electrons harvested from the exoelectrogens and salinity-gradient between sea water and fresh water in MREC. Complete decolorization and mineralization of 400 mg L-1 Orange G...

Insights into the mechanisms on chemical reactions: reaction paths for chemical reactions

International Nuclear Information System (INIS)

Dunning, T.H. Jr.; Rosen, E.; Eades, R.A.

1987-01-01

We report reaction paths for two prototypical chemical reactions: Li + HF, an electron transfer reaction, and OH + H 2 , an abstraction reaction. In the first reaction we consider the connection between the energetic terms in the reaction path Hamiltonian and the electronic changes which occur upon reaction. In the second reaction we consider the treatment of vibrational effects in chemical reactions in the reaction path formalism. 30 refs., 9 figs

Drift reversal capability in helical systems

International Nuclear Information System (INIS)

Yokoyama, M.; Itoh, K.; Okamura, S.

2002-10-01

The maximum-J (J is the second adiabatic invariant) capability, i.e., the drift reversal capability, is examined in quasi-axisymmetric (QAS) stellarators and quasi-poloidally symmetric (QPS) stellarators as a possible mechanism for turbulent transport suppression. Due to the existence of non-axisymmetry of the magnetic field strength in QAS configurations, a local maximum of J is created to cause the drift reversal. The increase of magnetic shear in finite beta equilibria also has favorable effect in realizing the drift reversal. The radial variation of the uniform magnetic field component plays a crucial role for the drift reversal in a QPS configuration. Thus, the drift reversal capability and its external controllability are demonstrated for QAS and QPS stellarators, by which the impact of magnetic configuration on turbulent transport can be studied in experiments. (author)

Drift reversal capability in helical systems

International Nuclear Information System (INIS)