WorldWideScience

Sample records for monocytogenes virulence genes

  1. The metabolic regulator CodY links L. monocytogenes metabolism to virulence by directly activating the virulence regulatory gene, prfA

    Science.gov (United States)

    Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.

    2015-01-01

    Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920

  2. [Virulent gene prevalence of foodborne Listeria monocytogenes in China in 2005].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yun-Chang; Pei, Xiao-Yan; Liu, Xiu-Mei

    2010-12-01

    To study the virulent gene prevalence of foodborne Listeria monocytogenes (LM) isolated from China. 78 LM isolates derived from raw meat, cooked food, aquatic products and vegetables of 13 provinces and cities.LM isolates were investigated for prevalence of virulence genes (LIPI-1 (prfA, plcA, hly, mpl, actA, plcB); LIPI-2 (inlA, inlB), and iap) by PCR method. 87.2% (68/78) of the isolates were prfA positive, 98.7% (77/78) of the isolates were plcA, actA and plcB positive, 97.4% (76/78) of the isolates were hly positive, 87.2% (68/78) of the isolates were mpl positive, 92.3% (72/78) of the isolates were inlA positive, 100% (78/78) of the isolates were inlB positive, 98.7% (77/78) of the isolates were iap positive. Among 21 virulent gene negative isolates, there was 7 isolates lack of two or more virulence genes. The rate of virulence genes deletion isolates from cooked meat was 31.3% (10/32), the rate of virulence genes deletion isolates from raw meat was 16.1% (5/31), the rate of virulence genes deletion isolates from vegetables was 36.4% (4/11) and rate of virulence genes deletion isolates from seafood was 50% (2/4). No significant difference was found (χ(2) = 3.721, P > 0.05). The virulence gene array-1 strains were dominant among these isolates. Among 78 LM isolates, prevalent of virulent genes were different except inlB, virulence genes of LIP-1 were deleted prevalently among isolates, virulence gene deletion patterns were diverse.

  3. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone

    2010-01-01

    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants use......, such as antibiotic resistance....... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  4. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Science.gov (United States)

    Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

  5. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Directory of Open Access Journals (Sweden)

    Mira Rakic Martinez

    Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

  6. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

    Science.gov (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

    2017-11-01

    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  7. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

    2010-08-01

    Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

  8. The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

    Science.gov (United States)

    Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

    2018-06-13

    The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

  9. Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

    Science.gov (United States)

    Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

    2013-06-01

    The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

  10. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel

    2012-09-01

    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  11. Antimicrobial medium- and long-chain free fatty acids prevent PrfA-dependent activation of virulence genes in Listeria monocytogenes.

    Science.gov (United States)

    Sternkopf Lillebæk, Eva Maria; Lambert Nielsen, Stine; Scheel Thomasen, Rikke; Færgeman, Nils J; Kallipolitis, Birgitte H

    The foodborne pathogen Listeria monocytogenes is the causative agent of the invasive disease listeriosis. Infection by L. monocytogenes involves bacterial crossing of the intestinal barrier and intracellular replication in a variety of host cells. The PrfA protein is the master regulator of virulence factors required for bacterial entry, intracellular replication and cell-to-cell spread. PrfA-dependent activation of virulence genes occurs primarily in the blood and during intracellular infection. In contrast, PrfA does not play a significant role in regulation of virulence gene expression in the intestinal environment. In the gastrointestinal phase of infection, the bacterium encounters a variety of antimicrobial agents, including medium- and long-chain free fatty acids that are commonly found in our diet and as active components of bile. Here we show that subinhibitory concentrations of specific antimicrobial free fatty acids act to downregulate transcription of PrfA-activated virulence genes. Interestingly, the inhibitory effect is also evident in cells encoding a constitutively active variant of PrfA. Collectively, our data suggest that antimicrobial medium- and long-chain free fatty acids may act as signals to prevent PrfA-mediated activation of virulence genes in environments where PrfA activation is not required, such as in food and the gastrointestinal tract. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  12. Metabolic Genetic Screens Reveal Multidimensional Regulation of Virulence Gene Expression in Listeria monocytogenes and an Aminopeptidase That Is Critical for PrfA Protein Activation.

    Science.gov (United States)

    Friedman, Sivan; Linsky, Marika; Lobel, Lior; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A

    2017-06-01

    Listeria monocytogenes is an environmental saprophyte and intracellular bacterial pathogen. Upon invading mammalian cells, the bacterium senses abrupt changes in its metabolic environment, which are rapidly transduced to regulation of virulence gene expression. To explore the relationship between L. monocytogenes metabolism and virulence, we monitored virulence gene expression dynamics across a library of genetic mutants grown under two metabolic conditions known to activate the virulent state: charcoal-treated rich medium containing glucose-1-phosphate and minimal defined medium containing limiting concentrations of branched-chain amino acids (BCAAs). We identified over 100 distinct mutants that exhibit aberrant virulence gene expression profiles, the majority of which mapped to nonessential metabolic genes. Mutants displayed enhanced, decreased, and early and late virulence gene expression profiles, as well as persistent levels, demonstrating a high plasticity in virulence gene regulation. Among the mutants, one was noteworthy for its particularly low virulence gene expression level and mapped to an X-prolyl aminopeptidase (PepP). We show that this peptidase plays a role in posttranslational activation of the major virulence regulator, PrfA. Specifically, PepP mediates recruitment of PrfA to the cytoplasmic membrane, a step identified as critical for PrfA protein activation. This study establishes a novel step in the complex mechanism of PrfA activation and further highlights the cross regulation of metabolism and virulence. Copyright © 2017 American Society for Microbiology.

  13. Effect of co-culture with enterocinogenic E. faecium on L. monocytogenes key virulence gene expression

    Directory of Open Access Journals (Sweden)

    Eleftherios H. Drosinos

    2016-08-01

    Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.

  14. Comparative genomics analyses revealed two virulent Listeria monocytogenes strains isolated from ready-to-eat food.

    Science.gov (United States)

    Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.

  15. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

    Directory of Open Access Journals (Sweden)

    Ana Camejo

    2009-05-01

    Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

  16. Gene Transcription and Virulence Potential of Listeria monocytogenes Strains After Exposure to Acidic and NaCl Stress

    DEFF Research Database (Denmark)

    Olesen, Inger; Vogensen, Finn Kvist; Jespersen, Lene

    2009-01-01

    transcription were observed both after exposure to shock (six genes) and after long-term adaptation to stress (18 genes). In the shock experiments, a transient induction of clpC and clpE was seen for both strains, while transient induction of sigB, inlA, and inlB was observed for strain 4140 only; actA was only...... induced in EGD-e after NaCl shock. The longterm stress experiments were included to imitate the stress conditions encountered by L. monocytogenes when present in food products. Long-term adaptation of EGD-e to acidic stress induced transcription of iap and repressed flaA, while genes related to stress......Gene transcription and virulence potential of two strains of Listeria monocytogenes, EGD-e and 4140, were compared by quantitative real-time polymerase chain reaction and in a Caco-2 in vitro model after exposure to acidic (pH 5.5) and NaCl (4.5% w=v) stress. Strain-dependent differences in gene...

  17. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  18. Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

    2016-01-01

    Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  19. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop

    2017-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  20. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  1. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  2. Bifidobacterium breve IPLA20005 affects in vitro the expression of hly and luxS genes, related to the virulence of Listeria monocytogenes Lm23.

    Science.gov (United States)

    Rios-Covian, David; Nogacka, Alicja; Salazar, Nuria; Hernández-Barranco, A M; Cuesta, Isabel; Gueimonde, Miguel; de Los Reyes Gavilán, Clara G

    2018-03-01

    Mechanistic features that characterize the interaction and inhibition of the food-borne pathogen Listeria monocytogenes by members of the genus Bifidobacterium still remain unclear. In the present work, we tried to shed light on the influence that co-cultivation of L. monocytogenes with Bifidobacterium breve may exert on both microorganisms and on virulence of the pathogen. Production of acetate and lactate was measured by gas chromatography and high-performance liquid chromatography, respectively; bacterial counts were obtained by plate count; gene expression was determined by RT-qPCR; and haemolytic activity was analyzed against goat erythrocytes. We found slightly but significantly lower final counts of Listeria and Bifidobacterium (p monocytogenes cells from cocultures than in those from monocultures. In contrast, the hly and luxS genes, which code for the cytolysin listeriolysin O and participate in biofilm formation, respectively, were overexpressed when L. monocytogenes was grown in coculture. This indicates that the presence of Bifidobacterium is able to modify the gene expression and haemolytic activity of L. monocytogenes when both microorganisms grow together.

  3. How Listeria monocytogenes organizes its surface for virulence

    Science.gov (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

    2014-01-01

    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  4. The MogR Transcriptional Repressor Regulates Nonhierarchal Expression of Flagellar Motility Genes and Virulence in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Flagella are surface structures critical for motility and virulence of many bacterial species. In Listeria monocytogenes, MogR tightly represses expression of flagellin (FlaA during extracellular growth at 37 degrees C and during intracellular infection. MogR is also required for full virulence in a murine model of infection. Using in vitro and in vivo infection models, we determined that the severe virulence defect of MogR-negative bacteria is due to overexpression of FlaA. Specifically, overproduction of FlaA in MogR-negative bacteria caused pleiotropic defects in bacterial division (chaining phenotype, intracellular spread, and virulence in mice. DNA binding and microarray analyses revealed that MogR represses transcription of all known flagellar motility genes by binding directly to a minimum of two TTTT-N(5-AAAA recognition sites positioned within promoter regions such that RNA polymerase binding is occluded. Analysis of MogR protein levels demonstrated that modulation of MogR repression activity confers the temperature-specificity to flagellar motility gene expression. Epistasis analysis revealed that MogR repression of transcription is antagonized in a temperature-dependent manner by the DegU response regulator and that DegU further regulates FlaA levels through a posttranscriptional mechanism. These studies provide the first known example to our knowledge of a transcriptional repressor functioning as a master regulator controlling nonhierarchal expression of flagellar motility genes.

  5. Pregnancy - associated human listeriosis: Virulence and genotypic analysis of Listeria monocytogenes from clinical samples.

    Science.gov (United States)

    Soni, Dharmendra Kumar; Singh, Durg Vijai; Dubey, Suresh Kumar

    2015-09-01

    Listeria monocytogenes, a life-threatening pathogen, poses severe risk during pregnancy, may cause abortion, fetal death or neonatal morbidity in terms of septicemia and meningitis. The present study aimed at characterizing L. monocytogenes isolated from pregnant women based on serotyping, antibiotic susceptibility, virulence genes, in vivo pathogenicity test and ERIC- and REP-PCR fingerprint analyses. The results revealed that out of 3700 human clinical samples, a total of 30 (0.81%) isolates [12 (0.80%) from placental bit (1500), 18 (0.81%) from vaginal swab (2200)] were positive for L. monocytogenes. All the isolates belonged to serogroup 4b, and were + ve for virulence genes tested i.e. inlA, inlC, inlJ, plcA, prfA, actA, hlyA, and iap. Based on the mice inoculation tests, 20 isolates showed 100% and 4 isolates 60% relative virulence while 6 isolates were non-pathogenic. Moreover, 2 and 10 isolates were resistant to ciprofloxacin and cefoxitin, respectively, while the rest susceptible to other antibiotics used in this study. ERIC- and REP-PCR collectively depicted that the isolates from placental bit and vaginal swab had distinct PCR fingerprints except a few isolates with identical patterns. This study demonstrates prevalence of pathogenic strains mostly resistant to cefoxitin and/or ciprofloxacin. The results indicate the importance of isolating and characterizing the pathogen from human clinical samples as the pre-requisite for accurate epidemiological investigations.

  6. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  7. Genotypic and virulence characteristics of Listeria monocytogenes recovered from food items in Lebanon.

    Science.gov (United States)

    Haidar-Ahmad, Nathaline; Kissoyan, Kohar Annie B; Fadlallah, Sukayna M; El-Hajj, Rima; Saleh, Majd; Ghosn, Nada; Matar, Ghassan M

    2016-08-02

    Listeria monocytogenes is the agent of listeriosis, a life threatening foodborne disease for immunocompromised patients and pregnant women. This bacterium is not routinely screened for in Lebanon and there is lack of data about the prevalent strains and their potential pathogenicity. To that purpose, this study was undertaken to characterize L. monocytogenes from various food products, by assessing the in vitro biofilm forming ability, detecting their virulence potential, and characterizing them at the strain level. Fifty-nine isolates were obtained from the Lebanese Agriculture Research Institute (LARI). They were collected in 2012-2013 from local and imported food products in the Lebanese market. Biofilm formation was measured using the Microtiter Plate Assay. PCR amplification was performed for three main virulence genes; hly, actA, and inlB. Pulsed field gel electrophoresis (PFGE) and BIONUMERICS analysis were carried out. Lebanese isolates from cheese and raw meat showed higher biofilm formation than imported and Lebanese seafood isolates. A total of 100% of the isolates were PCR positive for hly and actA genes and 98.3% for inlB gene. PFGE analysis demonstrated the prevalence of 13 different subtypes with 100% similarity. Detected subtypes were grouped into 6 clusters of 90% genomic similarity. Clustered subtypes were particular to the country of origin. This study highlights the presence of L. monocytogenes in the Lebanese food market with high pathogenic potential and stresses the importance of enhanced surveillance and the implementation of strict regulations on local and imported food. Future investigations may be conducted on a larger food selection.

  8. Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction.

    Science.gov (United States)

    Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza

    2016-01-01

    This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

  9. Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Abazar Pournajaf

    Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

  10. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    Science.gov (United States)

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  11. Sensitivity to acetic acid, ability to colonize abiotic surfaces and virulence potential of Listeria monocytogenes EGD-e after incubation on parsley leaves.

    Science.gov (United States)

    Rieu, A; Guzzo, J; Piveteau, P

    2010-02-01

    To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.

  12. Antimicrobial Resistance, Virulence Profile, and Molecular Characterization of Listeria monocytogenes Isolated from Ready-to-eat Food in China, 2013-2014.

    Science.gov (United States)

    Yan, Shao Fei; Wang, Wei; Bai, Li; Hu, Yu Jie; Dong, Yin Ping; Xu, Jin; Li, Feng Qin

    2016-06-01

    We aimed to investigate the potential pathogenic profile and antibiotic resistance of Listeria monocytogenes isolated from ready-to-eat food in China. Antimicrobial resistance was determined by broth microdilution following the Clinical and Laboratory Standards Institute protocol. Molecular serotyping, virulence, and resistance genes were identified using PCR. Multi-locus sequence typing was performed on resistant strains. A total of 11.53% (113/980) isolates were resistant, from which 82.3% (93/113) harbored all the virulence genes tested. The resistant strains were subtyped into 18 sequence types (STs), from which ST2, ST5, ST8, and ST9 were involved in listeriosis. This study indicated that several L. monocytogenes isolates from ready-to-eat foods in China have pathogenic potential and are resistant to antibiotics, including antibiotics used as medicines by humans for listeriosis treatment. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  13. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  14. The effect of milk components and storage conditions on the virulence of Listeria monocytogenes as determined by a Caco-2 cell assay.

    Science.gov (United States)

    Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin

    2013-08-16

    Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

    Science.gov (United States)

    Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

    2009-03-01

    The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

  16. Virulence factors and resistance to antimicrobials in Listeria monocytogenes serotype 1/2c isolated from food.

    Science.gov (United States)

    Gelbíčová, T; Pantůček, R; Karpíšková, R

    2016-08-01

    The aim of this study was to assess the potential risk posed to the human population by the presence of Listeria monocytogenes serotype 1/2c in food based on the characterization of virulence factors of Listeria involved in the invasion of host cells and sensitivity to antimicrobial agents. In addition to sequencing of the inlA and inlB genes, the presence of genes lapB, aut, fbpA, ami, vip and llsX was tested. A premature stop codon (PMSC) in the inlA gene was detected in all tested strains of serotype 1/2c and, concurrently, two novel PMSC mutation types were identified. However, neither PMSC in the inlB gene nor deletion of the lapB, aut, fbpA, ami and vip genes were found in any of the strains. The presence of the llsX gene was not confirmed. Even though all L. monocytogenes strains showed sensitivity to the tested antimicrobials on the basis of their phenotype, sequencing revealed the presence of IS1542 insertion in the inlA gene, indicating the possibility of sharing of mobile genetic elements associated with antimicrobial resistance among strains. Other than the presence of PMSCs in the inlA gene, no PMSC in inlB or deletion of other factors linked to the invasiveness of listeria were detected. Tested strains showed sensitivity to antibiotics used in the therapy of listeriosis. Strains of L. monocytogenes serotype 1/2c typically carry a PMSC in the inlA gene, but these strains still represent a potential threat to public health. The possibility of transfer of IS1542, associated with resistance to vancomycin, between enterococci and Listeria spp. was revealed. © 2016 The Society for Applied Microbiology.

  17. The Majority of Genotypes of the Virulence Gene inlA Are Intact among Natural Watershed Isolates of Listeria monocytogenes from the Central California Coast.

    Directory of Open Access Journals (Sweden)

    Lisa Gorski

    Full Text Available Internalin A is an essential virulence gene involved in the uptake of the foodborne pathogen Listeria monocytogenes into host cells. It is intact in clinical strains and often truncated due to Premature Stop Codons (PMSCs in isolates from processed foods and processing facilities. Less information is known about environmental isolates. We sequenced the inlA alleles and did Multi Locus Variable Number Tandem Repeat Analysis (MLVA on 112 L. monocytogenes isolates from a 3-year period from naturally contaminated watersheds near a leafy green growing area in Central California. The collection contained 14 serotype 1/2a, 12 serotype 1/2b, and 86 serotype 4b strains. Twenty-seven different inlA alleles were found. Twenty-three of the alleles are predicted to encode intact copies of InlA, while three contain PMSCs. Another allele has a 9-nucleotide deletion, previously described for a clinical strain, indicating that it is still functional. Intact inlA genes were found in 101 isolates, and 8 isolates contained the allele predicted to contain the 3-amino acid deletion. Both allele types were found throughout the 3-year sampling period. Three strains contained inlA alleles with PMSCs, and these were found only during the first 3 months of the study. SNP analysis of the intact alleles indicated clustering of alleles based on serotype and lineage with serotypes 1/2b and 4b (lineage I strains clustering together, and serotype 1/2a (lineage II strains clustering separately. The combination of serotype, MLVA types, and inlA allele types indicate that the 112 isolates reflect at least 49 different strains of L. monocytogenes. The finding that 90% of environmental L. monocytogenes isolates contain intact inlA alleles varies significantly from isolates found in processing plants. This information is important to public health labs and growers as to the varieties of L. monocytogenes that could potentially contaminate fresh produce in the field by various means.

  18. Listeria monocytogenes in five Sardinian swine slaughterhouses: prevalence, serotype, and genotype characterization.

    Science.gov (United States)

    Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina

    2013-11-01

    In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.

  19. Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

    Science.gov (United States)

    Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

    2017-01-01

    The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

  20. Controlled branched-chain amino acids auxotrophy in Listeria monocytogenes allows isoleucine to serve as a host signal and virulence effector.

    Science.gov (United States)

    Brenner, Moran; Lobel, Lior; Borovok, Ilya; Sigal, Nadejda; Herskovits, Anat A

    2018-03-01

    Listeria monocytogenes (Lm) is a saprophyte and intracellular pathogen. Transition to the pathogenic state relies on sensing of host-derived metabolites, yet it remains unclear how these are recognized and how they mediate virulence gene regulation. We previously found that low availability of isoleucine signals Lm to activate the virulent state. This response is dependent on CodY, a global regulator and isoleucine sensor. Isoleucine-bound CodY represses metabolic pathways including branched-chain amino acids (BCAA) biosynthesis, however under BCAA depletion, as occurs during infection, BCAA biosynthesis is upregulated and isoleucine-unbound CodY activates virulence genes. While isoleucine was revealed as an important input signal, it was not identified how internal levels are controlled during infection. Here we show that Lm regulates BCAA biosynthesis via CodY and via a riboregulator located upstream to the BCAA biosynthesis genes, named Rli60. rli60 is transcribed when BCAA levels drop, forming a ribosome-mediated attenuator that cis-regulates the downstream genes according to BCAA supply. Notably, we found that Rli60 restricts BCAA production, essentially starving Lm, a mechanism that is directly linked to virulence, as it controls the internal isoleucine pool and thereby CodY activity. This controlled BCAA auxotrophy likely evolved to enable isoleucine to serve as a host signal and virulence effector.

  1. Controlled branched-chain amino acids auxotrophy in Listeria monocytogenes allows isoleucine to serve as a host signal and virulence effector.

    Directory of Open Access Journals (Sweden)

    Moran Brenner

    2018-03-01

    Full Text Available Listeria monocytogenes (Lm is a saprophyte and intracellular pathogen. Transition to the pathogenic state relies on sensing of host-derived metabolites, yet it remains unclear how these are recognized and how they mediate virulence gene regulation. We previously found that low availability of isoleucine signals Lm to activate the virulent state. This response is dependent on CodY, a global regulator and isoleucine sensor. Isoleucine-bound CodY represses metabolic pathways including branched-chain amino acids (BCAA biosynthesis, however under BCAA depletion, as occurs during infection, BCAA biosynthesis is upregulated and isoleucine-unbound CodY activates virulence genes. While isoleucine was revealed as an important input signal, it was not identified how internal levels are controlled during infection. Here we show that Lm regulates BCAA biosynthesis via CodY and via a riboregulator located upstream to the BCAA biosynthesis genes, named Rli60. rli60 is transcribed when BCAA levels drop, forming a ribosome-mediated attenuator that cis-regulates the downstream genes according to BCAA supply. Notably, we found that Rli60 restricts BCAA production, essentially starving Lm, a mechanism that is directly linked to virulence, as it controls the internal isoleucine pool and thereby CodY activity. This controlled BCAA auxotrophy likely evolved to enable isoleucine to serve as a host signal and virulence effector.

  2. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  3. Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

    Science.gov (United States)

    VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

    2016-10-01

    Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

  4. Characteristics of the biologically active 35-kDa metalloprotease virulence factor from Listeria monocytogenes

    NARCIS (Netherlands)

    Coffey, A; van den Burg, B; Veltman, R; Abee, T

    Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters

  5. The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

    Science.gov (United States)

    Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

    2017-11-01

    In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the

  6. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride.

    Science.gov (United States)

    Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia

    2015-06-01

    In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

    Science.gov (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

    2017-03-01

    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  8. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  9. Molecular Characterization and Phylogenetic Analysis of Listeria monocytogenes Isolated from Milk and Milk Products in Kaduna, Nigeria

    Directory of Open Access Journals (Sweden)

    U. B. Usman

    2016-01-01

    Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.

  10. Antimicrobial medium- and long-chain free fatty acids prevent PrfA-dependent activation of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sternkopf Lillebæk, Eva Maria; Lambert Nielsen, Stine; Scheel Thomasen, Rikke

    2017-01-01

    of virulence factors required for bacterial entry, intracellular replication and cell-to-cell spread. PrfA-dependent activation of virulence genes occurs primarily in the blood and during intracellular infection. In contrast, PrfA does not play a significant role in regulation of virulence gene expression...... antimicrobial free fatty acids act to downregulate transcription of PrfA-activated virulence genes. Interestingly, the inhibitory effect is also evident in cells encoding a constitutively active variant of PrfA. Collectively, our data suggest that antimicrobial medium- and long-chain free fatty acids may act...... as signals to prevent PrfA-mediated activation of virulence genes in environments where PrfA activation is not required, such as in food and the gastrointestinal tract....

  11. TetR-dependent gene regulation in intracellular Listeria monocytogenes demonstrates the spatiotemporal surface distribution of ActA.

    Science.gov (United States)

    Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J

    2017-08-01

    To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.

  12. The pathogenic potential of different pulsed-field gel electrophoresis types of Listeria monocytogenes strains isolated from food in Northeast Bosnia and Herzegovina.

    Science.gov (United States)

    Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo

    2011-09-01

    Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.

  13. Tracking Listeria monocytogenes contamination and virulence-associated characteristics in the ready-to-eat meat-based food products industry according to the hygiene level.

    Science.gov (United States)

    Henriques, A R; Gama, L T; Fraqueza, M J

    2017-02-02

    Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.

  14. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  15. Frequency, virulence genes and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis.

    Science.gov (United States)

    Jamali, Hossein; Radmehr, Behrad

    2013-11-01

    The aims of this study were to determine the prevalence, characteristics and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis in Iran. Listeria spp. were detected in 21/207 bovine mastitic milk samples from dairy farms in Iran, comprising L. monocytogenes (n=17), L. innocua (n=3) and L. ivanovii (n=1). L. monocytogenes isolates were grouped into serogroups '4b, 4d, 4e', '1/2a, 3a', '1/2b, 3b, 7' and '1/2c, 3c'; all harboured inlA, inlC and inlJ virulence genes. Listeria spp. were most frequently resistant to penicillin G (14/21 isolates, 66.7%) and tetracyclines (11/21 isolates, 52.4%). Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  17. Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

    Science.gov (United States)

    Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

    2014-01-21

    Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

  18. Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

    Directory of Open Access Journals (Sweden)

    Anna Mureddu

    2014-02-01

    Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

  19. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  20. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Paul D Cotter

    Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

  1. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  2. Listeria monocytogenes has a functional chitinolytic system and an active lytic polysaccharide monooxygenase

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Loose, Jennifer S. M.; Larsen, Marianne Halberg

    2015-01-01

    Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and ChiB) and a ......Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and Chi...... but different product profiles depending on the substrate. In LPMO-chitinase synergy experiments, CBP21 is able to boost the activity of both ChiA and ChiB more than LmLPMO10. Product analysis of the synergy assays revealed that the chitinases were unable to efficiently hydrolyse the LPMO products...... (chitooligosaccharide aldonic acids) with a degree of polymerization below four (ChiA and SmChiC) or three (ChiB). Gene transcription and protein expression analysis showed that LmLPMO10 is neither highly transcribed, nor abundantly secreted during the growth of L. monocytogenes in a chitin-containing medium...

  3. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

  4. Sublethal injury and virulence changes in Listeria monocytogenes and Listeria innocua treated with antimicrobials carvacrol and citral.

    Science.gov (United States)

    Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A

    2015-09-01

    The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Directory of Open Access Journals (Sweden)

    Lisandra Aguilar-Bultet

    2018-02-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

  6. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Science.gov (United States)

    Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

  7. The role of Listeria monocytogenes cell wall surface anchor protein LapB in virulence, adherence, and intracellular replication

    Science.gov (United States)

    Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...

  8. Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

    Science.gov (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

    2015-01-01

    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

  9. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  10. Molecular characteristics and virulence potential of Listeria monocytogenes isolates from Chinese food systems.

    Science.gov (United States)

    Chen, Jianshun; Luo, Xiaokai; Jiang, Lingli; Jin, Peijie; Wei, Wei; Liu, Dongyou; Fang, Weihuan

    2009-02-01

    In this study, we examined Listeria monocytogenes isolates from Chinese food sources in an attempt to gain further insights on the molecular characteristics and virulence potential of this important foodborne pathogen. Of the 88 L. monocytogenes food isolates recovered, 42 (47.7%) were of serovars 1/2a or 3a; 23 (26.1%) of serovars 1/2b or 3b; 15 (17.0%) of 1/2c or 3c; 6 (6.8%) of serovars 4b, 4d or 4e; and 2 (2.2%) of serovars 4a or 4c. In contrast to inlAB locus conserved in all serovars, internalin cluster between ascB and dapE varies with different serovars, with inlC2DE, inlGC2DE and inlGHE predominantly in serovars 1/2b or 4b, serovar 1/2a and serovar 1/2c. While inlF existed in all the inlGHE- and inlGC2DE-containing isolates but 17.4% of those having inlC2DE, lmo2026 existed in all the inlGHE-containing isolates but 20.0% of those bearing inlGC2DE, suggesting that inlF might have co-evolved with inlGC2DE and inlGHE while lmo2026 with inlGHE only. With the exception of serovar 4a isolate, most serovar isolates demonstrated remarkable ability to form plaques on L929 cells and produced significant mouse mortality irrespective of the internalin gene organization and whether an intact actA gene is present or not. These results indicate that majority of these food isolates may have the potential to cause human diseases if ingested via contaminated foods. Given that serovar 4b accounts for nearly half of human clinical listeriosis cases documented, the relative low proportion of serovar 4b food isolates suggests that this serovar is probably more tolerant of the adverse conditions in the host's stomach and/or more efficient in entering host cells than serovars 1/2a, 1/2b and 1/2c.

  11. BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Lea

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  12. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  13. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  14. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

    2010-03-31

    Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

  15. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Science.gov (United States)

    2010-01-01

    Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two

  16. Processing plant persistent strains of Listeria monocytogenes appear to have a lower virulence potential than clinical strains in selected virulence models

    DEFF Research Database (Denmark)

    Jensen, Anne; Thomsen, L.E.; Jørgensen, R.L.

    2008-01-01

    cell line, Caco-2; time to death in a nematode model, Caenorhabditis elegans and in a fruit fly model, Drosophila melanogaster and fecal shedding in a guinea pig model. All strains adhered to and grew in Caco-2 cells in similar levels. When exposed to 10(6) CFU/ml, two strains representing......% killed C elegans worms was longer (110 h) for the RAPD type 9 strains than for the other four strains (80 h). The Scott A strain and one RAPD type 9 strain were suspended in whipping cream before being fed to guinea pigs and the persistent RAPD type 9 strain was isolated from feces in a lower level...... to contaminate food products, and it is important to determine their virulence potential to evaluate risk to consumers. We compared the behaviour of food processing persistent and clinical L. monocytogenes strains in four virulence models: Adhesion, invasion and intracellular growth was studied in an epithelial...

  17. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  18. The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

    Science.gov (United States)

    Ren, Jun; Prescott, John F

    2004-11-15

    An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

  19. The intrinsic cephalosporin resistome of Listeria monocytogenes in the context of stress response, gene regulation, pathogenesis and therapeutics.

    Science.gov (United States)

    Krawczyk-Balska, A; Markiewicz, Z

    2016-02-01

    Intrinsic resistance to antibiotics is a serious therapeutic problem in the case of many bacterial species. The Gram-positive human pathogen Listeria monocytogenes is intrinsically resistant to broad spectrum cephalosporin antibiotics, which are commonly used in therapy of bacterial infections. Besides three penicillin-binding proteins the intrinsic cephalosporin resistome of L. monocytogenes includes multidrug resistance transporter transporters, proteins involved in peptidoglycan biosynthesis and modification, cell envelope proteins with structural or general detoxification function, cytoplasmic proteins with unknown function and regulatory proteins. Analysis of the regulation of the expression of genes involved in the intrinsic resistance of L. monocytogenes to cephalosporins highlights the high complexity of control of the intrinsic resistance phenotype. The regulation of the transcription of the intrinsic resistome determinants involves the activity of eight regulators, namely LisR, CesR, LiaR, VirR, σ(B) , σ(H) , σ(L) and PrfA, of which the most prominent role play LisR, CesR and σ(B) . Furthermore, the vast majority of the intrinsic resistome determinants contribute to the tolerance of different stress conditions and virulence. A study indicates that O-acetyltransferase OatA is the most promising candidate for co-drug development since an agent targeting OatA should sensitize L. monocytogenes to certain antibiotics, therefore improving the efficacy of listeriosis treatment as well as food preservation measures. © 2015 The Society for Applied Microbiology.

  20. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  1. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions.

    Science.gov (United States)

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow's milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulence factors, biofilm formation, and antibiopotential of Listeria isolated from the milk of goat and sheep. Udder milk samples were collected from 107 goats and 102 sheep and screened for mastitis using the California mastitis test (CMT). Samples were then examined for the presence of pathogenic Listeria spp; if detected, the isolation of pathogenic Listeria (L. monocytogenes and Listeria ivanovii) was completed using isolation and identification techniques recommended by the International Organization for Standards (ISO 11290-1, 1996), in addition to serological, in vitro and in vivo pathogenicity tests. The isolates were subjected to PCR assay for virulence associated genes (hlyA, plcA, actA, and iap). Pathogenic Listeria spp. were isolated from 5·6% of goat and 3·9% sheep milk samples, with 33·3 and 25% of these selected samples respectively containing L. monocytogenes. The results of this study provide evidence of the low-likelihood of contamination leading to the presence of L. monocytogenes in raw goat and sheep milk; however, this study also confirmed a strong in vitro ability for biofilm formation and pathogenic capability of L. monocytogenes if discovered in the milk. L. monocytogenes may be present in goat and sheep milk and in order to reduce the exposure, hygienic milking conditions must be employed for the milk to be considered a safe alternative for human consumption.

  2. An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

    Directory of Open Access Journals (Sweden)

    Laura Bifulco

    2013-01-01

    Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  3. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  4. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  5. Inhibition effect of tea tree oil on Listeria monocytogenes growth and exotoxin proteins listeriolysin O and p60 secretion.

    Science.gov (United States)

    Liu, Z; Meng, R; Zhao, X; Shi, C; Zhang, X; Zhang, Y; Guo, N

    2016-12-01

    Listeria monocytogenes (L. monocytogenes) is a Gram-positive bacterium that causes infections in humans. In this study, the effects of tea tree oil (TTO) at subinhibitory concentrations on L. monocytogenes growth and two important exotoxin proteins secreted by L. monocytogenes were researched. Treatment with half of minimal inhibitory concentration of TTO demonstrated very little or no reduction in numbers of viable ATCC 19115 cells. Listeriolysin O (LLO) and p60, were investigated. A listeriolysin assay was used to investigate the hemolytic activities of L. monocytogenes exposed to TTO, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, real-time RT-PCR was used to analyse the influence of TTO on the transcription of LLO and p60 encoded genes hly and iap respectively. According to our experimental results, we propose that TTO could be used as a promising natural compound against L. monocytogenes and its virulence factors. This is the first report on the influence of subinhibitory concentrations of tea tree oil (TTO) on the secretion of listeriolysin O (LLO) and p60, the critical virulence factors involved in Listeria pathogenesis. The results showed that TTO at 0·25 mg ml -1 reduced the secretion of LLO and p60 to 10 and 34·9% respectively, in addtion, the transcription of hly and iap was reduced to 10 and 4·3% at 0·5 mg ml -1 respectively. We propose that TTO could be used as a promising antimicrobial compound and virulence inhibitor against L. monocytogenes. © 2016 The Society for Applied Microbiology.

  6. Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions

    Directory of Open Access Journals (Sweden)

    Changyong Cheng

    2017-06-01

    Full Text Available Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the ΔtrxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA, and plcB. Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a

  7. Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions.

    Science.gov (United States)

    Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui

    2017-01-01

    Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for

  8. A Naturally Occurring Mutation K220T in the Pleiotropic Activator PrfA of Listeria Monocytogenes Results in a Loss of Virulence Due to Decreasing DNA-Binding Affinity

    Energy Technology Data Exchange (ETDEWEB)

    Velge,P.; Herler, M.; Johansson, J.; Roches, S.; Temoin, S.; Fedorov, A.; Gracieux, P.; Almo, S.; Goebel, W.; Cossart, P.

    2007-01-01

    The sequencing of prfA, encoding the transcriptional regulator of virulence genes, in 26 low-virulence field Listeria monocytogenes strains showed that eight strains exhibited the same single amino-acid substitution: PrfAK220T. These strains exhibited no expression of PrfA-regulated proteins and thus no virulence. This substitution inactivated PrfA, since expression of the PrfAK220T mutant gene in an EGD{Delta}prfA strain did not restore the haemolytic and phosphatidylcholine phospholipase C activities, in contrast to the wild-type prfA gene. The substitution of the lysine at position 220 occurred in the helix H. However, the data showed that the PrfAK220T protein is dimerized just as well as its wild-type counterpart, but does not bind to PrfA-boxes. PrfAK220T did not form a PrfA-DNA complex in electrophoretic mobility shift assays, but low concentrations of CI complexes (PrfAK220T-RNA polymerase-DNA complex) were formed by adding RNA polymerase, suggesting that PrfA interacted with RNA polymerase in solution in the absence of DNA. Formation of some transcriptionally active complexes was confirmed by in vitro runoff transcription assays and quantitative RT-PCR. Crystallographic analyses described the structure of native PrfA and highlighted the key role of allosteric changes in the activity of PrfA and especially the role of the Lys220 in the conformation of the helix-turn-helix (HTH) motif.

  9. Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

    Science.gov (United States)

    Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

    2013-02-01

    This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

  10. Characterisation of InlA truncation in Listeria monocytogenes isolates from farm animals and human cases in the province of Quebec

    Science.gov (United States)

    Fravalo, Philippe; Cherifi, Tamazight; Neira Feliciano, Kersti Dina; Letellier, Ann; Fairbrother, Julie-Hélène; Bekal, Sadjia

    2017-01-01

    The introduction of Listeria monocytogenes into the food production chain is a concern, with numerous grouped cases of listeriosis associated with milk-derived or pork-derived products have been documented. Management of this zoonotic pathogen considers all strains as an equal risk. Recently, a new perspective for characterisation of strain virulence was introduced with the discovery of the unaltered sequence of InlA as a determinant of strain virulence; this has also been reported as an infrequent finding among so-called environmental strains, that is, strains isolated from food or from surfaces in food industries. The aim of this study was to differentiate L monocytogenes strains isolated from animal cases versus those from human cases and to differentiate clinical strains from environmental ones using a Caenorhabditis elegans virulence testing model. In Quebec in 2013/2014, the surveillance of L monocytogenes clinical isolates registered a total of 20 strains of animal origin and 16 pulsed-field gel electrophoresis types isolated from human cases. The mixed PCR multiplex agglutination protocol used for geno-serotyping clearly discriminated genogroup IVB strains from bovine and human origins. The presence of a premature stop codon single nucleotide polymorphism in the inlA gene sequence in clinical strains and the identical behaviour of particular strains in the C elegans model are discussed in this paper from the perspective of industrial management of L monocytogenes risk. PMID:28761668

  11. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  12. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

    Directory of Open Access Journals (Sweden)

    David eMontero

    2015-04-01

    Full Text Available Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE such as sausage, cheese, fresh salads and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR identified that strains belonging to serotype 4b, and containing one or more genes encoded by LIPI-1, were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE, it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1 pathogenicity island, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent

  13. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

    Science.gov (United States)

    Montero, David; Bodero, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M; Vidal, Maricel

    2015-01-01

    Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance.

  14. 'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

    Science.gov (United States)

    Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

    2014-03-01

    The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

  15. Salt stress-induced transcription of σB- and CtsR-regulated genes in persistent and non-persistent Listeria monocytogenes strains from food processing plants.

    Science.gov (United States)

    Ringus, Daina L; Ivy, Reid A; Wiedmann, Martin; Boor, Kathryn J

    2012-03-01

    Listeria monocytogenes is a foodborne pathogen that can persist in food processing environments. Six persistent and six non-persistent strains from fish processing plants and one persistent strain from a meat plant were selected to determine if expression of genes in the regulons of two stress response regulators, σ(B) and CtsR, under salt stress conditions is associated with the ability of L. monocytogenes to persist in food processing environments. Subtype data were also used to categorize the strains into genetic lineages I or II. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to measure transcript levels for two σ(B)-regulated genes, inlA and gadD3, and two CtsR-regulated genes, lmo1138 and clpB, before and after (t=10 min) salt shock (i.e., exposure of exponential phase cells to BHI+6% NaCl for 10 min at 37°C). Exposure to salt stress induced higher transcript levels relative to levels under non-stress conditions for all four stress and virulence genes across all wildtype strains tested. Analysis of variance (ANOVA) of induction data revealed that transcript levels for one gene (clpB) were induced at significantly higher levels in non-persistent strains compared to persistent strains (p=0.020; two-way ANOVA). Significantly higher transcript levels of gadD3 (p=0.024; two-way ANOVA) and clpB (p=0.053; two-way ANOVA) were observed after salt shock in lineage I strains compared to lineage II strains. No clear association between stress gene transcript levels and persistence was detected. Our data are consistent with an emerging model that proposes that establishment of L. monocytogenes persistence in a specific environment occurs as a random, stochastic event, rather than as a consequence of specific bacterial strain characteristics.

  16. Natural Selection in Virulence Genes of Francisella tularensis.

    Science.gov (United States)

    Gunnell, Mark K; Robison, Richard A; Adams, Byron J

    2016-06-01

    A fundamental tenet of evolution is that alleles that are under negative selection are often deleterious and confer no evolutionary advantage. Negatively selected alleles are removed from the gene pool and are eventually extinguished from the population. Conversely, alleles under positive selection do confer an evolutionary advantage and lead to an increase in the overall fitness of the organism. These alleles increase in frequency until they eventually become fixed in the population. Francisella tularensis is a zoonotic pathogen and a potential biothreat agent. The most virulent type of F. tularensis, Type A, is distributed across North America with Type A.I occurring mainly in the east and Type A.II appearing mainly in the west. F. tularensis is thought to be a genome in decay (losing genes) because of the relatively large number of pseudogenes present in its genome. We hypothesized that the observed frequency of gene loss/pseudogenes may be an artifact of evolution in response to a changing environment, and that genes involved in virulence should be under strong positive selection. To test this hypothesis, we sequenced and compared whole genomes of Type A.I and A.II isolates. We analyzed a subset of virulence and housekeeping genes from several F. tularensis subspecies genomes to ascertain the presence and extent of positive selection. Eleven previously identified virulence genes were screened for positive selection along with 10 housekeeping genes. Analyses of selection yielded one housekeeping gene and 7 virulence genes which showed significant evidence of positive selection at loci implicated in cell surface structures and membrane proteins, metabolism and biosynthesis, transcription, translation and cell separation, and substrate binding and transport. Our results suggest that while the loss of functional genes through disuse could be accelerated by negative selection, the genome decay in Francisella could also be the byproduct of adaptive evolution

  17. Differential gene expression and filamentation of Listeria monocytogenes 08-5923 exposed to sodium lactate and sodium diacetate.

    Science.gov (United States)

    Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M

    2017-05-01

    This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Antimicrobial activity and the presence of virulence factors and bacteriocin structural genes in Enterococcus faecium CM33 isolated from ewe colostrum

    Directory of Open Access Journals (Sweden)

    YOUSEF eNAMI

    2015-07-01

    Full Text Available AbstractScreening of lactic acid bacteria isolated from ewe colostrum led to the identification and isolation of Enterococcus faecium CM33 with interesting features, such as high-survival rates under acidic or bile salt conditions, high tolerance to the simulated gastrointestinal condition, and high adhesive potential to Caco-2 cells. According to the inhibition of pathogen adhesion test results, this strain could reduce more than 50% adhesion capacity of Escherichia coli, Shigella flexneri, Klebsiella pneumoniae, Listeria monocytogenes, and Staphylococcus aureus to Caco-2 cells. Based on the antibiotic sensitivity test findings, E. faecium CM33 was susceptible to gentamycin, vancomycin, erythromycin, ampicillin, penicillin, tetracycline, and rifampicin, but resistant to chloramphenicol, clindamycin, and kanamycin. Upon the assessment of the virulence determinants for E. faecium CM33, this strain was negative for all tested virulence genes. Furthermore, the genome of this strain was evaluated for the incidence of the known enterocin genes by specific PCR amplification, and the genes encoding enterocins A, 31, X, and Q were discovered. The findings of this study showed that the strain E. faecium CM33 could be considered a valuable nutraceutical, and it can be introduced as a new potential probiotic.

  19. Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Jozi Fagundes de Mello

    2008-03-01

    Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

  20. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter

    2012-01-31

    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  1. Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

    Science.gov (United States)

    Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

    2017-07-04

    Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

  2. Prevalence and phylogenetic characterization of Listeria monocytogenes isolated from processed meat marketed in Egypt

    Directory of Open Access Journals (Sweden)

    Yasmin Mohamed

    2016-06-01

    Full Text Available Because of its high case fatality rate, listeriosis locates among the most frequent causes of death due to food-borne illness. In this study, a total of 150 processed meat samples were collected from Giza Governorate, Egypt. Phenotypic and genotypic identification of Listeria monocytogenes was performed using PCR incorporating listeriolysin O virulence gene hlyA followed by DNA sequence analysis. L. monocytogenes was confirmed in 4% of each of beef burger, minced meat, and luncheon samples. Phylogenetic analysis showed that all the six Egyptian isolates have high homology with Colombian isolate (EF030606, except one Egyptian isolate which showed high homology with Indian isolate (EU840690. The public health significance of these pathogens as well as recommended sanitary measures were discussed.

  3. Isolation and biochemical and molecular characterization of Listeria monocytogenes in food

    International Nuclear Information System (INIS)

    Helel, Salma

    2008-01-01

    monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)

  4. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain.

    Science.gov (United States)

    NicAogáin, Kerrie; O'Byrne, Conor P

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.

  5. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain

    Science.gov (United States)

    NicAogáin, Kerrie; O’Byrne, Conor P.

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042

  6. Pathogenomic inference of virulence-associated genes in Leptospira interrogans.

    Science.gov (United States)

    Lehmann, Jason S; Fouts, Derrick E; Haft, Daniel H; Cannella, Anthony P; Ricaldi, Jessica N; Brinkac, Lauren; Harkins, Derek; Durkin, Scott; Sanka, Ravi; Sutton, Granger; Moreno, Angelo; Vinetz, Joseph M; Matthias, Michael A

    2013-01-01

    Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.

  7. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    Directory of Open Access Journals (Sweden)

    Kristensen Hans-Henrik

    2008-11-01

    Full Text Available Abstract Background Host defense peptides (HDPs, or antimicrobial peptides (AMPs, are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases. Hence it is important to determine the natural variation in susceptibility to HDPs to ensure a successful use in clinical treatment regimes. Results Strains of two human bacterial pathogens, Listeria monocytogenes and Staphylococcus aureus, were selected to cover a wide range of origin, sub-type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10 were similar in activity profile (MIC value spectrum to the human β-defensin 3 (HBD-3. All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs. Conclusion Strains of L. monocytogenes and S. aureus were within each species equally sensitive to a range of HDPs despite variations in subtype, origin, and phenotypic behavior. Our results suggest that therapeutic use of HDPs will not be hampered by occurrence of naturally tolerant strains of the two species investigated in the present study.

  8. Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

  9. Immersion infection of germ-free zebrafish with Listeria monocytogenes induces transient expression of innate immune response genes

    Directory of Open Access Journals (Sweden)

    Ying eShan

    2015-04-01

    Full Text Available Zebrafish, Denio rerio, could be an alternative to other classic animal models for human infectious diseases to examine the processes of microbial infections and host-pathogen interactions in vivo because of their small body dimension but large clutch size. We established germ-free zebrafish infection models of Listeria monocytogenes through different routes of infection: oral immersion and injection via yolk sac, brain ventricle and blood island. Immersion of zebrafish larva even with 1010CFU/mL L. monocytogenes EGDe strain in egg water was unable to cause mortality, but GFP-expressing bacteria in the gut lumen could be observed in frozen sections. Several selected maker genes of the innate immune system, including cyp1a, irg1l, il1b and mmp9, were significantly induced by oral immersion not only with strain EGDe, but also with strain M7 and L. innocua, though to a lesser degree (P < 0.01. Such induction appears to be transient with peak at 48 h post-infection, but returned to basal level at 72 h post-infection. Of the three injection routes, mortality after infection by yolk sac was 80% in early stage of infection. Few eggs could survive and hatch. Injection into zebrafish embryos via brain ventricle or blood island led to progressive lethal infection. L. mocytogenes EGDe showed steady replication in the fish embryos and was far more pathogenic than strain M7, which is consistent with findings in the murine model. We conclude that zebrafish could serve as susceptible and microscopically visible infection models for L. monocytogenes via different routes and could be applied to further studies on the interactions between bacterial virulence factors and host immune responses.

  10. Pathogenomic inference of virulence-associated genes in Leptospira interrogans.

    Directory of Open Access Journals (Sweden)

    Jason S Lehmann

    Full Text Available Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.

  11. Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

    DEFF Research Database (Denmark)

    Jiang, Lingli; Olesen, Inger; Andersen, Thomas

    2010-01-01

    -related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

  12. Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

    Science.gov (United States)

    Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

    2017-05-01

    Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  13. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  14. Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Masoumeh Hayati

    2017-11-01

    Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.

  15. Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

    2015-07-25

    The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

  16. Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.

    Directory of Open Access Journals (Sweden)

    Kathrin Rychli

    Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.

  17. Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes.

    Science.gov (United States)

    Jahandeh, Nadia; Ranjbar, Reza; Behzadi, Payam; Behzadi, Elham

    2015-01-01

    The pathotypes of uropathogenic Escherichia coli (UPEC) cause different types of urinary tract infections (UTIs). The presence of a wide range of virulence genes in UPEC enables us to design appropriate DNA microarray probes. These probes, which are used in DNA microarray technology, provide us with an accurate and rapid diagnosis and definitive treatment in association with UTIs caused by UPEC pathotypes. The main goal of this article is to introduce the UPEC virulence genes as invaluable approaches for designing DNA microarray probes. Main search engines such as Google Scholar and databases like NCBI were searched to find and study several original pieces of literature, review articles, and DNA gene sequences. In parallel with in silico studies, the experiences of the authors were helpful for selecting appropriate sources and writing this review article. There is a significant variety of virulence genes among UPEC strains. The DNA sequences of virulence genes are fabulous patterns for designing microarray probes. The location of virulence genes and their sequence lengths influence the quality of probes. The use of selected virulence genes for designing microarray probes gives us a wide range of choices from which the best probe candidates can be chosen. DNA microarray technology provides us with an accurate, rapid, cost-effective, sensitive, and specific molecular diagnostic method which is facilitated by designing microarray probes. Via these tools, we are able to have an accurate diagnosis and a definitive treatment regarding UTIs caused by UPEC pathotypes.

  18. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  19. Genetic Characterization of Listeria monocytogenes Isolates from Industrial and Retail Ready-to-Eat Meat-Based Foods and Their Relationship with Clinical Strains from Human Listeriosis in Portugal.

    Science.gov (United States)

    Henriques, A R; Cristino, J Melo; Fraqueza, M J

    2017-04-01

    Listeria monocytogenes isolates (n = 81) recovered from ready-to-eat meat-based food products (RTEMP) collected in industrial processing plants and retail establishments were genetically characterized for comparison with those from human clinical cases of listeriosis (n = 49). The aim was to assess RTEMP as a possible food source for human infection. L. monocytogenes was detected in 12.5% of the RTEMP samples, and in some cases, counts were above the European food safety criteria. All isolates were assessed by multiplex PCR for serogroup determination and detection of virulence-associated genes inlA, inlB, inlC, inlJ, plcA, hlyA, actA, and iap. Serogroups IIb and IVb dominated in RTEMP and human isolates, and all were positive for the assessed virulence genes. Antibiotic susceptibility testing by the disk diffusion method revealed a low level of resistance among the isolates. Pulsed-field gel electrophoresis (PFGE) of L. monocytogenes isolates, using restriction enzymes ApaI and AscI, revealed genetic variability and differentiated the isolates in five clusters. Although some pulsed-field gel electrophoresis profiles of particular RTEMP and human isolates seemed to be highly related, exhibiting more than 90% similarity, which suggests a possible common source, in most cases the strains were not genetically or temporally matched. The close genetic relatedness of RTEMP and human listeriosis strains stressed the importance of preventive measure implementation throughout the food chain.

  20. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  1. Main functions and taxonomic distribution of virulence genes in Brucella melitensis 16 M.

    Directory of Open Access Journals (Sweden)

    Aniel Jessica Leticia Brambila-Tapia

    Full Text Available Many virulence genes have been detected in attenuated mutants of Brucella melitensis 16 M; nevertheless, a complete report of these genes, including the main Cluster of Orthologous Groups (COG represented as well as the taxonomical distribution among all complete bacterial and archaeal genomes, has not been analyzed. In this work a total of 160 virulence genes that have been reported in attenuated mutants in B. melitensis were included and analyzed. Additionally, we obtained 250 B. melitensis randomly selected genes as a reference group for the taxonomical comparisons. The COGs and the taxonomical distribution profile for 789 nonredundant bacterial and archaeal genomes were obtained and compared with the whole-genome COG distribution and with the 250 randomly selected genes, respectively. The main COGs associated with virulence genes corresponded to the following: intracellular trafficking, secretion and vesicular transport (U; cell motility (N; nucleotide transport and metabolism (F; transcription (K; and cell wall/membrane/envelope biogenesis (M. In addition, we found that virulence genes presented a higher proportion of orthologs in the Euryarchaeota and Proteobacteria phyla, with a significant decrease in Chlamydiae, Bacteroidetes, Tenericutes, Firmicutes and Thermotogae. In conclusion, we found that genes related to specific functions are more relevant to B. melitensis virulence, with the COG U the most significant. Additionally, the taxonomical distribution of virulence genes highlights the importance of these genes in the related Proteobacteria, being less relevant in distant groups of organisms with the exception of Euryarchaeota.

  2. Prevalence, populations and pheno- and genotypic characteristics of Listeria monocytogenes isolated from ready-to-eat vegetables marketed in São Paulo, Brazil.

    Science.gov (United States)

    Sant'Ana, Anderson S; Igarashi, Maria Crystina; Landgraf, Mariza; Destro, Maria Teresa; Franco, Bernadette D G M

    2012-04-02

    Listeria monocytogenes is a foodborne pathogen of great concern due to the high fatality rates of listeriosis. The consumption of RTE vegetables has increased in Brazil over the last two decades, but little is known about the risks associated to the consumption of these products. This study evaluated the prevalence and counts of L. monocytogenes in 512 packages of ready-to-eat vegetables marketed in São Paulo. The isolates were characterized for their serotypes, ribotypes, positivity for virulence genes inlA, inlC and inlJ, resistance to chlorine, growth rate variability and capability to form biofilm on stainless steel (AISI 304, #4) coupons. L. monocytogenes was detected in 3.1% of the samples. Only five samples presented countable levels, with counts between 1.0×10(1) and 2.6×10(2)CFU/g. Isolates belonged to serotypes 1/2b or 4b and most were positive for genes inlC and inlJ. Ribotypable isolates were grouped into four groups: 1038 (69.4%), 19175 (11.3%), 19191 (17.7%) and 18604 (one isolate). Most isolates survived to exposure to 125 ppm of a chlorine-based disinfectant for 3 min. All isolates were capable to attach to the coupons, reaching counts above 4 log(10) CFU/cm(2) and the growth rate (μ) at 25°C of the majority of the isolates varied between 0.1 and 0.2 log OD/h, but for few strains the μ was as high as 0.26 log OD/h. Results of this survey indicate that RTE vegetables may be vehicles of L. monocytogenes strains with limited variation in serotype, ribotype and virulence factors but varying significantly in resistance to chlorine disinfectants, capability of forming biofilm and growth rate. Data obtained is of foremost importance to serve as baseline for the development of scientific-based policies to control the incidence of L. monocytogenes in RTE vegetables in Brazil. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

    OpenAIRE

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2016-01-01

    ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST...

  4. Protocols for screening antimicrobial peptides that influence virulence gene expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bojer, Martin Saxtorph; Baldry, Mara; Ingmer, Hanne

    2017-01-01

    Compounds that inhibit virulence gene expression in bacterial pathogens have received increasing interest as possible alternatives to the traditional antibiotic treatment of infections. For the human pathogen Staphylococcus aureus, we have developed two simple assays based on reporter gene fusions...... to central virulence genes that are easily applicable for screening various sources of natural and synthetic peptides for anti-virulence effects. The plate assay is qualitative but simultaneously assesses the effect of gradient concentrations of the investigated compound, whereas the liquid assay...... is quantitative and can be employed to address whether a compound is acting on the central quorum sensing regulatory system, agr, that controls a large number of virulence genes in S. aureus....

  5. Serovar 4b complex predominates among Listeria monocytogenes isolates from imported aquatic products in China.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan

    2010-01-01

    Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.

  6. Inhibitory effect of live-attenuated Listeria monocytogenes-based vaccines expressing MIA gene on malignant melanoma.

    Science.gov (United States)

    Qian, Yue; Zhang, Na; Jiang, Ping; Chen, Siyuan; Chu, Shujuan; Hamze, Firas; Wu, Yan; Luo, Qin; Feng, Aiping

    2012-08-01

    Listeria monocytogenes (LM), a Gram-positive facultative intracellular bacterium, can be used as an effective exogenous antigen expression vector in tumor-target therapy. But for successful clinical application, it is necessary to construct attenuated LM stain that is safe yet retains the potency of LM based on the full virulent pathogen. In this study, attenuated LM and recombinants of LM expressing melanoma inhibitory activity (MIA) were constructed successfully. The median lethal dose (LD(50)) and invasion efficiency of attenuated LM strains were detected. The recombinants were utilized for immunotherapy of animal model of B16F10 melanoma. The level of MIA mRNA expression in tumor tissue was detected by using real-time polymerase chain reaction (PCR) with specific sequence, meanwhile the anti-tumor immune response was assayed by flow cytometric analysis and enzyme-linked immunosorbent spot (ELISPOT) assay. The results showed the toxicity and invasiveness of attenuated LM were decreased as compared with LM, and attenuated LM expressing MIA, especially the double-genes attenuated LM recombinant, could significantly induce anti-tumor immune response and inhibit tumor growth. This study implicates attenuated LM may be a safer and more effective vector for immunotherapy of melanoma.

  7. Virulence Gene Pool Detected in Bovine Group C Streptococcus dysgalactiae subsp. dysgalactiae Isolates by Use of a Group A S. pyogenes Virulence Microarray ▿

    Science.gov (United States)

    Rato, Márcia G.; Nerlich, Andreas; Bergmann, René; Bexiga, Ricardo; Nunes, Sandro F.; Vilela, Cristina L.; Santos-Sanches, Ilda; Chhatwal, Gursharan S.

    2011-01-01

    A custom-designed microarray containing 220 virulence genes of Streptococcus pyogenes (group A Streptococcus [GAS]) was used to test group C Streptococcus dysgalactiae subsp. dysgalactiae (GCS) field strains causing bovine mastitis and group C or group G Streptococcus dysgalactiae subsp. equisimilis (GCS/GGS) isolates from human infections, with the latter being used for comparative purposes, for the presence of virulence genes. All bovine and all human isolates carried a fraction of the 220 genes (23% and 39%, respectively). The virulence genes encoding streptolysin S, glyceraldehyde-3-phosphate dehydrogenase, the plasminogen-binding M-like protein PAM, and the collagen-like protein SclB were detected in the majority of both bovine and human isolates (94 to 100%). Virulence factors, usually carried by human beta-hemolytic streptococcal pathogens, such as streptokinase, laminin-binding protein, and the C5a peptidase precursor, were detected in all human isolates but not in bovine isolates. Additionally, GAS bacteriophage-associated virulence genes encoding superantigens, DNase, and/or streptodornase were detected in bovine isolates (72%) but not in the human isolates. Determinants located in non-bacteriophage-related mobile elements, such as the gene encoding R28, were detected in all bovine and human isolates. Several virulence genes, including genes of bacteriophage origin, were shown to be expressed by reverse transcriptase PCR (RT-PCR). Phylogenetic analysis of superantigen gene sequences revealed a high level (>98%) of identity among genes of bovine GCS, of the horse pathogen Streptococcus equi subsp. equi, and of the human pathogen GAS. Our findings indicate that alpha-hemolytic bovine GCS, an important mastitis pathogen and considered to be a nonhuman pathogen, carries important virulence factors responsible for virulence and pathogenesis in humans. PMID:21525223

  8. Construction of a multiple fluorescence labeling system for use in co-invasion studies of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Andersen, Jens Bo; Roldgaard, Bent; Lindner, A. B.

    2006-01-01

    strains at the single cell level by use of fluorescence microscopy. More than 90% of the L. monocytogenes host cells maintained the fluorescence tags for 40 generations. The fluorescence tags did not alter the invasive capacity of the L. monocytogenes cells in a traditional Caco-2 cell invasion assay......, and visual discrimination between invaded bacteria carrying different fluorescent labels inside the cells was possible. Conclusion The constructed fluorescent marker system is stable, easy to use, does not affect the virulence of L. monocytogenes in Caco-2 cell assays, and allows discrimination between...... deviations in the observed capacity for infection when animal models are used. One way to circumvent this problem is to carry out virulence studies as competition assays between 2 or more strains. This, however, requires invasion-neutral markers that enable easy discrimination between the different strains...

  9. Analysis of the role of betL in contributing to the growth and survival of Listeria monocytogenes LO28.

    Science.gov (United States)

    Sleator, R D; Gahan CGM; O'Driscoll, B; Hill, C

    2000-09-25

    Survival of the food-borne pathogen Listeria monocytogenes in environments of elevated osmolarity and reduced temperature is attributed, at least in part, to the accumulation of the trimethylammonium compound glycine betaine. Previously we identified betL, a gene encoding the secondary glycine betaine transporter BetL, which we linked to the salt tolerance of Listeria. In this report, we demonstrate that betL, preceded by a consensus sigmaB-dependent promoter, is regulated by osmotic up-shock, at least in part at the level of transcription. Using allelic exchange mutagenesis we constructed an in-frame deletion in betL, and used this mutant to determine the role of BetL in contributing to the growth and survival of L. monocytogenes, both in a high risk food (Camembert cheese) and animal model. Our results indicate that while BetL plays an important role in glycine betaine mediated osmoprotection, mutating the gene does not significantly effect either the cryotolerance or virulence of the organism.

  10. P-Ser-HPr-a link between carbon metabolism and the virulence of some pathogenic bacteria

    DEFF Research Database (Denmark)

    Mijakovic, Ivan

    2005-01-01

    HPr kinase/phosphorylase phosphorylates HPr, a phosphocarrier protein of the phosphoenolpyruvate:carbohydrate phosphotransferase system, at serine-46. P-Ser-HPr is the central regulator of carbon metabolism in Gram-positive bacteria, but also plays a role in virulence development of certain...... pathogens. In Listeria monocytogenes, several virulence genes, which depend on the transcription activator PrfA, are repressed by glucose, fructose, etc., in a catabolite repressor (CcpA)-independent mechanism. However, the catabolite co-repressor P-Ser-HPr was found to inhibit the activity of Prf...... is preceded by an operator site, which serves as target for the CcpA/P-Ser-HPr complex. Numerous Gram-negative pathogens also contain hprK, which is often organised in an operon with transcription regulators necessary for the development of virulence, indicating that in these organisms P-Ser-HPr also plays...

  11. Virulence Genes and Antibiotic Susceptibilities of Uropathogenic E. coli Strains.

    Science.gov (United States)

    Uzun, Cengiz; Oncül, Oral; Gümüş, Defne; Alan, Servet; Dayioğlu, Nurten; Küçüker, Mine Anğ

    2015-01-01

    The aim of this study is to detect the presence of and possible relation between virulence genes and antibiotic resistance in E. coli strains isolated from patients with acute, uncomplicated urinary tract infections (UTI). 62 E. coli strains isolated from patients with acute, uncomplicated urinary tract infections (50 strains isolated from acute uncomplicated cystitis cases (AUC); 12 strains from acute uncomplicated pyelonephritis cases (AUP)) were screened for virulence genes [pap (pyelonephritis-associated pili), sfa/foc (S and F1C fimbriae), afa (afimbrial adhesins), hly (hemolysin), cnf1 (cytotoxic necrotizing factor), aer (aerobactin), PAI (pathogenicity island marker), iroN (catecholate siderophore receptor), ompT (outer membrane protein T), usp (uropathogenic specific protein)] by PCR and for antimicrobial resistance by disk diffusion method according to CLSI criteria. It was found that 56 strains (90.3%) carried at least one virulence gene. The most common virulence genes were ompT (79%), aer (51.6%), PAI (51.6%) and usp (56.5%). 60% of the strains were resistant to at least one antibiotic. The highest resistance rates were against ampicillin (79%) and co-trimoxazole (41.9%). Fifty percent of the E. coli strains (31 strains) were found to be multiple resistant. Eight (12.9%) out of 62 strains were found to be ESBL positive. Statistically significant relationships were found between the absence of usp and AMP - SXT resistance, iroN and OFX - CIP resistance, PAI and SXT resistance, cnf1 and AMP resistance, and a significant relationship was also found between the presence of the afa and OFX resistance. No difference between E. coli strains isolated from two different clinical presentations was found in terms of virulence genes and antibiotic susceptibility.

  12. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

    Directory of Open Access Journals (Sweden)

    Saliou Niassy

    2013-01-01

    Full Text Available Virulence is the primary factor used for selection of entomopathogenic fungi (EPF for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.

  13. Detection of virulence-associated genes in Brucella melitensis ...

    African Journals Online (AJOL)

    The current study involved detection of three virulence genes (bvfA, virB, ure) by PCR in 52 isolates of Brucella melitensis biovar 3, recovered from different animal species (28 sheep, 10 goats, 9 cattle and 5 buffaloes). Of the 52 B. melitensis strains; 48 (92.3%) isolates carried bvfA genes, 51 (98.1%) isolates had virB genes ...

  14. Listeriolysin S Is a Streptolysin S-Like Virulence Factor That Targets Exclusively Prokaryotic Cells In Vivo

    Directory of Open Access Journals (Sweden)

    Juan J. Quereda

    2017-04-01

    Full Text Available Streptolysin S (SLS-like virulence factors from clinically relevant Gram-positive pathogens have been proposed to behave as potent cytotoxins, playing key roles in tissue infection. Listeriolysin S (LLS is an SLS-like hemolysin/bacteriocin present among Listeria monocytogenes strains responsible for human listeriosis outbreaks. As LLS cytotoxic activity has been associated with virulence, we investigated the LLS-specific contribution to host tissue infection. Surprisingly, we first show that LLS causes only weak red blood cell (RBC hemolysis in vitro and neither confers resistance to phagocytic killing nor favors survival of L. monocytogenes within the blood cells or in the extracellular space (in the plasma. We reveal that LLS does not elicit specific immune responses, is not cytotoxic for eukaryotic cells, and does not impact cell infection by L. monocytogenes. Using in vitro cell infection systems and a murine intravenous infection model, we actually demonstrate that LLS expression is undetectable during infection of cells and murine inner organs. Importantly, upon intravenous animal inoculation, L. monocytogenes is found in the gastrointestinal system, and only in this environment LLS expression is detected in vivo. Finally, we confirm that LLS production is associated with destruction of target bacteria. Our results demonstrate therefore that LLS does not contribute to L. monocytogenes tissue injury and virulence in inner host organs as previously reported. Moreover, we describe that LlsB, a putative posttranslational modification enzyme encoded in the LLS operon, is necessary for murine inner organ colonization. Overall, we demonstrate that LLS is the first SLS-like virulence factor targeting exclusively prokaryotic cells during in vivo infections.

  15. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B. H.; Ingmer, H.

    2001-01-01

    of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  16. Nigribactin, a Novel Siderophore from Vibrio nigripulchritudo, Modulates Staphylococcus aureus Virulence Gene Expression

    DEFF Research Database (Denmark)

    Nielsen, Anita; Månsson, Maria; Wietz, Matthias

    2012-01-01

    Staphylococcus aureus is a serious human pathogen that employs a number of virulence factors as part of its pathogenesis. The purpose of the present study was to explore marine bacteria as a source of compounds that modulate virulence gene expression in S. aureus. During the global marine Galathea...... 3 expedition, a strain collection was established comprising bacteria that express antimicrobial activity against Vibrio anguillarum and/or Staphylococcus aureus. Within this collection we searched colony material, culture supernatants, and cell extracts for virulence modulating activity showing......, enterobactin, failed to influence S. aureus virulence gene expression. This study shows that marine microorganisms produce compounds with potential use in therapeutic strategies targeting virulence rather than viability of human pathogens....

  17. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C

    DEFF Research Database (Denmark)

    Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup

    2016-01-01

    proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...

  18. Genome-wide identification of Pseudomonas aeruginosa virulence-related genes using a Caenorhabditis elegans infection model.

    Directory of Open Access Journals (Sweden)

    Rhonda L Feinbaum

    Full Text Available Pseudomonas aeruginosa strain PA14 is an opportunistic human pathogen capable of infecting a wide range of organisms including the nematode Caenorhabditis elegans. We used a non-redundant transposon mutant library consisting of 5,850 clones corresponding to 75% of the total and approximately 80% of the non-essential PA14 ORFs to carry out a genome-wide screen for attenuation of PA14 virulence in C. elegans. We defined a functionally diverse 180 mutant set (representing 170 unique genes necessary for normal levels of virulence that included both known and novel virulence factors. Seven previously uncharacterized virulence genes (ABC transporters PchH and PchI, aminopeptidase PepP, ATPase/molecular chaperone ClpA, cold shock domain protein PA0456, putative enoyl-CoA hydratase/isomerase PA0745, and putative transcriptional regulator PA14_27700 were characterized with respect to pigment production and motility and all but one of these mutants exhibited pleiotropic defects in addition to their avirulent phenotype. We examined the collection of genes required for normal levels of PA14 virulence with respect to occurrence in P. aeruginosa strain-specific genomic regions, location on putative and known genomic islands, and phylogenetic distribution across prokaryotes. Genes predominantly contributing to virulence in C. elegans showed neither a bias for strain-specific regions of the P. aeruginosa genome nor for putatively horizontally transferred genomic islands. Instead, within the collection of virulence-related PA14 genes, there was an overrepresentation of genes with a broad phylogenetic distribution that also occur with high frequency in many prokaryotic clades, suggesting that in aggregate the genes required for PA14 virulence in C. elegans are biased towards evolutionarily conserved genes.

  19. Genome-wide identification of Pseudomonas aeruginosa virulence-related genes using a Caenorhabditis elegans infection model.

    Science.gov (United States)

    Feinbaum, Rhonda L; Urbach, Jonathan M; Liberati, Nicole T; Djonovic, Slavica; Adonizio, Allison; Carvunis, Anne-Ruxandra; Ausubel, Frederick M

    2012-01-01

    Pseudomonas aeruginosa strain PA14 is an opportunistic human pathogen capable of infecting a wide range of organisms including the nematode Caenorhabditis elegans. We used a non-redundant transposon mutant library consisting of 5,850 clones corresponding to 75% of the total and approximately 80% of the non-essential PA14 ORFs to carry out a genome-wide screen for attenuation of PA14 virulence in C. elegans. We defined a functionally diverse 180 mutant set (representing 170 unique genes) necessary for normal levels of virulence that included both known and novel virulence factors. Seven previously uncharacterized virulence genes (ABC transporters PchH and PchI, aminopeptidase PepP, ATPase/molecular chaperone ClpA, cold shock domain protein PA0456, putative enoyl-CoA hydratase/isomerase PA0745, and putative transcriptional regulator PA14_27700) were characterized with respect to pigment production and motility and all but one of these mutants exhibited pleiotropic defects in addition to their avirulent phenotype. We examined the collection of genes required for normal levels of PA14 virulence with respect to occurrence in P. aeruginosa strain-specific genomic regions, location on putative and known genomic islands, and phylogenetic distribution across prokaryotes. Genes predominantly contributing to virulence in C. elegans showed neither a bias for strain-specific regions of the P. aeruginosa genome nor for putatively horizontally transferred genomic islands. Instead, within the collection of virulence-related PA14 genes, there was an overrepresentation of genes with a broad phylogenetic distribution that also occur with high frequency in many prokaryotic clades, suggesting that in aggregate the genes required for PA14 virulence in C. elegans are biased towards evolutionarily conserved genes.

  20. The Composition and Spatial Patterns of Bacterial Virulence Factors and Antibiotic Resistance Genes in 19 Wastewater Treatment Plants.

    Directory of Open Access Journals (Sweden)

    Bing Zhang

    Full Text Available Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs are as an important sink and source of pathogens and antibiotic resistance genes (ARGs. Virulence genes (encoding virulence factors are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs.

  1. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  2. Evaluation of bacteriocin-producing Lactobacillus sakei 1 against Listeria monocytogenes 1/2a growth and haemolytic activity Avaliação de Lactobacillus sakei 1 produtor de bacteriocina frente a Listeria monocytogenes 1/2a e sua atividade hemolítica

    Directory of Open Access Journals (Sweden)

    Rafael C.R. Martinez

    2005-03-01

    Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr

  3. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-01-01

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono......-killed cells of L. monocytogenes have no effect on luxS transcription. The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes...

  4. A functional gene array for detection of bacterial virulence elements

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2007-11-01

    We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.

  5. Comparative genome analysis of 24 bovine-associated Staphylococcus isolates with special focus on the putative virulence genes

    Science.gov (United States)

    Åvall-Jääskeläinen, Silja; Paulin, Lars; Blom, Jochen

    2018-01-01

    Non-aureus staphylococci (NAS) are most commonly isolated from subclinical mastitis. Different NAS species may, however, have diverse effects on the inflammatory response in the udder. We determined the genome sequences of 20 staphylococcal isolates from clinical or subclinical bovine mastitis, belonging to the NAS species Staphylococcus agnetis, S. chromogenes, and S. simulans, and focused on the putative virulence factor genes present in the genomes. For comparison we used our previously published genome sequences of four S. aureus isolates from bovine mastitis. The pan-genome and core genomes of the non-aureus isolates were characterized. After that, putative virulence factor orthologues were searched in silico. We compared the presence of putative virulence factors in the NAS species and S. aureus and evaluated the potential association between bacterial genotype and type of mastitis (clinical vs. subclinical). The NAS isolates had much less virulence gene orthologues than the S. aureus isolates. One third of the virulence genes were detected only in S. aureus. About 100 virulence genes were present in all S. aureus isolates, compared to about 40 to 50 in each NAS isolate. S. simulans differed the most. Several of the virulence genes detected among NAS were harbored only by S. simulans, but it also lacked a number of genes present both in S. agnetis and S. chromogenes. The type of mastitis was not associated with any specific virulence gene profile. It seems that the virulence gene profiles or cumulative number of different virulence genes are not directly associated with the type of mastitis (clinical or subclinical), indicating that host derived factors such as the immune status play a pivotal role in the manifestation of mastitis. PMID:29610707

  6. Comparative genome analysis of 24 bovine-associated Staphylococcus isolates with special focus on the putative virulence genes

    Directory of Open Access Journals (Sweden)

    Silja Åvall-Jääskeläinen

    2018-03-01

    Full Text Available Non-aureus staphylococci (NAS are most commonly isolated from subclinical mastitis. Different NAS species may, however, have diverse effects on the inflammatory response in the udder. We determined the genome sequences of 20 staphylococcal isolates from clinical or subclinical bovine mastitis, belonging to the NAS species Staphylococcus agnetis, S. chromogenes, and S. simulans, and focused on the putative virulence factor genes present in the genomes. For comparison we used our previously published genome sequences of four S. aureus isolates from bovine mastitis. The pan-genome and core genomes of the non-aureus isolates were characterized. After that, putative virulence factor orthologues were searched in silico. We compared the presence of putative virulence factors in the NAS species and S. aureus and evaluated the potential association between bacterial genotype and type of mastitis (clinical vs. subclinical. The NAS isolates had much less virulence gene orthologues than the S. aureus isolates. One third of the virulence genes were detected only in S. aureus. About 100 virulence genes were present in all S. aureus isolates, compared to about 40 to 50 in each NAS isolate. S. simulans differed the most. Several of the virulence genes detected among NAS were harbored only by S. simulans, but it also lacked a number of genes present both in S. agnetis and S. chromogenes. The type of mastitis was not associated with any specific virulence gene profile. It seems that the virulence gene profiles or cumulative number of different virulence genes are not directly associated with the type of mastitis (clinical or subclinical, indicating that host derived factors such as the immune status play a pivotal role in the manifestation of mastitis.

  7. Wide distribution of virulence genes among Enterococcus faecium and Enterococcus faecalis clinical isolates.

    Science.gov (United States)

    Soheili, Sara; Ghafourian, Sobhan; Sekawi, Zamberi; Neela, Vasanthakumari; Sadeghifard, Nourkhoda; Ramli, Ramliza; Hamat, Rukman Awang

    2014-01-01

    Enterococcus, a Gram-positive facultative anaerobic cocci belonging to the lactic acid bacteria of the phylum Firmicutes, is known to be able to resist a wide range of hostile conditions such as different pH levels, high concentration of NaCl (6.5%), and the extended temperatures between 5(°)C and 65(°)C. Despite being the third most common nosocomial pathogen, our understanding on its virulence factors is still poorly understood. The current study was aimed to determine the prevalence of different virulence genes in Enterococcus faecalis and Enterococcus faecium. For this purpose, 79 clinical isolates of Malaysian enterococci were evaluated for the presence of virulence genes. pilB, fms8, efaAfm, and sgrA genes are prevalent in all clinical isolates. In conclusion, the pathogenicity of E. faecalis and E. faecium could be associated with different virulence factors and these genes are widely distributed among the enterococcal species.

  8. Wide Distribution of Virulence Genes among Enterococcus faecium and Enterococcus faecalis Clinical Isolates

    Directory of Open Access Journals (Sweden)

    Sara Soheili

    2014-01-01

    Full Text Available Enterococcus, a Gram-positive facultative anaerobic cocci belonging to the lactic acid bacteria of the phylum Firmicutes, is known to be able to resist a wide range of hostile conditions such as different pH levels, high concentration of NaCl (6.5%, and the extended temperatures between 5°C and 65°C. Despite being the third most common nosocomial pathogen, our understanding on its virulence factors is still poorly understood. The current study was aimed to determine the prevalence of different virulence genes in Enterococcus faecalis and Enterococcus faecium. For this purpose, 79 clinical isolates of Malaysian enterococci were evaluated for the presence of virulence genes. pilB, fms8, efaAfm, and sgrA genes are prevalent in all clinical isolates. In conclusion, the pathogenicity of E. faecalis and E. faecium could be associated with different virulence factors and these genes are widely distributed among the enterococcal species.

  9. Bacteriocinogenic potential and virulence traits of Enterococcus faecium and E. faecalis isolated from human milk

    Science.gov (United States)

    Khalkhali, Soodabeh; Mojgani, Naheed

    2017-01-01

    Background and Objectives: Human milk is a continuous supply of Lactic Acid bacteria (LAB), including enterococci with probiotic potentials. The aim of this study was to analyze two Enterococcus species, isolated from human milk for their probiotic potential, bacteriocin producing ability and virulence traits. Materials and Methods: Enterococcus faecium TA0033 and E. faecalis TA102 were tested for acid and bile tolerance, survival in simulated gastric and intestinal conditions. The antibacterial spectrum of the isolates was tested by agar well diffusion assay. The antagonistic agent was characterized by physico-chemical methods. The enterocin structural genes, virulence determinants, vancomycin resistance and biogenic amine genes, such as hdc1, hdc2, tdc, ldc and odc were also determined. Results: The tested isolates survived acidic conditions, high bile salt (1%), simulated gastric and intestinal conditions. The culture supernatant fluids of the two isolates inhibited the growth of Escherichia coli, Listeria monocytogenes, Salmonella typhi, Staphylococcus aureus, Shigella dysenteriae and Streptococcus agalactiae. The antagonistic activity was lost in the presence of proteolytic enzymes but tolerated the action of catalase, lysozyme and lipase. In contrast to enterocin TA102, enterocin TA0033 possessed bactericidal mode of action. Bacteriocin structural genes, entA and entB were present in the genome of the two isolates, while E. faecalis TA102 additionally harboured entP and bac31 genes. The phenotypic and genotypic virulence assessment studies indicated hyaluronidase (hyl) production and vancomycin resistance in E. faecalis TA102 while, none of the isolates harboured the biogenic amine genes. Conclusion: The presence of virulence genes in E. faecalis TA102 calls for careful monitoring of Enterococcus isolates for their safety parameters. PMID:29238458

  10. Genes involved in virulence of the entomopathogenic fungus Beauveria bassiana.

    Science.gov (United States)

    Valero-Jiménez, Claudio A; Wiegers, Harm; Zwaan, Bas J; Koenraadt, Constantianus J M; van Kan, Jan A L

    2016-01-01

    Pest insects cause severe damage to global crop production and pose a threat to human health by transmitting diseases. Traditionally, chemical pesticides (insecticides) have been used to control such pests and have proven to be effective only for a limited amount of time because of the rapid spread of genetic insecticide resistance. The basis of this resistance is mostly caused by (co)dominant mutations in single genes, which explains why insecticide use alone is an unsustainable solution. Therefore, robust solutions for insect pest control need to be sought in alternative methods such as biological control agents for which single-gene resistance is less likely to evolve. The entomopathogenic fungus Beauveria bassiana has shown potential as a biological control agent of insects, and insight into the mechanisms of virulence is essential to show the robustness of its use. With the recent availability of the whole genome sequence of B. bassiana, progress in understanding the genetics that constitute virulence toward insects can be made more quickly. In this review we divide the infection process into distinct steps and provide an overview of what is currently known about genes and mechanisms influencing virulence in B. bassiana. We also discuss the need for novel strategies and experimental methods to better understand the infection mechanisms deployed by entomopathogenic fungi. Such knowledge can help improve biocontrol agents, not only by selecting the most virulent genotypes, but also by selecting the genotypes that use combinations of virulence mechanisms for which resistance in the insect host is least likely to develop. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Effect of Negative Pressure on Proliferation, Virulence Factor Secretion, Biofilm Formation, and Virulence-Regulated Gene Expression of Pseudomonas aeruginosa In Vitro

    Directory of Open Access Journals (Sweden)

    Guo-Qi Wang

    2016-01-01

    Full Text Available Objective. To investigate the effect of negative pressure conditions induced by NPWT on P. aeruginosa. Methods. P. aeruginosa was cultured in a Luria–Bertani medium at negative pressure of −125 mmHg for 24 h in the experimental group and at atmospheric pressure in the control group. The diameters of the colonies of P. aeruginosa were measured after 24 h. ELISA kit, orcinol method, and elastin-Congo red assay were used to quantify the virulence factors. Biofilm formation was observed by staining with Alexa Fluor® 647 conjugate of concanavalin A (Con A. Virulence-regulated genes were determined by quantitative RT-PCR. Results. As compared with the control group, growth of P. aeruginosa was inhibited by negative pressure. The colony size under negative pressure was significantly smaller in the experimental group than that in the controls (p<0.01. Besides, reductions in the total amount of virulence factors were observed in the negative pressure group, including exotoxin A, rhamnolipid, and elastase. RT-PCR results revealed a significant inhibition in the expression level of virulence-regulated genes. Conclusion. Negative pressure could significantly inhibit the growth of P. aeruginosa. It led to a decrease in the virulence factor secretion, biofilm formation, and a reduction in the expression level of virulence-regulated genes.

  12. Accessory genes confer a high replication rate to virulent feline immunodeficiency virus.

    Science.gov (United States)

    Troyer, Ryan M; Thompson, Jesse; Elder, John H; VandeWoude, Sue

    2013-07-01

    Feline immunodeficiency virus (FIV) is a lentivirus that causes AIDS in domestic cats, similar to human immunodeficiency virus (HIV)/AIDS in humans. The FIV accessory protein Vif abrogates the inhibition of infection by cat APOBEC3 restriction factors. FIV also encodes a multifunctional OrfA accessory protein that has characteristics similar to HIV Tat, Vpu, Vpr, and Nef. To examine the role of vif and orfA accessory genes in FIV replication and pathogenicity, we generated chimeras between two FIV molecular clones with divergent disease potentials: a highly pathogenic isolate that replicates rapidly in vitro and is associated with significant immunopathology in vivo, FIV-C36 (referred to here as high-virulence FIV [HV-FIV]), and a less-pathogenic strain, FIV-PPR (referred to here as low-virulence FIV [LV-FIV]). Using PCR-driven overlap extension, we produced viruses in which vif, orfA, or both genes from virulent HV-FIV replaced equivalent genes in LV-FIV. The generation of these chimeras is more straightforward in FIV than in primate lentiviruses, since FIV accessory gene open reading frames have very little overlap with other genes. All three chimeric viruses exhibited increased replication kinetics in vitro compared to the replication kinetics of LV-FIV. Chimeras containing HV-Vif or Vif/OrfA had replication rates equivalent to those of the virulent HV-FIV parental virus. Furthermore, small interfering RNA knockdown of feline APOBEC3 genes resulted in equalization of replication rates between LV-FIV and LV-FIV encoding HV-FIV Vif. These findings demonstrate that Vif-APOBEC interactions play a key role in controlling the replication and pathogenicity of this immunodeficiency-inducing virus in its native host species and that accessory genes act as mediators of lentiviral strain-specific virulence.

  13. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model.

    LENUS (Irish Health Repository)

    Monk, Ian R

    2010-01-01

    Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells.

  14. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Pathogen, E. coli O157:H7, virulence genes, antibiotic-resistance, beef meat. Correspondence: ... box to the laboratory for further processing. Isolation and identification of ... Technologies (IDT) Inc, U.S.A. The sequences and annealing ...

  15. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  16. Carbapenem-resistant Pseudomonas aeruginosa: association with virulence genes and biofilm formation

    Directory of Open Access Journals (Sweden)

    Iara Rossi Gonçalves

    Full Text Available Abstract Pseudomonas aeruginosa is an opportunistic pathogen that causes frequently nosocomial infections, currently becoming more difficult to treat due to the various resistance mechanisms and different virulence factors. The purpose of this study was to determine the risk factors independently associated with the development of bacteremia by carbapenem-resistant P. aeruginosa, the frequency of virulence genes in metallo-β-lactamases producers and to evaluate their ability to produce biofilm. We conducted a case–control study in the Uberlândia Federal University – Hospital Clinic, Brazil. Polymerase Chain Reaction was performed for metallo-β-lactamases and virulence genes. Adhesion and biofilm assays were done by quantitative tests. Among the 157 strains analyzed, 73.9% were multidrug-resistant, 43.9% were resistant to carbapenems, 16.1% were phenotypically positive for metallo-β-lactamases, and of these, 10.7% were positive for blaSPM gene and 5.3% positive for blaVIM. The multivariable analysis showed that mechanical ventilation, enteral/nasogastric tubes, primary bacteremia with unknown focus, and inappropriate therapy were independent risk factors associated with bacteremia. All tested strains were characterized as strongly biofilm producers. A higher mortality was found among patients with bacteremia by carbapenem-resistant P. aeruginosa strains, associated independently with extrinsic risk factors, however it was not evident the association with the presence of virulence and metallo-β-lactamases genes.

  17. Subinhibitory concentrations of antibiotics affect stress and virulence gene expression in Listeria monocytogenes and cause enhanced stress sensitivity but do not affect Caco‐2 cell invasion

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Holch, Anne; Gram, Lone

    2012-01-01

    with promoter fusions, 14 of 16 antibiotics induced or repressed expression of one or more stress and/or virulence genes. Despite ampicillin‐induced up‐regulation of PinlA‐lacZ expression, Caco‐2 cell invasion was not affected. Subinhibitory concentrations of ampicillin and tetracycline caused up‐ and down...

  18. Identification of virulence genes carried by bacteriophages obtained from clinically isolated methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Karasartova, Djursun; Cavusoglu, Zeynep Burcin; Turegun, Buse; Ozsan, Murat T; Şahin, Fikret

    2016-12-01

    Bacteriophages play an important role in the pathogenicity of Staphylococcus aureus (S. aureus) either by carrying accessory virulence factors or several superantigens. Despite their importance, there are not many studies showing the actual distribution of the virulence genes carried by the prophages obtained from the clinically isolated Staphylococcus. In this study, we investigated prophages obtained from methicillin-resistant S. aureus (MRSA) strains isolated from hospital- and community-associated (HA-CA) infections for the virulence factors. In the study, 43 phages isolated from 48 MRSA were investigated for carrying toxin genes including the sak, eta, lukF-PV, sea, selp, sek, seg, seq chp, and scn virulence genes using polymerase chain reaction (PCR) and Southern blot. Restriction fragment length polymorphism was used to analyze phage genomes to investigate the relationship between the phage profiles and the toxin genes' presence. MRSA strains isolated from HA infections tended to have higher prophage presence than the MRSA strains obtained from the CA infections (97% and 67%, respectively). The study showed that all the phages with the exception of one phage contained one or more virulence genes in their genomes with different combinations. The most common toxin genes found were sea (83%) followed by sek (77%) and seq (64%). The study indicates that prophages encode a significant proportion of MRSA virulence factors.

  19. Bacterial Human Virulence Genes across Diverse Habitats As Assessed by In silico Analysis of Environmental Metagenomes

    DEFF Research Database (Denmark)

    Søborg, Ditte A; Hendriksen, Niels B; Kilian, Mogens

    2016-01-01

    of natural environments in the evolution of bacterial virulence. Twenty four bacterial virulence genes were analyzed in 46 diverse environmental metagenomic datasets, representing various soils, seawater, freshwater, marine sediments, hot springs, the deep-sea, hypersaline mats, microbialites, gutless worms......The occurrence and distribution of clinically relevant bacterial virulence genes across natural (non-human) environments is not well understood. We aimed to investigate the occurrence of homologs to bacterial human virulence genes in a variety of ecological niches to better understand the role...... in non-human environments point to an important ecological role of the genes for the activity and survival of environmental bacteria. Furthermore, the high degree of sequence conservation between several of the environmental and clinical genes suggests common ancestral origins....

  20. Multiple plasmid-borne virulence genes of Clavibacter michiganensis ssp. capsici critical for disease development in pepper.

    Science.gov (United States)

    Hwang, In Sun; Oh, Eom-Ji; Kim, Donghyuk; Oh, Chang-Sik

    2018-02-01

    Clavibacter michiganensis ssp. capsici is a Gram-positive plant-pathogenic bacterium causing bacterial canker disease in pepper. Virulence genes and mechanisms of C. michiganensis ssp. capsici in pepper have not yet been studied. To identify virulence genes of C. michiganensis ssp. capsici, comparative genome analyses with C. michiganensis ssp. capsici and its related C. michiganensis subspecies, and functional analysis of its putative virulence genes during infection were performed. The C. michiganensis ssp. capsici type strain PF008 carries one chromosome (3.056 Mb) and two plasmids (39 kb pCM1 Cmc and 145 kb pCM2 Cmc ). The genome analyses showed that this bacterium lacks a chromosomal pathogenicity island and celA gene that are important for disease development by C. michiganensis ssp. michiganensis in tomato, but carries most putative virulence genes in both plasmids. Virulence of pCM1 Cmc -cured C. michiganensis ssp. capsici was greatly reduced compared with the wild-type strain in pepper. The complementation analysis with pCM1 Cmc -located putative virulence genes showed that at least five genes, chpE, chpG, ppaA1, ppaB1 and pelA1, encoding serine proteases or pectate lyase contribute to disease development in pepper. In conclusion, C. michiganensis ssp. capsici has a unique genome structure, and its multiple plasmid-borne genes play critical roles in virulence in pepper, either separately or together. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  1. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  2. Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny.

    Science.gov (United States)

    Adib, N; Ghanbarpour, R; Solatzadeh, H; Alizade, H

    2014-03-01

    Escherichia coli (E. coli) strains are the major cause of urinary tract infections (UTI) and belong to the large group of extra-intestinal pathogenic E. coli. The purposes of this study were to determine the antibiotic resistance profile, virulence genes and phylogenetic background of E. coli isolates from UTI cases. A total of 137 E. coli isolates were obtained from UTI samples. The antimicrobial susceptibility of confirmed isolates was determined by disk diffusion method against eight antibiotics. The isolates were examined to determine the presence and prevalence of selected virulence genes including iucD, sfa/focDE, papEF and hly. ECOR phylo-groups of isolates were determined by detection of yjaA and chuA genes and fragment TspE4.C2. The antibiogram results showed that 71% of the isolates were resistant to cefazolin, 60.42% to co-trimoxazole, 54.16% to nalidixic acid, 36.45% to gentamicin, 29.18% to ciprofloxacin, 14.58% to cefepime, 6.25% to nitrofurantoin and 0.00% to imipenem. Twenty-two antibiotic resistance patterns were observed among the isolates. Virulence genotyping of isolates revealed that 58.39% isolates had at least one of the four virulence genes. The iucD gene was the most prevalent gene (43.06%). The other genes including sfa/focDE, papEF and hly genes were detected in 35.76%, 18.97% and 2.18% isolates, respectively. Nine combination patterns of the virulence genes were detected in isolates. Phylotyping of 137 isolates revealed that the isolates fell into A (45.99%), B1 (13.14%), B2 (19.71%) and D (21.16%) groups. Phylotyping of multidrug resistant isolates indicated that these isolates are mostly in A (60.34%) and D (20.38%) groups. In conclusion, the isolates that possessed the iucD, sfa/focDE, papEF and hly virulence genes mostly belonged to A and B2 groups, whereas antibiotic resistant isolates were in groups A and D. Escherichia coli strains carrying virulence factors and antibiotic resistance are distributed in specific phylogenetic

  3. Virulence Factors and Antibiotic Susceptibility of Staphylococcus aureus Isolates in Ready-to-Eat Foods: Detection of S. aureus Contamination and a High Prevalence of Virulence Genes

    Directory of Open Access Journals (Sweden)

    Suat Moi Puah

    2016-02-01

    Full Text Available Staphylococcus aureus is one of the leading causes of food poisoning. Its pathogenicity results from the possession of virulence genes that produce different toxins which result in self-limiting to severe illness often requiring hospitalization. In this study of 200 sushi and sashimi samples, S. aureus contamination was confirmed in 26% of the food samples. The S. aureus isolates were further characterized for virulence genes and antibiotic susceptibility. A high incidence of virulence genes was identified in 96.2% of the isolates and 20 different virulence gene profiles were confirmed. DNA amplification showed that 30.8% (16/52 of the S. aureus carried at least one SE gene which causes staphylococcal food poisoning. The most common enterotoxin gene was seg (11.5% and the egc cluster was detected in 5.8% of the isolates. A combination of hla and hld was the most prevalent coexistence virulence genes and accounted for 59.6% of all isolates. Antibiotic resistance studies showed tetracycline resistance to be the most common at 28.8% while multi-drug resistance was found to be low at 3.8%. In conclusion, the high rate of S. aureus in the sampled sushi and sashimi indicates the need for food safety guidelines.

  4. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Virulence gene profiles of avian pathogenic Escherichia coli isolated from chickens with colibacillosis in Bulawayo, Zimbabwe

    Directory of Open Access Journals (Sweden)

    Joshua Mbanga

    2015-04-01

    Full Text Available Colibacillosis, a disease caused by avian pathogenic Escherichia coli (APEC, is one of the main causes of economic losses in the poultry industry worldwide. This study was carried out in order to determine the APEC-associated virulence genes contained by E. coli isolates causing colibacillosis in chickens. A total of 45 E. coli isolates were obtained from the diagnostics and research branch of the Central Veterinary Laboratories, Bulawayo, Zimbabwe. These isolates were obtained from chickens with confirmed cases of colibacillosis after postmortem examination. The presence of the iutA, hlyF, ompT, frz, sitD, fimH, kpsM, sitA, sopB, uvrY, pstB and vat genes were investigated by multiplex polymerase chain reaction (PCR assay. Of the 45 isolates, 93% were positive for the presence of at least one virulence gene. The three most prevalent virulence genes were iutA (80%, fimH (33.3% and hlyF (24.4%. The kpsM, pstB and ompT genes had the lowest prevalence, having been detected in only 2.2% of the isolates. All 12 virulence genes studied were detected in the 45 APEC isolates. Virulence gene profiles were constructed for each APEC isolate from the multiplex data. The APEC isolates were profiled as 62.2% fitting profile A, 31.1% profile B and 6.7% profile C. None of the isolates had more than seven virulence genes. Virulence profiles of Zimbabwean APEC isolates are different from those previously reported. Zimbabwean APEC isolates appear to be less pathogenic and may rely on environmental factors and stress in hosts to establish infection.

  6. A combination of independent transcriptional regulators shapes bacterial virulence gene expression during infection.

    Directory of Open Access Journals (Sweden)

    Samuel A Shelburne

    2010-03-01

    Full Text Available Transcriptional regulatory networks are fundamental to how microbes alter gene expression in response to environmental stimuli, thereby playing a critical role in bacterial pathogenesis. However, understanding how bacterial transcriptional regulatory networks function during host-pathogen interaction is limited. Recent studies in group A Streptococcus (GAS suggested that the transcriptional regulator catabolite control protein A (CcpA influences many of the same genes as the control of virulence (CovRS two-component gene regulatory system. To provide new information about the CcpA and CovRS networks, we compared the CcpA and CovR transcriptomes in a serotype M1 GAS strain. The transcript levels of several of the same genes encoding virulence factors and proteins involved in basic metabolic processes were affected in both DeltaccpA and DeltacovR isogenic mutant strains. Recombinant CcpA and CovR bound with high-affinity to the promoter regions of several co-regulated genes, including those encoding proteins involved in carbohydrate and amino acid metabolism. Compared to the wild-type parental strain, DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains were significantly less virulent in a mouse myositis model. Inactivation of CcpA and CovR alone and in combination led to significant alterations in the transcript levels of several key GAS virulence factor encoding genes during infection. Importantly, the transcript level alterations in the DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains observed during infection were distinct from those occurring during growth in laboratory medium. These data provide new knowledge regarding the molecular mechanisms by which pathogenic bacteria respond to environmental signals to regulate virulence factor production and basic metabolic processes during infection.

  7. The prevalence of virulence genes of E. coli strains isolated from children with urinary tract infection

    Directory of Open Access Journals (Sweden)

    Farshad Shohreh

    2009-01-01

    Full Text Available To evaluate the prevalence of virulence genes in E. coli strains isolated from urine samples of children with urinary tract infection(UTI and their correlation with clinical data, we iso-lated E. coli strains from urine samples of children with UTI during the period of August 2005 - August 2006 and studied them for the presence of the virulence genes by PCR. A total of 96 E. coli strains were isolated. The prevalence of genes, pyelonephritis associated pili (pap genes, S-family adhesions (sfa gene, hemolysin (hly gene, and cytotoxic nercotizing factor type 1 (cnf-1-1 gene among the isolated strains was 27.1%, 14.6%, 13.5% and 22.9 %, respectively. Pyelonephritis was more prevalent in the cases with positive virulence genes. The results showed significant correlation bet-ween age of the patient and the presence of the genes (P< 0.05. Cnf-1 gene was significantly more common in samples of patients with abnormal finding on the ultrasound of kidneys (P= 0.049. Our study demonstrated higher prevalence of pyelonephritis in the presence of E. coli virulence genes. Detection of the genes in urine samples may help in the management of UTI.

  8. The prevalence of virulence genes of E. coli strains isolated from children with urinary tract infection

    International Nuclear Information System (INIS)

    Farshad, Shohreh; Emamghorashi, Fatemeh

    2009-01-01

    To evaluate the prevalence of virulence genes in E. coli strains isolated from urine samples of children with urinary tract infection(UTI) and their correlation with clinical data, we isolated E. coli strains from urine samples of children with UTI during the period of August 2005 - August 2006 and studied them for the presence of the virulence genes by PCR. A total of 96 E. coli strains were isolated. The prevalence of genes, pyelonephritis associated pili (pap genes), S-family adhesions (sfa gene), hemolysin (hly gene), and cytotoxic nercotizing factor type 1 (cnf-1-1 gene) among the isolated strains was 27.1%, 14.6%, 13.5% and 22.9 %, respectively. Pyelonephritis was more prevalent in the cases with positive virulence genes. The results showed significant correlation between age of the patient and the presence of the genes (P< 0.05). Cnf-1 gene was significantly more common in samples of patients with abnormal finding on the ultrasound of kidneys (P0.049). Our study demonstrated higher prevalence of pyelonephritis in the presence of E. coli virulence genes. Detection of the genes in urine samples may help in the management of UTI. (author)

  9. Virulence factor genes possessing Enterococcus faecalis strains from rabbits and their sensitivity to enterocins

    Directory of Open Access Journals (Sweden)

    M. Pogány Simonová

    2017-03-01

    Full Text Available Information concerning the virulence factor genes and antibiotic resistance of rabbit enterococci is limited, so in this study we tested the virulence factor genes in Enterococcus faecalis strains from rabbits. Moreover, their resistance/sensitivity to antibiotics and sensitivity to enterocins was also tested, with the aim of contributing to our enterocin spectra study and to indicate the possibility of enterocin application in prevention or contaminant elimination in rabbit husbandry. A total of 144 rabbit samples were treated using a standard microbiological method. Thirty-one pure colonies of the species Enterococcus faecalis were identified, using the MALDI-TOF identification system and confirmed using phenotyping, among which 15 strains were virulence factor gene absent. The gelE gene was the most detected (42%; however, the expression of gelatinase phenotype did not always correlate with the detection of gelE. Strains did not show ß-haemolysis and were mostly resistant to tested antibiotics, but sensitive to enterocins (Ent, mainly to Ents EK13=A (P, 2019 and Ent M. Rabbit E. faecalis strains displayed antibiotic resistant traits and the presence of expressed and silent virulence genes, but they showed high levels of sensitivity to natural antimicrobials-enterocins, which indicates the possible prevention of multidrug and virulent enterococcal contaminants by enterocins.

  10. The Role of TonB Gene in Edwardsiella ictaluri Virulence

    Directory of Open Access Journals (Sweden)

    Hossam Abdelhamed

    2017-12-01

    Full Text Available Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen that causes enteric septicemia in catfish (ESC. Stress factors including poor water quality, poor diet, rough handling, overcrowding, and water temperature fluctuations increase fish susceptibility to ESC. The TonB energy transducing system (TonB-ExbB-ExbD and TonB-dependent transporters of Gram-negative bacteria support active transport of scarce resources including iron, an essential micronutrient for bacterial virulence. Deletion of the tonB gene attenuates virulence in several pathogenic bacteria. In the current study, the role of TonB (NT01EI_RS07425 in iron acquisition and E. ictaluri virulence were investigated. To accomplish this, the E. ictaluri tonB gene was in-frame deleted. Growth kinetics, iron utilization, and virulence of the EiΔtonB mutant were determined. Loss of TonB caused a significant reduction in bacterial growth in iron-depleted medium (p > 0.05. The EiΔtonB mutant grew similarly to wild-type E. ictaluri when ferric iron was added to the iron-depleted medium. The EiΔtonB mutant was significantly attenuated in catfish compared with the parent strain (21.69 vs. 46.91% mortality. Catfish surviving infection with EiΔtonB had significant protection against ESC compared with naïve fish (100 vs. 40.47% survival. These findings indicate that TonB participates in pathogenesis of ESC and is an important E. ictaluri virulence factor.

  11. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

    Science.gov (United States)

    Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

    2017-06-01

    This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

  12. Characterization of Listeria monocytogenes isolated from Ganges water, human clinical and milk samples at Varanasi, India.

    Science.gov (United States)

    Soni, Dharmendra K; Singh, Rakesh K; Singh, Durg V; Dubey, Suresh K

    2013-03-01

    Listeria monocytogenes isolated from Ganges water, human clinical and milk samples were characterized by antibiotic susceptibility, serotype identification, detection of virulence genes and ERIC- and REP-PCR fingerprint analyses. All isolates were uniformly resistant to ampicillin, except two isolates, and showed variable resistance to gentamicin, cotrimoxazole, ofloxacin, rifampicin and tetracycline. Of the 20 isolates found positive for pathogens, seven (four human and three water isolates) belong to serogroups 4b, 4d and 4e; six (one human and five water isolates) belong to serogroups 1/2c and 3c; four milk isolates belong to serogroups 1/2b and 3b; and three milk isolates belong to serogroups 1/2a and 3a. Two water isolates, all human isolates, except one (Pb1) lacking inlJ gene, and three milk isolates possess inlA, inlC, plcA, prfA, actA, hlyA and iap genes. The remaining water and milk isolates showed variable presence of inlJ, plcA, prfA, and iap genes. ERIC- and REP-PCR based analyses collectively indicated that isolates of human clinical samples belong to identical or similar clone and isolates of water and milk samples belong to different clones. Overall study demonstrates the prevalence of pathogenic L. monocytogenes species in the environmental and clinical samples. Most of the isolates were resistant to commonly used antibiotics. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain.

    Science.gov (United States)

    Guerrero-Ramos, Emilia; Cordero, Jorge; Molina-González, Diana; Poeta, Patrícia; Igrejas, Gilberto; Alonso-Calleja, Carlos; Capita, Rosa

    2016-02-01

    A total of 55 enterococci (45 Enterococcus faecium, 7 Enterococcus faecalis, and three Enterococcus durans) isolated from the meat of wild game animals (roe deer, boar, rabbit, pheasant, and pigeon) in North-Western Spain were tested for susceptibility to 14 antimicrobials by the disc diffusion method. All strains showed a multi-resistant phenotype (resistance to between three and 10 antimicrobials). The strains exhibited high percentages of resistance to erythromycin (89.1%), tetracycline (67.3%), ciprofloxacin (92.7%), nitrofurantoin (67.3%), and quinupristin-dalfopristin (81.8%). The lowest values (9.1%) were observed for high-level resistance to gentamicin, kanamycin, and streptomycin. The average number of resistances per strain was 5.8 for E. faecium isolates, 7.9 for E. faecalis, and 5.7 for E. durans. Genes encoding antimicrobial resistance and virulence were studied by polymerase chain reaction. A total of 15 (57.7%) of the 26 vancomycin-resistant isolates harboured the vanA gene. Other resistance genes detected included vanB, erm(B) and/or erm(C), tet(L) and/or tet(M), acc(6')-aph(2″), and aph(3')-IIIa in strains resistant to vancomycin, erythromycin, tetracycline, gentamicin, and kanamycin, respectively. Specific genes of the Tn5397 transposon were detected in 54.8% of the tet(M)-positive enterococci. Nine virulence factors (gelE, agg, ace, cpd, frs, esp, hyl, efaAfs and efaAfm) were studied. All virulence genes, with the exception of the frs gene, were found to be present in the enterococcal isolates. At least one virulence gene was detected in 20.0% of E. faecium, 71.4% of E. faecalis and 33.3% of E. durans isolates, with ace and cpd being the most frequently detected genes (6 isolates each). This suggests that wild game meat might play a role in the spreading through the food chain of enterococci with antimicrobial resistance and virulence determinants to humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Prevalence of clonal complexes and virulence genes among commensal and invasive Staphylococcus aureus isolates in Sweden.

    Directory of Open Access Journals (Sweden)

    Gunlög Rasmussen

    Full Text Available Staphylococcus aureus encodes a remarkable number of virulence factors which may contribute to its pathogenicity and ability to cause invasive disease. The main objective of this study was to evaluate the association between S. aureus invasiveness and bacterial genotype, in terms of the presence of virulence genes and affiliation to clonal complexes. Also, the significance of different virulence genes, mainly adhesins, for the development of infective endocarditis was investigated. DNA microarray technology was used to analyze 134 S. aureus isolates, all methicillin-susceptible, derived from three groups of clinically well-characterized patients: nasal carriers (n=46, bacteremia (n=55, and bacteremia with infective endocarditis (n=33. Invasive isolates were dominant in four of the major clonal complexes: 5, 8, 15, and 25. Of the 170 virulence genes examined, those encoding accessory gene regulator group II (agr II, capsule polysaccharide serotype 5 (cap5, and adhesins such as S. aureus surface protein G (sasG and fibronectin-binding protein B (fnbB were found to be associated with invasive disease. The same was shown for the leukocidin genes lukD/lukE, as well as the genes encoding serine protease A and B (splA/splB, staphylococcal complement inhibitor (scn and the staphylococcal exotoxin-like protein (setC or selX. In addition, there was a trend of higher prevalence of certain genes or gene clusters (sasG, agr II, cap5 among isolates causing infective endocarditis compared to other invasive isolates. In most cases, the presence of virulence genes was linked to clonal complex affiliation. In conclusion, certain S. aureus clonal lineages harboring specific sets of virulence genes seem to be more successful in causing invasive disease.

  15. A novel anti-virulence gene revealed by proteomic analysis in Shigella flexneri 2a

    Directory of Open Access Journals (Sweden)

    Ying Tianyi

    2010-06-01

    Full Text Available Abstract Background Shigella flexneri is a gram-negative, facultative pathogen that causes the majority of communicable bacterial dysenteries in developing countries. The virulence factors of S. flexneri have been shown to be produced at 37 degrees C but not at 30 degrees C. To discover potential, novel virulence-related proteins of S. flexneri, we performed differential in-gel electrophoresis (DIGE analysis to measure changes in the expression profile that are induced by a temperature increase. Results The ArgT protein was dramatically down-regulated at 37 degrees C. In contrast, the ArgT from the non-pathogenic E. coli did not show this differential expression as in S. flexneri, which suggested that argT might be a potential anti-virulence gene. Competitive invasion assays in HeLa cells and in BALB/c mice with argT mutants were performed, and the results indicated that the over-expression of ArgTY225D would attenuate the virulence of S. flexneri. A comparative proteomic analysis was subsequently performed to investigate the effects of ArgT in S. flexneri at the molecular level. We show that HtrA is differentially expressed among different derivative strains. Conclusion Gene argT is a novel anti-virulence gene that may interfere with the virulence of S. flexneri via the transport of specific amino acids or by affecting the expression of the virulence factor, HtrA.

  16. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  17. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

    Science.gov (United States)

    Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

    2016-04-16

    Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434

  18. Virulence Genes of S. aureus from Dairy Cow Mastitis and Contagiousness Risk.

    Science.gov (United States)

    Magro, Giada; Biffani, Stefano; Minozzi, Giulietta; Ehricht, Ralf; Monecke, Stefan; Luini, Mario; Piccinini, Renata

    2017-06-21

    Staphylococcus aureus ( S. aureus ) is a major agent of dairy cow intramammary infections: the different prevalences of mastitis reported might be related to a combination of S. aureus virulence factors beyond host factors. The present study considered 169 isolates from different Italian dairy herds that were classified into four groups based on the prevalence of S. aureus infection at the first testing: low prevalence (LP), medium-low (MLP), medium-high (MHP) and high (HP). We aimed to correlate the presence of virulence genes with the prevalence of intramammary infections in order to develop new strategies for the control of S. aureus mastitis. Microarray data were statistically evaluated using binary logistic regression and correspondence analysis to screen the risk factors and the relationship between prevalence group and gene. The analysis showed: (1) 24 genes at significant risk of being detected in all the herds with infection prevalence >5%, including genes belonging to microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), immune evasion and serine proteases; and (2) a significant correlation coefficient between the genes interacting with the host immune response and HP isolates against LP ones. These results support the hypothesis that virulence factors, in addition to cow management, could be related to strain contagiousness, offering new insights into vaccine development.

  19. Virulence Genes of S. aureus from Dairy Cow Mastitis and Contagiousness Risk

    Directory of Open Access Journals (Sweden)

    Giada Magro

    2017-06-01

    Full Text Available Staphylococcus aureus (S. aureus is a major agent of dairy cow intramammary infections: the different prevalences of mastitis reported might be related to a combination of S. aureus virulence factors beyond host factors. The present study considered 169 isolates from different Italian dairy herds that were classified into four groups based on the prevalence of S. aureus infection at the first testing: low prevalence (LP, medium–low (MLP, medium–high (MHP and high (HP. We aimed to correlate the presence of virulence genes with the prevalence of intramammary infections in order to develop new strategies for the control of S. aureus mastitis. Microarray data were statistically evaluated using binary logistic regression and correspondence analysis to screen the risk factors and the relationship between prevalence group and gene. The analysis showed: (1 24 genes at significant risk of being detected in all the herds with infection prevalence >5%, including genes belonging to microbial surface components recognizing adhesive matrix molecules (MSCRAMMs, immune evasion and serine proteases; and (2 a significant correlation coefficient between the genes interacting with the host immune response and HP isolates against LP ones. These results support the hypothesis that virulence factors, in addition to cow management, could be related to strain contagiousness, offering new insights into vaccine development.

  20. Bistable expression of virulence genes in salmonella leads to the formation of an antibiotic-tolerant subpopulation.

    Directory of Open Access Journals (Sweden)

    Markus Arnoldini

    2014-08-01

    Full Text Available Phenotypic heterogeneity can confer clonal groups of organisms with new functionality. A paradigmatic example is the bistable expression of virulence genes in Salmonella typhimurium, which leads to phenotypically virulent and phenotypically avirulent subpopulations. The two subpopulations have been shown to divide labor during S. typhimurium infections. Here, we show that heterogeneous virulence gene expression in this organism also promotes survival against exposure to antibiotics through a bet-hedging mechanism. Using microfluidic devices in combination with fluorescence time-lapse microscopy and quantitative image analysis, we analyzed the expression of virulence genes at the single cell level and related it to survival when exposed to antibiotics. We found that, across different types of antibiotics and under concentrations that are clinically relevant, the subpopulation of bacterial cells that express virulence genes shows increased survival after exposure to antibiotics. Intriguingly, there is an interplay between the two consequences of phenotypic heterogeneity. The bet-hedging effect that arises through heterogeneity in virulence gene expression can protect clonal populations against avirulent mutants that exploit and subvert the division of labor within these populations. We conclude that bet-hedging and the division of labor can arise through variation in a single trait and interact with each other. This reveals a new degree of functional complexity of phenotypic heterogeneity. In addition, our results suggest a general principle of how pathogens can evade antibiotics: Expression of virulence factors often entails metabolic costs and the resulting growth retardation could generally increase tolerance against antibiotics and thus compromise treatment.

  1. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    Directory of Open Access Journals (Sweden)

    Vanessa de Vasconcelos Byrne

    2016-06-01

    Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

  2. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  3. The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.

    Science.gov (United States)

    Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María

    2016-09-01

    The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

  4. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  5. A Bistable Switch and Anatomical Site Control Vibrio cholerae Virulence Gene Expression in the Intestine

    DEFF Research Database (Denmark)

    Nielsen, Alex Toftgaard; Dolganov, N. A.; Rasmussen, Thomas

    2010-01-01

    A fundamental, but unanswered question in host-pathogen interactions is the timing, localization and population distribution of virulence gene expression during infection. Here, microarray and in situ single cell expression methods were used to study Vibrio cholerae growth and virulence gene...... expression during infection of the rabbit ligated ileal loop model of cholera. Genes encoding the toxin-coregulated pilus (TCP) and cholera toxin (CT) were powerfully expressed early in the infectious process in bacteria adjacent to epithelial surfaces. Increased growth was found to co......, a chemical inducer of virulence gene expression. Striking bifurcation of the population occurred during entry into stationary phase: one subpopulation continued to express tcpA, whereas the expression declined in the other subpopulation. ctxA, encoding the A subunit of CT, and toxT, encoding the proximal...

  6. Evaluation of Antimicrobial Resistance and Virulence Genes in Uropathogenic Escherichia coli in Pediatric and Adult Patients

    Directory of Open Access Journals (Sweden)

    Kerem YILMAZ

    2017-06-01

    Full Text Available We aimed to evaluate the antimicrobial resistance patterns and the prevalence of certain virulence genes in uropathogenic E. coli isolated from pediatric and adult patients with uncomplicated urinary tract infection.We examined nonduplicate 83 uropathogenic E. coli isolated from mid-stream clean-catch urine samples of the pediatric and adult outpatients with the diagnosis of acute uncomplicated urinary tract infection. VITEK® 2 automated system (bioMerieux, Marcy l’Etoile, France was used for identification and determination of antimicrobial resistance. We examined the isolates in respect to their antimicrobial resistance patterns and the presence of virulence genes (pap, aer, sfa, hly and cnf-1. Antimicrobial susceptibility testing results of the E. coli isolates revealed that commonly used empiric antimicrobials (ciprofloxacin, trimethoprim–sulfamethoxazole, gentamicin, ampicillin and cephalothin for urinary tract infections were less effective than others. Most frequently detected virulence genes were pap and aer in both age groups. Sfa and hly genes were the least frequently detected genes in the pediatric age group; hly gene was the also the least common in the adult age group. There was no association with virulence factors and antimicrobial resistance patterns of the uropathogenic E. coli isolates in contrary to literature. More comprehensive studies with larger sample groups are needed to demonstrate the relation between virulence factors with antimicrobial drugs in different age groups.

  7. In vitro and in vivo invasiveness of different pulsed-field get electrophoresis types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Charlotte Nexmann; Nørrung, Birgit; Sommer, Helle Mølgaard

    2002-01-01

    The virulence of different pulsed-field gel electrophoresis (PFGE) types of Listeria monocytogenes was examined by monitoring their ability to invade Caco-2 cells. Strains belonging to seven different PFGE types originating from both foods and humans were included. No significant differences...

  8. A bistable switch and anatomical site control Vibrio cholerae virulence gene expression in the intestine.

    Directory of Open Access Journals (Sweden)

    Alex T Nielsen

    2010-09-01

    Full Text Available A fundamental, but unanswered question in host-pathogen interactions is the timing, localization and population distribution of virulence gene expression during infection. Here, microarray and in situ single cell expression methods were used to study Vibrio cholerae growth and virulence gene expression during infection of the rabbit ligated ileal loop model of cholera. Genes encoding the toxin-coregulated pilus (TCP and cholera toxin (CT were powerfully expressed early in the infectious process in bacteria adjacent to epithelial surfaces. Increased growth was found to co-localize with virulence gene expression. Significant heterogeneity in the expression of tcpA, the repeating subunit of TCP, was observed late in the infectious process. The expression of tcpA, studied in single cells in a homogeneous medium, demonstrated unimodal induction of tcpA after addition of bicarbonate, a chemical inducer of virulence gene expression. Striking bifurcation of the population occurred during entry into stationary phase: one subpopulation continued to express tcpA, whereas the expression declined in the other subpopulation. ctxA, encoding the A subunit of CT, and toxT, encoding the proximal master regulator of virulence gene expression also exhibited the bifurcation phenotype. The bifurcation phenotype was found to be reversible, epigenetic and to persist after removal of bicarbonate, features consistent with bistable switches. The bistable switch requires the positive-feedback circuit controlling ToxT expression and formation of the CRP-cAMP complex during entry into stationary phase. Key features of this bistable switch also were demonstrated in vivo, where striking heterogeneity in tcpA expression was observed in luminal fluid in later stages of the infection. When this fluid was diluted into artificial seawater, bacterial aggregates continued to express tcpA for prolonged periods of time. The bistable control of virulence gene expression points to a

  9. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  10. A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

    Science.gov (United States)

    Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

  11. Prevalence of Escherichia coli virulence genes in patients with ...

    African Journals Online (AJOL)

    In this study, we investigated the prevalence of the virulence genes specific for five major pathogroups of diarrheagenic Escherichia coli (DEC) in primary cultures from diarrhoeagenic patients in Burkina Faso. Methodology: From September 2016 to Mars 2017, a total of 211 faecal samples from diarrhoeagenic patients from ...

  12. Prevalence and characterization of Listeria monocytogenes, Salmonella and Shiga toxin-producing Escherichia coli isolated from small Mexican retail markets of queso fresco.

    Science.gov (United States)

    Soto Beltran, Marcela; Gerba, Charles P; Porto Fett, Anna; Luchansky, John B; Chaidez, Cristobal

    2015-01-01

    Queso fresco (QF) is a handmade cheese consumed and produced in Latin America. In Mexico, QF production is associated with a microbiological risk. The aim of the study was to determine the incidence and characterization of Listeria monocytogenes, Salmonella spp., and Shiga toxin-producing Escherichia coli (STEC) in QF from retail markets of the north-western State of Sinaloa, Mexico, and to assess the effect of physicochemical parameters on Listeria presence. A total of 75 QF samples were obtained. L. monocytogenes, E. coli, and coliforms were detected in 9.3, 94, and 100%, respectively. Salmonella was not detected. STEC isolates showed virulence genes. Microbial loads were above the maximum values recommended by the Official Mexican Standards. Physicochemical parameters such as water activity (aw), moisture content, pH, and salinity played a role in Listeria prevalence in QF. Rigorous control in QF made in Culiacan, Mexico is needed to reduce the risk of foodborne pathogens.

  13. The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as 'virulence genes'

    Directory of Open Access Journals (Sweden)

    Saunders Nigel J

    2006-05-01

    Full Text Available Abstract Background Neisseria meningitidis causes the life-threatening diseases meningococcal meningitis and meningococcal septicemia. Neisseria gonorrhoeae is closely related to the meningococcus, but is the cause of the very different infection, gonorrhea. A number of genes have been implicated in the virulence of these related yet distinct pathogens, but the genes that define and differentiate the species and their behaviours have not been established. Further, a related species, Neisseria lactamica is not associated with either type of infection in normally healthy people, and lives as a harmless commensal. We have determined which of the genes so far identified in the genome sequences of the pathogens are also present in this non-pathogenic related species. Results Thirteen unrelated strains of N. lactamica were investigated using comparative genome hybridization to the pan-Neisseria microarray-v2, which contains 2845 unique gene probes. The presence of 127 'virulence genes' was specifically addressed; of these 85 are present in N. lactamica. Of the remaining 42 'virulence genes' only 11 are present in all four of the sequenced pathogenic Neisseria. Conclusion Assessment of the complete dataset revealed that the vast majority of genes present in the pathogens are also present in N. lactamica. Of the 1,473 probes to genes shared by all four pathogenic genome sequences, 1,373 hybridize to N. lactamica. These shared genes cannot include genes that are necessary and sufficient for the virulence of the pathogens, since N. lactamica does not share this behaviour. This provides an essential context for the interpretation of gene complement studies of the pathogens.

  14. Listeria monocytogenes Sequence Types 121 and 14 Repeatedly Isolated Within One Year of Sampling in a Rabbit Meat Processing Plant: Persistence and Ecophysiology

    Directory of Open Access Journals (Sweden)

    Frédérique Pasquali

    2018-03-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1 assess persistence of L. monocytogenes isolates from the rabbit-plant; (2 select genes associated to physiological adaptation to the food-processing environment; (3 compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2 (alkaline and oxidative stress, qacH gene (resistance to benzalkonium chloride, cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride and a truncated version of actA gene (biofilm formation. Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2 including the ars operon (arsenic resistance and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride. Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121

  15. Listeria monocytogenes Sequence Types 121 and 14 Repeatedly Isolated Within One Year of Sampling in a Rabbit Meat Processing Plant: Persistence and Ecophysiology

    Science.gov (United States)

    Pasquali, Frédérique; Palma, Federica; Guillier, Laurent; Lucchi, Alex; De Cesare, Alessandra; Manfreda, Gerardo

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen adapted to survive and persist in multiple environments. Following two previous studies on prevalence and virulence of L. monocytogenes ST121 and ST14 repeatedly collected in a the same rabbit-meat processing plant, the research questions of the present study were to: (1) assess persistence of L. monocytogenes isolates from the rabbit-plant; (2) select genes associated to physiological adaptation to the food-processing environment; (3) compare presence/absence/truncation of these genes in newly sequenced and publicly available ST121 and ST14 genomes. A total of 273 draft genomes including ST121 and ST14 newly sequenced and publicly available draft genomes were analyzed. Whole-genome Single Nucleotide Polymorfism (wgSNP) analysis was performed separately on the assemblies of ST121 and ST14 draft genomes. SNPs alignments were used to infer phylogeny. A dataset of L. monocytogenes ecophysiology genes was built based on a comprehensive literature review. The 94 selected genes were screened on the assemblies of all ST121 and ST14 draft genomes. Significant gene enrichments were evaluated by statistical analyses. A persistent ST14 clone, including 23 out of 27 newly sequenced genomes, was circulating in the rabbit-meat plant along with two not persistent clones. A significant enrichment was observed in ST121 genomes concerning stress survival islet 2 (SSI-2) (alkaline and oxidative stress), qacH gene (resistance to benzalkonium chloride), cadA1C gene cassette (resistance to 70 mg/l of cadmium chloride) and a truncated version of actA gene (biofilm formation). Conversely, ST14 draft genomes were enriched with a full-length version of actA gene along with the Listeria Genomic Island 2 (LGI 2) including the ars operon (arsenic resistance) and the cadA4C gene cassette (resistance to 35 mg/l of cadmium chloride). Phenotypic tests confirmed ST121 as a weak biofilm producer in comparison to ST14. In conclusion, ST121 carried the

  16. Sporadic case of listeriosis associated with the consumption of a Listeria monocytogenes-contaminated 'Camembert' cheese.

    Science.gov (United States)

    Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G

    1997-09-01

    Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.

  17. Control of Listeria monocytogenes in goat's milk and goat's jben by the bacteriocinogenic Enterococcus faecium F58 strain.

    Science.gov (United States)

    Achemchem, Fouad; Abrini, Jamal; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes

    2006-10-01

    The bacteriocinogenic Enterococcus faecium F58 strain, a natural goat's jben cheese isolate, lacks decarboxylase activity involved in most biogenic amine formation. It was also sensitive to 13 antibiotics assayed and free of virulence and vancomycin resistance genes. The F58 strain reached the stationary phase after 12 h of growth in sterile goat's milk, and the production of enterocin F-58 (Ent L50) was first detected after 48 h (400 AU/ml), thereafter remaining stable up to 5 days. The effectiveness of the F58 strain in controlling Listeria monocytogenes serovar 4b in reduced fat and whole goat's milk, and in goat's jben has been examined. Coculture experiments of F58-L. monocytogenes in both types of milk demonstrated that listeriae were not eliminated, although reductions by 1 to 4 log units were found. Nevertheless, when the F58 strain was previously inoculated in whole milk and left to grow for 12 h before contamination, the pathogen was completely eliminated after 130 h of coculture. Production of jben cheese contaminated with L. monocytogenes prior to packaging, using preparations of F58-producer strain, caused a significant decrease in the number of viable listeriae, which were undetectable after 1 week of cheese storage at 22 degrees C. Altogether, results from this study suggest that E. faecium F58 strain may be used as an adjunct culture in cheese to control contamination and growth of L. monocytogenes by in situ enterocin production, thus providing an additional hurdle to enhance control of this pathogen.

  18. Coliform bacteria isolated from recreational lakes carry class 1 and class 2 integrons and virulence-associated genes.

    Science.gov (United States)

    Koczura, R; Krysiak, N; Taraszewska, A; Mokracka, J

    2015-08-01

    To characterize the integron-harbouring Gram-negative bacteria in recreational lakes, with focus on the genetic content of integrons, antimicrobial resistance profiles and virulence-associated genes. The presence and structure of integrons in coliform bacteria isolated from the water of four recreational lakes located in Poznań, Poland, was determined by PCR method. Antimicrobial resistance testing was done by disc diffusion method. Virulence-associated genes in integron-bearing Escherichia coli isolates were detected by PCR. A total of 155 integron-bearing strains of coliform bacteria were cultured. Sequence analysis showed the presence of dfrA7, aadA1, dfrA1-aadA1, dfrA17-aadA5 and dfrA12-orfF-aadA2 gene cassette arrays in class 1 integrons and dfrA1-sat2-aadA1 in class 2 integrons. Higher frequency of integron-positive bacteria and higher antimicrobial resistance ranges were noted in colder months (January and November) compared with spring and summer months. The integron-harbouring E. coli carried up to nine virulence-associated genes, with the highest frequency of kpsMT (84.6%) and traT (783%), coding for group 2 capsule and determining human serum resistance respectively. Integron-bearing multidrug resistant coliform bacteria carrying virulence genes are present in waters of recreational lakes. This study presents antimicrobial resistance and virulence-associated genes in integron-bearing coliform bacteria present in the waters of recreational lakes, which showed that multidrug resistant bacteria with virulence traits might pose a threat to public health. Moreover, the presence of genes typical for enterotoxigenic and Shiga toxin-producing E. coli is a concern. © 2015 The Society for Applied Microbiology.

  19. Genetic diversity and virulence genes in Streptococcus uberis strains isolated from bovine mastitis

    Directory of Open Access Journals (Sweden)

    Rafael Ambrósio Loures

    2017-08-01

    Full Text Available Mastitis is one of the most common and costly infectious diseases in dairy cattle worldwide. This is a multifactorial illness caused by different microorganisms, including virus, yeasts, algae, parasites, and several species of bacteria. Among these bacteria, Streptococcus uberis is an important environmental pathogen that is responsible for a large range of clinical and subclinical mammary infections, especially in intensively managed herds. Despite the increasing importance of this pathogen in the etiology of bovine mastitis, data on its virulence and diversity in Brazilian dairy herds are scarce. The aims of the present study were to investigate the virulence characteristics of S. uberis isolated from bovine mastitis and to assess the molecular epidemiology of the Brazilian isolates using pulsed-field gel electrophoresis (PFGE. In this work, 46 strains of S. uberis isolated from bovine mastitis from 26 Brazilian dairy herds were evaluated regarding their genetic diversity by PFGE using with the SmaI enzyme. Additionally, the presence of the virulence genes skc and pauA, which encode plasminogen activators, and the gene sua, which encodes an adhesion molecule in mammary epithelial cells, were assessed by PCR. Our results showed a high genetic diversity in the population, displaying many different patterns in the PFGE analysis. A high proportion of strains was positive for virulence genes in the sampled population (sua [100%], pauA [91%], and skc [91%]. The high frequency of skc, pauA, and sua genes among the studied strains suggests the importance of these virulence factors, possibly helping S. uberis in the colonization of the bovine mammary gland. Surveys of the genetic and molecular characteristics of this pathogen can improve our knowledge of bacterial activity and identify molecules that have roles in the establishment of the infection. This might help in the development of more effective measures to control and prevent bovine mastitis.

  20. Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

    Science.gov (United States)

    de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

    2018-04-12

    Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

  1. Network analysis of S. aureus response to ramoplanin reveals modules for virulence factors and resistance mechanisms and characteristic novel genes.

    Science.gov (United States)

    Subramanian, Devika; Natarajan, Jeyakumar

    2015-12-10

    Staphylococcus aureus is a major human pathogen and ramoplanin is an antimicrobial attributed for effective treatment. The goal of this study was to examine the transcriptomic profiles of ramoplanin sensitive and resistant S. aureus to identify putative modules responsible for virulence and resistance-mechanisms and its characteristic novel genes. The dysregulated genes were used to reconstruct protein functional association networks for virulence-factors and resistance-mechanisms individually. Strong link between metabolic-pathways and development of virulence/resistance is suggested. We identified 15 putative modules of virulence factors. Six hypothetical genes were annotated with novel virulence activity among which SACOL0281 was discovered to be an essential virulence factor EsaD. The roles of MazEF toxin-antitoxin system, SACOL0202/SACOL0201 two-component system and that of amino-sugar and nucleotide-sugar metabolism in virulence are also suggested. In addition, 14 putative modules of resistance mechanisms including modules of ribosomal protein-coding genes and metabolic pathways such as biotin-synthesis, TCA-cycle, riboflavin-biosynthesis, peptidoglycan-biosynthesis etc. are also indicated. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Comparisons of Salmonella conjugation and virulence gene hyperexpression mediated by rumen protozoa from domestic and exotic ruminants.

    Science.gov (United States)

    Brewer, Matt T; Xiong, Nalee; Dier, Jeffery D; Anderson, Kristi L; Rasmussen, Mark A; Franklin, Sharon K; Carlson, Steve A

    2011-08-05

    Recent studies have identified a phenomenon in which ciliated protozoa engulf Salmonella and the intra-protozoal environment hyperactivates virulence gene expression and provides a venue for conjugal transfer of antibiotic resistance plasmids. The former observation is relegated to Salmonella bearing the SGI1 multiresistance integron while the latter phenomenon appears to be a more generalized event for recipient Salmonella. Our previous studies have assessed virulence gene hyperexpression only with protozoa from the bovine rumen while conjugal transfer has been demonstrated in rumen protozoa from cattle and goats. The present study examined virulence gene hyperexpression for Salmonella exposed to rumen protozoa obtained from cattle, sheep, goats, or two African ruminants (giraffe and bongo). Conjugal transfer was also assessed in these protozoa using Salmonella as the recipient. Virulence gene hyperexpression was only observed following exposure to the rumen protozoa from cattle and sheep while elevated virulence was also observed in these animals. Conjugal transfer events were, however, observed in all protozoa evaluated. It therefore appears that the protozoa-based hypervirulence is not universal to all ruminants while conjugal transfer is more ubiquitous. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

    Science.gov (United States)

    de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

    2016-01-01

    Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  4. Haemophilus ducreyi Hfq contributes to virulence gene regulation as cells enter stationary phase.

    Science.gov (United States)

    Gangaiah, Dharanesh; Labandeira-Rey, Maria; Zhang, Xinjun; Fortney, Kate R; Ellinger, Sheila; Zwickl, Beth; Baker, Beth; Liu, Yunlong; Janowicz, Diane M; Katz, Barry P; Brautigam, Chad A; Munson, Robert S; Hansen, Eric J; Spinola, Stanley M

    2014-02-11

    To adapt to stresses encountered in stationary phase, Gram-negative bacteria utilize the alternative sigma factor RpoS. However, some species lack RpoS; thus, it is unclear how stationary-phase adaptation is regulated in these organisms. Here we defined the growth-phase-dependent transcriptomes of Haemophilus ducreyi, which lacks an RpoS homolog. Compared to mid-log-phase organisms, cells harvested from the stationary phase upregulated genes encoding several virulence determinants and a homolog of hfq. Insertional inactivation of hfq altered the expression of ~16% of the H. ducreyi genes. Importantly, there were a significant overlap and an inverse correlation in the transcript levels of genes differentially expressed in the hfq inactivation mutant relative to its parent and the genes differentially expressed in stationary phase relative to mid-log phase in the parent. Inactivation of hfq downregulated genes in the flp-tad and lspB-lspA2 operons, which encode several virulence determinants. To comply with FDA guidelines for human inoculation experiments, an unmarked hfq deletion mutant was constructed and was fully attenuated for virulence in humans. Inactivation or deletion of hfq downregulated Flp1 and impaired the ability of H. ducreyi to form microcolonies, downregulated DsrA and rendered H. ducreyi serum susceptible, and downregulated LspB and LspA2, which allow H. ducreyi to resist phagocytosis. We propose that, in the absence of an RpoS homolog, Hfq serves as a major contributor of H. ducreyi stationary-phase and virulence gene regulation. The contribution of Hfq to stationary-phase gene regulation may have broad implications for other organisms that lack an RpoS homolog. Pathogenic bacteria encounter a wide range of stresses in their hosts, including nutrient limitation; the ability to sense and respond to such stresses is crucial for bacterial pathogens to successfully establish an infection. Gram-negative bacteria frequently utilize the alternative sigma

  5. Virulence-associated gene pattern of porcine and human Yersinia enterocolitica biotype 4 isolates.

    Science.gov (United States)

    Schneeberger, M; Brodard, I; Overesch, G

    2015-04-02

    Yersinia enterocolitica 4/O:3 is the most important human pathogenic bioserotype in Europe and the predominant pathogenic bioserotype in slaughter pigs. Although many studies on the virulence of Y. enterocolitica strains have showed a broad spectrum of detectable factors in pigs and humans, an analysis based on a strict comparative approach and serving to verify the virulence capability of porcine Y. enterocolitica as a source for human yersiniosis is lacking. Therefore, in the present study, strains of biotype (BT) 4 isolated from Swiss slaughter pig tonsils and feces and isolates from human clinical cases were compared in terms of their spectrum of virulence-associated genes (yadA, virF, ail, inv, rovA, ymoA, ystA, ystB and myfA). An analysis of the associated antimicrobial susceptibility pattern completed the characterization. All analyzed BT 4 strains showed a nearly similar pattern, comprising the known fundamental virulence-associated genes yadA, virF, ail, inv, rovA, ymoA, ystA and myfA. Only ystB was not detectable among all analyzed isolates. Importantly, neither the source of the isolates (porcine tonsils and feces, humans) nor the serotype (ST) had any influence on the gene pattern. From these findings, it can be concluded that the presence of the full complement of virulence genes necessary for human infection is common among porcine BT 4 strains. Swiss porcine BT 4 strains not only showed antimicrobial susceptibility to chloramphenicol, cefotaxime, ceftazidime, ciprofloxacin, colistin, florfenicol, gentamicin, kanamycin, nalidixic acid, sulfamethoxazole, streptomycin, tetracycline and trimethoprim but also showed 100% antibiotic resistance to ampicillin. The human BT 4 strains revealed comparable results. However, in addition to 100% antibiotic resistance to ampicillin, 2 strains were resistant to chloramphenicol and nalidixic acid. Additionally, 1 of these strains was resistant to sulfamethoxazole. The results demonstrated that Y. enterocolitica BT 4

  6. Detection of virulence genes and the phylogenetic groups of Escherichia coli isolated from dogs in Brazil

    Directory of Open Access Journals (Sweden)

    Fernanda Morcatti Coura

    2018-02-01

    Full Text Available ABSTRACT: This study identified the virulence genes, pathovars, and phylogenetic groups of Escherichia coli strains obtained from the feces of dogs with and without diarrhea. Virulence genes and phylogenetic group identification were studied using polymerase chain reaction. Thirty-seven E. coli isolates were positive for at least one virulence factor gene. Twenty-one (57.8% of the positive isolates were isolated from diarrheal feces and sixteen (43.2% were from the feces of non-diarrheic dogs. Enteropathogenic E. coli (EPEC were the most frequently (62.2% detected pathovar in dog feces and were mainly from phylogroup B1 and E. Necrotoxigenic E. coli were detected in 16.2% of the virulence-positive isolates and these contained the cytotoxic necrotizing factor 1 (cnf1 gene and were classified into phylogroups B2 and D. All E. coli strains were negative for the presence of enterotoxigenic E. coli (ETEC enterotoxin genes, but four strains were positive for ETEC-related fimbriae 987P and F18. Two isolates were Shiga toxin-producing E. coli strains and contained the toxin genesStx2 or Stx2e, both from phylogroup B1. Our data showed that EPEC was the most frequent pathovar and B1 and E were the most common phylogroups detected in E. coli isolated from the feces of diarrheic and non-diarrheic dogs.

  7. Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

    2013-04-01

    Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

  8. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  9. Different distribution patterns of ten virulence genes in Legionella reference strains and strains isolated from environmental water and patients.

    Science.gov (United States)

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-04-01

    Virulence genes are distinct regions of DNA which are present in the genome of pathogenic bacteria and absent in nonpathogenic strains of the same or related species. Virulence genes are frequently associated with bacterial pathogenicity in genus Legionella. In the present study, an assay was performed to detect ten virulence genes, including iraA, iraB, lvrA, lvrB, lvhD, cpxR, cpxA, dotA, icmC and icmD in different pathogenicity islands of 47 Legionella reference strains, 235 environmental strains isolated from water, and 4 clinical strains isolated from the lung tissue of pneumonia patients. The distribution frequencies of these genes in reference or/and environmental L. pneumophila strains were much higher than those in reference non-L. pneumophila or/and environmental non-L. pneumophila strains, respectively. L. pneumophila clinical strains also maintained higher frequencies of these genes compared to four other types of Legionella strains. Distribution frequencies of these genes in reference L. pneumophila strains were similar to those in environmental L. pneumophila strains. In contrast, environmental non-L. pneumophila maintained higher frequencies of these genes compared to those found in reference non-L. pneumophila strains. This study illustrates the association of virulence genes with Legionella pathogenicity and reveals the possible virulence evolution of non-L. pneumophia strains isolated from environmental water.

  10. Lvr, a Signaling System That Controls Global Gene Regulation and Virulence in Pathogenic Leptospira

    Science.gov (United States)

    Adhikarla, Haritha; Wunder, Elsio A.; Mechaly, Ariel E.; Mehta, Sameet; Wang, Zheng; Santos, Luciane; Bisht, Vimla; Diggle, Peter; Murray, Gerald; Adler, Ben; Lopez, Francesc; Townsend, Jeffrey P.; Groisman, Eduardo; Picardeau, Mathieu; Buschiazzo, Alejandro; Ko, Albert I.

    2018-01-01

    Leptospirosis is an emerging zoonotic disease with more than 1 million cases annually. Currently there is lack of evidence for signaling pathways involved during the infection process of Leptospira. In our comprehensive genomic analysis of 20 Leptospira spp. we identified seven pathogen-specific Two-Component System (TCS) proteins. Disruption of two these TCS genes in pathogenic Leptospira strain resulted in loss-of-virulence in a hamster model of leptospirosis. Corresponding genes lvrA and lvrB (leptospira virulence regulator) are juxtaposed in an operon and are predicted to encode a hybrid histidine kinase and a hybrid response regulator, respectively. Transcriptome analysis of lvr mutant strains with disruption of one (lvrB) or both genes (lvrA/B) revealed global transcriptional regulation of 850 differentially expressed genes. Phosphotransfer assays demonstrated that LvrA phosphorylates LvrB and predicted further signaling downstream to one or more DNA-binding response regulators, suggesting that it is a branched pathway. Phylogenetic analyses indicated that lvrA and lvrB evolved independently within different ecological lineages in Leptospira via gene duplication. This study uncovers a novel-signaling pathway that regulates virulence in pathogenic Leptospira (Lvr), providing a framework to understand the molecular bases of regulation in this life-threatening bacterium. PMID:29600195

  11. Yersinia enterocolitica of porcine origin: carriage of virulence genes and genotypic diversity.

    Science.gov (United States)

    Tadesse, Daniel A; Bahnson, Peter B; Funk, Julie A; Morrow, W E Morgan; Abley, Melanie J; Ponte, Valeria A; Thakur, Siddhartha; Wittum, Thomas; DeGraves, Fred J; Rajala-Schultz, Paivi J; Gebreyes, Wondwossen A

    2013-01-01

    Yersinia enterocolitica is an important foodborne pathogen, and pigs are recognized as a major reservoir and potential source of pathogenic strains to humans. A total of 172 Y. enterocolitica recovered from conventional and antimicrobial-free pig production systems from different geographic regions (North Carolina, Ohio, Michigan, Wisconsin, and Iowa) were investigated to determine their pathogenic significance to humans. Phenotypic and genotypic diversity of the isolates was assessed using antibiogram, serogrouping, and amplified fragment length polymorphism (AFLP). Carriage of chromosomal and plasmid-borne virulence genes were investigated using polymerase chain reaction. A total of 12 antimicrobial resistance patterns were identified. More than two-thirds (67.4%) of Y. enterocolitica were pan-susceptible, and 27.9% were resistant against β-lactams. The most predominant serogroup was O:3 (43%), followed by O:5 (25.6%) and O:9 (4.1%). Twenty-two of 172 (12.8%) isolates were found to carry Yersinia adhesion A (yadA), a virulence gene encoded on the Yersinia virulence plasmid. Sixty-nine (40.1%) isolates were found to carry ail gene. The ystA and ystB genes were detected in 77% and 26.2% of the strains, respectively. AFLP genotyping of isolates showed wide genotypic diversity and were grouped into nine clades with an overall genotypic similarity of 66.8-99.3%. AFLP analysis revealed that isolates from the same production system showed clonal relatedness, while more than one genotype of Y. enterocolitica circulates within a farm.

  12. Prevalence of diarrheagenic Escherichia coli virulence genes in the feces of slaughtered cattle, chickens, and pigs in Burkina Faso

    Science.gov (United States)

    Kagambèga, Assèta; Martikainen, Outi; Siitonen, Anja; Traoré, Alfred S; Barro, Nicolas; Haukka, Kaisa

    2012-01-01

    We investigated the prevalence of the virulence genes specific for five major pathogroups of diarrheagenic Escherichia coli (DEC) in primary cultures from feces of animals slaughtered for human consumption in Burkina Faso. For the study, 704 feces samples were collected from cattle (n = 304), chickens (n = 350), and pigs (n = 50) during carcass processing. The presence of the virulence-associated genes in the mixed bacterial cultures was assessed using 16-plex polymerase chain reaction (PCR). Virulence genes indicating presence of DEC were detected in 48% of the cattle, 48% of the chicken, and 68% of the pig feces samples. Virulence genes specific for different DECs were detected in the following percentages of the cattle, chicken, and pig feces samples: Shiga toxin-producing E. coli (STEC) in 37%, 6%, and 30%; enteropathogenic E. coli (EPEC) in 8%, 37%, and 32%; enterotoxigenic E. coli (ETEC) in 4%, 5%, and 18%; and enteroaggregative E. coli (EAEC) in 7%, 6%, and 32%. Enteroinvasive E. coli (EIEC) virulence genes were detected in 1% of chicken feces samples only. The study was the first of its kind in Burkina Faso and revealed the common occurrence of the diarrheal virulence genes in feces of food animals. This indicates that food animals are reservoirs of DEC that may contaminate meat because of the defective slaughter and storage conditions and pose a health risk to the consumers in Burkina Faso. PMID:23170227

  13. Virulence factors genes of Staphylococcus spp. isolated from caprine subclinical mastitis.

    Science.gov (United States)

    Salaberry, Sandra Renata Sampaio; Saidenberg, André Becker Simões; Zuniga, Eveline; Melville, Priscilla Anne; Santos, Franklin Gerônimo Bispo; Guimarães, Ednaldo Carvalho; Gregori, Fábio; Benites, Nilson Roberti

    2015-08-01

    The aim of this study was to investigate genes involved in adhesion expression, biofilm formation, and enterotoxin production in isolates of Staphylococcus spp. from goats with subclinical mastitis and associate these results with the staphylococcal species. One hundred and twenty-four isolates were identified and polymerase chain reaction (PCR) was performed to detect the following genes: cna, ebpS, eno, fib, fnbA, fnbB, bap, sea, seb, sec, sed and see. The most commonly Staphylococcus species included S. epidermidis, S. lugdunensis, S. chromogenes, S. capitis ss capitis and S. intermedius. With the exception of fnbB, the genes were detected in different frequencies of occurrence in 86.3% of the Staphylococcus spp. isolates. Eno (73.2%) and bap (94.8%) were more frequently detected in coagulase-negative staphylococci (CNS); ebpS (76%), fib (90.9%) and fnbA (87%) were the most frequent genes in coagulase-positive staphylococci (CPS). Regarding enterotoxins, genes sed (28.2%) and see (24.2%) had a higher frequency of occurrence; sec gene was more frequently detected in CPS (58.8%). There was no association between the presence of the genes and the Staphylococcus species. Different virulence factors genes can be detected in caprine subclinical mastitis caused by CNS and CPS. The knowledge of the occurrence of these virulence factors is important for the development of effective control and prevention measures of subclinical mastitis caused by CNS and CPS in goats. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Recruitment of the major vault protein by InlK: a Listeria monocytogenes strategy to avoid autophagy.

    Directory of Open Access Journals (Sweden)

    Laurent Dortet

    2011-08-01

    Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.

  15. Temperature and Oxidative Stress as Triggers for Virulence Gene Expression in Pathogenic Leptospira spp.

    Directory of Open Access Journals (Sweden)

    Tricia Fraser

    2017-05-01

    Full Text Available Leptospirosis is a zooanthroponosis aetiologically caused by pathogenic bacteria belonging to the genus, Leptospira. Environmental signals such as increases in temperatures or oxidative stress can trigger response regulatory modes of virulence genes during infection. This study sought to determine the effect of temperature and oxidative stress on virulence associated genes in highly passaged Leptospira borgpeterseneii Jules and L. interrogans Portlandvere. Bacteria were grown in EMJH at 30°C, 37°C, or at 30°C before being transferred to 37°C. A total of 14 virulence-associated genes (fliY, invA, lenA, ligB, lipL32, lipL36, lipL41, lipL45, loa22, lsa21, mce, ompL1, sph2, and tlyC were assessed using endpoint PCR. Transcriptional analyses of lenA, lipL32, lipL41, loa22, sph2 were assessed by quantitative real-time RT-PCR at the temperature conditions. To assess oxidative stress, bacteria were exposed to H2O2 for 30 and 60 min with or without the temperature stress. All genes except ligB (for Portlandvere and ligB and mce (for Jules were detectable in the strains. Quantitatively, temperature stress resulted in significant changes in gene expression within species or between species. Temperature changes were more influential in gene expression for Jules, particularly at 30°C and upshift conditions; at 37°C, expression levels were higher for Portlandvere. However, compared to Jules, where temperature was influential in two of five genes, temperature was an essential element in four of five genes in Portlandvere exposed to oxidative stress. At both low and high oxidative stress levels, the interplay between genetic predisposition (larger genome size and temperature was biased towards Portlandvere particularly at 30°C and upshift conditions. While it is clear that expression of many virulence genes in highly passaged strains of Leptospira are attenuated or lost, genetic predisposition, changes in growth temperature and/or oxidative intensity and

  16. Virulence meets metabolism: Cra and KdpE gene regulation in enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    Njoroge, Jacqueline W; Nguyen, Y; Curtis, Meredith M; Moreira, Cristiano G; Sperandio, Vanessa

    2012-10-16

    Gastrointestinal (GI) bacteria sense diverse environmental signals as cues for differential gene regulation and niche adaptation. Pathogens such as enterohemorrhagic Escherichia coli (EHEC), which causes bloody diarrhea, use these signals for the temporal and energy-efficient regulation of their virulence factors. One of the main virulence strategies employed by EHEC is the formation of attaching and effacing (AE) lesions on enterocytes. Most of the genes necessary for the formation of these lesions are grouped within a pathogenicity island, the locus of enterocyte effacement (LEE), whose expression requires the LEE-encoded regulator Ler. Here we show that growth of EHEC in glycolytic environments inhibits the expression of ler and consequently all other LEE genes. Conversely, growth within a gluconeogenic environment activates expression of these genes. This sugar-dependent regulation is achieved through two transcription factors: KdpE and Cra. Both Cra and KdpE directly bind to the ler promoter, and Cra's affinity to this promoter is catabolite dependent. Moreover, we show that the Cra and KdpE proteins interact in vitro and that KdpE's ability to bind DNA is enhanced by the presence of Cra. Cra is important for AE lesion formation, and KdpE contributes to this Cra-dependent regulation. The deletion of cra and kdpE resulted in the ablation of AE lesions. One of the many challenges that bacteria face within the GI tract is to successfully compete for carbon sources. Linking carbon metabolism to the precise coordination of virulence expression is a key step in the adaptation of pathogens to the GI environment. IMPORTANCE An appropriate and prompt response to environmental cues is crucial for bacterial survival. Cra and KdpE are two proteins found in both nonpathogenic and pathogenic bacteria that regulate genes in response to differences in metabolite concentration. In this work, we show that, in the deadly pathogen enterohemorrhagic Escherichia coli (EHEC) O157:H7

  17. Phenotypic and genotypic antimicrobial resistance and virulence genes of Salmonella enterica isolated from pet dogs and cats

    Science.gov (United States)

    Srisanga, Songsak; Angkititrakul, Sunpetch; Sringam, Patcharee; Le Ho, Phuong T.; Vo, An T. T.

    2017-01-01

    Salmonella enterica isolates (n = 122), including 32 serotypes from 113 dogs and 9 cats, were obtained from household dogs (n = 250) and cats (n = 50) during 2012–2015. The isolates were characterized by serotyping, antimicrobial resistance phenotyping and genotyping, and virulence gene screening. Serovars Weltevreden (15.6%) and Typhimurium (13.9%) were the most common. The majority (43%) of the isolates were multidrug resistant. The dog isolates (12.3%) harbored class 1 integrons, of which the dfrA12-aadA2 cassette was most frequent (66.7%). The only class integron in serovar Albany was located on a conjugative plasmid. Two ESBL-producing isolates (i.e., a serovar Krefeld and a serovar Enteritridis) carried blaTEM and blaCTX-M, and the blaTEM gene in both was horizontally transferred. Of the plasmid-mediated quinolone resistance genes tested, only qnrS (4.9%) was detected. Most Salmonella isolates harbored invA (100%), prgH (91.8%), and sipB (91%). Positive associations between resistance and virulence genes were observed for blaPSE-1/orgA, cmlA/spaN, tolC, and sul1/tolC (p resistance and virulence genes and that antimicrobial use in companion animals may select for the examined Salmonella virulence factors. PMID:27586467

  18. Genetic characteristics of Japanese clinical Listeria monocytogenes isolates.

    Directory of Open Access Journals (Sweden)

    Satoko Miya

    Full Text Available Listeria monocytogenes causes foodborne illnesses through consumption of ready-to-eat foods. Although 135-201annual listeriosis cases have been estimated in Japan, the details regarding the clinical isolates such as infection source, virulence level, and other genetic characteristics, are not known. In order to uncover the trends of listeriosis in Japan and use the knowledge for prevention measures to be taken, the genetic characteristics of the past human clinical isolates needs to be elucidated. For this purpose, multilocus tandem-repeat sequence analysis (MLTSA and multi-virulence-locus sequence typing (MVLST were used in this study. The clinical isolates showed a variety of genetically distant genotypes, indicating they were from sporadic cases. However, the MVLST profiles of 7 clinical isolates were identical to those of epidemic clone (EC I isolates, which have caused several serious outbreaks in other countries, suggesting the possibility that they have strong virulence potential and originated from a single outbreak. Moreover, 6 Japanese food isolates shared their genotypes with ECI isolates, indicating that there may be risks for listeriosis outbreak in Japan. This is the first investigational study on genetic characteristics of Japanese listeriosis isolates. The listeriosis cases happened in the past are presumably sporadic, but it is still possible that some isolates with strong virulence potential have caused listeriosis outbreaks, and future listeriosis risks also exist.

  19. The biofilm formation ability of Listeria monocytogenes isolated from meat, poultry, fish and processing plant environments is related to serotype and pathogenic profile of the strains

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2012-10-01

    Full Text Available In the present study, the relationships between serotype, pathogenic profile and in vitro biofilm formation of 106 Listeria monocytogenes strains, having no epidemiological correlation and isolated from different environmental and food sources, were analyzed. The quantitative assessment of the in vitro biofilm formation was carried out by using a microtiter plate assay with spectrophotometric reading (OD620. The isolates were also submitted to serogrouping using the target genes lmo0737, lmo1118, ORF2819, ORF2110, prs, and to the evaluation of the presence of the following virulence genes: prfA, hlyA, rrn, inlA, inlB, iap, plcA, plcB, actA and mpl, by multiplex PCRs. The 62% of the strains showed weak or moderate in vitro ability in biofilm formation, in particular serotypes 1/2b and 4b, frequently associated with sporadic or epidemic listeriosis cases. The 25% of these isolates showed polymorphism for the actA gene, producing a fragment of 268-bp instead of the expected 385-bp. The deletion of nucleotides in this gene seems to be related to enhanced virulence properties among these strains. Strains belonging to serotypes associated with human infections and characterized by pathogenic potential are capable to persist within the processing plants forming biofilm.

  20. Virulence Genes Profile of Multidrug Resistant Pseudomonas aeruginosa Isolated from Iranian Children with UTIs

    Directory of Open Access Journals (Sweden)

    Zohreh Heidary

    2016-04-01

    Full Text Available Virulent and resistant strains Pseudomonas aeruginosa (P. aeruginosa is one of the most important cause of UTIs in pediatrics. The present study was carried to investigate the frequency of virulence factors in the multi-drug resistant strains of P. aeruginosa isolated from pediatrics hospitalized due to the UTIs. One - hundred and forty three urine samples were collected from pediatric patients suffered from UTIs. Samples were cultured and those that were P. aeruginosa positive were analyzed for the presence of putative virulence genes. Seventy one out of 143 samples (49.65% were positive for P. aeruginosa. Monthly, sex and age-dependent prevalence were seen for P. aeruginosa. Bacterial strains had the highest levels of resistance against ampicillin (95.77%, gentamicin (92.95% and ciprofloxacin (81.69%. Of 71 P. aeruginosa isolates, 12 strains were resistant to more than 9 antibiotics (16.90%. The most commonly detected virulence factors in the cases of urethral infections were exoU and plcH while those of pyelonephritis and cystitis were were exoS and lasB. Our findings should raise awareness about antibiotic resistance in hospitalized pediatrics with UTIs in Iran. Clinicians should exercise caution in prescribing antibiotics, especially in cases of UTIs. Such information can help in identifying these virulence genes as useful diagnostic markers for clinical P. aeruginosa strains isolated from UTIs.

  1. A mutation in the aroE gene affects pigment production, virulence, and chemotaxis in Xanthomonas oryzae pv. oryzae.

    Science.gov (United States)

    Kim, Hong-Il; Noh, Tae-Hwan; Lee, Chang-Soo; Park, Young-Jin

    2015-01-01

    Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight (BB) in rice. To study its function, a random insertion mutation library of Xoo was constructed using the Tn5 transposon. A mutant strain with decreased virulence against the susceptible rice cultivar IR24 was isolated from the library (aroE mutant), which also had extremely low pigment production. Thermal asymmetric interlaced-polymerase chain reaction (TAIL-PCR) and sequence analysis of the mutant revealed that the transposon was inserted into the aroE gene (encoding shikimate dehydrogenase). To investigate gene expression changes in the pigment- and virulence-deficient mutant, DNA microarray analysis was performed, which showed downregulation of 20 genes involved in the chemotaxis of Xoo. Our findings reveal that mutation of the aroE gene affects virulence and pigment production, as well as expression of genes involved in Xoo chemotaxis. Copyright © 2014 Elsevier GmbH. All rights reserved.

  2. Virulence of Klebsiella pneumoniae isolates harboring bla KPC-2 carbapenemase gene in a Caenorhabditis elegans model.

    Directory of Open Access Journals (Sweden)

    Jean-Philippe Lavigne

    Full Text Available Klebsiella pneumoniae carbapenemase (KPC is a carbapenemase increasingly reported worldwide in Enterobacteriaceae. The aim of this study was to analyze the virulence of several KPC-2-producing K. pneumoniae isolates. The studied strains were (i five KPC-2 clinical strains from different geographical origins, belonging to different ST-types and possessing plasmids of different incompatibility groups; (ii seven transformants obtained after electroporation of either these natural KPC plasmids or a recombinant plasmid harboring only the bla KPC-2 gene into reference strains K. pneumoniae ATCC10031/CIP53153; and (iii five clinical strains cured of plasmids. The virulence of K. pneumoniae isolates was evaluated in the Caenorhabditis elegans model. The clinical KPC producers and transformants were significantly less virulent (LT50: 5.5 days than K. pneumoniae reference strain (LT50: 4.3 days (p<0.01. However, the worldwide spread KPC-2 positive K. pneumoniae ST258 strains and reference strains containing plasmids extracted from K. pneumoniae ST258 strains had a higher virulence than KPC-2 strains belonging to other ST types (LT50: 5 days vs. 6 days, p<0.01. The increased virulence observed in cured strains confirmed this trend. The bla KPC-2 gene itself was not associated to increased virulence.

  3. Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes

    Science.gov (United States)

    2014-01-01

    The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

  4. Comparative genomic analysis of Brucella abortus vaccine strain 104M reveals a set of candidate genes associated with its virulence attenuation.

    Science.gov (United States)

    Yu, Dong; Hui, Yiming; Zai, Xiaodong; Xu, Junjie; Liang, Long; Wang, Bingxiang; Yue, Junjie; Li, Shanhu

    2015-01-01

    The Brucella abortus strain 104M, a spontaneously attenuated strain, has been used as a vaccine strain in humans against brucellosis for 6 decades in China. Despite many studies, the molecular mechanisms that cause the attenuation are still unclear. Here, we determined the whole-genome sequence of 104M and conducted a comprehensive comparative analysis against the whole genome sequences of the virulent strain, A13334, and other reference strains. This analysis revealed a highly similar genome structure between 104M and A13334. The further comparative genomic analysis between 104M and A13334 revealed a set of genes missing in 104M. Some of these genes were identified to be directly or indirectly associated with virulence. Similarly, a set of mutations in the virulence-related genes was also identified, which may be related to virulence alteration. This study provides a set of candidate genes associated with virulence attenuation in B.abortus vaccine strain 104M.

  5. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  6. Allele-dependent differences in quorum-sensing dynamics result in variant expression of virulence genes in Staphylococcus aureus.

    Science.gov (United States)

    Geisinger, Edward; Chen, John; Novick, Richard P

    2012-06-01

    Agr is an autoinducing, quorum-sensing system that functions in many Gram-positive species and is best characterized in the pathogen Staphylococcus aureus, in which it is a global regulator of virulence gene expression. Allelic variations in the agr genes have resulted in the emergence of four quorum-sensing specificity groups in S. aureus, which correlate with different strain pathotypes. The basis for these predilections is unclear but is hypothesized to involve the phenomenon of quorum-sensing interference between strains of different agr groups, which may drive S. aureus strain isolation and divergence. Whether properties intrinsic to each agr allele directly influence virulence phenotypes within S. aureus is unknown. In this study, we examined group-specific differences in agr autoinduction and virulence gene regulation by utilizing congenic strains, each harboring a unique S. aureus agr allele, enabling a dissection of agr locus-dependent versus genotype-dependent effects on quorum-sensing dynamics and virulence factor production. Employing a reporter fusion to the principal agr promoter, P3, we observed allele-dependent differences in the timing and magnitude of agr activation. These differences were mediated by polymorphisms within the agrBDCA genes and translated to significant variations in the expression of a key transcriptional regulator, Rot, and of several important exoproteins and surface factors involved in pathogenesis. This work uncovers the contribution of divergent quorum-sensing alleles to variant expression of virulence determinants within a bacterial species.

  7. Occurrence of Salmonella, Listeria monocytogenes, and enterotoxigenic Staphylococcus in goat milk from small and medium-sized farms located in Minas Gerais State, Brazil.

    Science.gov (United States)

    Cavicchioli, V Q; Scatamburlo, T M; Yamazi, A K; Pieri, F A; Nero, L A

    2015-12-01

    Consumption of goat milk has been increasing due to its nutritional characteristics and health benefits. Therefore, assessment of the presence of foodborne pathogens in this product is critical to ensure its safety to consumers. The present study aimed to identify common foodborne pathogens in raw goat milk. Fifty-three samples of raw goat milk from 11 farms were collected and cultured for the presence of Salmonella spp. and Listeria monocytogenes, as well as for enumeration and isolation of coagulase-positive and coagulase-negative Staphylococcus (CPS and CNS, respectively). All samples tested negative for Salmonella spp. and L. monocytogenes. The CPS counts in raw goat milk samples were predominantly less than 2 log cfu/mL (n=39), and CNS counts were predominantly higher than 3 log cfu/mL (n=42). Based on Staphylococcus counts, 51 isolates were selected (CPS=26; CNS=25) and tested by PCR for the presence of classic enterotoxin-encoding genes (sea, seb, sec, sed, and see). Only 3 isolates (CPS=2, CNS=1) were negative for all enterotoxin-encoding genes tested, and the genotype sec and see was the most frequent (n=16), followed by sea, sec, and see (n=13) and sec (n=13); sed was not detected in any isolate. The frequencies of enterotoxin-encoding genes for CPS and CNS were similar, demonstrating the equivalence of both groups in harboring these virulent markers. These results suggest that Salmonella and L. monocytogenes are not frequent contaminants of raw goat milk, but that Staphylococcus spp. that are capable of producing enterotoxins are prevalent; therefore, consumers of raw goat milk and products made from raw milk are at risk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

    Science.gov (United States)

    Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

    2014-01-01

    Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

  9. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes Internalin A for enhanced infectivity in the murine oral infection model

    LENUS (Irish Health Repository)

    Monk, Ian R

    2010-12-13

    Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human

  10. Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model

    Directory of Open Access Journals (Sweden)

    Hill Colin

    2010-12-01

    Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced

  11. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes.

    Science.gov (United States)

    Vadia, Stephen; Seveau, Stephanie

    2014-03-01

    Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

  13. Irf3 polymorphism alters induction of interferon beta in response to Listeria monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Oleg Garifulin

    2007-09-01

    Full Text Available Genetic makeup of the host plays a significant role in the course and outcome of infection. Inbred strains of mice display a wide range of sensitivities to Listeria monocytogenes infection and thus serve as a good model for analysis of the effect of genetic polymorphism. The outcome of L. monocytogenes infection in mice is influenced by the ability of this bacterium to induce expression of interferon beta mRNA, encoded in mouse by the Ifnb1 (interferon beta 1, fibroblast gene. Mouse strains that lack components of the IFN beta signaling pathway are substantially more resistant to infection. We found that macrophages from the ByJ substrain of the common C57BL/6 inbred strain of mice are impaired in their ability to induce Ifnb1 expression in response to bacterial and viral infections. We mapped the locus that controls differential expression of Ifnb1 to a region on Chromosome 7 that includes interferon regulatory factor 3 (Irf3, which encodes a transcription factor responsible for early induction of Ifnb1 expression. In C57BL/6ByJ mice, Irf3 mRNA was inefficiently spliced, with a significant proportion of the transcripts retaining intron 5. Analysis of the Irf3 locus identified a single base-pair polymorphism and revealed that intron 5 of Irf3 is spliced by the atypical U12-type spliceosome. We found that the polymorphism disrupts a U12-type branchpoint and has a profound effect on the efficiency of splicing of Irf3. We demonstrate that a naturally occurring change in the splicing control element has a dramatic effect on the resistance to L. monocytogenes infection. Thus, the C57BL/6ByJ mouse strain serves as an example of how a mammalian host can counter bacterial virulence strategies by introducing subtle alteration of noncoding sequences.

  14. Reduced Set of Virulence Genes Allows High Accuracy Prediction of Bacterial Pathogenicity in Humans

    Science.gov (United States)

    Iraola, Gregorio; Vazquez, Gustavo; Spangenberg, Lucía; Naya, Hugo

    2012-01-01

    Although there have been great advances in understanding bacterial pathogenesis, there is still a lack of integrative information about what makes a bacterium a human pathogen. The advent of high-throughput sequencing technologies has dramatically increased the amount of completed bacterial genomes, for both known human pathogenic and non-pathogenic strains; this information is now available to investigate genetic features that determine pathogenic phenotypes in bacteria. In this work we determined presence/absence patterns of different virulence-related genes among more than finished bacterial genomes from both human pathogenic and non-pathogenic strains, belonging to different taxonomic groups (i.e: Actinobacteria, Gammaproteobacteria, Firmicutes, etc.). An accuracy of 95% using a cross-fold validation scheme with in-fold feature selection is obtained when classifying human pathogens and non-pathogens. A reduced subset of highly informative genes () is presented and applied to an external validation set. The statistical model was implemented in the BacFier v1.0 software (freely available at ), that displays not only the prediction (pathogen/non-pathogen) and an associated probability for pathogenicity, but also the presence/absence vector for the analyzed genes, so it is possible to decipher the subset of virulence genes responsible for the classification on the analyzed genome. Furthermore, we discuss the biological relevance for bacterial pathogenesis of the core set of genes, corresponding to eight functional categories, all with evident and documented association with the phenotypes of interest. Also, we analyze which functional categories of virulence genes were more distinctive for pathogenicity in each taxonomic group, which seems to be a completely new kind of information and could lead to important evolutionary conclusions. PMID:22916122

  15. Enhanced Virulence Gene Activity of Agrobacterium in Muskmelon (Cucumis melo L. cv. ‘Birdie’

    Directory of Open Access Journals (Sweden)

    Abul K.M. MOHIUDDIN

    2011-05-01

    Full Text Available Muskmelon (Cucumis melo L. cultivar ‘Birdie’, was evaluated for its response to the tumorigenic Agrobacterium tumefaciens and the oncogenic A. rhizogenes strains. Stem and petiole of three week-old in vitro-grown muskmelon plants were inoculated with five strains of A. tumefaciens and A. rhizogenes each and observed phenotypic expressions i.e. induction of crown galls and hairy roots. This phenotypic expression was efficaciously increased when virulence gene activity of different strains of two Agrobacterium species was enhanced. Intensive studies on enhancement of virulence gene activity of Agrobacterium found to be correlated to the appropriate light intensity (39.3 μmol m-2 s-1 with a specific concentration of monocyclic phenolic compound, acetosyringone (20 μM. The gene activity was also influenced by several other physical factors e.g. plant tissue type, Agrobacterium species and their strains, and plant tissue-Agrobacterium interaction. Among the different A. tumefaciens strains, LBA4404 showed the best virulence gene activity in both stem and petiole through the formation of higher rate of crown galls. On the other hand, strain 15834 of A. rhizogenes showed better gene activity in stem and 8196 in petiole through the formation of higher rate of hairy roots as well as higher average number of hairy roots. Among the two different types of explants, petiole was more susceptible to both Agrobacterium species. Thus it was concluded that future muskmelon transformation study can efficiently be carried out with LBA4404, 15834 and 8196 strains using petiole explants by adding 20 μM of acetosyringone in the medium.

  16. Plasmid fingerprinting and virulence gene detection among indigenous strains of salmonella enterica serovar enteritidis

    International Nuclear Information System (INIS)

    Sajid, S.U.; Schwarz, S.

    2009-01-01

    Salmonella enterica serovar Enteritidis is an important frequently reported zoonotic pathogen and a common cause of human gastroenteritis worldwide. The highly conserved Serospecific plasmids (SSPs) and Salmonella plasmid virulence (Spv) genes have been shown to mediate extra-intestinal colonization and systemic infection. The objective of current study was to document the presence of SSPs and SpvB/SpvC genes prevailing in the indigenous population of serovar Enteritidis. A total of 48 epidemiologically unrelated strains of Salmonella enteritidis were included in the study. Preparation of plasmids DNA suitable for endonuclease digestion and separation of respective fragments by agarose gel electrophoresis followed previously described protocols. The plasmids of Escherichia coli V517, 1-kbp ladder, and lambda DNA HindIII fragments served as DNA size standards. Transfer of DNA fragments from agarose gels to nitrocellulose membranes was achieved by capillary blot procedure. An ECL labeled 3.6 kbp HindIII fragment of plasmid PRQ 51 was used as probe for SpvB/SpvC gene detection. Plasmid DNA fingerprinting revealed the presence of two different profiles of approximately 55 kbp and 90 kbp and were identified as virulence plasmids by DNA hybridization. The SpvB/SpvC genes were located on HindIII fragments of 3.6 kbp in each of the two types of virulence plasmids. The study confirms the presence of SSPs and SpvB/SpvC genes in indigenous strains of S. enteritidis isolated from Northern Punjab area of Pakistan and substantiate the previous data on such findings from other parts of the world. (author)

  17. Steps toward broad-spectrum therapeutics: discovering virulence-associated genes present in diverse human pathogens

    Directory of Open Access Journals (Sweden)

    de Rochefort Anna

    2009-10-01

    Full Text Available Abstract Background New and improved antimicrobial countermeasures are urgently needed to counteract increased resistance to existing antimicrobial treatments and to combat currently untreatable or new emerging infectious diseases. We demonstrate that computational comparative genomics, together with experimental screening, can identify potential generic (i.e., conserved across multiple pathogen species and novel virulence-associated genes that may serve as targets for broad-spectrum countermeasures. Results Using phylogenetic profiles of protein clusters from completed microbial genome sequences, we identified seventeen protein candidates that are common to diverse human pathogens and absent or uncommon in non-pathogens. Mutants of 13 of these candidates were successfully generated in Yersinia pseudotuberculosis and the potential role of the proteins in virulence was assayed in an animal model. Six candidate proteins are suggested to be involved in the virulence of Y. pseudotuberculosis, none of which have previously been implicated in the virulence of Y. pseudotuberculosis and three have no record of involvement in the virulence of any bacteria. Conclusion This work demonstrates a strategy for the identification of potential virulence factors that are conserved across a number of human pathogenic bacterial species, confirming the usefulness of this tool.

  18. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  19. Evaluating virulence of waterborne and clinical Aeromonas isolates using gene expression and mortality in neonatal mice followed by assessing cell culture’s ability to predict virulence based on transcriptional response

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, S L; Rodgers, M R; Lye, D J; Stelma, G N; McKinstry, Craig A.; Malard, Joel M.; Vesper, Sephen J.

    2007-10-01

    Aims: To assess the virulence of Aeromonas spp. using two models, a neonatal mouse assay and a mouse intestinal cell culture. Methods and Results: After artificial infection with a variety of Aeromonas spp., mRNA extracts from the two models were processed and hydridized to murine microarrays to determine host gene response. Definition of virulence was determined based on host mRNA production in murine neonatal intestinal tissue and mortality of infected animals. Infections of mouse intestinal cell cultures were then performed to determine whether this simpler model system’s mRNA responses correlated to neonatal results and therefore be predictive of virulence of Aeromonas spp. Virulent aeromonads up-regulated transcripts in both models including multiple host defense gene products (chemokines, regulation of transcription and apoptosis and cell signalling). Avirulent species exhibited little or no host response in neonates. Mortality results correlated well with both bacterial dose and average fold change of up-regulated transcripts in the neonatal mice. Conclusions: Cell culture results were less discriminating but showed promise as potentially being able to be predictive of virulence. Jun oncogene up-regulation in murine cell culture is potentially predictive of Aeromonas virulence. Significance and Impact of the Study: Having the ability to determine virulence of waterborne pathogens quickly would potentially assist public health officials to rapidly assess exposure risks.

  20. Distribution of genes encoding virulence factors and molecular analysis of Shigella spp. isolated from patients with diarrhea in Kerman, Iran.

    Science.gov (United States)

    Hosseini Nave, Hossein; Mansouri, Shahla; Emaneini, Mohammad; Moradi, Mohammad

    2016-03-01

    Shigella is one of the important causes of diarrhea worldwide. Shigella has several virulence factors contributing in colonization and invasion of epithelial cells and eventually death of host cells. The present study was performed in order to investigate the distribution of virulence factors genes in Shigella spp. isolated from patients with acute diarrhea in Kerman, Iran as well as the genetic relationship of these isolates. A total of 56 isolates including 31 S. flexneri, 18 S. sonnei and 7 S. boydii were evaluated by polymerase chain reaction (PCR) for the presence of 11 virulence genes (ipaH, ial, set1A, set1B, sen, virF, invE, sat, sigA, pic and sepA). Then, the clonal relationship of these strains was analyzed by multilocus variable-number tandem repeat analysis (MLVA) method. All isolates were positive for ipaH gene. The other genes include ial, invE and virF were found in 80.4%, 60.7% and 67.9% of the isolates, respectively. Both set1A and set1B were detected in 32.3% of S. flexneri isolates, whereas 66.1% of the isolates belonging to different serogroup carried sen gene. The sat gene was present in all S. flexneri isolates, but not in the S. sonnei and S. boydii isolates. The result showed, 30.4% of isolates were simultaneously positive and the rest of the isolates were negative for sepA and pic genes. The Shigella isolates were divided into 29 MLVA types. This study, for the first time, investigated distribution of 11 virulence genes in Shigella spp. Our results revealed heterogeneity of virulence genes in different Shigella serogroups. Furthermore, the strains belonging to the same species had little diversity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Influenza A virus NS1 gene mutations F103L and M106I increase replication and virulence

    Directory of Open Access Journals (Sweden)

    Ping Jihui

    2011-01-01

    Full Text Available Abstract Background To understand the evolutionary steps required for a virus to become virulent in a new host, a human influenza A virus (IAV, A/Hong Kong/1/68(H3N2 (HK-wt, was adapted to increased virulence in the mouse. Among eleven mutations selected in the NS1 gene, two mutations F103L and M106I had been previously detected in the highly virulent human H5N1 isolate, A/HK/156/97, suggesting a role for these mutations in virulence in mice and humans. Results To determine the selective advantage of these mutations, reverse genetics was used to rescue viruses containing each of the NS1 mouse adapted mutations into viruses possessing the HK-wt NS1 gene on the A/PR/8/34 genetic backbone. Both F103L and M106I NS1 mutations significantly enhanced growth in vitro (mouse and canine cells and in vivo (BALB/c mouse lungs as well as enhanced virulence in the mouse. Only the M106I NS1 mutation enhanced growth in human cells. Furthermore, these NS1 mutations enhanced early viral protein synthesis in MDCK cells and showed an increased ability to replicate in mouse interferon β (IFN-β pre-treated mouse cells relative to rPR8-HK-NS-wt NS1. The double mutant, rPR8-HK-NS-F103L + M106I, demonstrated growth attenuation late in infection due to increased IFN-β induction in mouse cells. We then generated a rPR8 virus possessing the A/HK/156/97 NS gene that possesses 103L + 106I, and then rescued the L103F + I106M mutant. The 103L + 106I mutations increased virulence by >10 fold in BALB/c mice. We also inserted the avian A/Ck/Beijing/1/95 NS1 gene (the source lineage of the A/HK/156/97 NS1 gene that possesses 103L + 106I, onto the A/WSN/33 backbone and then generated the L103F + I106M mutant. None of the H5N1 and H9N2 NS containing viruses resulted in increased IFN-β induction. The rWSN-A/Ck/Beijing/1/95-NS1 gene possessing 103L and 106I demonstrated 100 fold enhanced growth and >10 fold enhanced virulence that was associated with increased tropism for lung

  2. Virulence Genes among Enterococcus faecalis and Enterococcus faecium Isolated from Coastal Beaches and Human and Nonhuman Sources in Southern California and Puerto Rico

    Directory of Open Access Journals (Sweden)

    Donna M. Ferguson

    2016-01-01

    Full Text Available Most Enterococcus faecalis and E. faecium are harmless to humans; however, strains harboring virulence genes, including esp, gelE, cylA, asa1, and hyl, have been associated with human infections. E. faecalis and E. faecium are present in beach waters worldwide, yet little is known about their virulence potential. Here, multiplex PCR was used to compare the distribution of virulence genes among E. faecalis and E. faecium isolated from beaches in Southern California and Puerto Rico to isolates from potential sources including humans, animals, birds, and plants. All five virulence genes were found in E. faecalis and E. faecium from beach water, mostly among E. faecalis. gelE was the most common among isolates from all source types. There was a lower incidence of asa1, esp, cylA, and hyl genes among isolates from beach water, sewage, septage, urban runoff, sea wrack, and eelgrass as compared to human isolates, indicating that virulent strains of E. faecalis and E. faecium may not be widely disseminated at beaches. A higher frequency of asa1 and esp among E. faecalis from dogs and of asa1 among birds (mostly seagull suggests that further studies on the distribution and virulence potential of strains carrying these genes may be warranted.

  3. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  4. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  5. Association between antimicrobial resistance and virulence genes in Escherichia coli obtained from blood and faeces

    DEFF Research Database (Denmark)

    Bagger-Skjøt, Line; Sandvang, Dorthe; Frimodt-Møller, Niels

    2007-01-01

    Escherichia coli isolates obtained from faeces (n = 85) and blood (n = 123) were susceptibility tested against 17 antimicrobial agents and the presence of 9 virulence genes was determined by PCR. Positive associations between several antimicrobial resistances and 2 VF genes (iutA and traT) were...

  6. Relationship of biofilm formation and different virulence genes in uropathogenic Escherichia coli isolates from Northwest Iran

    Directory of Open Access Journals (Sweden)

    Fattahi, Sargol

    2015-07-01

    Full Text Available Background and objectives: The ( bacterium is one of the main causative agents of urinary tract infections (UTI worldwide. The ability of this bacterium to form biofilms on medical devices such as catheters plays an important role in the development of UTI. The aim of the present study was to investigate the possible relationship between virulence factors and biofilm formation of isolates responsible for urinary tract infection.Materials and methods: A total of 100 isolates isolated from patients with UTI were collected and characterized by routine bacteriological methods. In vitro biofilm formation by these isolates was determined using the 96-well microtiter-plate test, and the presence of , , and virulence genes was examined by PCR assay. Data analysis was performed using SPSS 16.0 software.Results: From 100 isolates isolated from UTIs, 92% were shown to be biofilm positive. The genes , , and were detected in 43%, 94% and 26% of isolates, respectively. Biofilm formation in isolates that expressed , , and genes was 100%, 93%, and 100%, respectively. A significant relationship was found between presence of the gene and biofilm formation in isolates isolated from UTI (<0.01, but there was no statistically significant correlation between presence of and genes with biofilm formation (<0.072, <0.104. Conclusion: Results showed that and genes do not seem to be necessary or sufficient for the production of biofilm in , but the presence of correlates with increased biofilm formation of urinary tract isolates. Overall, the presence of , , and virulence genes coincides with in vitro biofilm formation in uropathogenic

  7. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  8. Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

    Directory of Open Access Journals (Sweden)

    Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*

    2013-11-01

    Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

  9. Characterization of Aeromonas hydrophila wound pathotypes by comparative genomic and functional analyses of virulence genes.

    Science.gov (United States)

    Grim, Christopher J; Kozlova, Elena V; Sha, Jian; Fitts, Eric C; van Lier, Christina J; Kirtley, Michelle L; Joseph, Sandeep J; Read, Timothy D; Burd, Eileen M; Tall, Ben D; Joseph, Sam W; Horneman, Amy J; Chopra, Ashok K; Shak, Joshua R

    2013-04-23

    Aeromonas hydrophila has increasingly been implicated as a virulent and antibiotic-resistant etiologic agent in various human diseases. In a previously published case report, we described a subject with a polymicrobial wound infection that included a persistent and aggressive strain of A. hydrophila (E1), as well as a more antibiotic-resistant strain of A. hydrophila (E2). To better understand the differences between pathogenic and environmental strains of A. hydrophila, we conducted comparative genomic and functional analyses of virulence-associated genes of these two wound isolates (E1 and E2), the environmental type strain A. hydrophila ATCC 7966(T), and four other isolates belonging to A. aquariorum, A. veronii, A. salmonicida, and A. caviae. Full-genome sequencing of strains E1 and E2 revealed extensive differences between the two and strain ATCC 7966(T). The more persistent wound infection strain, E1, harbored coding sequences for a cytotoxic enterotoxin (Act), a type 3 secretion system (T3SS), flagella, hemolysins, and a homolog of exotoxin A found in Pseudomonas aeruginosa. Corresponding phenotypic analyses with A. hydrophila ATCC 7966(T) and SSU as reference strains demonstrated the functionality of these virulence genes, with strain E1 displaying enhanced swimming and swarming motility, lateral flagella on electron microscopy, the presence of T3SS effector AexU, and enhanced lethality in a mouse model of Aeromonas infection. By combining sequence-based analysis and functional assays, we characterized an A. hydrophila pathotype, exemplified by strain E1, that exhibited increased virulence in a mouse model of infection, likely because of encapsulation, enhanced motility, toxin secretion, and cellular toxicity. Aeromonas hydrophila is a common aquatic bacterium that has increasingly been implicated in serious human infections. While many determinants of virulence have been identified in Aeromonas, rapid identification of pathogenic versus nonpathogenic

  10. Biofilm formation, antimicrobial susceptibility, serogroups and virulence genes of uropathogenic E. coli isolated from clinical samples in Iran

    Directory of Open Access Journals (Sweden)

    Elahe Tajbakhsh

    2016-04-01

    Full Text Available Abstract Background Uropathogenic Escherichia coli O- Serogroups with their virulence factors are the most prevalent causes of UTIs. The present research performed to track common uropathogenic E.coli serogroups, antibiotic resistance pattern of strains and prevalence of virulence genes in isolations having the ability to constitute biofilm. Methods In this research 130 E.coli isolation from patients having UTI symptoms were collected and antimicrobial resistance pattern was performed by Kirby-Bauer method. Polymerase chain reaction was done using primer pairs to identify common serogroups of uropathogenic E.coli and studying virulence genes in isolations creating biofilm. Results Among 130 E.coli isolates, 80 (61.53 % were able to make biofilm that 15 isolates (18.75 % indicated strong reaction, 20 (25 % of medium and 45 (56.25 % of weak biofilm reaction. Among isolations creating biofilm, the highest resistance reported to Ampicillin (87.5 % and the lowest to Nitrofurantoin (3.75 %. The frequency of fimH, pap, sfa and afa genes in isolations having the ability to create strong biofilm reported 93.33 %, 86.66 %, 86.66 % and 66.66 %, respectively. Conclusions The findings indicated the importance of virulence genes in serogroups producing uropathogenic E.coli biofilm. It is recommended that strains producing biofilm before antibiotic use should be studied.

  11. Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

    Science.gov (United States)

    Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

    2017-01-16

    The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Crystal Structure of the Substrate-Binding Domain from Listeria monocytogenes Bile-Resistance Determinant BilE

    OpenAIRE

    Stephanie J. Ruiz; Gea K. Schuurman-Wolters; Bert Poolman

    2016-01-01

    BilE has been reported as a bile resistance determinant that plays an important role in colonization of the gastrointestinal tract by Listeria monocytogenes, the causative agent of listeriosis. The mechanism(s) by which BilE mediates bile resistance are unknown. BilE shares significant sequence similarity with ATP-binding cassette (ABC) importers that contribute to virulence and stress responses by importing quaternary ammonium compounds that act as compatible solutes. Assays using related co...

  13. The Propeptide of the Metalloprotease of Listeria monocytogenes Controls Compartmentalization of the Zymogen during Intracellular Infection▿

    OpenAIRE

    O'Neil, Heather S.; Forster, Brian M.; Roberts, Kari L.; Chambers, Andrew J.; Bitar, Alan Pavinski; Marquis, Hélène

    2009-01-01

    Integral to the virulence of the intracellular bacterial pathogen Listeria monocytogenes is its metalloprotease (Mpl). Mpl regulates the activity and compartmentalization of the bacterial broad-range phospholipase C (PC-PLC). Mpl is secreted as a proprotein that undergoes intramolecular autocatalysis to release its catalytic domain. In related proteases, the propeptide serves as a folding catalyst and can act either in cis or in trans. Propeptides can also influence protein compartmentalizati...

  14. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  15. Virulence genes in a probiotic E. coli product with a recorded long history of safe use

    Science.gov (United States)

    Zschüttig, Anke; Beimfohr, Claudia; Geske, Thomas; Auerbach, Christian; Cook, Helen; Zimmermann, Kurt; Gunzer, Florian

    2015-01-01

    The probiotic product Symbioflor2 (DSM 17252) is a bacterial concentrate of six different Escherichia coli genotypes, whose complete genome sequences are compared here, between each other as well as to other E. coli genomes. The genome sequences of Symbioflor2 E. coli components contained a number of virulence-associated genes. Their presence seems to be in conflict with a recorded history of safe use, and with the observed low frequency of adverse effects over a period of more than 6 years. The genome sequences were used to identify unique sequences for each component, for which strain-specific hybridization probes were designed. A colonization study was conducted whereby five volunteers were exposed to an exceptionally high single dose. The results showed that the probiotic E. coli could be detected for 3 months or longer in their stools, and this was in particular the case for those components containing higher numbers of virulence-associated genes. Adverse effects from this long-term colonization were absent. Thus, the presence of the identified virulence genes does not result in a pathogenic phenotype in the genetic background of these probiotic E. coli. PMID:25883796

  16. The effect of γ radiation on the expression of the virulence genes of Salmonella typhimurium and Vibrio spp

    International Nuclear Information System (INIS)

    Lim, Sangyong; Jung, Jinwoo; Kim, Dongho

    2007-01-01

    The principle benefit of food irradiation is the reduction of food-borne bacteria in food products. However, the microbiological safety with respect to increased virulence of surviving pathogens after irradiation remains an important issue with regard to the effectiveness of food irradiation. In this study, the transcriptional changes of virulence genes of Salmonella and Vibrio spp. after γ radiation were investigated by real-time PCR (RT-PCR). Samonella typhimurium is dependent upon the products of a large number of genes located within Salmonella pathogenicity islands (SPI) on the chromosome. The expressions of seven genes including four SPI genes, hilD, ssrB, pipB, and sopD, were measured at 1 h after 1 kGy irradiation. Compared with non-irradiated controls, the expression of hilD encoded within SPI1 and sopD encoding SPI1-related effector proteins was reduced about 4- and 16-fold, respectively. The expressions of Vibrio toxin genes, vvhA, ctxA, and tdh, were also monitored during the course of a growth cycle after re-inoculation of irradiated Vibrio spp. (0.5 and 1.0 kGy). The expressions of Vibrio toxin genes tested did not increase compared with non-irradiated counterparts. Results from this study indicate that γ radiation is much more likely to reduce the virulence gene expression of surviving pathogens

  17. The effect of {gamma} radiation on the expression of the virulence genes of Salmonella typhimurium and Vibrio spp

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Sangyong; Jung, Jinwoo [Radiation Food Science and Biotechnology Team, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongup 580-185 (Korea, Republic of); Kim, Dongho [Radiation Food Science and Biotechnology Team, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongup 580-185 (Korea, Republic of)], E-mail: fungikim@kaeri.re.kr

    2007-11-15

    The principle benefit of food irradiation is the reduction of food-borne bacteria in food products. However, the microbiological safety with respect to increased virulence of surviving pathogens after irradiation remains an important issue with regard to the effectiveness of food irradiation. In this study, the transcriptional changes of virulence genes of Salmonella and Vibrio spp. after {gamma} radiation were investigated by real-time PCR (RT-PCR). Samonella typhimurium is dependent upon the products of a large number of genes located within Salmonella pathogenicity islands (SPI) on the chromosome. The expressions of seven genes including four SPI genes, hilD, ssrB, pipB, and sopD, were measured at 1 h after 1 kGy irradiation. Compared with non-irradiated controls, the expression of hilD encoded within SPI1 and sopD encoding SPI1-related effector proteins was reduced about 4- and 16-fold, respectively. The expressions of Vibrio toxin genes, vvhA, ctxA, and tdh, were also monitored during the course of a growth cycle after re-inoculation of irradiated Vibrio spp. (0.5 and 1.0 kGy). The expressions of Vibrio toxin genes tested did not increase compared with non-irradiated counterparts. Results from this study indicate that {gamma} radiation is much more likely to reduce the virulence gene expression of surviving pathogens.

  18. Virulence-associated and antibiotic resistance genes of microbial populations in cattle feces analyzed using a metagenomic approach.

    Science.gov (United States)

    Durso, Lisa M; Harhay, Gregory P; Bono, James L; Smith, Timothy P L

    2011-02-01

    The bovine fecal microbiota impacts human food safety as well as animal health. Although the bacteria of cattle feces have been well characterized using culture-based and culture-independent methods, techniques have been lacking to correlate total community composition with community function. We used high throughput sequencing of total DNA extracted from fecal material to characterize general community composition and examine the repertoire of microbial genes present in beef cattle feces, including genes associated with antibiotic resistance and bacterial virulence. Results suggest that traditional 16S sequencing using "universal" primers to generate full-length sequence may under represent Acitinobacteria and Proteobacteria. Over eight percent (8.4%) of the sequences from our beef cattle fecal pool sample could be categorized as virulence genes, including a suite of genes associated with resistance to antibiotic and toxic compounds (RATC). This is a higher proportion of virulence genes found in Sargasso sea, chicken cecum, and cow rumen samples, but comparable to the proportion found in Antarctic marine derived lake, human fecal, and farm soil samples. The quantitative nature of metagenomic data, combined with the large number of RATC classes represented in samples from widely different habitats indicates that metagenomic data can be used to track relative amounts of antibiotic resistance genes in individual animals over time. Consequently, these data can be used to generate sample-specific and temporal antibiotic resistance gene profiles to facilitate an understanding of the ecology of the microbial communities in each habitat as well as the epidemiology of antibiotic resistant gene transport between and among habitats. Published by Elsevier B.V.

  19. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

    Science.gov (United States)

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

    2014-01-02

    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  20. Growth of Listeria monocytogenes on a RTE-meat matrix enhances cell invasiveness to mouse J774A.1 macrophages.

    Science.gov (United States)

    Lin, Chen-Si; Wang, Chinling; Tsai, Hsiang-Jung; Chou, Chung-Hsi

    2010-11-15

    It remains unclear whether the growth of Listeria monocytogenes on a ready-to-eat (RTE) meat matrix has an impact on the bacterium's pathogenic abilities. In this study, we investigated the impact of environments on virulence by growing L. monocytogenes (F2365 strain) on brain heart infusion agar (BHI), tryptic soy agar (TSA), and RTE turkey meat matrices. Bacteria cultured from these media were harvested and used to infect mouse macrophage cell line J774A.1 with different MOIs to examine their invasion ability. At MOI=10 and 50, the numbers of bacteria recovered from cells infected with turkey-meat-grown Listeria were significantly higher than those from the two nutrient-rich growth media. Additionally, MOI played a role in determining L. monocytogenes recovery rates, since significant differences were found amongst all three groups at low MOI, while no significant differences were found between BHI and TSA groups at high MOI. These results indicate that environmental changes affect the ability of L. monocytogenes to invade and survive intracellularly while grown on RTE-meat matrix. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  2. Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

    Science.gov (United States)

    Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

    2009-02-15

    The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

  3. Comparative genomics reveals cotton-specific virulence factors in flexible genomic regions in Verticillium dahliae and evidence of horizontal gene transfer from Fusarium.

    Science.gov (United States)

    Chen, Jie-Yin; Liu, Chun; Gui, Yue-Jing; Si, Kai-Wei; Zhang, Dan-Dan; Wang, Jie; Short, Dylan P G; Huang, Jin-Qun; Li, Nan-Yang; Liang, Yong; Zhang, Wen-Qi; Yang, Lin; Ma, Xue-Feng; Li, Ting-Gang; Zhou, Lei; Wang, Bao-Li; Bao, Yu-Ming; Subbarao, Krishna V; Zhang, Geng-Yun; Dai, Xiao-Feng

    2018-01-01

    Verticillium dahliae isolates are most virulent on the host from which they were originally isolated. Mechanisms underlying these dominant host adaptations are currently unknown. We sequenced the genome of V. dahliae Vd991, which is highly virulent on its original host, cotton, and performed comparisons with the reference genomes of JR2 (from tomato) and VdLs.17 (from lettuce). Pathogenicity-related factor prediction, orthology and multigene family classification, transcriptome analyses, phylogenetic analyses, and pathogenicity experiments were performed. The Vd991 genome harbored several exclusive, lineage-specific (LS) genes within LS regions (LSRs). Deletion mutants of the seven genes within one LSR (G-LSR2) in Vd991 were less virulent only on cotton. Integration of G-LSR2 genes individually into JR2 and VdLs.17 resulted in significantly enhanced virulence on cotton but did not affect virulence on tomato or lettuce. Transcription levels of the seven LS genes in Vd991 were higher during the early stages of cotton infection, as compared with other hosts. Phylogenetic analyses suggested that G-LSR2 was acquired from Fusarium oxysporum f. sp. vasinfectum through horizontal gene transfer. Our results provide evidence that horizontal gene transfer from Fusarium to Vd991 contributed significantly to its adaptation to cotton and may represent a significant mechanism in the evolution of an asexual plant pathogen. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  4. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  5. Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit.

    Science.gov (United States)

    Liu, Cheng-Qian; Hu, Kang-Di; Li, Ting-Ting; Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan; Zhang, Hua

    2017-01-01

    Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit.

  6. New Insight into Biofilm Formation Ability, the Presence of Virulence Genes and Probiotic Potential of Enterococcus sp. Dairy Isolates

    Directory of Open Access Journals (Sweden)

    Nikola Popović

    2018-01-01

    Full Text Available Enterococci have controversial status due to their emerging role in nosocomial infections and transmission of antibiotic resistance genes, while some enterococci strains are used as probiotics for humans and animals and starter cultures in dairy industry. In order to improve our understanding of factors involved in the safe use of enterococci as potential probiotics, the antibiotic susceptibility, virulence and probiotic traits of 75 dairy enterococci isolates belonging to Enterococcus durans (50, En. faecium (15, En. faecalis (6, En. italicus (3, and En. hirae (1 were evaluated. The results revealed that ciprofloxacin resistance and biofilm formation are correlated with isolates originated from Golija mountain (Serbia, while gelatinase activity was more common in isolates from Prigorje region (Croatia, pointing to uncontrolled use of antibiotics and anthropogenic impact on dairy products' microbiota in these regions. The virulence genes were sporadically present in 13 selected dairy enterococci isolates. Interestingly, biofilm formation was correlated with higher ability of strains to reduce the adhesion of E. coli and Salmonella Enteritidis to HT29-MTX cells. To our knowledge this is the first study reporting the presence of the esp gene (previously correlated with pathogenesis in dairy enterococci isolates, mostly associated with the genes involved in adhesion property. Hence, the results of this study revealed that the virulence genes are sporadically present in dairy isolates and more correlated to adhesion properties and biofilm formation, implicating their role in gut colonization rather than to the virulence traits.

  7. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Listeria monocytogenes efficiently invades Caco-2 cells after low-temperature storage in broth and on deli meat.

    Science.gov (United States)

    Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne

    2010-09-01

    The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p 0.05) in invasiveness after 7 days at 10 degrees C in BHI broth or on sausage, whereas a slight increase (p < 0.05) was observed after incubation on ham for 2 and 4 weeks compared to that in BHI broth. Most importantly, our results show that L. monocytogenes efficiently invade Caco-2 cells even after 4 weeks of storage at chilled temperature. This is highly relevant for safety assessment of this organism in food as these conditions reflect storage of ready-to-eat food products in domestic refrigerators.

  9. Transcriptomic Analysis of the Adaptation of Listeria monocytogenes to Lagoon and Soil Matrices Associated with a Piggery Environment: Comparison of Expression Profiles.

    Science.gov (United States)

    Vivant, Anne-Laure; Desneux, Jeremy; Pourcher, Anne-Marie; Piveteau, Pascal

    2017-01-01

    Understanding how Listeria monocytogenes , the causative agent of listeriosis, adapts to the environment is crucial. Adaptation to new matrices requires regulation of gene expression. To determine how the pathogen adapts to lagoon effluent and soil, two matrices where L. monocytogenes has been isolated, we compared the transcriptomes of L. monocytogenes CIP 110868 20 min and 24 h after its transfer to effluent and soil extract. Results showed major variations in the transcriptome of L. monocytogenes in the lagoon effluent but only minor modifications in the soil. In both the lagoon effluent and in the soil, genes involved in mobility and chemotaxis and in the transport of carbohydrates were the most frequently represented in the set of genes with higher transcript levels, and genes with phage-related functions were the most represented in the set of genes with lower transcript levels. A modification of the cell envelop was only found in the lagoon environment. Finally, the differential analysis included a large proportion of regulators, regulons, and ncRNAs.

  10. A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

    2011-01-01

    role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

  11. Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

    Science.gov (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

    2011-01-01

    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

  12. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  13. Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia

    Directory of Open Access Journals (Sweden)

    Judy Natalia Jiménez

    2011-12-01

    Full Text Available Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA and methicillin-resistant S. aureus (MRSA strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric patients between zero-14 years. We identified the genes encoding virulence factors, which included Panton-Valentine leucocidine (PVL, staphylococcal enterotoxins A-E, exfoliative toxins A and B and toxic shock syndrome toxin 1. Typing of the staphylococcal chromosome cassette mec (SCCmec was performed in MRSA strains. The virulence genes were more diverse and frequent in MSSA than in MRSA isolates (83% vs. 73%. MRSA strains harboured SCCmec types IVc (60%, I (30%, IVa (7% and V (3%. SCCmec type IVc isolates frequently carried the PVL encoding genes and harboured virulence determinants resembling susceptible strains while SCCmec type I isolates were often negative. PVL was not exclusive to skin and soft tissue infections. As previously suggested, these differences in the distribution of virulence factor genes may be due to the fitness cost associated with methicillin resistance.

  14. Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia.

    Science.gov (United States)

    Jiménez, Judy Natalia; Ocampo, Ana María; Vanegas, Johanna Marcela; Rodríguez, Erika Andrea; Garcés, Carlos Guillermo; Patiño, Luz Adriana; Ospina, Sigifredo; Correa, Margarita María

    2011-12-01

    Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric patients between zero-14 years. We identified the genes encoding virulence factors, which included Panton-Valentine leucocidine (PVL), staphylococcal enterotoxins A-E, exfoliative toxins A and B and toxic shock syndrome toxin 1. Typing of the staphylococcal chromosome cassette mec (SCCmec) was performed in MRSA strains. The virulence genes were more diverse and frequent in MSSA than in MRSA isolates (83% vs. 73%). MRSA strains harboured SCCmec types IVc (60%), I (30%), IVa (7%) and V (3%). SCCmec type IVc isolates frequently carried the PVL encoding genes and harboured virulence determinants resembling susceptible strains while SCCmec type I isolates were often negative. PVL was not exclusive to skin and soft tissue infections. As previously suggested, these differences in the distribution of virulence factor genes may be due to the fitness cost associated with methicillin resistance.

  15. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  16. Reduction of Aspergillus niger Virulence in Apple Fruits by Deletion of the Catalase Gene cpeB.

    Science.gov (United States)

    Zhang, Meng-Ke; Tang, Jun; Huang, Zhong-Qin; Hu, Kang-Di; Li, Yan-Hong; Han, Zhuo; Chen, Xiao-Yan; Hu, Lan-Ying; Yao, Gai-Fang; Zhang, Hua

    2018-05-30

    Aspergillus niger, a common saprophytic fungus, causes rot in many fruits. We studied the role of a putative catalase-peroxidase-encoding gene, cpeB, in oxidative stress and virulence in fruit. The cpeB gene was deleted in A. niger by homologous recombination, and the Δ cpeB mutant showed decreased CAT activity compared with that of the wild type. The cpeB gene deletion caused increased sensitivity to H 2 O 2 stress, and spore germination was significantly reduced; in addition, the reactive-oxygen-species (ROS) metabolites superoxide anions (·O 2 - ), hydrogen peroxide (H 2 O 2 ), and malondialdehyde (MDA) accumulated in the Δ cpeB mutant during H 2 O 2 stress. Furthermore, ROS metabolism in A. niger infected apples was determined, and our results showed that the Δ cpeB mutant induced an attenuated response in apple fruit during the fruit-pathogen interaction; the cpeB gene deletion significantly reduced the development of lesions, suggesting that the cpeB gene in A. niger is essential for full virulence in apples.

  17. Prevalence of genes encoding extracellular virulence factors among meticillin-resistant Staphylococcus aureus isolates from the University Hospital, Olomouc, Czech Republic.

    Science.gov (United States)

    Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D

    2008-04-01

    A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.

  18. Selected lactic acid-producing bacterial isolates with the capacity to reduce Salmonella translocation and virulence gene expression in chickens.

    Directory of Open Access Journals (Sweden)

    Xiaojian Yang

    Full Text Available BACKGROUND: Probiotics have been used to control Salmonella colonization/infection in chickens. Yet the mechanisms of probiotic effects are not fully understood. This study has characterized our previously-selected lactic acid-producing bacterial (LAB isolates for controlling Salmonella infection in chickens, particularly the mechanism underlying the control. METHODOLOGY/PRINCIPAL FINDINGS: In vitro studies were conducted to characterize 14 LAB isolates for their tolerance to low pH (2.0 and high bile salt (0.3-1.5% and susceptibility to antibiotics. Three chicken infection trials were subsequently carried out to evaluate four of the isolates for reducing the burden of Salmonella enterica serovar Typhimurium in the broiler cecum. Chicks were gavaged with LAB cultures (10(6-7 CFU/chick or phosphate-buffered saline (PBS at 1 day of age followed by Salmonella challenge (10(4 CFU/chick next day. Samples of cecal digesta, spleen, and liver were examined for Salmonella counts on days 1, 3, or 4 post-challenge. Salmonella in the cecum from Trial 3 was also assessed for the expression of ten virulence genes located in its pathogenicity island-1 (SPI-1. These genes play a role in Salmonella intestinal invasion. Tested LAB isolates (individuals or mixed cultures were unable to lower Salmonella burden in the chicken cecum, but able to attenuate Salmonella infection in the spleen and liver. The LAB treatments also reduced almost all SPI-1 virulence gene expression (9 out of 10 in the chicken cecum, particularly at the low dose. In vitro treatment with the extracellular culture fluid from a LAB culture also down-regulated most SPI-1 virulence gene expression. CONCLUSIONS/SIGNIFICANCE: The possible correlation between attenuation of Salmonella infection in the chicken spleen and liver and reduction of Salmonella SPI-1 virulence gene expression in the chicken cecum by LAB isolates is a new observation. Suppression of Salmonella virulence gene expression in

  19. Identification of genes preferentially expressed by highly virulent piscine Streptococcus agalactiae upon interaction with macrophages.

    Directory of Open Access Journals (Sweden)

    Chang-Ming Guo

    Full Text Available Streptococcus agalactiae, long recognized as a mammalian pathogen, is an emerging concern with regard to fish. In this study, we used a mouse model and in vitro cell infection to evaluate the pathogenetic characteristics of S. agalactiae GD201008-001, isolated from tilapia in China. This bacterium was found to be highly virulent and capable of inducing brain damage by migrating into the brain by crossing the blood-brain barrier (BBB. The phagocytosis assays indicated that this bacterium could be internalized by murine macrophages and survive intracellularly for more than 24 h, inducing injury to macrophages. Further, selective capture of transcribed sequences (SCOTS was used to investigate microbial gene expression associated with intracellular survival. This positive cDNA selection technique identified 60 distinct genes that could be characterized into 6 functional categories. More than 50% of the differentially expressed genes were involved in metabolic adaptation. Some genes have previously been described as associated with virulence in other bacteria, and four showed no significant similarities to any other previously described genes. This study constitutes the first step in further gene expression analyses that will lead to a better understanding of the molecular mechanisms used by S. agalactiae to survive in macrophages and to cross the BBB.

  20. Identification of Genes Preferentially Expressed by Highly Virulent Piscine Streptococcus agalactiae upon Interaction with Macrophages

    Science.gov (United States)

    Guo, Chang-Ming; Chen, Rong-Rong; Kalhoro, Dildar Hussain; Wang, Zhao-Fei; Liu, Guang-Jin; Lu, Cheng-Ping; Liu, Yong-Jie

    2014-01-01

    Streptococcus agalactiae, long recognized as a mammalian pathogen, is an emerging concern with regard to fish. In this study, we used a mouse model and in vitro cell infection to evaluate the pathogenetic characteristics of S. agalactiae GD201008-001, isolated from tilapia in China. This bacterium was found to be highly virulent and capable of inducing brain damage by migrating into the brain by crossing the blood–brain barrier (BBB). The phagocytosis assays indicated that this bacterium could be internalized by murine macrophages and survive intracellularly for more than 24 h, inducing injury to macrophages. Further, selective capture of transcribed sequences (SCOTS) was used to investigate microbial gene expression associated with intracellular survival. This positive cDNA selection technique identified 60 distinct genes that could be characterized into 6 functional categories. More than 50% of the differentially expressed genes were involved in metabolic adaptation. Some genes have previously been described as associated with virulence in other bacteria, and four showed no significant similarities to any other previously described genes. This study constitutes the first step in further gene expression analyses that will lead to a better understanding of the molecular mechanisms used by S. agalactiae to survive in macrophages and to cross the BBB. PMID:24498419

  1. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Poyin Chen

    2017-12-01

    Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

  2. PecS is an important player in the regulatory network governing the coordinated expression of virulence genes during the interaction between Dickeya dadantii 3937 and plants.

    Science.gov (United States)

    Mhedbi-Hajri, Nadia; Malfatti, Pierrette; Pédron, Jacques; Gaubert, Stéphane; Reverchon, Sylvie; Van Gijsegem, Frédérique

    2011-11-01

    Successful infection of a pathogen relies on the coordinated expression of numerous virulence factor-encoding genes. In plant-bacteria interactions, this control is very often achieved through the integration of several regulatory circuits controlling cell-cell communication or sensing environmental conditions. Dickeya dadantii (formerly Erwinia chrysanthemi), the causal agent of soft rot on many crops and ornamentals, provokes maceration of infected plants mainly by producing and secreting a battery of plant cell wall-degrading enzymes. However, several other virulence factors have also been characterized. During Arabidopsis infection, most D. dadantii virulence gene transcripts accumulated in a coordinated manner during infection. This activation requires a functional GacA-GacS two-component regulatory system but the Gac system is not involved in the growth phase dependence of virulence gene expression. Here we show that, contrary to Pectobacterium, the AHL-mediated ExpIR quorum-sensing system does not play a major role in the growth phase-dependent control of D. dadantii virulence genes. On the other hand, the global regulator PecS participates in this coordinated expression since, in a pecS mutant, an early activation of virulence genes is observed both in vitro and in planta. This correlated with the known hypervirulence phenotype of the pecS mutant. Analysis of the relationship between the regulatory circuits governed by the PecS and GacA global regulators indicates that these two regulators act independently. PecS prevents a premature expression of virulence genes in the first stages of colonization whereas GacA, presumably in conjunction with other regulators, is required for the activation of virulence genes at the onset of symptom occurrence. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  3. Pleiotropic Regulation of Virulence Genes in Streptococcus mutans by the Conserved Small Protein SprV.

    Science.gov (United States)

    Shankar, Manoharan; Hossain, Mohammad S; Biswas, Indranil

    2017-04-15

    Streptococcus mutans , an oral pathogen associated with dental caries, colonizes tooth surfaces as polymicrobial biofilms known as dental plaque. S. mutans expresses several virulence factors that allow the organism to tolerate environmental fluctuations and compete with other microorganisms. We recently identified a small hypothetical protein (90 amino acids) essential for the normal growth of the bacterium. Inactivation of the gene, SMU.2137, encoding this protein caused a significant growth defect and loss of various virulence-associated functions. An S. mutans strain lacking this gene was more sensitive to acid, temperature, osmotic, oxidative, and DNA damage-inducing stresses. In addition, we observed an altered protein profile and defects in biofilm formation, bacteriocin production, and natural competence development, possibly due to the fitness defect associated with SMU.2137 deletion. Transcriptome sequencing revealed that nearly 20% of the S. mutans genes were differentially expressed upon SMU.2137 deletion, thereby suggesting a pleiotropic effect. Therefore, we have renamed this hitherto uncharacterized gene as sprV ( s treptococcal p leiotropic r egulator of v irulence). The transcript levels of several relevant genes in the sprV mutant corroborated the phenotypes observed upon sprV deletion. Owing to its highly conserved nature, inactivation of the sprV ortholog in Streptococcus gordonii also resulted in poor growth and defective UV tolerance and competence development as in the case of S. mutans Our experiments suggest that SprV is functionally distinct from its homologs identified by structure and sequence homology. Nonetheless, our current work is aimed at understanding the importance of SprV in the S. mutans biology. IMPORTANCE Streptococcus mutans employs several virulence factors and stress resistance mechanisms to colonize tooth surfaces and cause dental caries. Bacterial pathogenesis is generally controlled by regulators of fitness that are

  4. Helicobacter pylori virulence genes and microevolution in host and the clinical outcome: review article

    Directory of Open Access Journals (Sweden)

    Seyedeh Zahra Bakhti

    2014-12-01

    Full Text Available Helicobacter pylori (H. pylori is the causative agent in development of gastroduode-nal diseases, such as chronic atrophic gastritis, peptic ulcers, mucosa associated lym-phoid tissue (MALT lymphoma, and gastric cancer. H. pylori has been associated with inflammation in cardia, showing the fact that infection with this bacterium could also be a risk factor for gastric cardia cancer. Gastric cancer is the fourth most common cancer worldwide. This is the second leading cause of cancer-related deaths, and ap-proximately 700,000 people succumb each year to gastric adenocarcinoma. It has been estimated that 69% of the Iranian population currently harbor H. pylori infection. The prevalence of duodenal ulcer and gastric cancer is high in Iranian populations. However, this has been largely influenced by geographic and/or ethnic origin. Epidemi-ology studies have shown that host, environmental, and bacterial factors determine the outcome of H. pylori infection. The bacterium contains allelic diversity and high genet-ic variability into core- and virulence-genes and that this diversity is geographically and ethnically structured. The genetic diversity within H. pylori is greater than within most other bacteria, and its diversity is more than 50-fold higher than that of human DNA. The maintenance of high diversification makes this bacterium to cope with particular challenges in individual hosts. It has been reported that the recombination contributed to the creation of new genes and gene family. Furthermore, the microevolution in cagA and vacA genes is a common event, leading to a change in the virulence phenotype. These factors contribute to the bacterial survival in acidic conditions in stomach and protect it from host immune system, causing tissue damage and clinical disease. In this review article, we discussed the correlation between H. pylori virulence factors and clin-ical outcomes, microevolution of H. pylori virulence genes in a single host

  5. Natural variation in the VELVET gene bcvel1 affects virulence and light-dependent differentiation in Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Julia Schumacher

    Full Text Available Botrytis cinerea is an aggressive plant pathogen causing gray mold disease on various plant species. In this study, we identified the genetic origin for significantly differing phenotypes of the two sequenced B. cinerea isolates, B05.10 and T4, with regard to light-dependent differentiation, oxalic acid (OA formation and virulence. By conducting a map-based cloning approach we identified a single nucleotide polymorphism (SNP in an open reading frame encoding a VELVET gene (bcvel1. The SNP in isolate T4 results in a truncated protein that is predominantly found in the cytosol in contrast to the full-length protein of isolate B05.10 that accumulates in the nuclei. Deletion of the full-length gene in B05.10 resulted in the T4 phenotype, namely light-independent conidiation, loss of sclerotial development and oxalic acid production, and reduced virulence on several host plants. These findings indicate that the identified SNP represents a loss-of-function mutation of bcvel1. In accordance, the expression of the B05.10 copy in T4 rescued the wild-type/B05.10 phenotype. BcVEL1 is crucial for full virulence as deletion mutants are significantly hampered in killing and decomposing plant tissues. However, the production of the two best known secondary metabolites, the phytotoxins botcinic acid and botrydial, are not affected by the deletion of bcvel1 indicating that other factors are responsible for reduced virulence. Genome-wide expression analyses of B05.10- and Δbcvel1-infected plant material revealed a number of genes differentially expressed in the mutant: while several protease- encoding genes are under-expressed in Δbcvel1 compared to the wild type, the group of over-expressed genes is enriched for genes encoding sugar, amino acid and ammonium transporters and glycoside hydrolases reflecting the response of Δbcvel1 mutants to nutrient starvation conditions.

  6. Natural variation in the VELVET gene bcvel1 affects virulence and light-dependent differentiation in Botrytis cinerea.

    Science.gov (United States)

    Schumacher, Julia; Pradier, Jean-Marc; Simon, Adeline; Traeger, Stefanie; Moraga, Javier; Collado, Isidro González; Viaud, Muriel; Tudzynski, Bettina

    2012-01-01

    Botrytis cinerea is an aggressive plant pathogen causing gray mold disease on various plant species. In this study, we identified the genetic origin for significantly differing phenotypes of the two sequenced B. cinerea isolates, B05.10 and T4, with regard to light-dependent differentiation, oxalic acid (OA) formation and virulence. By conducting a map-based cloning approach we identified a single nucleotide polymorphism (SNP) in an open reading frame encoding a VELVET gene (bcvel1). The SNP in isolate T4 results in a truncated protein that is predominantly found in the cytosol in contrast to the full-length protein of isolate B05.10 that accumulates in the nuclei. Deletion of the full-length gene in B05.10 resulted in the T4 phenotype, namely light-independent conidiation, loss of sclerotial development and oxalic acid production, and reduced virulence on several host plants. These findings indicate that the identified SNP represents a loss-of-function mutation of bcvel1. In accordance, the expression of the B05.10 copy in T4 rescued the wild-type/B05.10 phenotype. BcVEL1 is crucial for full virulence as deletion mutants are significantly hampered in killing and decomposing plant tissues. However, the production of the two best known secondary metabolites, the phytotoxins botcinic acid and botrydial, are not affected by the deletion of bcvel1 indicating that other factors are responsible for reduced virulence. Genome-wide expression analyses of B05.10- and Δbcvel1-infected plant material revealed a number of genes differentially expressed in the mutant: while several protease- encoding genes are under-expressed in Δbcvel1 compared to the wild type, the group of over-expressed genes is enriched for genes encoding sugar, amino acid and ammonium transporters and glycoside hydrolases reflecting the response of Δbcvel1 mutants to nutrient starvation conditions.

  7. The diversities of staphylococcal species, virulence and antibiotic resistance genes in the subclinical mastitis milk from a single Chinese cow herd.

    Science.gov (United States)

    Xu, Jia; Tan, Xiao; Zhang, Xinyu; Xia, Xiaoli; Sun, Huaichang

    2015-11-01

    Staphylococci are the leading pathogens of bovine mastitis which is difficult to control. However, the published data on the prevalence of staphylococcal species, virulence and antibiotic resistance genes in bovine mastitis from China are limited. In this study, 104 out of 209 subclinical mastitis milk samples from a single Chinese dairy herd were cultured-positive for staphylococci (49.8%), which were further identified as coagulase-positive staphylococci (CPS) or coagulase-negative staphylococci (CNS). According to the partial tuf and/or 16S rRNA gene sequence, the 28 CPS isolates were confirmed to be Staphylococcus aureus (26.9%), and 76 CNS isolates were assigned to 13 different species (73.1%) with Staphylococcus arlettae, Staphylococcus sciuri, Staphylococcus xylosus and Staphylococcus chromogenes as the dominant species. In the 28 S. aureus isolates, the most prevalent general virulence genes were coa, Ig and eno (100%), followed by hla (96.4%), hlb (92.9%), fib (92.9%), clfA (89.3%), clfB (85.7%) and nuc (85.7%). Both exotoxin and biofilm-associated genes were significantly less prevalent than the previously reported. Although 19 different virulence gene patterns were found, only one was dominant (32.1%). The prevalence of blaZ (82.1%) or mecA gene (35.7%) was much higher than the previously reported. In the 76 CNS isolates, the virulence genes were significantly less prevalent than that in the S. aureus isolates. Among the 4 main CNS species, S. chromogenes (n = 12) was the only species with high percentage (75%) of blaZ gene, while S. sciuri (n = 12) was the only species with the high percentage (66.7%) of mecA gene. The most of antibiotic resistance genes were present as multi-resistance genes, and the antibiotic resistances were attributed by different resistance genes between resistant S. aureus and CNS isolates. These data suggest that the prevalence of staphylococcal species, virulence and antibiotic resistance in the mastitis milk from the Chinese

  8. Antimicrobial susceptibility, virulence genes, and randomly amplified polymorphic DNA analysis of Staphylococcus aureus recovered from bovine mastitis in Ningxia, China.

    Science.gov (United States)

    Wang, Dong; Zhang, Limei; Zhou, Xuezhang; He, Yulong; Yong, Changfu; Shen, Mingliang; Szenci, Otto; Han, Bo

    2016-12-01

    Staphylococcus aureusis the leading pathogen involved inbovine mastitis, but knowledgeabout antimicrobial resistance, virulence factors, and genotypes of Staphylococcus aureus resulting in bovine mastitis in Ningxia, China, is limited. Therefore, antimicrobial susceptibility, virulence gene, and randomly amplified polymorphic DNA (RAPD) analyses of Staph. aureus were carried out. A total of 327 milk samples from cows with clinical and subclinical mastitis in 4 regions of Ningxia were used for the isolation and identification of pathogens according to phenotypic and molecular characteristics. Antimicrobial susceptibility against 22 antimicrobial agents was determined by disk diffusion. The presence of 8 virulence genes in Staph. aureus isolates was tested by PCR. Genotypes of isolates were investigated based on RAPD. Results showed that 35 isolates obtained from mastitis milk samples were identified as Staph. aureus. The isolates were resistant to sulfamethoxazole (100%), penicillin G (94.3%), ampicillin (94.3%), erythromycin (68.6%), azithromycin (68.6%), clindamycin (25.7%), amoxicillin (11.4%), and tetracycline (5.7%). All of the isolates contained one or more virulence genes with average (standard deviation) of 6.6±1.6. The most prevalent virulence genes were hlb (97.1%), followed by fnbpA, hla, coa (94.3% each), nuc (85.7%), fnbpB (80%), clfA (77.1%), and tsst-1 (40%). Nine different gene patterns were found and 3 of them were the dominant gene combinations (77.1%). Staphylococcus aureus isolates (n=35) were divided into 6 genotypes by RAPD tying, the genotypes III and VI were the most prevalent genotypes. There was greatvariation in genotypes of Staph. aureus isolates, not only among different farms, but also within the same herd in Ningxia province. The study showed a high incidence of Staph. aureus with genomic variation of resistance genes, which is matter of great concern in public and animal health in Ningxia province of China. Copyright © 2016 American

  9. Longitudinal study on the sources of Listeria monocytogenes contamination in cold-smoked salmon and its processing environment in Italy.

    Science.gov (United States)

    Di Ciccio, Pierluigi; Meloni, Domenico; Festino, Anna Rita; Conter, Mauro; Zanardi, Emanuela; Ghidini, Sergio; Vergara, Alberto; Mazzette, Rina; Ianieri, Adriana

    2012-08-01

    The aim of the present study was to investigate the sources of Listeria monocytogenes contamination in a cold smoked salmon processing environment over a period of six years (2003-2008). A total of 170 samples of raw material, semi-processed, final product and processing surfaces at different production stages were tested for the presence of L. monocytogenes. The L. monocytogenes isolates were characterized by multiplex PCR for the analysis of virulence factors and for serogrouping. The routes of contamination over the six year period were traced by PFGE. L. monocytogenes was isolated from 24% of the raw salmon samples, 14% of the semi-processed products and 12% of the final products. Among the environmental samples, 16% were positive for L. monocytogenes. Serotyping yielded three serovars: 1/2a, 1/2b, 4b, with the majority belonging to serovars 1/2a (46%) and 1/2b (39%). PFGE yielded 14 profiles: two of them were repeatedly isolated in 2005-2006 and in 2007-2008 mainly from the processing environment and final products but also from raw materials. The results of this longitudinal study highlighted that contamination of smoked salmon occurs mainly during processing rather than originating from raw materials, even if raw fish can be a contamination source of the working environment. Molecular subtyping is critical for the identification of the contamination routes of L. monocytogenes and its niches into the production plant when control strategies must be implemented with the aim to reduce its prevalence during manufacturing. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. An eight-year study of Shigella species in Beijing, China: serodiversity, virulence genes, and antimicrobial resistance.

    Science.gov (United States)

    Qu, Mei; Zhang, Xin; Liu, Guirong; Huang, Ying; Jia, Lei; Liang, Weili; Li, Xitai; Wu, Xiaona; Li, Jie; Yan, Hanqiu; Kan, Biao; Wang, Quanyi

    2014-07-14

    This study was conducted to determine the prevalence of serotypes, virulence factors, and antimicrobial resistance patterns of Shigella spp. in Beijing, China, from 2004 to 2011. Real-time PCR assays were used to detect virulent genes, and the Kirby-Bauer disk diffusion method was used to evaluate antimicrobial resistance. Among the total of 1,652 Shigella isolates, S. sonnei (57.1%) was the predominant species, followed by S. flexneri (42.3%), S. dysenteriae (0.4%), and S. boydii (0.2%). Nineteen serotypes were discovered among S. flexneri strains. The virulence gene ipaH was the most frequent, followed by sen and set. The presence of set showed significant difference in two dominant serogroups, S. flexneri and S. sonnei. Over 90% of Shigella isolates showed resistance to at least three drugs with widened spectrum. High-level antimicrobial resistance to single and multiple antibiotics was more common among S. sonnei than S. flexneri. There was an obvious serotype change and a dramatic increase of antibiotic resistance in Shigella prevalence in Beijing.

  11. Genomes of the most dangerous epidemic bacteria have a virulence repertoire characterized by fewer genes but more toxin-antitoxin modules.

    Directory of Open Access Journals (Sweden)

    Kalliopi Georgiades

    2011-03-01

    Full Text Available We conducted a comparative genomic study based on a neutral approach to identify genome specificities associated with the virulence capacity of pathogenic bacteria. We also determined whether virulence is dictated by rules, or if it is the result of individual evolutionary histories. We systematically compared the genomes of the 12 most dangerous pandemic bacteria for humans ("bad bugs" to their closest non-epidemic related species ("controls".We found several significantly different features in the "bad bugs", one of which was a smaller genome that likely resulted from a degraded recombination and repair system. The 10 Cluster of Orthologous Group (COG functional categories revealed a significantly smaller number of genes in the "bad bugs", which lacked mostly transcription, signal transduction mechanisms, cell motility, energy production and conversion, and metabolic and regulatory functions. A few genes were identified as virulence factors, including secretion system proteins. Five "bad bugs" showed a greater number of poly (A tails compared to the controls, whereas an elevated number of poly (A tails was found to be strongly correlated to a low GC% content. The "bad bugs" had fewer tandem repeat sequences compared to controls. Moreover, the results obtained from a principal component analysis (PCA showed that the "bad bugs" had surprisingly more toxin-antitoxin modules than did the controls.We conclude that pathogenic capacity is not the result of "virulence factors" but is the outcome of a virulent gene repertoire resulting from reduced genome repertoires. Toxin-antitoxin systems could participate in the virulence repertoire, but they may have developed independently of selfish evolution.

  12. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

    DEFF Research Database (Denmark)

    Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

    2009-01-01

    Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....

  13. Comparison of phenotypic and virulence genes characteristics in human and chicken isolates of Proteus mirabilis.

    Science.gov (United States)

    Barbour, Elie K; Hajj, Zahi G; Hamadeh, Shadi; Shaib, Houssam A; Farran, Mohamad T; Araj, George; Faroon, Obaid; Barbour, Kamil E; Jirjis, Faris; Azhar, Esam; Kumosani, Taha; Harakeh, Steve

    2012-10-01

    The objective of this work is to compare the phenotypic and virulence genes characteristics in human and chicken isolates of Proteus mirabilis. The bacterial examination of 50 livers of individual broilers, marketed by four major outlets, revealed a high recovery of P. mirabilis (66%), and a low recovery frequency of Salmonella spp. (4%), Serratia odorifera (2%), Citrobacter brakii (2%), and Providencia stuartii (2%). The phenotypic biochemical characterization of the recovered 33 chicken isolates of P. mirabilis were compared to 30 human isolates (23 urinary and six respiratory isolates). The comparison revealed significant differences in the presence of gelatinase enzyme (100% presence in chicken isolates versus 91.3 and 83.3% presence in human urinary and respiratory isolates, respectively, P,0.05). The H(2)S production occurred in 100% of chicken isolates versus 95.6 and 66.7% presence in human urinary and respiratory isolates, respectively, P,0.05). The other 17 biochemical characteristics did not differ significantly among the three groups of isolates (P.0.05). Two virulence genes, the mrpA and FliL, were having a typical 100% presence in randomly selected isolates of P. mirabilis recovered from chicken livers (N510) versus isolates recovered from urinary (N55) and respiratory specimens of humans (N55) (P.0.05). The average percentage similarity of mrpA gene nucleotide sequence of poultry isolates to human urinary and respiratory isolates was 93.2 and 97.5-%, respectively. The high similarity in phenotypic characteristics, associated with typical frequency of presence of two virulence genes, and high similarity in sequences of mrpA gene among poultry versus human P. mirabilis isolates justifies future investigations targeting the evaluation of adaptable pathogenicity of avian Proteus mirabilis isolates to mammalian hosts.

  14. Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

    2015-08-01

    In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates.

    Science.gov (United States)

    Paixão, A C; Ferreira, A C; Fontes, M; Themudo, P; Albuquerque, T; Soares, M C; Fevereiro, M; Martins, L; Corrêa de Sá, M I

    2016-07-01

    Poultry colibacillosis due to Avian Pathogenic Escherichia coli (APEC) is responsible for several extra-intestinal pathological conditions, leading to serious economic damage in poultry production. The most commonly associated pathologies are airsacculitis, colisepticemia, and cellulitis in broiler chickens, and salpingitis and peritonitis in broiler breeders. In this work a total of 66 strains isolated from dead broiler breeders affected with colibacillosis and 61 strains from healthy broilers were studied. Strains from broiler breeders were typified with serogroups O2, O18, and O78, which are mainly associated with disease. The serogroup O78 was the most prevalent (58%). All the strains were checked for the presence of 11 virulence genes: 1) arginine succinyltransferase A (astA); ii) E.coli hemeutilization protein A (chuA); iii) colicin V A/B (cvaA/B); iv) fimbriae mannose-binding type 1 (fimC); v) ferric yersiniabactin uptake A (fyuA); vi) iron-repressible high-molecular-weight proteins 2 (irp2); vii) increased serum survival (iss); viii) iron-uptake systems of E.coli D (iucD); ix) pielonefritis associated to pili C (papC); x) temperature sensitive haemaglutinin (tsh), and xi) vacuolating autotransporter toxin (vat), by Multiplex-PCR. The results showed that all genes are present in both commensal and pathogenic E. coli strains. The iron uptake-related genes and the serum survival gene were more prevalent among APEC. The adhesin genes, except tsh, and the toxin genes, except astA, were also more prevalent among APEC isolates. Except for astA and tsh, APEC strains harbored the majority of the virulence-associated genes studied and fimC was the most prevalent gene, detected in 96.97 and 88.52% of APEC and AFEC strains, respectively. Possession of more than one iron transport system seems to play an important role on APEC survival. © 2016 Poultry Science Association Inc.

  16. Identification of a novel gene in ROD9 island of Salmonella Enteritidis involved in the alteration of virulence-associated genes expression.

    Science.gov (United States)

    Das, Susmita; Ray, Shilpa; Ryan, Daniel; Sahu, Bikash; Suar, Mrutyunjay

    2018-01-01

    Salmonella enterica subsp. I serovar Enteritidis (S. Enteritidis), one of the causative agents for non-typhoidal gastrointestinal diseases in humans is an intracellular bacterium and mechanism for its invasion into host cells is critical to cause infection. The virulence of the pathogen is explained by the expression of genes located on its pathogenicity islands, mostly encoded under SPI-1 and SPI-2. However, S. Typhimurium SL1344, despite sharing ∼98% of its genome with S. Enteritidis P125109, lacks few regions of differences (ROD) that are hypothesized to impart virulence potential to S. Enteritidis. In this study, we created different mutants in the ROD9 island of S. Enteritidis, also referred as SPI-19 and identified a novel locus, SEN1005, encoding a hypothetical protein that is involved in its pathogenesis. ΔSEN1005 displayed significantly reduced entry into cultured epithelial cells as well as uptake by macrophages and failed to cause acute colitis in C57BL/6 mice at day 3 post-infection (p.i.). Additionally, the global transcriptome analysis revealed a highly repressed SPI-1 and other down-regulated genes responsible for flagellar assembly, chemotaxis and motility in the mutant which correlated with decreased invasion and abated inflammation as compared to the wild-type. Therefore, our findings revealed that ΔSEN1005 was attenuated in vitro as well as in vivo and we propose this hypothetical protein to play a role in altering the expression of genes involved in Salmonella virulence.

  17. Catecholamines promote the expression of virulence and oxidative stress genes in Porphyromonas gingivalis.

    Science.gov (United States)

    Graziano, T S; Closs, P; Poppi, T; Franco, G C; Cortelli, J R; Groppo, F C; Cogo, K

    2014-10-01

    Stress has been identified as an important risk factor in the development of many infectious diseases, including periodontitis. Porphyromonas gingivalis, a gram-negative oral anaerobic bacterium, is considered an important pathogen in chronic periodontitis. Microorganisms, including P. gingivalis, that participate in infectious diseases have been shown to respond to catecholamines released during stress processes by modifying their growth and virulence. Therefore, the purpose of this study was to evaluate the effects of adrenaline and noradrenaline on the growth, antimicrobial susceptibility and gene expression in P. gingivalis. P. gingivalis was incubated in the presence of adrenaline and noradrenaline (100 μm) for different time-periods in rich (Tryptic soy broth supplemented with 0.2% yeast extract, 5 μg/mL of hemin and 1 μg/mL of menadione) and poor (serum-SAPI minimal medium and serum-SAPI minimal medium supplemented with 5 μg/mL of hemin and 1 μg/mL of menadione) media, and growth was evaluated based on absorbance at 660 nm. Bacterial susceptibility to metronidazole was examined after exposure to adrenaline and noradrenaline. The expression of genes involved in iron acquisition, stress oxidative protection and virulence were also evaluated using RT-quantitative PCR. Catecholamines did not interfere with the growth of P. gingivalis, regardless of nutritional or hemin conditions. In addition, bacterial susceptibility to metronidazole was not modified by exposure to adrenaline or noradrenaline. However, the expression of genes related to iron acquisition (hmuR), oxidative stress (tpx, oxyR, dps, sodB and aphC) and pathogenesis (hem, hagA and ragA) were stimulated upon exposure to adrenaline and/or noradrenaline. Adrenaline and noradrenaline can induce changes in gene expression related to oxidative stress and virulence factors in P. gingivalis. The present study is, in part, a step toward understanding the stress-pathogen interactions that may

  18. Transcriptomic Analysis of the Adaptation of Listeria monocytogenes to Lagoon and Soil Matrices Associated with a Piggery Environment: Comparison of Expression Profiles

    Science.gov (United States)

    Vivant, Anne-Laure; Desneux, Jeremy; Pourcher, Anne-Marie; Piveteau, Pascal

    2017-01-01

    Understanding how Listeria monocytogenes, the causative agent of listeriosis, adapts to the environment is crucial. Adaptation to new matrices requires regulation of gene expression. To determine how the pathogen adapts to lagoon effluent and soil, two matrices where L. monocytogenes has been isolated, we compared the transcriptomes of L. monocytogenes CIP 110868 20 min and 24 h after its transfer to effluent and soil extract. Results showed major variations in the transcriptome of L. monocytogenes in the lagoon effluent but only minor modifications in the soil. In both the lagoon effluent and in the soil, genes involved in mobility and chemotaxis and in the transport of carbohydrates were the most frequently represented in the set of genes with higher transcript levels, and genes with phage-related functions were the most represented in the set of genes with lower transcript levels. A modification of the cell envelop was only found in the lagoon environment. Finally, the differential analysis included a large proportion of regulators, regulons, and ncRNAs. PMID:29018416

  19. Differences in virulence genes and genome patterns of mastitis-associated Staphylococcus aureus among goat, cow, and human isolates in Taiwan.

    Science.gov (United States)

    Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi

    2013-03-01

    A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

  20. Detection of virulence genes determining the ability to adhere and invade in Campylobacter spp. from cattle and swine in Poland.

    Science.gov (United States)

    Wysok, Beata; Wojtacka, Joanna

    2018-02-01

    The aim of the study was to determine the prevalence of virulence genes responsible for the adhesion (flaA, cadF and racR) and invasion (virB11, iam and pldA) in Campylobacter isolates from cattle and swine and determine their adherence and invasion abilities. The studies conducted revealed high prevalence rate of adherence and invasion associated genes irrespective of the isolates origin. All Campylobacter strains of swine and cattle origin adhered to HeLa cells at mean level 0.1099% ± SD 0.1341% and 0.0845% ± SD 0.1304% of starting viable inoculum, respectively. However swine isolates exhibited higher invasion abilities (0.0012% ± SD 0.0011%) compared to bovine isolates (0.00038% ± SD 0.00055%). The results obtained revealed significantly positive correlation between invasion and adherence abilities of swine origin isolates (R = 0.4867 in regard to C. jejuni and R = 0.4507 in regard to C. coli) and bovine origin isolates (R = 0.726 in regard to C. jejuni). Bacterial virulence is multifactorial and it is affected by the expression of virulence genes. Moreover the presence of virulence genes determines the ability of Campylobacter isolates to adhere and invade the cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Virulence genes and genetic diversity of Streptococcus suis serotype 2 isolates from Thailand.

    Science.gov (United States)

    Maneerat, K; Yongkiettrakul, S; Kramomtong, I; Tongtawe, P; Tapchaisri, P; Luangsuk, P; Chaicumpa, W; Gottschalk, M; Srimanote, P

    2013-11-01

    Isolates of Streptococcus suis from different Western countries as well as those from China and Vietnam have been previously well characterized. So far, the genetic characteristics and relationship between S. suis strains isolated from both humans and pigs in Thailand are unknown. In this study, a total of 245 S. suis isolates were collected from both human cases (epidemic and sporadic) and pigs (diseased and asymptomatic) in Thailand. Bacterial strains were identified by biochemical tests and PCR targeting both, the 16S rRNA and gdh genes. Thirty-six isolates were identified as serotype 2 based on serotyping and the cps2-PCR. These isolates were tested for the presence of six virulence-associated genes: an arginine deiminase (arcA), a 38-kDa protein and protective antigen (bay046), an extracellular factor (epf), an hyaluronidase (hyl), a muramidase-released protein (mrp) and a suilysin (sly). In addition, the genetic diversities of these isolates were studied by RAPD PCR and multilocus sequence typing (MLST) analysis. Four virulence-associated gene patterns (VAGP 1 to 4) were obtained, and the majority of isolates (32/36) carried all genes tested (VAGP1). Each of the three OPB primers used provided 4 patterns designated RAPD-A to RAPD-D. Furthermore, MLST analysis could also distinguish the 36 isolates into four sequence types (STs): ST1 (n = 32), ST104 (n = 2), ST233 (n = 1) and a newly identified ST, ST336 (n = 1). Dendrogram constructions based on RAPD patterns indicated that S. suis serotype 2 isolates from Thailand could be divided into four groups and that the characteristics of the individual groups were in complete agreement with the virulence gene profiles and STs. The majority (32/36) of isolates recovered from diseased pigs, slaughterhouse pigs or human patients could be classified into a single group (VAGP1, RAPD-A and ST1). This genetic information strongly suggests the transmission of S. suis isolates from pigs to humans in Thailand. Our findings are

  2. Virulence genes and subclone status as markers of experimental virulence in a murine sepsis model among Escherichia coli sequence type 131 clinical isolates from Spain.

    Directory of Open Access Journals (Sweden)

    Irene Merino

    Full Text Available To assess experimental virulence among sequence type 131 (ST131 Escherichia coli bloodstream isolates in relation to virulence genotype and subclone.We analysed 48 Spanish ST131 bloodstream isolates (2010 by PCR for ST131 subclone status (H30Rx, H30 non-Rx, or non-H30, virulence genes (VGs, and O-type. Then we compared these traits with virulence in a murine sepsis model, as measured by illness severity score (ISS and rapid lethality (mean ISS ≥ 4.Of the 48 study isolates, 65% were H30Rx, 21% H30 non-Rx, and 15% non-H30; 44% produced ESBLs, 98% were O25b, and 83% qualified as extraintestinal pathogenic E. coli (ExPEC. Of 49 VGs, ibeA and iss were associated significantly with non-H30 isolates, and sat, iha and malX with H30 isolates. Median VG scores differed by subclone, i.e., 12 (H30Rx, 10 (H30 non-Rx, and 11 (non-H30 (p < 0.01. Nearly 80% of isolates represented a described virotype. In mice, H30Rx and non-H30 isolates were more virulent than H30 non-Rx isolates (according to ISS [p = 0.03] and rapid lethality [p = 0.03], as were ExPEC isolates compared with non-ExPEC isolates (median ISS, 4.3 vs. 2.7: p = 0.03. In contrast, most individual VGs, VG scores, VG profiles, and virotypes were not associated with mouse virulence.ST131 subclone and ExPEC status, but not individual VGs, VG scores or profiles, or virotypes, predicted mouse virulence. Given the lower virulence of non-Rx H30 isolates, hypervirulence probably cannot explain the ST131-H30 clade's epidemic emergence.

  3. Identifying Virulence-Associated Genes Using Transcriptomic and Proteomic Association Analyses of the Plant Parasitic Nematode Bursaphelenchus mucronatus

    Directory of Open Access Journals (Sweden)

    Lifeng Zhou

    2016-09-01

    Full Text Available Bursaphelenchus mucronatus (B. mucronatus isolates that originate from different regions may vary in their virulence, but their virulence-associated genes and proteins are poorly understood. Thus, we conducted an integrated study coupling RNA-Seq and isobaric tags for relative and absolute quantitation (iTRAQ to analyse transcriptomic and proteomic data of highly and weakly virulent B. mucronatus isolates during the pathogenic processes. Approximately 40,000 annotated unigenes and 5000 proteins were gained from the isolates. When we matched all of the proteins with their detected transcripts, a low correlation coefficient of r = 0.138 was found, indicating probable post-transcriptional gene regulation involved in the pathogenic processes. A functional analysis showed that five differentially expressed proteins which were all highly expressed in the highly virulent isolate were involved in the pathogenic processes of nematodes. Peroxiredoxin, fatty acid- and retinol-binding protein, and glutathione peroxidase relate to resistance against plant defence responses, while β-1,4-endoglucanase and expansin are associated with the breakdown of plant cell walls. Thus, the pathogenesis of B. mucronatus depends on its successful survival in host plants. Our work adds to the understanding of B. mucronatus’ pathogenesis, and will aid in controlling B. mucronatus and other pinewood nematode species complexes in the future.

  4. [Research on the relevance between the virulent genes differential expression and pathogenecity of Leptospira with microarray].

    Science.gov (United States)

    Yu, De-li; Bao, Lang

    2015-01-01

    To find the change of virulent gene expression and to analyze the relevance between the virulent change and the gene expression. Grouped guinea pigs were inoculated with 1 mL Leptospira cultured in vivo, Leptospira cultured in vitro and the Leptospira culture medium through abdominal subcutaneous respectively. The survival rate, body mass and temperature change of guinea pigs in different groups were measured within 15 d after the inoculation, then the survived guinea pigs were scarified, and the organ coefficient was also measured to know the virulence of Leptospira cultured in different environment. The amplified gene segments from Leptospira were used as probes and wrote the microarray. The total RNA was extracted from Leptospira standard strain cultured in culture medium and guinea pigs. After reverse transcription to cDNA, they were labeled with Cy3 and Cy5 respectively. Labeled cDNA was mixed and hybridized with the microarray. The hybridized mircroarray was scanned and analysed. The survival rate of inoculated guinea pig was different from group to group (in vivo group: 0%; in vitro group: 88.9%; culture medium group: 100%). The guinea pigs in vivo group had a higher temperature (PLeptospira: LA1027, LA1029, LA4004, LA3050, LA3540, LA0327, LA0378, LA1650, LA3937, LA2089, LA2144, LA3576, LA0011 and gene of Loa22 were up regulation after continuously cultured in guinea pigs. The pathogenic ability of Leptospira cultured in different environment is different and the gene expression of Leptospira is different between in vivo and in vitro as well. The understanding of the meaning of this change might help to know the pathogenecity of Leptospira.

  5. Use of Potential Probiotic Lactic Acid Bacteria (LAB) Biofilms for the Control of Listeria monocytogenes, Salmonella Typhimurium, and Escherichia coli O157:H7 Biofilms Formation.

    Science.gov (United States)

    Gómez, Natacha C; Ramiro, Juan M P; Quecan, Beatriz X V; de Melo Franco, Bernadette D G

    2016-01-01

    Use of probiotic biofilms can be an alternative approach for reducing the formation of pathogenic biofilms in food industries. The aims of this study were (i) to evaluate the probiotic properties of bacteriocinogenic (Lactococcus lactis VB69, L. lactis VB94, Lactobacillus sakei MBSa1, and Lactobacillus curvatus MBSa3) and non-bacteriocinogenic (L. lactis 368, Lactobacillus helveticus 354, Lactobacillus casei 40, and Weissela viridescens 113) lactic acid bacteria (LAB) isolated from Brazilian's foods and (ii) to develop protective biofilms with these strains and test them for exclusion of Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella Typhimurium. LAB were tested for survival in acid and bile salt conditions, surface properties, biosurfactant production, β-galactosidase and gelatinase activity, antibiotic resistance and presence of virulence genes. Most strains survived exposure to pH 2 and 4% bile salts. The highest percentages of auto-aggregation were obtained after 24 h of incubation. Sixty-seven percentage auto-aggregation value was observed in W. viridescens 113 and Lactobacillus curvatus MBSa3 exhibited the highest co-aggregation (69% with Listeria monocytogenes and 74.6% with E. coli O157:H7), while the lowest co-aggregation was exhibited by W. viridescens 113 (53.4% with Listeria monocytogenes and 38% with E. coli O157:H7). Tests for hemolytic activity, bacterial cell adherence with xylene, and drop collapse confirmed the biosurfactant-producing ability of most strains. Only one strain (L. lactis 368) produced β-galactosidase. All strains were negative for virulence genes cob, ccf, cylLL, cylLs, cyllM, cylB, cylA and efaAfs and gelatinase production. The antibiotic susceptibility tests indicated that the MIC for ciprofloxacin, clindamycin, gentamicin, kanamycin, and streptomycin did not exceed the epidemiological cut-off suggested by the European Food Safety Authority. Some strains were resistant to one or more antibiotics and resistance

  6. Staphylococcus aureus Quorum Regulator SarA Targeted Compound, 2-[(Methylaminomethyl]phenol Inhibits Biofilm and Down-Regulates Virulence Genes

    Directory of Open Access Journals (Sweden)

    P. Balamurugan

    2017-07-01

    Full Text Available Staphylococcus aureus is a widely acknowledged Gram-positive pathogen for forming biofilm and virulence gene expressions by quorum sensing (QS, a cell to cell communication process. The quorum regulator SarA of S. aureus up-regulates the expression of many virulence factors including biofilm formation to mediate pathogenesis and evasion of the host immune system in the late phases of growth. Thus, inhibiting the production or blocking SarA protein might influence the down-regulation of biofilm and virulence factors. In this context, here we have synthesized 2-[(Methylaminomethyl]phenol, which was specifically targeted toward the quorum regulator SarA through in silico approach in our previous study. The molecule has been evaluated in vitro to validate its antibiofilm activity against clinical S. aureus strains. In addition, antivirulence properties of the inhibitor were confirmed with the observation of a significant reduction in the expression of representative virulence genes like fnbA, hla and hld that are governed under S. aureus QS. Interestingly, the SarA targeted inhibitor showed negligible antimicrobial activity and markedly reduced the minimum inhibitory concentration of conventional antibiotics when used in combination making it a more attractive lead for further clinical tests.

  7. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  8. Erwinia amylovora expresses fast and simultaneously hrp/dsp virulence genes during flower infection on apple trees.

    Directory of Open Access Journals (Sweden)

    Doris Pester

    Full Text Available BACKGROUND: Pathogen entry through host blossoms is the predominant infection pathway of the gram-negative bacterium Erwinia amylovora leading to manifestation of the disease fire blight. Like in other economically important plant pathogens, E. amylovora pathogenicity depends on a type III secretion system encoded by hrp genes. However, timing and transcriptional order of hrp gene expression during flower infections are unknown. METHODOLOGY/PRINCIPAL FINDINGS: Using quantitative real-time PCR analyses, we addressed the questions of how fast, strong and uniform key hrp virulence genes and the effector dspA/E are expressed when bacteria enter flowers provided with the full defense mechanism of the apple plant. In non-invasive bacterial inoculations of apple flowers still attached to the tree, E. amylovora activated expression of key type III secretion genes in a narrow time window, mounting in a single expression peak of all investigated hrp/dspA/E genes around 24-48 h post inoculation (hpi. This single expression peak coincided with a single depression in the plant PR-1 expression at 24 hpi indicating transient manipulation of the salicylic acid pathway as one target of E. amylovora type III effectors. Expression of hrp/dspA/E genes was highly correlated to expression of the regulator hrpL and relative transcript abundances followed the ratio: hrpA>hrpN>hrpL>dspA/E. Acidic conditions (pH 4 in flower infections led to reduced virulence/effector gene expression without the typical expression peak observed under natural conditions (pH 7. CONCLUSION/SIGNIFICANCE: The simultaneous expression of hrpL, hrpA, hrpN, and the effector dspA/E during early floral infection indicates that speed and immediate effector transmission is important for successful plant invasion. When this delicate balance is disturbed, e.g., by acidic pH during infection, virulence gene expression is reduced, thus partly explaining the efficacy of acidification in fire blight

  9. Virulence Characterization of Salmonella enterica by a New Microarray: Detection and Evaluation of the Cytolethal Distending Toxin Gene Activity in the Unusual Host S. Typhimurium.

    Directory of Open Access Journals (Sweden)

    Rui Figueiredo

    Full Text Available Salmonella enterica is a zoonotic foodborne pathogen that causes acute gastroenteritis in humans. We assessed the virulence potential of one-hundred and six Salmonella strains isolated from food animals and products. A high through-put virulence genes microarray demonstrated Salmonella Pathogenicity Islands (SPI and adherence genes were highly conserved, while prophages and virulence plasmid genes were variably present. Isolates were grouped by serotype, and virulence plasmids separated S. Typhimurium in two clusters. Atypical microarray results lead to whole genome sequencing (WGS of S. Infantis Sal147, which identified deletion of thirty-eight SPI-1 genes. Sal147 was unable to invade HeLa cells and showed reduced mortality in Galleria mellonella infection model, in comparison to a SPI-1 harbouring S. Infantis. Microarray and WGS of S. Typhimurium Sal199, established for the first time in S. Typhimurium presence of cdtB and other Typhi-related genes. Characterization of Sal199 showed cdtB genes were upstream of transposase IS911, and co-expressed with other Typhi-related genes. Cell cycle arrest, cytoplasmic distension, and nuclear enlargement were detected in HeLa cells infected by Sal199, but not with S. Typhimurium LT2. Increased mortality of Galleria was detected on infection with Sal199 compared to LT2. Thus, Salmonella isolates were rapidly characterized using a high through-put microarray; helping to identify unusual virulence features which were corroborated by further characterisation. This work demonstrates that the use of suitable screening methods for Salmonella virulence can help assess the potential risk associated with certain Salmonella to humans. Incorporation of such methodology into surveillance could help reduce the risk of emergence of epidemic Salmonella strains.

  10. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes.

    Science.gov (United States)

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S; Allard, Marc W; Strain, Errol A; Brown, Eric W

    2016-10-15

    Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated that core genome MLST

  11. Salmonella Modulates Metabolism During Growth under Conditions that Induce Expression of Virulence Genes

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young-Mo; Schmidt, Brian; Kidwai, Afshan S.; Jones, Marcus B.; Deatherage, Brooke L.; Brewer, Heather M.; Mitchell, Hugh D.; Palsson, Bernhard O.; McDermott, Jason E.; Heffron, Fred; Smith, Richard D.; Peterson, Scott N.; Ansong, Charles; Hyduke, Daniel R.; Metz, Thomas O.; Adkins, Joshua N.

    2013-04-05

    Salmonella enterica serovar Typhimurium (S. Typhimurium) is a facultative pathogen that uses complex mechanisms to invade and proliferate within mammalian host cells. To investigate possible contributions of metabolic processes in S. Typhimurium grown under conditions known to induce expression of virulence genes, we used a metabolomics-driven systems biology approach coupled with genome scale modeling. First, we identified distinct metabolite profiles associated with bacteria grown in either rich or virulence-inducing media and report the most comprehensive coverage of the S. Typhimurium metabolome to date. Second, we applied an omics-informed genome scale modeling analysis of the functional consequences of adaptive alterations in S. Typhimurium metabolism during growth under our conditions. Excitingly, we observed possible sequestration of metabolites recently suggested to have immune modulating roles. Modeling efforts highlighted a decreased cellular capability to both produce and utilize intracellular amino acids during stationary phase culture in virulence conditions, despite significant abundance increases for these molecules as observed by our metabolomics measurements. Model-guided analysis suggested that alterations in metabolism prioritized other activities necessary for pathogenesis instead, such as lipopolysaccharide biosynthesis.

  12. Structure of Rot, a global regulator of virulence genes in Staphylococcus aureus.

    Science.gov (United States)

    Zhu, Yuwei; Fan, Xiaojiao; Zhang, Xu; Jiang, Xuguang; Niu, Liwen; Teng, Maikun; Li, Xu

    2014-09-01

    Staphylococcus aureus is a highly versatile pathogen that can infect human tissue by producing a large arsenal of virulence factors that are tightly regulated by a complex regulatory network. Rot, which shares sequence similarity with SarA homologues, is a global regulator that regulates numerous virulence genes. However, the recognition model of Rot for the promoter region of target genes and the putative regulation mechanism remain elusive. In this study, the 1.77 Å resolution X-ray crystal structure of Rot is reported. The structure reveals that two Rot molecules form a compact homodimer, each of which contains a typical helix-turn-helix module and a β-hairpin motif connected by a flexible loop. Fluorescence polarization results indicate that Rot preferentially recognizes AT-rich dsDNA with ~30-base-pair nucleotides and that the conserved positively charged residues on the winged-helix motif are vital for binding to the AT-rich dsDNA. It is proposed that the DNA-recognition model of Rot may be similar to that of SarA, SarR and SarS, in which the helix-turn-helix motifs of each monomer interact with the major grooves of target dsDNA and the winged motifs contact the minor grooves. Interestingly, the structure shows that Rot adopts a novel dimerization model that differs from that of other SarA homologues. As expected, perturbation of the dimer interface abolishes the dsDNA-binding ability of Rot, suggesting that Rot functions as a dimer. In addition, the results have been further confirmed in vivo by measuring the transcriptional regulation of α-toxin, a major virulence factor produced by most S. aureus strains.

  13. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  14. Mycobacterium tuberculosis nuoG is a virulence gene that inhibits apoptosis of infected host cells.

    Directory of Open Access Journals (Sweden)

    Kamalakannan Velmurugan

    2007-07-01

    Full Text Available The survival and persistence of Mycobacterium tuberculosis depends on its capacity to manipulate multiple host defense pathways, including the ability to actively inhibit the death by apoptosis of infected host cells. The genetic basis for this anti-apoptotic activity and its implication for mycobacterial virulence have not been demonstrated or elucidated. Using a novel gain-of-function genetic screen, we demonstrated that inhibition of infection-induced apoptosis of macrophages is controlled by multiple genetic loci in M. tuberculosis. Characterization of one of these loci in detail revealed that the anti-apoptosis activity was attributable to the type I NADH-dehydrogenase of M. tuberculosis, and was mainly due to the subunit of this multicomponent complex encoded by the nuoG gene. Expression of M. tuberculosis nuoG in nonpathogenic mycobacteria endowed them with the ability to inhibit apoptosis of infected human or mouse macrophages, and increased their virulence in a SCID mouse model. Conversely, deletion of nuoG in M. tuberculosis ablated its ability to inhibit macrophage apoptosis and significantly reduced its virulence in mice. These results identify a key component of the genetic basis for an important virulence trait of M. tuberculosis and support a direct causal relationship between virulence of pathogenic mycobacteria and their ability to inhibit macrophage apoptosis.

  15. Screening for spontaneous virulent mutants of barley powdery mildew (Erysiphe graminis DC)

    International Nuclear Information System (INIS)

    Torp, J.; Jensen, H.P.

    1989-01-01

    Full text: Seedlings of 4 barley lines possessing resistance genes M1-a6, M1-a12 or M1-g were inoculated with powdery mildew culture CR3, which is a-virulent to the 4 host lines. In total, 50 million conidia were screened for the occurrence of virulent mutants, 43 putative virulent mutants were found. They could be grouped into 5 genotypes according to the virulence spectrum. They might have originated by one of the following events: 1. admixture, 2. physiological events that allow a few conidia to establish colonies in spite of the presence of a functional gene for resistance, 3. mutation in a gene for specificity, 4. deletion or mutation in some kind of suppressing element in which case more than one virulence may be affected. Based upon the virulence spectra, mating type, biochemical tests and analysis of test crosses, 3 of the genotypes were clearly classified as not being of mutational origin. Of the two remaining genotypes one differed in 4 virulences, the other by two virulences and one avirulence. Based upon expectations from the gene-for-gene concept, it is concluded that both were not of mutational origin. If in fact there are derived from a mutation, the concept of gene-for-gene interactions would have to be revised. Assuming that no mutations for virulence were found in this experiment, the spontaneous mutation frequency from avirulence to virulence would be below 2x10 -8 . (author)

  16. Single Nucleotide Polymorphisms in Regulator-Encoding Genes Have an Additive Effect on Virulence Gene Expression in a Vibrio cholerae Clinical Isolate.

    Science.gov (United States)

    Carignan, Bailey M; Brumfield, Kyle D; Son, Mike S

    2016-01-01

    Vibrio cholerae is the etiological agent of the infectious disease cholera, which is characterized by vomiting and severe watery diarrhea. Recently, V. cholerae clinical isolates have demonstrated increased virulence capabilities, causing more severe symptoms with a much higher rate of disease progression than previously observed. We have identified single nucleotide polymorphisms (SNPs) in four virulence-regulatory genes (hapR, hns, luxO, and vieA) of a hypervirulent V. cholerae clinical isolate, MQ1795. Herein, all SNPs and SNP combinations of interest were introduced into the prototypical El Tor reference strain N16961, and the effects on the production of numerous virulence-related factors, including cholera toxin (CT), the toxin-coregulated pilus (TCP), and ToxT, were analyzed. Our data show that triple-SNP (hapR hns luxO and hns luxO vieA) and quadruple-SNP combinations produced the greatest increases in CT, TCP, and ToxT production. The hns and hns luxO SNP combinations were sufficient for increased TCP and ToxT production. Notably, the hns luxO vieA triple-SNP combination strain produced TCP and ToxT levels similar to those of MQ1795. Certain SNP combinations (hapR and hapR vieA) had the opposite effect on CT, TCP, and ToxT expression. Interestingly, the hns vieA double-SNP combination strain increased TCP production while decreasing CT production. Our findings suggest that SNPs identified in the four regulatory genes, in various combinations, are associated with increased virulence capabilities observed in V. cholerae clinical isolates. These studies provide insight into the evolution of highly virulent strains. IMPORTANCE Cholera, an infectious disease of the small intestine caused by the aquatic bacterium Vibrio cholerae, often results in vomiting and acute watery diarrhea. If left untreated or if the response is too slow, the symptoms can quickly lead to extreme dehydration and ultimately death of the patient. Recent anecdotal evidence of cholera

  17. Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL

    2014-01-01

    Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

  18. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  19. A Pectate Lyase-Coding Gene Abundantly Expressed during Early Stages of Infection Is Required for Full Virulence in Alternaria brassicicola.

    Directory of Open Access Journals (Sweden)

    Yangrae Cho

    Full Text Available Alternaria brassicicola causes black spot disease of Brassica species. The functional importance of pectin digestion enzymes and unidentified phytotoxins in fungal pathogenesis has been suspected but not verified in A. brassicicola. The fungal transcription factor AbPf2 is essential for pathogenicity and induces 106 genes during early pathogenesis, including the pectate lyase-coding gene, PL1332. The aim of this study was to test the importance and roles of PL1332 in pathogenesis. We generated deletion strains of the PL1332 gene, produced heterologous PL1332 proteins, and evaluated their association with virulence. Deletion strains of the PL1332 gene were approximately 30% less virulent than wild-type A. brassicicola, without showing differences in colony expansion on solid media and mycelial growth in nutrient-rich liquid media or minimal media with pectins as a major carbon source. Heterologous PL1332 expressed as fusion proteins digested polygalacturons in vitro. When the fusion proteins were injected into the apoplast between leaf veins of host plants the tissues turned dark brown and soft, resembling necrotic leaf tissue. The PL1332 gene was the first example identified as a general toxin-coding gene and virulence factor among the 106 genes regulated by the transcription factor, AbPf2. It was also the first gene to have its functions investigated among the 19 pectate lyase genes and several hundred putative cell-wall degrading enzymes in A. brassicicola. These results further support the importance of the AbPf2 gene as a key pathogenesis regulator and possible target for agrochemical development.

  20. Genomic presence of gadD1 glutamate decarboxylase correlates with the organization of ascB-dapE internalin cluster in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan

    2012-02-01

    The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.

  1. Comparative genomics of Beauveria bassiana: uncovering signatures of virulence against mosquitoes.

    Science.gov (United States)

    Valero-Jiménez, Claudio A; Faino, Luigi; Spring In't Veld, Daphne; Smit, Sandra; Zwaan, Bas J; van Kan, Jan A L

    2016-12-01

    Entomopathogenic fungi such as Beauveria bassiana are promising biological agents for control of malaria mosquitoes. Indeed, infection with B. bassiana reduces the lifespan of mosquitoes in the laboratory and in the field. Natural isolates of B. bassiana show up to 10-fold differences in virulence between the most and the least virulent isolate. In this study, we sequenced the genomes of five isolates representing the extremes of low/high virulence and three RNA libraries, and applied a genome comparison approach to uncover genetic mechanisms underpinning virulence. A high-quality, near-complete genome assembly was achieved for the highly virulent isolate Bb8028, which was compared to the assemblies of the four other isolates. Whole genome analysis showed a high level of genetic diversity between the five isolates (2.85-16.8 SNPs/kb), which grouped into two distinct phylogenetic clusters. Mating type gene analysis revealed the presence of either the MAT1-1-1 or the MAT1-2-1 gene. Moreover, a putative new MAT gene (MAT1-2-8) was detected in the MAT1-2 locus. Comparative genome analysis revealed that Bb8028 contains 163 genes exclusive for this isolate. These unique genes have a tendency to cluster in the genome and to be often located near the telomeres. Among the genes unique to Bb8028 are a Non-Ribosomal Peptide Synthetase (NRPS) secondary metabolite gene cluster, a polyketide synthase (PKS) gene, and five genes with homology to bacterial toxins. A survey of candidate virulence genes for B. bassiana is presented. Our results indicate several genes and molecular processes that may underpin virulence towards mosquitoes. Thus, the genome sequences of five isolates of B. bassiana provide a better understanding of the natural variation in virulence and will offer a major resource for future research on this important biological control agent.

  2. Role of the Genes of Type VI Secretion System in Virulence of Rice Bacterial Brown Stripe Pathogen Acidovorax avenae subsp. avenae Strain RS-2

    Directory of Open Access Journals (Sweden)

    Md. Mahidul Islam Masum

    2017-09-01

    Full Text Available The Type VI secretion system (T6SS is a class of macromolecular machine that is required for the virulence of gram-negative bacteria. However, it is still not clear what the role of T6SS in the virulence of rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae (Aaa is. The aim of the current study was to investigate the contribution of T6SS in Aaa strain RS2 virulence using insertional deletion mutation and complementation approaches. This strain produced weak virulence but contains a complete T6SS gene cluster based on a genome-wide analysis. Here we compared the virulence-related phenotypes between the wild-type (RS-2 and 25 T6SS mutants, which were constructed using homologous recombination methods. The mutation of 15 T6SS genes significantly reduced bacterial virulence and the secretion of Hcp protein. Additionally, the complemented 7 mutations ΔpppA, ΔclpB, Δhcp, ΔdotU, ΔicmF, ΔimpJ, and ΔimpM caused similar virulence characteristics as RS-2. Moreover, the mutant ΔpppA, ΔclpB, ΔicmF, ΔimpJ and ΔimpM genes caused by a 38.3~56.4% reduction in biofilm formation while the mutants ΔpppA, ΔclpB, ΔicmF and Δhcp resulted in a 37.5~44.6% reduction in motility. All together, these results demonstrate that T6SS play vital roles in the virulence of strain RS-2, which may be partially attributed to the reductions in Hcp secretion, biofilm formation and motility. However, differences in virulence between strain RS-1 and RS-2 suggest that other factors may also be involved in the virulence of Aaa.

  3. Role of the Genes of Type VI Secretion System in Virulence of Rice Bacterial Brown Stripe Pathogen Acidovorax avenae subsp. avenae Strain RS-2.

    Science.gov (United States)

    Masum, Md Mahidul Islam; Yang, Yingzi; Li, Bin; Olaitan, Ogunyemi Solabomi; Chen, Jie; Zhang, Yang; Fang, Yushi; Qiu, Wen; Wang, Yanli; Sun, Guochang

    2017-09-21

    The Type VI secretion system (T6SS) is a class of macromolecular machine that is required for the virulence of gram-negative bacteria. However, it is still not clear what the role of T6SS in the virulence of rice bacterial brown stripe pathogen Acidovorax avenae subsp. avenae (Aaa) is. The aim of the current study was to investigate the contribution of T6SS in Aaa strain RS2 virulence using insertional deletion mutation and complementation approaches. This strain produced weak virulence but contains a complete T6SS gene cluster based on a genome-wide analysis. Here we compared the virulence-related phenotypes between the wild-type (RS-2) and 25 T6SS mutants, which were constructed using homologous recombination methods. The mutation of 15 T6SS genes significantly reduced bacterial virulence and the secretion of Hcp protein. Additionally, the complemented 7 mutations Δ pppA , Δ clpB , Δ hcp , Δ dotU , Δ icmF , Δ impJ , and Δ impM caused similar virulence characteristics as RS-2. Moreover, the mutant Δ pppA , Δ clpB , Δ icmF , Δ impJ and Δ impM genes caused by a 38.3~56.4% reduction in biofilm formation while the mutants Δ pppA , Δ clpB , Δ icmF and Δ hcp resulted in a 37.5~44.6% reduction in motility. All together, these results demonstrate that T6SS play vital roles in the virulence of strain RS-2, which may be partially attributed to the reductions in Hcp secretion, biofilm formation and motility. However, differences in virulence between strain RS-1 and RS-2 suggest that other factors may also be involved in the virulence of Aaa.

  4. Identification of an essential virulence gene of cyprinid herpesvirus 3.

    Science.gov (United States)

    Boutier, Maxime; Gao, Yuan; Vancsok, Catherine; Suárez, Nicolás M; Davison, Andrew J; Vanderplasschen, Alain

    2017-09-01

    The genus Cyprinivirus consists of a growing list of phylogenetically related viruses, some of which cause severe economic losses to the aquaculture industry. The archetypal member, cyprinid herpesvirus 3 (CyHV-3) causes mass mortalities worldwide in koi and common carp. A CyHV-3 mutant was described previously that is attenuated in vivo by a deletion affecting two genes (ORF56 and ORF57). The relative contributions of ORF56 and ORF57 to the safety and efficacy profile of this vaccine candidate have now been assessed by analysing viruses individually deleted for ORF56 or ORF57. Inoculation of these viruses into carp demonstrated that the absence of ORF56 did not affect virulence, whereas the absence of ORF57 led to an attenuation comparable to, though slightly less than, that of the doubly deleted virus. To demonstrate further the role of ORF57 as a key virulence factor, a mutant retaining the ORF57 region but unable to express the ORF57 protein was produced by inserting multiple in-frame stop codons into the coding region. Analysis of this virus in vivo revealed a safety and efficacy profile comparable to that of the doubly deleted virus. These findings show that ORF57 encodes an essential CyHV-3 virulence factor. They also indicate that ORF57 orthologues in other cypriniviruses may offer promising targets for the rational design of attenuated recombinant vaccines. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Clonality, virulence and antimicrobial resistance of enteroaggregative Escherichia coli from Mirzapur, Bangladesh.

    Science.gov (United States)

    Chattaway, Marie Anne; Day, Michaela; Mtwale, Julia; White, Emma; Rogers, James; Day, Martin; Powell, David; Ahmad, Marwa; Harris, Ross; Talukder, Kaisar Ali; Wain, John; Jenkins, Claire; Cravioto, Alejandro

    2017-10-01

    This study investigates the virulence and antimicrobial resistance in association with common clonal complexes (CCs) of enteroaggregative Escherichia coli (EAEC) isolated from Bangladesh. The aim was to determine whether specific CCs were more likely to be associated with putative virulence genes and/or antimicrobial resistance. The presence of 15 virulence genes (by PCR) and susceptibility to 18 antibiotics were determined for 151 EAEC isolated from cases and controls during an intestinal infectious disease study carried out between 2007-2011 in the rural setting of Mirzapur, Bangladesh (Kotloff KL, Blackwelder WC, Nasrin D, Nataro JP, Farag TH et al.Clin Infect Dis 2012;55:S232-S245). These data were then analysed in the context of previously determined serotypes and clonal complexes defined by multi-locus sequence typing. Overall there was no association between the presence of virulence or antimicrobial resistance genes in isolates of EAEC from cases versus controls. However, when stratified by clonal complex (CC) one CC associated with cases harboured more virulence factors (CC40) and one CC harboured more resistance genes (CC38) than the average. There was no direct link between the virulence gene content and antibiotic resistance. Strains within a single CC had variable virulence and resistance gene content indicating independent and multiple gene acquisitions over time. In Bangladesh, there are multiple clonal complexes of EAEC harbouring a variety of virulence and resistance genes. The emergence of two of the most successful clones appeared to be linked to either increased virulence (CC40) or antimicrobial resistance (CC38), but increased resistance and virulence were not found in the same clonal complexes.

  6. Antimicrobial Resistance Profiles of Listeria monocytogenes and Listeria innocua Isolated from Ready-to-Eat Products of Animal Origin in Spain.

    Science.gov (United States)

    Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio

    2017-06-01

    The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.

  7. [Virulence markers of Escherichia coli O1 strains].

    Science.gov (United States)

    Makarova, M A; Kaftyreva, L A; Grigor'eva, N S; Kicha, E V; Lipatova, L A

    2011-01-01

    To detect virulence genes in clinical isolates of Escherichia coli O1 using polymerase chain reaction (PCR). One hundred and twenty strains of E.coli O1 strains isolated from faeces of patients with acute diarrhea (n = 45) and healthy persons (n = 75) were studied. PCR with primers for rfb and fliC genes, which control synthesis of O- and H- antigens respectively, was used. Fourteen virulence genes (pap, aaf, sfa, afa, eaeA, bfpA, ial, hly, cnf, stx1, stx2, lt, st, and aer) were detected by PCR primers. K1-antigen was determined by Pastorex Meningo B/E. coli O1 kit (Bio-Rad). rfb gene controlling O-antigen synthesis in serogroup O1 as well as fliC gene controlling synthesis of H7 and K1 antigens were detected in all strains. Thus all E. coli strains had antigenic structure O1:K1 :H-:F7. Virulence genes aafl, sfa, afa, eaeA, bfpA, ial, hly, cnf, stx1, stx2, lt, and st were not detected. All strains owned pap and aer genes regardless of the presence of acute diarrhea symptoms. It was shown that E. coli O1:KI:H-:F7 strains do not have virulence genes which are characteristic for diarrhea-causing Escherichia. In accordance with the presence of pap and aer genes they could be attributed to uropathogenic Escherichia (UPEC) or avian-pathogenic Escherichia (APEC). It is necessary to detect virulence factors in order to determine E. coli as a cause of intestinal infection.

  8. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Science.gov (United States)

    Nayak, Deepti N.; Savalia, C. V.; Kalyani, I. H.; Kumar, Rajeev; Kshirsagar, D. P.

    2015-01-01

    Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence

  9. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Directory of Open Access Journals (Sweden)

    Deepti N. Nayak

    2015-06-01

    Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest

  10. 2-deoxy-D-glucose-induced metabolic stress enhances resistance to Listeria monocytogenes infection in mice

    Science.gov (United States)

    Miller, E. S.; Bates, R. A.; Koebel, D. A.; Fuchs, B. B.; Sonnenfeld, G.

    1998-01-01

    Exposure to different forms of psychological and physiological stress can elicit a host stress response, which alters normal parameters of neuroendocrine homeostasis. The present study evaluated the influence of the metabolic stressor 2-deoxy-D-glucose (2-DG; a glucose analog, which when administered to rodents, induces acute periods of metabolic stress) on the capacity of mice to resist infection with the facultative intracellular bacterial pathogen Listeria monocytogenes. Female BDF1 mice were injected with 2-DG (500 mg/kg b. wt.) once every 48 h prior to, concurrent with, or after the onset of a sublethal dose of virulent L. monocytogenes. Kinetics of bacterial growth in mice were not altered if 2-DG was applied concurrently or after the start of the infection. In contrast, mice exposed to 2-DG prior to infection demonstrated an enhanced resistance to the listeria challenge. The enhanced bacterial clearance in vivo could not be explained by 2-DG exerting a toxic effect on the listeria, based on the results of two experiments. First, 2-DG did not inhibit listeria replication in trypticase soy broth. Second, replication of L. monocytogenes was not inhibited in bone marrow-derived macrophage cultures exposed to 2-DG. Production of neopterin and lysozyme, indicators of macrophage activation, were enhanced following exposure to 2-DG, which correlated with the increased resistance to L. monocytogenes. These results support the contention that the host response to 2-DG-induced metabolic stress can influence the capacity of the immune system to resist infection by certain classes of microbial pathogens.

  11. Genome Plasticity and Polymorphisms in Critical Genes Correlate with Increased Virulence of Dutch Outbreak-Related Coxiella burnetii Strains

    Directory of Open Access Journals (Sweden)

    Runa Kuley

    2017-08-01

    Full Text Available Coxiella burnetii is an obligate intracellular bacterium and the etiological agent of Q fever. During 2007–2010 the largest Q fever outbreak ever reported occurred in The Netherlands. It is anticipated that strains from this outbreak demonstrated an increased zoonotic potential as more than 40,000 individuals were assumed to be infected. The acquisition of novel genetic factors by these C. burnetii outbreak strains, such as virulence-related genes, has frequently been proposed and discussed, but is not proved yet. In the present study, the whole genome sequence of several Dutch strains (CbNL01 and CbNL12 genotypes, a few additionally selected strains from different geographical locations and publicly available genome sequences were used for a comparative bioinformatics approach. The study focuses on the identification of specific genetic differences in the outbreak related CbNL01 strains compared to other C. burnetii strains. In this approach we investigated the phylogenetic relationship and genomic aspects of virulence and host-specificity. Phylogenetic clustering of whole genome sequences showed a genotype-specific clustering that correlated with the clustering observed using Multiple Locus Variable-number Tandem Repeat Analysis (MLVA. Ortholog analysis on predicted genes and single nucleotide polymorphism (SNP analysis of complete genome sequences demonstrated the presence of genotype-specific gene contents and SNP variations in C. burnetii strains. It also demonstrated that the currently used MLVA genotyping methods are highly discriminatory for the investigated outbreak strains. In the fully reconstructed genome sequence of the Dutch outbreak NL3262 strain of the CbNL01 genotype, a relatively large number of transposon-linked genes were identified as compared to the other published complete genome sequences of C. burnetii. Additionally, large numbers of SNPs in its membrane proteins and predicted virulence-associated genes were identified

  12. Comparison of antibiotic resistance, virulence gene profiles, and pathogenicity of methicillin-resistant and methicillin-susceptible Staphylococcus aureus using a Caenorhabditis elegans infection model

    Science.gov (United States)

    Thompson, Terissa; Brown, Paul D

    2014-01-01

    Objectives: This study compared the presence of 35 virulence genes, resistance phenotypes to 11 anti-staphylococcal antibiotics, and pathogenicity in methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-susceptible S. aureus (MSSA). Methods: Multiplex PCR analysis was used to differentiate Staphylococcus aureus isolates (n = 102) based on characterization of the Staphylococcal Cassette Chromosome mec (SCCmec). Singleplex and multiplex PCR assays targeting 35 virulence determinants were used to analyze the virulence repertoire of S. aureus. In vitro activities of the antibiotics were determined by the disk-diffusion method. The pathogenicity of representative isolates was assessed using Caenorhabditis elegans survival assays. Significance in virulence distribution and antibiotic resistance phenotypes was assessed using the Chi-squared tests. Kaplan–Meier survival estimates were used to analyze nematode survival and significance of survival rates evaluated using the log-rank test. Results: Except for sei (staphylococcal enterotoxin I) (P  =  0.027), all other virulence genes were not significantly associated with MRSA. Resistance to clindamycin (P  =  0.03), tetracycline (P  =  0.048), trimethoprim/sulfamethoxazole (P  =  0.038), and oxacillin (P  =  0.004) was significantly associated with MRSA. Survival assay showed MSSA having a lower median lifespan of 3 days than MRSA that had a median lifespan of 6 days. The difference in the killing time of MRSA and MSSA was significant (P virulence genes. The quicker killing potential of MSSA compared to MRSA suggests that carriage of virulence determinants per se does not determine pathogenicity in S. aureus. Pathogenicity is impacted by other factors, possibly antibiotic resistance. PMID:25319852

  13. Matrix metalloproteinase-9 plays a role in protecting zebrafish from lethal infection with Listeria monocytogenes by enhancing macrophage migration.

    Science.gov (United States)

    Shan, Ying; Zhang, Yikai; Zhuo, Xunhui; Li, Xiaoliang; Peng, Jinrong; Fang, Weihuan

    2016-07-01

    Zebrafish could serve as an alternative animal model for pathogenic bacteria in multiple infectious routes. Our previous study showed that immersion infection in zebrafish with Listeria monocytogenes did not cause lethality but induced transient expression of several immune response genes. We used an Affymetrix gene chip to examine the expression profiles of genes of zebrafish immersion-infected with L. monocytogenes. A total of 239 genes were up-regulated and 56 genes down-regulated compared with uninfected fish. Highest expression (>20-fold) was seen with the mmp-9 gene encoding the matrix metalloproteinase-9 (Mmp-9) known to degrade the extracellular matrix proteins. By morpholino knockdown of mmp-9, we found that the morphants showed rapid death with much higher bacterial load after intravenous or intraventricular (brain ventricle) infection with L. monocytogenes. Macrophages in mmp-9-knockdown morphants had significant defect in migrating to the brain cavity upon intraventricular infection. Decreased migration of murine macrophages with knockdown of mmp-9 and cd44 was also seen in transwell inserts with 8-μm pore polycarbonate membrane, as compared with the scrambled RNA. These findings suggest that Mmp-9 is a protective molecule against infection by L. monocytogenes by engaging in migration of zebrafish macrophages to the site of infection via a non-proteolytic role. Further work is required on the molecular mechanisms governing Mmp-9-driven macrophage migration in zebrafish. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Virulence potential of Staphylococcus aureus isolates from Buruli ulcer patients.

    Science.gov (United States)

    Amissah, Nana Ama; Chlebowicz, Monika A; Ablordey, Anthony; Tetteh, Caitlin S; Prah, Isaac; van der Werf, Tjip S; Friedrich, Alex W; van Dijl, Jan Maarten; Stienstra, Ymkje; Rossen, John W

    2017-06-01

    Buruli ulcer (BU) is a necrotizing infection of the skin and subcutaneous tissue caused by Mycobacterium ulcerans. BU wounds may also be colonized with other microorganisms including Staphylococcus aureus. This study aimed to characterize the virulence factors of S. aureus isolated from BU patients. Previously sequenced genomes of 21 S. aureus isolates from BU patients were screened for the presence of virulence genes. The results show that all S. aureus isolates harbored on their core genomes genes for known virulence factors like α-hemolysin, and the α- and β-phenol soluble modulins. Besides the core genome virulence genes, mobile genetic elements (MGEs), i.e. prophages, genomic islands, pathogenicity islands and a Staphylococcal cassette chromosome (SCC) were found to carry different combinations of virulence factors, among them genes that are known to encode factors that promote immune evasion, superantigens and Panton-Valentine Leucocidin. The present observations imply that the S. aureus isolates from BU patients harbor a diverse repertoire of virulence genes that may enhance bacterial survival and persistence in the wound environment and potentially contribute to delayed wound healing. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  15. The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne

    to be transmitted to food processing plants from where it can establish and survive for extended periods of time contaminating processed food products. Recently we have identified the response regulator ResD of L. monocytogenes and showed that it is important for growth in laboratory media and for sugar uptake...... in the upstream regulatory region of several genes of L. monocytogenes and the binding of the ResD protein to some of these regulatory regions upstream putative target genes is analysed by electrophoretic mobility shift assays (EMSAs). In conclusion, the response regulator ResD act is important for metabolisme...

  16. Cytopathogenic effects in enterocytelike Caco-2 cells differentiate virulent from avirulent Listeria strains.

    OpenAIRE

    Pine, L; Kathariou, S; Quinn, F; George, V; Wenger, J D; Weaver, R E

    1991-01-01

    We have developed a simple test that differentiates between virulent and avirulent Listeria species as defined by the mouse 50% lethal doses (LD50S). The assay is based on trypan blue-revealed cytopathogenic effects that are produced during the infection of the human enterocytelike cell line Caco-2. These effects were elicited only by Listeria strains that had an intraperitoneal mouse LD50 less than 10(8) and were not produced by nonhemolytic, avirulent strains of Listeria monocytogenes gener...

  17. Epigenetic control of virulence gene expression in Pseudomonas aeruginosa by a LysR-type transcription regulator.

    Directory of Open Access Journals (Sweden)

    Keith H Turner

    2009-12-01

    Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.

  18. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  19. Abundance of Pathogenic Escherichia coli Virulence-Associated Genes in Well and Borehole Water Used for Domestic Purposes in a Peri-Urban Community of South Africa.

    Science.gov (United States)

    Abia, Akebe Luther King; Schaefer, Lisa; Ubomba-Jaswa, Eunice; Le Roux, Wouter

    2017-03-20

    In the absence of pipe-borne water, many people in Africa, especially in rural communities, depend on alternative water sources such as wells, boreholes and rivers for household and personal hygiene. Poor maintenance and nearby pit latrines, however, lead to microbial pollution of these sources. We evaluated the abundance of Escherichia coli and the prevalence of pathogenic E. coli virulence genes in water from wells, boreholes and a river in a South African peri-urban community. Monthly samples were collected between August 2015 and November 2016. In all, 144 water samples were analysed for E. coli using the Colilert 18 system. Virulence genes ( eagg , eaeA , stx1 , stx2 , flichH7 , ST , ipaH , ibeA ) were investigated using real-time polymerase chain reaction. Mean E. coli counts ranged between 0 and 443.1 Most Probable Number (MPN)/100 mL of water sample. Overall, 99.3% of samples were positive for at least one virulence gene studied, with flicH7 being the most detected gene (81/140; 57.6%) and the stx2 gene the least detected gene (8/140; 5.7%). Both intestinal and extraintestinal pathogenic E. coli genes were detected. The detection of virulence genes in these water sources suggests the presence of potentially pathogenic E. coli strains and is a public health concern.

  20. Abundance of Pathogenic Escherichia coli Virulence-Associated Genes in Well and Borehole Water Used for Domestic Purposes in a Peri-Urban Community of South Africa

    Directory of Open Access Journals (Sweden)

    Akebe Luther King Abia

    2017-03-01

    Full Text Available In the absence of pipe-borne water, many people in Africa, especially in rural communities, depend on alternative water sources such as wells, boreholes and rivers for household and personal hygiene. Poor maintenance and nearby pit latrines, however, lead to microbial pollution of these sources. We evaluated the abundance of Escherichia coli and the prevalence of pathogenic E. coli virulence genes in water from wells, boreholes and a river in a South African peri-urban community. Monthly samples were collected between August 2015 and November 2016. In all, 144 water samples were analysed for E. coli using the Colilert 18 system. Virulence genes (eagg, eaeA, stx1, stx2, flichH7, ST, ipaH, ibeA were investigated using real-time polymerase chain reaction. Mean E. coli counts ranged between 0 and 443.1 Most Probable Number (MPN/100 mL of water sample. Overall, 99.3% of samples were positive for at least one virulence gene studied, with flicH7 being the most detected gene (81/140; 57.6% and the stx2 gene the least detected gene (8/140; 5.7%. Both intestinal and extraintestinal pathogenic E. coli genes were detected. The detection of virulence genes in these water sources suggests the presence of potentially pathogenic E. coli strains and is a public health concern.

  1. Virulence-related genes, adhesion and invasion of some Yersinia enterocolitica-like strains suggests its pathogenic potential.

    Science.gov (United States)

    Imori, Priscilla F M; Passaglia, Jaqueline; Souza, Roberto A; Rocha, Lenaldo B; Falcão, Juliana P

    2017-03-01

    Yersina enterocolitica-like species have not been extensively studied regarding its pathogenic potential. This work aimed to assess the pathogenic potential of some Y. enterocolitica-like strains by evaluating the presence of virulence-related genes by PCR and their ability to adhere to and invade Caco-2 and HEp-2 cells. A total of 50 Y. frederiksenii, 55 Y. intermedia and 13 Y. kristensenii strains were studied. The strains contained the following genes: Y. frederiksenii, fepA(44%), fes(44%) and ystB(18%); Y. intermedia, ail(53%), fepA (35%), fepD(2%), fes(97%), hreP(2%), ystB(2%) and tccC(35%); Y. kristensenii, ail(62%), ystB(23%), fepA(77%), fepD(54%), fes(54%) and hreP(77%). Generally, the Y. enterocolitica-like strains had a reduced ability to adhere to and invade mammalian cells compared to the highly pathogenic Y. enterocolitica 8081. However, Y. kristensenii FCF410 and Y. frederiksenii FCF461 presented high invasion potentials in Caco-2 cells after five days of pre-incubation increased by 45- and 7.2-fold compared to Y. enterocolitica 8081, respectively; but, the ail gene was not detected in these strains. The presence of virulence-related genes in some of the Y. enterocolitica-like strains indicated their possible pathogenic potential. Moreover, the results suggest the existence of alternative virulence mechanisms and that the pathogenicity of Y. kristensenii and Y. frederiksenii may be strain-dependent. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  3. Dynamics of Vibrio with virulence genes detected in Pacific harbor seals (Phoca vitulina richardii) off California: implications for marine mammal health.

    Science.gov (United States)

    Hughes, Stephanie N; Greig, Denise J; Miller, Woutrina A; Byrne, Barbara A; Gulland, Frances M D; Harvey, James T

    2013-05-01

    Given their coastal site fidelity and opportunistic foraging behavior, harbor seals (Phoca vitulina) may serve as sentinels for coastal ecosystem health. Seals using urbanized coastal habitat can acquire enteric bacteria, including Vibrio that may affect their health. To understand Vibrio dynamics in seals, demographic and environmental factors were tested for predicting potentially virulent Vibrio in free-ranging and stranded Pacific harbor seals (Phoca vitulina richardii) off California. Vibrio prevalence did not vary with season and was greater in free-ranging seals (29 %, n = 319) compared with stranded seals (17 %, n = 189). Of the factors tested, location, turbidity, and/or salinity best predicted Vibrio prevalence in free-ranging seals. The relationship of environmental factors with Vibrio prevalence differed by location and may be related to oceanographic or terrestrial contributions to water quality. Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio cholerae were observed in seals, with V. cholerae found almost exclusively in stranded pups and yearlings. Additionally, virulence genes (trh and tdh) were detected in V. parahaemolyticus isolates. Vibrio cholerae isolates lacked targeted virulence genes, but were hemolytic. Three out of four stranded pups with V. parahaemolyticus (trh+ and/or tdh+) died in rehabilitation, but the role of Vibrio in causing mortality is unclear, and Vibrio expression of virulence genes should be investigated. Considering that humans share the environment and food resources with seals, potentially virulent Vibrio observed in seals also may be of concern to human health.

  4. Listeria monocytogenes efficiently invades caco-2 cells after low-temperature storage in broth and on deli meat

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne

    2010-01-01

    The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart...... infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p ... to invade Caco-2 cells was compared after growth on a fermented sausage and on cured cooked ham to that of bacteria grown in BHI broth supplemented with salt. Samples were stored under chilling conditions for up to 4 weeks. The results showed no difference (p > 0.05) in invasiveness after 7 days at 10...

  5. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  6. Virulence-associated gene profiling of Streptococcus suis isolates by PCR

    NARCIS (Netherlands)

    Silva, L.M.G.; Baums, C.G.; Rehm, T.; Wisselink, H.J.; Goethe, R.; Valentin-Weigand, P.

    2006-01-01

    Definition of virulent Streptococcus suis strains is controversial. One successful approach for identification of virulent European strains is differentiation of capsular serotypes (or the corresponding cps types) and subsequent detection of virulence-associated factors, namely the extracellular

  7. Cytokine responses in primary chicken embryo intestinal cells infected with Campylobacter jejuni strains of human and chicken origin and the expression of bacterial virulence-associated genes

    DEFF Research Database (Denmark)

    Li, Yiping; Ingmer, Hanne; Madsen, Mogens

    2008-01-01

    of the bacterial genes. We have investigated the invasiveness of primary chicken embryo intestinal cells (CEICs) by C. jejuni strains of human and chicken origins and the production of pro-inflammatory cytokines as well as the expression of the bacterial virulence-associated genes during co-cultivation. Results C......-free media from another co-cultivation experiment also increased the expression of the virulence-associated genes in the C. jejuni chicken isolate, indicating that the expression of bacterial genes is regulated by component(s) secreted upon co-cultivation of bacteria and CEICs. Conclusion We show that under...... in vitro culture condition C. jejuni strains of both human and chicken origins can invade avian host cells with a pro-inflammatory response and that the virulence-associated genes of C. jejuni may play a role in this process....

  8. Differentiation of the virulence potential of Campylobacter jejuni strains by use of gene transcription analysis and a caco-2 assay

    DEFF Research Database (Denmark)

    Poli, Vanessa Fadanelli Schoenardie; Thorsen, Line; Olesen, Inger

    2012-01-01

    properties were evaluated by analyzing transcriptions of the virulence genes cdtB, ciaB, cadF and the stress associated genes clpP, htrB using reverse transcription quantitative PCR (RT-qPCR) and by the ability of the C. jejuni strains to adhere to and invade Caco-2 cells. Similar cell survival and no growth...... gene, cipA between DFVF1099 and NCTC11168 resulting in a 14 amino acid deletion and 28 amino acid addition at the N and C terminal ends respectively of the CipA protein of DFVF1099. In contrast to DFVF1099, strains NCTC1168 and TB1048 were able to invade Caco-2 cells. Invasion ability was not affected...... expression of C. jejuni. The clinical strains appeared to be more virulent than the chicken isolate as measured by the Caco-2 invasion assay which could be due to differences in CipA functionality. The RT-qPCR analysis and Caco-2 assay showed to be useful tools for differentiating virulence potentials...

  9. Cold Plasma Inactivation of Bacterial Biofilms and Reduction of Quorum Sensing Regulated Virulence Factors.

    Directory of Open Access Journals (Sweden)

    Dana Ziuzina

    Full Text Available The main objectives of this work were to investigate the effect of atmospheric cold plasma (ACP against a range of microbial biofilms commonly implicated in foodborne and healthcare associated human infections and against P. aeruginosa quorum sensing (QS-regulated virulence factors, such as pyocyanin, elastase (Las B and biofilm formation capacity post-ACP treatment. The effect of processing factors, namely treatment time and mode of plasma exposure on antimicrobial activity of ACP were also examined. Antibiofilm activity was assessed for E. coli, L. monocytogenes and S. aureus in terms of reduction of culturability and retention of metabolic activity using colony count and XTT assays, respectively. All samples were treated 'inpack' using sealed polypropylene containers with a high voltage dielectric barrier discharge ACP generated at 80 kV for 0, 60, 120 and 300 s and a post treatment storage time of 24 h. According to colony counts, ACP treatment for 60 s reduced populations of E. coli to undetectable levels, whereas 300 s was necessary to significantly reduce populations of L. monocytogenes and S. aureus biofilms. The results obtained from XTT assay indicated possible induction of viable but non culturable state of bacteria. With respect to P. aeruginosa QS-related virulence factors, the production of pyocyanin was significantly inhibited after short treatment times, but reduction of elastase was notable only after 300 s and no reduction in actual biofilm formation was achieved post-ACP treatment. Importantly, reduction of virulence factors was associated with reduction of the cytotoxic effects of the bacterial supernatant on CHO-K1 cells, regardless of mode and duration of treatment. The results of this study point to ACP technology as an effective strategy for inactivation of established biofilms and may play an important role in attenuation of virulence of pathogenic bacteria. Further investigation is warranted to propose direct evidence

  10. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  11. Detection of virulence-associated genes in Brucella melitensis ...

    African Journals Online (AJOL)

    Ibrahim Eldaghayes

    2018-03-20

    Mar 20, 2018 ... isolated from goats. This discrepancies may indicate that B. melitensis field strains prevailing in Egypt are more virulent than the strains of B. melitensis isolated from caprines in Iran. As, it was emphasized that the. T4SS of Brucella encoded by the virB operon is a major virulence factor (Delrue et al., 2005).

  12. Differential role of gpaB and sidA gene expressions in relation to virulence in Aspergillus species from patients with invasive aspergillosis.

    Science.gov (United States)

    Ghods, Nayereh; Falahati, Mehraban; Roudbary, Maryam; Farahyar, Shirin; Shamaei, Masoud; Pourabdollah, Mahin; Seif, Farhad

    2018-02-03

    The virulence genes in invasive aspergillosis (IA) have not been analyzed adequately. The present study was designed to evaluate the expression of gpaB and sidA genes, which are important virulence genes in Aspergillus spp. from bronchoalveolar lavage (BAL) samples. Direct examination and culture on Czapek Agar and Sabouraud Dextrose Agar media were performed for 600 BAL specimens isolated from patients with possible aspergillosis. A Galactomannan ELISA assay was also carried out. The expression levels of the gpaB and sidA genes in isolates were analyzed using quantitative real-time PCR (qRT-PCR). We identified 2 species, including Aspergillus flavus (A. flavus) and Aspergillus fumigatus (A. fumigatus) in 25 positive samples for invasive aspergillosis as validated using GM-ELISA. A. flavus is the main pathogen threatening transplant recipients and cancer patients worldwide. In this study, A. flavus had low levels of the gpaB gene expression compared to A. fumigatus (p=0.006). The highest sidA expression was detected in transplant recipients (p=0.05). There was no significant correlation between sidA expression and underlying disease (p=0.15). The sidA and gpaB gene expression patterns may provide evidence that these virulence genes play important roles in the pathogenicity of Aspergillus isolates; however, there are several regulatory genes responsible for the unexpressed sidA and gpaB genes in the isolates. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  13. Virulence Genotyping of Pasteurella multocida Isolated from Multiple Hosts from India

    Directory of Open Access Journals (Sweden)

    Laxmi Narayan Sarangi

    2014-01-01

    Full Text Available In this study, 108 P. multocida isolates recovered from various host animals such as cattle, buffalo, swine, poultry (chicken, duck, and emu and rabbits were screened for carriage of 8 virulence associated genes. The results revealed some unique information on the prevalence of virulence associated genes among Indian isolates. With the exception of toxA gene, all other virulence associated genes were found to be regularly distributed among host species. Association study between capsule type and virulence genes suggested that pfhA, nanB, and nanH genes were regularly distributed among all serotypes with the exception of CapD, whereas toxA gene was found to be positively associated with CapD and CapA. The frequency of hgbA and nanH genes among swine isolates of Indian origin was found to be less in comparison to its equivalents around the globe. Interestingly, very high prevalence of tbpA gene was observed among poultry, swine, and rabbit isolates. Likewise, very high prevalence of pfhA gene (95.3% was observed among Indian isolates, irrespective of host species origin.

  14. Virulence genotyping of Pasteurella multocida isolated from multiple hosts from India.

    Science.gov (United States)

    Sarangi, Laxmi Narayan; Priyadarshini, Adyasha; Kumar, Santosh; Thomas, Prasad; Gupta, Santosh Kumar; Nagaleekar, Viswas Konasagara; Singh, Vijendra Pal

    2014-01-01

    In this study, 108 P. multocida isolates recovered from various host animals such as cattle, buffalo, swine, poultry (chicken, duck, and emu) and rabbits were screened for carriage of 8 virulence associated genes. The results revealed some unique information on the prevalence of virulence associated genes among Indian isolates. With the exception of toxA gene, all other virulence associated genes were found to be regularly distributed among host species. Association study between capsule type and virulence genes suggested that pfhA, nanB, and nanH genes were regularly distributed among all serotypes with the exception of CapD, whereas toxA gene was found to be positively associated with CapD and CapA. The frequency of hgbA and nanH genes among swine isolates of Indian origin was found to be less in comparison to its equivalents around the globe. Interestingly, very high prevalence of tbpA gene was observed among poultry, swine, and rabbit isolates. Likewise, very high prevalence of pfhA gene (95.3%) was observed among Indian isolates, irrespective of host species origin.

  15. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction.

    Science.gov (United States)

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W

    2015-07-01

    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

  16. The Hos2 Histone Deacetylase Controls Ustilago maydis Virulence through Direct Regulation of Mating-Type Genes.

    Directory of Open Access Journals (Sweden)

    Alberto Elías-Villalobos

    2015-08-01

    Full Text Available Morphological changes are critical for host colonisation in plant pathogenic fungi. These changes occur at specific stages of their pathogenic cycle in response to environmental signals and are mediated by transcription factors, which act as master regulators. Histone deacetylases (HDACs play crucial roles in regulating gene expression, for example by locally modulating the accessibility of chromatin to transcriptional regulators. It has been reported that HDACs play important roles in the virulence of plant fungi. However, the specific environment-sensing pathways that control fungal virulence via HDACs remain poorly characterised. Here we address this question using the maize pathogen Ustilago maydis. We find that the HDAC Hos2 is required for the dimorphic switch and pathogenic development in U. maydis. The deletion of hos2 abolishes the cAMP-dependent expression of mating type genes. Moreover, ChIP experiments detect Hos2 binding to the gene bodies of mating-type genes, which increases in proportion to their expression level following cAMP addition. These observations suggest that Hos2 acts as a downstream component of the cAMP-PKA pathway to control the expression of mating-type genes. Interestingly, we found that Clr3, another HDAC present in U. maydis, also contributes to the cAMP-dependent regulation of mating-type gene expression, demonstrating that Hos2 is not the only HDAC involved in this control system. Overall, our results provide new insights into the role of HDACs in fungal phytopathogenesis.

  17. Hemolytic porcine intestinal Escherichia coli without virulence-associated genes typical of intestinal pathogenic E. coli.

    Science.gov (United States)

    Schierack, Peter; Weinreich, Joerg; Ewers, Christa; Tachu, Babila; Nicholson, Bryon; Barth, Stefanie

    2011-12-01

    Testing 1,666 fecal or intestinal samples from healthy and diarrheic pigs, we obtained hemolytic Escherichia coli isolates from 593 samples. Focusing on hemolytic E. coli isolates without virulence-associated genes (VAGs) typical for enteropathogens, we found that such isolates carried a broad variety of VAGs typical for extraintestinal pathogenic E. coli.

  18. Clonality, virulence and antimicrobial resistance of enteroaggregative Escherichia coli from Mirzapur, Bangladesh

    DEFF Research Database (Denmark)

    Chattaway, Marie Anne; Day, Michaela; Mtwale, Julia

    2017-01-01

    Purpose. This study investigates the virulence and antimicrobial resistance in association with common clonal complexes (CCs) of enteroaggregative Escherichia coli (EAEC) isolated from Bangladesh. The aim was to determine whether specific CCs were more likely to be associated with putative...... virulence genes and/or antimicrobial resistance.Methodology. The presence of 15 virulence genes (by PCR) and susceptibility to 18 antibiotics were determined for 151 EAEC isolated from cases and controls during an intestinal infectious disease study carried out between 2007-2011 in the rural setting...... between the presence of virulence or antimicrobial resistance genes in isolates of EAEC from cases versus controls. However, when stratified by clonal complex (CC) one CC associated with cases harboured more virulence factors (CC40) and one CC harboured more resistance genes (CC38) than the average...

  19. Genomic insights into a new Citrobacter koseri strain revealed gene exchanges with the virulence-associated Yersinia pestis pPCP1 plasmid

    Directory of Open Access Journals (Sweden)

    Fabrice eArmougom

    2016-03-01

    Full Text Available The history of infectious diseases raised the plague as one of the most devastating for human beings. Far too often considered an ancient disease, the frequent resurgence of the plague has led to consider it as a reemerging disease in Madagascar, Algeria, Libya and Congo. The genetic factors associated with the pathogenicity of Yersinia pestis, the causative agent of the plague, involve the acquisition of the pPCP1 plasmid that promotes host invasion through the expression of the virulence factor Pla. The surveillance of plague foci after the 2003 outbreak in Algeria resulted in a positive detection of the specific pla gene of Y. pestis in rodents. However, the phenotypic characterization of the isolate identified a Citrobacter koseri. The comparative genomics of our sequenced C. koseri URMITE genome revealed a mosaic gene structure resulting from the lifestyle of our isolate and provided evidence for gene exchanges with different enteric bacteria. The most striking was the acquisition of a continuous 2 kb genomic fragment containing the virulence factor Pla of the Y. pestis pPCP1 plasmid; however, the subcutaneous injection of the CKU strain in mice did not produce any pathogenic effect. Our findings demonstrate that fast molecular detection of plague using solely the pla gene is unsuitable and should rather require Y. pestis gene marker combinations. We also suggest that the evolutionary force that might govern the expression of pathogenicity can occur through the acquisition of virulence genes but could also require the loss or the inactivation of resident genes such as antivirulence genes.

  20. Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes

    Directory of Open Access Journals (Sweden)

    Valentina Monistero

    2018-06-01

    Full Text Available Staphylococcus aureus is recognized worldwide as one of the major agents of dairy cow intra-mammary infections. This microorganism can express a wide spectrum of pathogenic factors used to attach, colonize, invade and infect the host. The present study evaluated 120 isolates from eight different countries that were genotyped by RS-PCR and investigated for 26 different virulence factors to increase the knowledge on the circulating genetic lineages among the cow population with mastitis. New genotypes were observed for South African strains while for all the other countries new variants of existing genotypes were detected. For each country, a specific genotypic pattern was found. Among the virulence factors, fmtB, cna, clfA and leucocidins genes were the most frequent. The sea and sei genes were present in seven out of eight countries; seh showed high frequency in South American countries (Brazil, Colombia, Argentina, while sel was harboured especially in one Mediterranean country (Tunisia. The etb, seb and see genes were not detected in any of the isolates, while only two isolates were MRSA (Germany and Italy confirming the low diffusion of methicillin resistance microorganism among bovine mastitis isolates. This work demonstrated the wide variety of S. aureus genotypes found in dairy cattle worldwide. This condition suggests that considering the region of interest might help to formulate strategies for reducing the infection spreading.

  1. Correlation between Group B Streptococcal Genotypes, Their Antimicrobial Resistance Profiles, and Virulence Genes among Pregnant Women in Lebanon

    Directory of Open Access Journals (Sweden)

    Antoine Hannoun

    2009-01-01

    Full Text Available The antimicrobial susceptibility profiles of 76 Streptococcus agalactiae (Group B Streptococci [GBS] isolates from vaginal specimens of pregnant women near term were correlated to their genotypes generated by Random Amplified Polymorphic DNA analysis and their virulence factors encoding genes cylE, lmb, scpB, rib, and bca by PCR. Based on the distribution of the susceptibility patterns, six profiles were generated. RAPD analysis detected 7 clusters of genotypes. The cylE gene was present in 99% of the isolates, the lmb in 96%, scpB in 94.7%, rib in 33%, and bca in 56.5% of isolates. The isolates demonstrated a significant correlation between antimicrobial resistance and genotype clusters denoting the distribution of particular clones with different antimicrobial resistance profiles, entailing the practice of caution in therapeutic options. All virulence factors encoding genes were detected in all seven genotypic clusters with rib and bca not coexisting in the same genome.

  2. Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

    Science.gov (United States)

    Guenther, Susanne; Loessner, Martin J

    2011-03-01

    Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

  3. Inactivation of the Haemophilus ducreyi luxS gene affects the virulence of this pathogen in human subjects.

    Science.gov (United States)

    Labandeira-Rey, Maria; Janowicz, Diane M; Blick, Robert J; Fortney, Kate R; Zwickl, Beth; Katz, Barry P; Spinola, Stanley M; Hansen, Eric J

    2009-08-01

    Haemophilus ducreyi 35000HP contains a homologue of the luxS gene, which encodes an enzyme that synthesizes autoinducer 2 (AI-2) in other gram-negative bacteria. H. ducreyi 35000HP produced AI-2 that functioned in a Vibrio harveyi-based reporter system. A H. ducreyi luxS mutant was constructed by insertional inactivation of the luxS gene and lost the ability to produce AI-2. Provision of the H. ducreyi luxS gene in trans partially restored AI-2 production by the mutant. The luxS mutant was compared with its parent for virulence in the human challenge model of experimental chancroid. The pustule-formation rate in 5 volunteers was 93.3% (95% confidence interval, 81.7%-99.9%) at 15 parent sites and 60.0% (95% confidence interval, 48.3%-71.7%) at 15 mutant sites (1-tailed P < .001). Thus, the luxS mutant was partially attenuated for virulence. This is the first report of AI-2 production contributing to the pathogenesis of a genital ulcer disease.

  4. Molecular analysis of the role of osmolyte transporters opuCA and betL in Listeria monocytogenes after cold and freezing stress.

    Science.gov (United States)

    Miladi, Hanene; Elabed, Hamouda; Ben Slama, Rihab; Rhim, Amel; Bakhrouf, Amina

    2017-03-01

    Listeria monocytogenes is a food-borne pathogen of humans and other animals. The striking ability to survive several stresses usually used for food preservation makes L. monocytogenes one of the biggest concerns to the food industry. This ubiquity can be partly explained by the ability of the organism to grow and persist at very low temperatures, a consequence of its ability to accumulate cryoprotective compound called osmolytes. A quantitative RT-PCR assay was used to measure mRNA transcript accumulation for the stress response genes opuCA and betL (encoding carnitine and betaine transporters, respectively) and the housekeeping gene 16S rRNA. Assays were conducted on mid-exponential phase L. monocytogenes cells exposed to conditions reflecting cold and freezing stress, conditions usually used to preserve foods. We showed that expression of the two cold-adapted genes encoded the transporters of the cryoprotectants carnitine and betaine in ATCC 19115 and the food-isolated L. monocytogenes S1 is induced after cold and freezing stress exposure. Furthermore, transcriptional analysis of the genes encoding opuCA and betL revealed that each transporter is induced to different degrees upon cold shock of L. monocytogenes ATCC 19115 and S1. Our results confirm an increase in carnitine uptake at low temperatures more than in betaine after cold-shocked temperature compared to the non-stress control treatment. It was concluded the use of carnitine and betaine as cryoprotectants is essential for rapid induction of the tested stress response under conditions typically encountered during food preservation.

  5. Phage-mediated dispersal of biofilm and distribution of bacterial virulence genes is induced by quorum sensing.

    Directory of Open Access Journals (Sweden)

    Friederike S Rossmann

    2015-02-01

    Full Text Available The microbiome and the phage meta-genome within the human gut are influenced by antibiotic treatments. Identifying a novel mechanism, here we demonstrate that bacteria use the universal communication molecule AI-2 to induce virulence genes and transfer them via phage release. High concentrations (i.e. 100 μM of AI-2 promote dispersal of bacteria from already established biofilms, and is associated with release of phages capable of infecting other bacteria. Enterococcus faecalis V583ΔABC harbours 7 prophages in its genome, and a mutant deficient in one of these prophages (i.e. prophage 5 showed a greatly reduced dispersal of biofilm. Infection of a probiotic E. faecalis strain without lytic prophages with prophage 5 resulted in increased biofilm formation and also in biofilm dispersal upon induction with AI-2. Infection of the probiotic E. faecalis strain with phage-containing supernatants released through AI-2 from E. faecalis V583ΔABC resulted in a strong increase in pathogenicity of this strain. The polylysogenic probiotic strain was also more virulent in a mouse sepsis model and a rat endocarditis model. Both AI-2 and ciprofloxacin lead to phage release, indicating that conditions in the gastrointestinal tract of hospitalized patients treated with antibiotics might lead to distribution of virulence genes to apathogenic enterococci and possibly also to other commensals or even to beneficial probiotic strains.

  6. cipC is important for Aspergillus fumigatus virulence.

    Science.gov (United States)

    Canela, Heliara Maria Spina; Takami, Luciano Akira; da Silva Ferreira, Márcia Eliana

    2017-02-01

    Aspergillus fumigatus is the main causative agent of invasive aspergillosis, a disease that affects immunocompromised patients and has a high mortality rate. We previously observed that the transcription of a cipC-like gene was increased when A. fumigatus encountered an increased CO 2 concentration, as occurs during the infection process. CipC is a protein of unknown function that might be associated with fungal pathogenicity. In this study, the cipC gene was disrupted in A. fumigatus to evaluate its importance for fungal pathogenicity. The gene was replaced, and the germination, growth phenotype, stress responses, and virulence of the resultant mutant were assessed. Although cipC was not essential, its deletion attenuated A. fumigatus virulence in a low-dose murine infection model, suggesting the involvement of the cipC gene in the virulence of this fungus. This study is the first to disrupt the cipC gene in A. fumigatus. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  7. Virulence Factor Genes in Staphylococcus aureus Isolated From Diabetic Foot Soft Tissue and Bone Infections.

    Science.gov (United States)

    Víquez-Molina, Gerardo; Aragón-Sánchez, Javier; Pérez-Corrales, Cristian; Murillo-Vargas, Christian; López-Valverde, María Eugenia; Lipsky, Benjamin A

    2018-03-01

    The aim of this study is to describe the presence of genes encoding for 4 virulence factors (pvl, eta, etb, and tsst), as well as the mecA gene conferring resistance to beta-lactam antibiotics, in patients with diabetes and a staphylococcal foot infection. We have also analyzed whether isolates of Staphylococcus aureus from bone infections have a different profile for these genes compared with those from exclusively soft tissue infections. In this cross-sectional study of a prospectively recruited series of patients admitted to the Diabetic Foot Unit, San Juan de Dios Hospital, San José, Costa Rica with a moderate or severe diabetic foot infection (DFI), we collected samples from infected soft tissue and from bone during debridement. During the study period (June 1, 2014 to May 31, 2016), we treated 379 patients for a DFI. S aureus was isolated from 101 wound samples, of which 43 were polymicrobial infections; we only included the 58 infections that were monomicrobial S aureus for this study. Infections were exclusively soft tissue in 17 patients (29.3%) while 41 (70.7%) had bone involvement (osteomyelitis). The mecA gene was detected in 35 cases (60.3%), pvl gene in 4 cases (6.9%), and tsst gene in 3 (5.2%). We did not detect etA and etB in any of the cases. There were no differences in the profile of S aureus genes encoding for virulence factors (pvl, etA, etB, and tsst) recovered from DFIs between those with just soft tissue compared to those with osteomyelitis. However, we found a significantly higher prevalence of pvl+ strains of S aureus associated with soft tissue compared with bone infections. Furthermore, we observed a significantly longer time to healing among patients infected with mecA+ (methicillin-resistant) S aureus (MRSA).

  8. Exploring potential virulence regulators in Paracoccidioides brasiliensis isolates of varying virulence through quantitative proteomics.

    Science.gov (United States)

    Castilho, Daniele G; Chaves, Alison F A; Xander, Patricia; Zelanis, André; Kitano, Eduardo S; Serrano, Solange M T; Tashima, Alexandre K; Batista, Wagner L

    2014-10-03

    Few virulence factors have been identified for Paracoccidioides brasiliensis, the agent of paracoccidioidomycosis. In this study, we quantitatively evaluated the protein composition of P. brasiliensis in the yeast phase using minimal and rich media to obtain a better understanding of its virulence and to gain new insights into pathogen adaptation strategies. This analysis was performed on two isolates of the Pb18 strain showing distinct infection profiles in B10.A mice. Using liquid chromatography/tandem mass spectrometry (LC-MS/MS) analysis, we identified and quantified 316 proteins in minimal medium, 29 of which were overexpressed in virulent Pb18. In rich medium, 29 out of 295 proteins were overexpressed in the virulent fungus. Three proteins were found to be up-regulated in both media, suggesting the potential roles of these proteins in virulence regulation in P. brasiliensis. Moreover, genes up-regulated in virulent Pb18 showed an increase in its expression after the recovery of virulence of attenuated Pb18. Proteins up-regulated in both isolates were grouped according to their functional categories. Virulent Pb18 undergoes metabolic reorganization and increased expression of proteins involved in fermentative respiration. This approach allowed us to identify potential virulence regulators and provided a foundation for achieving a molecular understanding of how Paracoccidioides modulates the host-pathogen interaction to its advantage.

  9. Exposure to minimally processed pear and melon during shelf life could modify the pathogenic potential of Listeria monocytogenes.

    Science.gov (United States)

    Colás-Medà, Pilar; Viñas, Inmaculada; Oliveira, Márcia; Anguera, Marina; Serrano, Jose C E; Abadias, Maribel

    2017-04-01

    Survival and virulence of foodborne pathogens can be influenced by environmental factors such as the intrinsic properties of food as well as the extrinsic properties that contribute to food shelf life (e.g., temperature and gas atmosphere). The direct contribution of food matrix characteristics on the survival of L. monocytogenes during fresh-cut fruit shelf life is not very well understood. In addition, the gastrointestinal tract is the primary route of listeriosis infection and penetration of the intestinal epithelial cell barrier is the first step in the infection process. Hence, the pathogenic potential of L. monocytogenes, measured as the capability for the organism to survive a simulated gastrointestinal tract and the proportion of cells able to subsequently adhere to and invade differentiated Caco-2 cells, subjected to fresh-cut pear and melon shelf life, was investigated. Samples were inoculated, stored at 10 °C for 7 days and evaluated after inoculation and again after 2 and 7 days of storage. A decrease in L. monocytogenes' capacity to survive a simulated gastrointestinal tract was observed with increasing storage time, regardless of the fruit matrix evaluated. Furthermore, L. monocytogenes placed on fresh-cut pear and melon was subjected to an attachment and invasion assay after crossing the simulated gastrointestinal tract. After inoculation, pathogen on fresh-cut pear showed 5-fold more capacity to adhere to Caco-2 cells than pathogen on fresh-cut melon. After 2 days of storage, L. monocytogenes grown on fresh-cut melon showed similar adhesive capacity (1.11%) than cells grown on pear (1.83%), but cells grown on melon had the higher invasive capacity (0.0093%). We can conclude that minimally processed melon could represent a more important hazard than pear under the studied shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. The chitinolytic activity of Listeria monocytogenes EGD is regulated by carbohydrates but also by the virulence regulator PrfA

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Leisner, Jørgen; Ingmer, Hanne

    2010-01-01

    Chitin, an insoluble polymer of N-acetyl-D-glucosamine (GlcNAc), is one of the most abundant carbohydrate polymers in marine and terrestrial environments. Chitin hydrolysis by Listeria monocytogenes depends on two chitinase-encoding genes, chiA and chiB, and the aim of this study was to investigate...... their regulation. Chitin induces the expression of both chitinases in late exponential growth phase, and chiA but not chiB is furthermore induced by the monomer GlcNAc. Furthermore, their expression is subjected to catabolite control. Chitinases expressed by bacterial pathogens have proven to be important not only...... in wild-type cells. In agreement with this, Northern blot analysis showed that the amounts of chiA and chiB transcripts upon induction by chitin were significantly lower in the prfA mutant than in the wild type. The chitinolytic activity and chiA and chiB expression were reduced in the absence of the sig...

  11. Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551.

    Science.gov (United States)

    Ahmad, Abdelmonim Ali; Stulberg, Michael J; Huang, Qi

    2017-01-01

    We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum , indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant), and nine of the prophage's 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant), respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes ( pilT, egl, pehC, hrPB, and phcA ), and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a lysogenic phage and

  12. Occurrence and phenotypic and molecular characterization of Listeriamonocytogenes and Salmonella spp. in slaughterhouses in southern Brazil.

    Science.gov (United States)

    Iglesias, Mariana Almeida; Kroning, Isabela Schneid; Decol, Luana Tombini; de Melo Franco, Bernadette Dora Gombossy; Silva, Wladimir Padilha da

    2017-10-01

    This study addressed the occurrence of Listeriamonocytogenes and Salmonella spp. in bovine carcasses at two slaughterhouses in southern Brazil. Then, the antimicrobial susceptibility profile and the virulence potential of the isolates were evaluated. Two hundred carcasses were sampled at four steps of the slaughter process, with L. monocytogenes being isolated in 12 and Salmonella spp. in 17 carcasses. All L. monocytogenes isolates carried the hlyA, prfA, plcA, plcB, actA, iap, mpl, inlA, inlB, inlC, and inlJ genes, while Salmonella spp. carried invA and hilA. Among the L. monocytogenes isolates, all of them presented virulence determinants and one showed multi-drug resistance. In relationship to Salmonella spp. isolates, many serogroups frequently related to outbreaks of foodborne diseases were identified and four isolates showed resistance to more than one antimicrobial agent. This data highlights the importance of a rigid hygienic-sanitary control during the slaughter process to reduce the risk of cross-contamination and lower the consumer exposure to L. monocytogenes and Salmonella spp. infections. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Characterization of Aeromonas hydrophila Wound Pathotypes by Comparative Genomic and Functional Analyses of Virulence Genes

    Science.gov (United States)

    Grim, Christopher J.; Kozlova, Elena V.; Sha, Jian; Fitts, Eric C.; van Lier, Christina J.; Kirtley, Michelle L.; Joseph, Sandeep J.; Read, Timothy D.; Burd, Eileen M.; Tall, Ben D.; Joseph, Sam W.; Horneman, Amy J.; Chopra, Ashok K.; Shak, Joshua R.

    2013-01-01

    ABSTRACT Aeromonas hydrophila has increasingly been implicated as a virulent and antibiotic-resistant etiologic agent in various human diseases. In a previously published case report, we described a subject with a polymicrobial wound infection that included a persistent and aggressive strain of A. hydrophila (E1), as well as a more antibiotic-resistant strain of A. hydrophila (E2). To better understand the differences between pathogenic and environmental strains of A. hydrophila, we conducted comparative genomic and functional analyses of virulence-associated genes of these two wound isolates (E1 and E2), the environmental type strain A. hydrophila ATCC 7966T, and four other isolates belonging to A. aquariorum, A. veronii, A. salmonicida, and A. caviae. Full-genome sequencing of strains E1 and E2 revealed extensive differences between the two and strain ATCC 7966T. The more persistent wound infection strain, E1, harbored coding sequences for a cytotoxic enterotoxin (Act), a type 3 secretion system (T3SS), flagella, hemolysins, and a homolog of exotoxin A found in Pseudomonas aeruginosa. Corresponding phenotypic analyses with A. hydrophila ATCC 7966T and SSU as reference strains demonstrated the functionality of these virulence genes, with strain E1 displaying enhanced swimming and swarming motility, lateral flagella on electron microscopy, the presence of T3SS effector AexU, and enhanced lethality in a mouse model of Aeromonas infection. By combining sequence-based analysis and functional assays, we characterized an A. hydrophila pathotype, exemplified by strain E1, that exhibited increased virulence in a mouse model of infection, likely because of encapsulation, enhanced motility, toxin secretion, and cellular toxicity. PMID:23611906

  14. Reciprocal interaction between dental alloy biocorrosion and Streptococcus mutans virulent gene expression.

    Science.gov (United States)

    Zhang, Songmei; Qiu, Jing; Ren, Yanfang; Yu, Weiqiang; Zhang, Fuqiang; Liu, Xiuxin

    2016-04-01

    Corrosion of dental alloys is a major concern in dental restorations. Streptococcus mutans reduces the pH in oral cavity and induces demineralization of the enamel as well as corrosion of restorative dental materials. The rough surfaces of dental alloys induced by corrosion enhance the subsequent accumulation of plaque. In this study, the corrosion process of nickel-chromium (Ni-Cr) and cobalt-chromium (Co-Cr) alloys in a nutrient-rich medium containing S. mutans was studied using inductively coupled plasma atomic emission spectrometry (ICP-AES), X-ray photoelectron spectroscopy (XPS) and electrochemical corrosion test. Our results showed that the release of Ni and Co ions increased, particularly after incubation for 3 days. The electrochemical corrosion results showed a significant decrease in the corrosion resistance (Rp) value after the alloys were immersed in the media containing S. mutans for 3 days. Correspondingly, XPS revealed a reduction in the relative dominance of Ni, Co, and Cr in the surface oxides after the alloys were immersed in the S. mutans culture. After removal of the biofilm, the pre-corroded alloys were re-incubated in S. mutans medium, and the expressions of genes associated with the adhesion and acidogenesis of S. mutans, including gtfBCD, gbpB, fif and ldh, were evaluated by detecting the mRNA levels using real-time reverse transcription polymerase chain reaction (RT-PCR). We found that the gtfBCD, gbpB, ftf and Idh expression of S. mutans were noticeably increased after incubation with pre-corroded alloys for 24 h. This study demonstrated that S. mutans enhanced the corrosion behavior of the dental alloys, on the other hand, the presence of corroded alloy surfaces up-regulated the virulent gene expression in S. mutans. Compared with smooth surfaces, the rough corroded surfaces of dental alloys accelerated the bacteria-adhesion and corrosion process by changing the virulence gene expression of S. mutans.

  15. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.

    Science.gov (United States)

    Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan

    2016-09-26

    Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.

  16. Staphylococcus aureus but not Listeria monocytogenes adapt to triclosan and adaptation correlates with increased fabI expression and agr deficiency

    DEFF Research Database (Denmark)

    Nielsen, Lene Nørby; Larsen, Marianne Halberg; Skovgaard, Sissel

    2013-01-01

    was initially 4 mg/L and remained unaltered by the exposure. The adapted S. aureus isolates retained normal colony size but displayed increased expression of fabI encoding an essential enzyme in bacterial fatty acid synthesis. Also, they displayed decreased or no expression of the virulence associated agr......C of the agr quorum sensing system. While most adapted strains of USA300 carried mutations in fabI, none of the adapted strains of 8325-4 did. Conclusions. Adaptability to triclosan varies substantially between Gram positive human pathogens. S. aureus displayed an intrinsically lower MIC for triclosan compared...... to L. monocytogenes but was easily adapted leading to the same MIC as L. monocytogenes. Even though all adapted S. aureus strains over-expressed fabI and eliminated expression of the agr quorum sensing system, adaptation in USA300 involved fabI mutations whereas this was not the case for 8325-4. Thus...

  17. Genome sequence of the endosymbiont Rickettsia peacockii and comparison with virulent Rickettsia rickettsii: identification of virulence factors.

    Directory of Open Access Journals (Sweden)

    Roderick F Felsheim

    2009-12-01

    Full Text Available Rickettsia peacockii, also known as the East Side Agent, is a non-pathogenic obligate intracellular bacterium found as an endosymbiont in Dermacentor andersoni ticks in the western USA and Canada. Its presence in ticks is correlated with reduced prevalence of Rickettsia rickettsii, the agent of Rocky Mountain Spotted Fever. It has been proposed that a virulent SFG rickettsia underwent changes to become the East Side Agent. We determined the genome sequence of R. peacockii and provide a comparison to a closely related virulent R. rickettsii. The presence of 42 chromosomal copies of the ISRpe1 transposon in the genome of R. peacockii is associated with a lack of synteny with the genome of R. rickettsii and numerous deletions via recombination between transposon copies. The plasmid contains a number of genes from distantly related organisms, such as part of the glycosylation island of Pseudomonas aeruginosa. Genes deleted or mutated in R. peacockii which may relate to loss of virulence include those coding for an ankyrin repeat containing protein, DsbA, RickA, protease II, OmpA, ScaI, and a putative phosphoethanolamine transferase. The gene coding for the ankyrin repeat containing protein is especially implicated as it is mutated in R. rickettsii strain Iowa, which has attenuated virulence. Presence of numerous copies of the ISRpe1 transposon, likely acquired by lateral transfer from a Cardinium species, are associated with extensive genomic reorganization and deletions. The deletion and mutation of genes possibly involved in loss of virulence have been identified by this genomic comparison. It also illustrates that the introduction of a transposon into the genome can have varied effects; either correlating with an increase in pathogenicity as in Francisella tularensis or a loss of pathogenicity as in R. peacockii and the recombination enabled by multiple transposon copies can cause significant deletions in some genomes while not in others.

  18. Prevalence study of Vibrio species and frequency of the virulence genes of Vibrio parahaemolyticus isolated from fresh and salted shrimps in Genaveh seaport

    Directory of Open Access Journals (Sweden)

    S Hosseini

    2014-08-01

    Full Text Available Vibrio species are important seafood-borne pathogens that are responsible for 50-70% of gasteroenteritis. The present study was carried out in order to determine the prevalence of Vibrio species and the distribution of tdh, tlh and trh virulence genes in Vibrio parahaemolyticus isolated from fresh and salted shrimp samples. Totally, 60 fresh and salted shrimp samples were collected from the Genaveh seaport. Microbial culture was used to isolate Vibrio species. In addition, the presences of Vibrio parahaemolyticus, Vibrio cholera, Vibrio vulnificus and Vibrio harveyi and the virulence genes of V. parahaemolyticus were studied using the PCR method. Results showed that 20% of fresh and 23.33% of salted shrimp samples were positive for Vibrio species. In studied samples, V. vulnificus had the highest prevalence rate (8.33%, while V. cholera had the lowest prevalence rate (1.66%. From a total of 4 detected V. parahaemolyticus, all of them had tlh gene (100%. The distribution of tdh and trh genes in isolated V. parahaemolyticus strains were 50% and 25%, respectively. High prevalence of Vibrio species and especially virulent V. parahaemolyticus in samples confirmed the lack of hygienic condition in the production and distribution centers of shrimp.

  19. Induction of virulence gene expression in Staphylococcus aureus by pulmonary surfactant.

    Science.gov (United States)

    Ishii, Kenichi; Adachi, Tatsuo; Yasukawa, Jyunichiro; Suzuki, Yutaka; Hamamoto, Hiroshi; Sekimizu, Kazuhisa

    2014-04-01

    We performed a genomewide analysis using a next-generation sequencer to investigate the effect of pulmonary surfactant on gene expression in Staphylococcus aureus, a clinically important opportunistic pathogen. RNA sequence (RNA-seq) analysis of bacterial transcripts at late log phase revealed 142 genes that were upregulated >2-fold following the addition of pulmonary surfactant to the culture medium. Among these genes, we confirmed by quantitative reverse transcription-PCR analysis that mRNA amounts for genes encoding ESAT-6 secretion system C (EssC), an unknown hypothetical protein (NWMN_0246; also called pulmonary surfactant-inducible factor A [PsiA] in this study), and hemolysin gamma subunit B (HlgB) were increased 3- to 10-fold by the surfactant treatment. Among the major constituents of pulmonary surfactant, i.e., phospholipids and palmitate, only palmitate, which is the most abundant fatty acid in the pulmonary surfactant and a known antibacterial substance, stimulated the expression of these three genes. Moreover, these genes were also induced by supplementing the culture with detergents. The induction of gene expression by surfactant or palmitate was not observed in a disruption mutant of the sigB gene, which encodes an alternative sigma factor involved in bacterial stress responses. Furthermore, each disruption mutant of the essC, psiA, and hlgB genes showed attenuation of both survival in the lung and host-killing ability in a murine pneumonia model. These findings suggest that S. aureus resists membrane stress caused by free fatty acids present in the pulmonary surfactant through the regulation of virulence gene expression, which contributes to its pathogenesis within the lungs of the host animal.

  20. Escherichia coli isolates from calf diarrhea in Korea and their virulent genetic characteristics.

    Science.gov (United States)

    Hur, Jin; Jeon, Byung Woo; Kim, Yeong Ju; Oh, In Gyeong; Lee, John Hwa

    2013-05-02

    Escherichia coli strains were isolated from the feces of 130 diarrheic calves at different farms locations in Korea. The presence of the virulence genes, such as fanC, f41, f17a, eaeA, clpG, afa-8D, sta, stx1 and stx2, in each E. coli isolate was examined. Among the 314 isolates, 157 carried one or more of the virulence genes tested in this study. The most prevalent virulence gene was clpG (45.9%), although f17A (36.9%) and afa-8D (21.7%) were also frequently observed. The sta, stx1 and eaeA genes were detected in between approximately 13 and 17% of the isolates, and the fanC and fim41a genes were detected to a lesser extent. Collectively, our data indicated that diarrhea in calves in these locations can be ascribed to various virulence factors, and the pathogenesis may be more related to virulence genes such as, clpG, f17A, and afa-8D.

  1. Distribution of virulence genes and genotyping of CTX-M-15-producing Klebsiella pneumoniae isolated from patients with community-acquired urinary tract infection (CA-UTI).

    Science.gov (United States)

    Ranjbar, Reza; Memariani, Hamed; Sorouri, Rahim; Memariani, Mojtaba

    2016-11-01

    Klebsiella pneumoniae is one of the most important agents of community-acquired urinary tract infection (CA-UTI). In addition to extended-spectrum β-lactamases (ESBLs), a number of virulence factors have been shown to play an important role in the pathogenesis of K. pneumoniae, including capsule, siderophores, and adhesins. Little is known about the genetic diversity and virulence content of the CTX-M-15-producing K. pneumoniae isolated from CA-UTI in Iran. A total of 152 K. pneumoniae isolates were collected from CA-UTI patients in Tehran from September 2015 through April 2016. Out of 152 isolates, 40 (26.3%) carried bla CTX-M-15 . PCR was performed for detection of virulence genes in CTX-M-15-producing isolates. Furthermore, all of these isolates were subjected to multiple-locus variable-number of tandem repeat (VNTR) analysis (MLVA). Using MLVA method, 36 types were identified. CTX-M-15-producing K. pneumoniae isolates were grouped into 5 clonal complexes (CCs). Of these isolates, mrkD was the most prevalent virulence gene (95%), followed by kpn (60%), rmpA (37.5%), irp (35%), and magA (2.5%). No correlation between MLVA types or CCs and virulence genes or antibiotic resistance patterns was observed. Overall, it is thought that CTX-M-15-producing K. pneumoniae strains isolated from CA-UTI have arisen from different clones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Inhibition of Virulence Gene Expression in Staphylococcus aureus by Novel Depsipeptides from a Marine Photobacterium

    Directory of Open Access Journals (Sweden)

    Lone Gram

    2011-12-01

    Full Text Available During a global research expedition, more than five hundred marine bacterial strains capable of inhibiting the growth of pathogenic bacteria were collected. The purpose of the present study was to determine if these marine bacteria are also a source of compounds that interfere with the agr quorum sensing system that controls virulence gene expression in Staphylococcus aureus. Using a gene reporter fusion bioassay, we recorded agr interference as enhanced expression of spa, encoding Protein A, concomitantly with reduced expression of hla, encoding α-hemolysin, and rnaIII encoding RNAIII, the effector molecule of agr. A marine Photobacterium produced compounds interfering with agr in S. aureus strain 8325-4, and bioassay-guided fractionation of crude extracts led to the isolation of two novel cyclodepsipeptides, designated solonamide A and B. Northern blot analysis confirmed the agr interfering activity of pure solonamides in both S. aureus strain 8325-4 and the highly virulent, community-acquired strain USA300 (CA-MRSA. To our knowledge, this is the first report of inhibitors of the agr system by a marine bacterium.

  3. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  4. Beyond the chromosome: the prevalence of unique extra-chromosomal bacteriophages with integrated virulence genes in pathogenic Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Bryan Utter

    Full Text Available In Staphylococcus aureus, the disease impact of chromosomally integrated prophages on virulence is well described. However, the existence of extra-chromosomal prophages, both plasmidial and episomal, remains obscure. Despite the recent explosion in bacterial and bacteriophage genomic sequencing, studies have failed to specifically focus on extra-chromosomal elements. We selectively enriched and sequenced extra-chromosomal DNA from S. aureus isolates using Roche-454 technology and uncovered evidence for the widespread distribution of multiple extra-chromosomal prophages (ExPΦs throughout both antibiotic-sensitive and -resistant strains. We completely sequenced one such element comprised of a 43.8 kbp, circular ExPΦ (designated ФBU01 from a vancomycin-intermediate S. aureus (VISA strain. Assembly and annotation of ФBU01 revealed a number of putative virulence determinants encoded within a bacteriophage immune evasion cluster (IEC. Our identification of several potential ExPΦs and mobile genetic elements (MGEs also revealed numerous putative virulence factors and antibiotic resistance genes. We describe here a previously unidentified level of genetic diversity of stealth extra-chromosomal elements in S. aureus, including phages with a larger presence outside the chromosome that likely play a prominent role in pathogenesis and strain diversity driven by horizontal gene transfer (HGT.

  5. Bacteriocin-like substances of Lactobacillus curvatus P99: characterization and application in biodegradable films for control of Listeria monocytogenes in cheese.

    Science.gov (United States)

    Marques, Juliana de Lima; Funck, Graciele Daiana; Dannenberg, Guilherme da Silva; Cruxen, Claudio Eduardo Dos Santos; Halal, Shanise Lisie Mello El; Dias, Alvaro Renato Guerra; Fiorentini, Ângela Maria; Silva, Wladimir Padilha da

    2017-05-01

    The aim of this study was to evaluate the effectiveness of a biodegradable film, with antimicrobial metabolites produced by Lactobacillus curvatus P99 incorporated, targeting the control of Listeria monocytogenes in sliced "Prato" cheese. Tests were performed to evaluate the spectrum of action of cell-free supernatant (CFS) of P99 against different microorganisms, as well as to detect the minimum inhibitory (MIC) and bactericidal (MBC) concentrations against L. monocytogenes Scott A. The detection of genes that encode for the production of bacteriocins and evaluation of their expression were performed. Antimicrobial films were prepared, followed by in vitro and in situ analysis. The MIC and MBC of CFS against L. monocytogenes Scott A was 15.6 μL/mL and 62.5 μL/mL, respectively. Lactobacillus curvatus P99 presented two genes coding for the bacteriocins, which were expressed. Films with added MBC showed activity against different indicator microorganisms and were able to control L. monocytogenes Scott A when used in sliced "Prato" cheese. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Aureusimines in Staphylococcus aureus are not involved in virulence.

    Science.gov (United States)

    Sun, Fei; Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; He, Chuan; Bae, Taeok

    2010-12-29

    Recently, dipeptide aureusimines were reported to activate expression of staphylococcal virulence genes, such as alpha-hemolysin, and increase S. aureus virulence. Surprisingly, most of the virulence genes affected by aureusimines form part of the regulon of the SaeRS two component system (TCS), raising the possibility that SaeRS might be directly or indirectly involved in the aureusimine-dependent signaling process. Using HPLC analyses, we confirmed that a transposon mutant of ausA, the gene encoding the aureusimine dipeptide synthesis enzyme, does not produce dipeptides. However, the transposon mutant showed normal hemolysis activity and alpha-hemolysin/SaeP production. Furthermore, the P1 promoter of the sae operon, one of the targets of the SaeRS TCS, showed normal transcription activity. Moreover, in contrast to the original report, the ausA transposon mutant did not exhibit attenuated virulence in an animal infection model. DNA sequencing revealed that the ausA deletion mutant used in the original study has an 83 nt-duplication in saeS. Hemolysis activity of the original mutant was restored by a plasmid carrying the sae operon. A mutant of the sae operon showed elevated resistance to chloramphenicol and erythromycin, two antibiotics widely used during staphylococcal mutagenesis. At 43°C in the presence of erythromycin and aeration, the conditions typically employed for staphylococcal mutagenesis, an saeR transposon mutant grew much faster than a control mutant and the saeR mutant was highly enriched in a mixed culture experiment. Our results show that the previously reported roles of aureusimines in staphylococcal gene regulation and virulence were due to an unintended mutation in saeS, which was likely selected due to elevated resistance of the mutant to environmental stresses. Thus, there is no evidence indicating that the dipeptide aureusimines play a role in sae-mediated virulence factor production or contribute to staphylococcal virulence.

  7. Aureusimines in Staphylococcus aureus are not involved in virulence.

    Directory of Open Access Journals (Sweden)

    Fei Sun

    2010-12-01

    Full Text Available Recently, dipeptide aureusimines were reported to activate expression of staphylococcal virulence genes, such as alpha-hemolysin, and increase S. aureus virulence. Surprisingly, most of the virulence genes affected by aureusimines form part of the regulon of the SaeRS two component system (TCS, raising the possibility that SaeRS might be directly or indirectly involved in the aureusimine-dependent signaling process.Using HPLC analyses, we confirmed that a transposon mutant of ausA, the gene encoding the aureusimine dipeptide synthesis enzyme, does not produce dipeptides. However, the transposon mutant showed normal hemolysis activity and alpha-hemolysin/SaeP production. Furthermore, the P1 promoter of the sae operon, one of the targets of the SaeRS TCS, showed normal transcription activity. Moreover, in contrast to the original report, the ausA transposon mutant did not exhibit attenuated virulence in an animal infection model. DNA sequencing revealed that the ausA deletion mutant used in the original study has an 83 nt-duplication in saeS. Hemolysis activity of the original mutant was restored by a plasmid carrying the sae operon. A mutant of the sae operon showed elevated resistance to chloramphenicol and erythromycin, two antibiotics widely used during staphylococcal mutagenesis. At 43°C in the presence of erythromycin and aeration, the conditions typically employed for staphylococcal mutagenesis, an saeR transposon mutant grew much faster than a control mutant and the saeR mutant was highly enriched in a mixed culture experiment.Our results show that the previously reported roles of aureusimines in staphylococcal gene regulation and virulence were due to an unintended mutation in saeS, which was likely selected due to elevated resistance of the mutant to environmental stresses. Thus, there is no evidence indicating that the dipeptide aureusimines play a role in sae-mediated virulence factor production or contribute to staphylococcal

  8. CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection.

    Science.gov (United States)

    Bikard, David; Hatoum-Aslan, Asma; Mucida, Daniel; Marraffini, Luciano A

    2012-08-16

    Pathogenic bacterial strains emerge largely due to transfer of virulence and antimicrobial resistance genes between bacteria, a process known as horizontal gene transfer (HGT). Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci of bacteria and archaea encode a sequence-specific defense mechanism against bacteriophages and constitute a programmable barrier to HGT. However, the impact of CRISPRs on the emergence of virulence is unknown. We programmed the human pathogen Streptococcus pneumoniae with CRISPR sequences that target capsule genes, an essential pneumococcal virulence factor, and show that CRISPR interference can prevent transformation of nonencapsulated, avirulent pneumococci into capsulated, virulent strains during infection in mice. Further, at low frequencies bacteria can lose CRISPR function, acquire capsule genes, and mount a successful infection. These results demonstrate that CRISPR interference can prevent the emergence of virulence in vivo and that strong selective pressure for virulence or antibiotic resistance can lead to CRISPR loss in bacterial pathogens. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Cloning, characterization and effect of TmPGRP-LE gene silencing on survival of Tenebrio molitor against Listeria monocytogenes infection.

    Science.gov (United States)

    Tindwa, Hamisi; Patnaik, Bharat Bhusan; Kim, Dong Hyun; Mun, Seulgi; Jo, Yong Hun; Lee, Bok Luel; Lee, Yong Seok; Kim, Nam Jung; Han, Yeon Soo

    2013-11-14

    Peptidoglycan recognition proteins (PGRPs) are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP)-type peptidoglycan to activate both the immune deficiency (Imd) and proPhenoloxidase (proPO) pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF) of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  10. Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-11-01

    Full Text Available Peptidoglycan recognition proteins (PGRPs are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP-type peptidoglycan to activate both the immune deficiency (Imd and proPhenoloxidase (proPO pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  11. Genes de virulência e diversidade genética em Salmonella spp. isoladas de amostras de origem suína

    Directory of Open Access Journals (Sweden)

    M.S. Moura

    2014-10-01

    Full Text Available A diversificação da produção industrial de alimentos de origem suína e o intercâmbio comercial de animais e seus derivados destinados ao consumo humano podem ser importantes disseminadores de sorovares de Salmonella spp. na cadeia alimentar. Objetivou-se avaliar em 86 cepas de Salmonella spp., isoladas em granja de terminação e no abate de suínos, a ocorrência de três genes de virulência (invA, agfA e lpfA, bem como a similaridade genética entre elas. A ocorrência do gene invA foi verificada em 100% das amostras. O gene lpfA foi detectado em 80,23% (69/86 das cepas, não foi detectado em S. Panama e estava presente em todas as cepas de S. Infantis. O gene agfA foi detectado em 63,95% (55/86 das amostras. S. Agona apresentou positividade para todos os genes de virulência estudados. A análise de homologia entre as cepas agrupou os diferentes sorovares em clusters. A similaridade foi independente do local de isolamento, o que demonstra a presença de clones ao longo da cadeia de produção e a existência de multiplicidade de fontes para a infecção dos animais, como a ração, e a contaminação cruzada das carcaças. A pesquisa de genes de virulência e a avaliação da proximidade gênica permitem a caracterização e um maior entendimento sobre cepas de Salmonella circulantes na cadeia produtiva de suínos e, assim, podem subsidiar medidas de controle durante o processo produtivo com o objetivo de garantir a saúde do consumidor.

  12. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  13. Screening of virulence genes in Staphylococcus aureus isolates from rabbits

    Directory of Open Access Journals (Sweden)

    David Viana Martín

    2015-09-01

    Full Text Available Staphylococcus aureus is a versatile pathogen able to cause disease in both humans and animals. In rabbits, this bacterium infects animals of different ages, producing several purulent lesions. The ability of S. aureus to cause disease depends on a combination of virulence factors. The aim of this study was therefore to investigate the distribution of bacterial virulence determinants in 69 S. aureus isolates from rabbits. Some virulence factors (7 adhesins, 1 toxin and 1 protease were positive in all rabbit S. aureus isolates analysed, while others (1 adhesin and 10 toxins were always negative. The remaining virulence factors were more variable among isolates. An association between genotype and the different profiles of virulence factors was observed, but not with the type of lesion (P<0.05. One strain of each genotype was further analysed by multilocus sequence typing, generating ST121, ST96 and ST2951, determining a greater number of enterotoxins in ST121 isolates compared to ST96 and ST2951 isolates, which could justify the different pathogenicity between strains. 

  14. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  15. Genotypes and pathogenicity of cellulitis isolates reveal traits that modulate APEC virulence.

    Directory of Open Access Journals (Sweden)

    Nicolle Lima Barbieri

    Full Text Available We characterized 144 Escherichia coli isolates from severe cellulitis lesions in broiler chickens from South Brazil. Analysis of susceptibility to 15 antimicrobials revealed frequencies of resistance of less than 30% for most antimicrobials except tetracycline (70% and sulphonamides (60%. The genotyping of 34 virulence-associated genes revealed that all the isolates harbored virulence factors related to adhesion, iron acquisition and serum resistance, which are characteristic of the avian pathogenic E. coli (APEC pathotype. ColV plasmid-associated genes (cvi/cva, iroN, iss, iucD, sitD, traT, tsh were especially frequent among the isolates (from 66.6% to 89.6%. According to the Clermont method of ECOR phylogenetic typing, isolates belonged to group D (47.2%, to group A (27.8%, to group B2 (17.4% and to group B1 (7.6%; the group B2 isolates contained the highest number of virulence-associated genes. Clonal relationship analysis using the ARDRA method revealed a similarity level of 57% or higher among isolates, but no endemic clone. The virulence of the isolates was confirmed in vivo in one-day-old chicks. Most isolates (72.9% killed all infected chicks within 7 days, and 65 isolates (38.1% killed most of them within 24 hours. In order to analyze differences in virulence among the APEC isolates, we created a pathogenicity score by combining the times of death with the clinical symptoms noted. By looking for significant associations between the presence of virulence-associated genes and the pathogenicity score, we found that the presence of genes for invasins ibeA and gimB and for group II capsule KpsMTII increased virulence, while the presence of pic decreased virulence. The fact that ibeA, gimB and KpsMTII are characteristic of neonatal meningitis E. coli (NMEC suggests that genes of NMEC in APEC increase virulence of strains.

  16. Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551

    Directory of Open Access Journals (Sweden)

    Abdelmonim Ali Ahmad

    2017-12-01

    Full Text Available We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum, indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant, and nine of the prophage’s 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant, respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes (pilT, egl, pehC, hrPB, and phcA, and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a

  17. Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia solanacearum Carrier Strain UW551

    Science.gov (United States)

    Ahmad, Abdelmonim Ali; Stulberg, Michael J.; Huang, Qi

    2017-01-01

    We previously characterized a filamentous lysogenic bacteriophage, ϕRs551, isolated directly from the race 3 biovar 2 phylotype IIB sequevar 1 strain UW551 of Ralstonia solanacearum grown under normal culture conditions. The genome of ϕRs551 was identified with 100% identity in the deposited genomes of 11 race 3 biovar 2 phylotype IIB sequevar 1 strains of R. solanacearum, indicating evolutionary and biological importance, and ORF14 of ϕRs551 was annotated as a putative type-2 repressor. In this study, we determined the effect of the prophage and its ORF14 on the virulence and competitive fitness of its carrier strain UW551 by deleting the orf14 gene only (the UW551 orf14 mutant), and nine of the prophage’s 14 genes including orf14 and six out of seven structural genes (the UW551 prophage mutant), respectively, from the genome of UW551. The two mutants were increased in extracellular polysaccharide production, twitching motility, expression of targeted virulence and virulence regulatory genes (pilT, egl, pehC, hrPB, and phcA), and virulence, suggesting that the virulence of UW551 was negatively regulated by ϕRs551, at least partially through ORF14. Interestingly, we found that the wt ϕRs551-carrying strain UW551 of R. solanacearum significantly outcompeted the wt strain RUN302 which lacks the prophage in tomato plants co-inoculated with the two strains. When each of the two mutant strains was co-inoculated with RUN302, however, the mutants were significantly out-competed by RUN302 for the same colonization site. Our results suggest that ecologically, ϕRs551 may play an important role by regulating the virulence of and offering a competitive fitness advantage to its carrier bacterial strain for persistence of the bacterium in the environment, which in turn prolongs the symbiotic relationship between the phage ϕRs551 and the R. solanacearum strain UW551. Our study is the first toward a better understanding of the co-existence between a lysogenic phage and

  18. RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

    Science.gov (United States)

    Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

    2008-01-01

    Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

  19. RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

    Science.gov (United States)

    Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

    2008-11-01

    Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

  20. Transcriptome Analysis of the Intracellular Facultative Pathogen Piscirickettsia salmonis: Expression of Putative Groups of Genes Associated with Virulence and Iron Metabolism.

    Directory of Open Access Journals (Sweden)

    Alvaro Machuca

    Full Text Available The intracellular facultative bacteria Piscirickettsia salmonis is one of the most important pathogens of the Chilean aquaculture. However, there is a lack of information regarding the whole genomic transcriptional response according to different extracellular environments. We used next generation sequencing (NGS of RNA (RNA-seq to study the whole transcriptome of an isolate of P. salmonis (FAVET-INBIOGEN using a cell line culture and a modified cell-free liquid medium, with or without iron supplementation. This was done in order to obtain information about the factors there are involved in virulence and iron acquisition. First, the isolate was grown in the Sf21 cell line; then, the bacteria were cultured into a cell-free liquid medium supplemented or not with iron. We identified in the transcriptome, genes associated with type IV secretion systems, genes related to flagellar structure assembly, several proteases and sigma factors, and genes related to the development of drug resistance. Additionally, we identified for the first time several iron-metabolism associated genes including at least two iron uptake pathways (ferrous iron and ferric iron uptake that are actually expressed in the different conditions analyzed. We further describe putative genes that are related with the use and storage of iron in the bacteria, which have not been previously described. Several sets of genes related to virulence were expressed in both the cell line and cell-free culture media (for example those related to flagellar structure; such as basal body, MS-ring, C-ring, proximal and distal rod, and filament, which may play roles in other basic processes rather than been restricted to virulence.

  1. Transcriptional start site turnover in the evolution of bacterial paralogous genes - the pelE-pelD virulence genes in Dickeya.

    Science.gov (United States)

    Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie

    2016-11-01

    After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.

  2. Acidified nitrite inhibits proliferation of Listeria monocytogenes - Transcriptional analysis of a preservation method.

    Science.gov (United States)

    Müller-Herbst, Stefanie; Wüstner, Stefanie; Kabisch, Jan; Pichner, Rohtraud; Scherer, Siegfried

    2016-06-02

    Sodium nitrite (NaNO2) is added as a preservative during raw meat processing such as raw sausage production to inhibit growth of pathogenic bacteria. In the present study it was shown in challenge assays that the addition of sodium nitrite indeed inhibited growth and survival of Listeria monocytogenes in short-ripened spreadable raw sausages. Furthermore, in vitro growth analyses were performed, which took into account combinations of various parameters of the raw sausage ripening process like temperature, oxygen availability, pH, NaCl concentration, and absence or presence of NaNO2. Data based on 300 growth conditions revealed that the inhibitory effect of nitrite was most prominent in combination with acidification, a combination that is also achieved during short-ripened spreadable raw sausage production. At pH6.0 and below, L. monocytogenes was unable to replicate in the presence of 200mg/l NaNO2. During the adaptation of L. monocytogenes to acidified nitrite stress (pH6.0, 200mg/l NaNO2) in comparison to acid exposure only (pH6.0, 0mg/l NaNO2), a massive transcriptional adaptation was observed using microarray analyses. In total, 202 genes were up-regulated and 204 genes were down-regulated. In accordance with growth inhibition, a down-regulation of genes encoding for proteins which are involved in central cellular processes, like cell wall/membrane/envelope biogenesis, translation and ribosomal structure and biogenesis, transcription, and replication, recombination and repair, was observed. Among the up-regulated genes the most prominent group belonged to poorly characterized genes. A considerable fraction of the up-regulated genes has been shown previously to be up-regulated intracellularly in macrophages, after exposure to acid shock or to be part of the SigB regulon. These data indicate that the adaptation to acidified nitrite partly overlaps with the adaptation to stress conditions being present during host colonization. Copyright © 2016 Elsevier B

  3. Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.

    Science.gov (United States)

    Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P

    2012-01-01

    Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. Virulence and genomic feature of multidrug resistant Campylobacter jejuni isolated from broiler chicken

    Directory of Open Access Journals (Sweden)

    Haihong Hao

    2016-10-01

    Full Text Available The aim of this study was to reveal the molecular mechanism involved in multidrug resistance and virulence of Campylobacter jejuni isolated from broiler chickens. The virulence of six multidrug resistant C. jejuni was determined by in vitro and in vivo methods. The de novo whole genome sequencing technology and molecular biology methods were used to analyze the genomic features associated with the multidrug resistance and virulence of a selected isolate (C. jejuni 1655. The comparative genomic analyses revealed a large number of single nucleotide polymorphisms, deletions, rearrangements, and inversions in C. jejuni 1655 compared to reference C. jejuni genomes. The co-emergence of Thr-86-Ile mutation in gyrA gene, A2075G mutation in 23S rRNA gene, tetO, aphA and aadE genes and pTet plasmid in C. jejuni 1655 contributed its multidrug resistance to fluoroquinolones, macrolides, tetracycline and aminoglycosides. The combination of multiple virulence genes may work together to confer the relative higher virulence in C. jejuni 1655. The co-existence of mobile gene elements (e.g. pTet and CRISPR-Cas system in C. jejuni 1655 may play an important role in the gene transfer and immune defense. The present study provides basic information of phenotypic and genomic features of C. jejuni 1655, a strain recently isolated from a chicken displaying multidrug resistance and relatively high level of virulence.

  5. Transcriptional Alterations of Virulence-Associated Genes in Extended Spectrum Beta-Lactamase (ESBL-Producing Uropathogenic Escherichia coli during Morphologic Transitions Induced by Ineffective Antibiotics

    Directory of Open Access Journals (Sweden)

    Isak Demirel

    2017-06-01

    Full Text Available It is known that an ineffective antibiotic treatment can induce morphological shifts in uropathogenic Escherichia coli (UPEC but the virulence properties during these shifts remain to be studied. The present study examines changes in global gene expression patterns and in virulence factor-associated genes in an extended spectrum beta-lactamase (ESBL-producing UPEC (ESBL019 during the morphologic transitions induced by an ineffective antibiotic and in the presence of human primary bladder epithelial cells. Microarray results showed that the different morphological states of ESBL019 had significant transcriptional alterations of a large number of genes (Transition; 7%, Filamentation; 32%, and Reverted 19% of the entities on the array. All three morphological states of ESBL019 were associated with a decreased energy metabolism, altered iron acquisition systems and altered adhesion expression. In addition, genes associated with LPS synthesis and bacterial motility was also altered in all the morphological states. Furthermore, the transition state induced a significantly higher release of TNF-α from bladder epithelial cells compared to all other morphologies, while the reverted state was unable to induce TNF-α release. Our findings show that the morphological shifts induced by ineffective antibiotics are associated with significant transcriptional virulence alterations in ESBL-producing UPEC, which may affect survival and persistence in the urinary tract.

  6. Norlichexanthone Reduces Virulence Gene Expression and Biofilm Formation in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Baldry, Mara; Nielsen, Anita; Bojer, Martin S.

    2016-01-01

    characterise the mode of action of norlichexanthone and its effect on biofilm formation. We find that norlichexanthone reduces expression of both hla and RNAIII also in strain USA300. Structurally, norlichexanthone resembles ω-hydroxyemodin that recently was shown to bind the agr two component response......-hydroxyemodin however, norlichexanthone reduces staphylococcal biofilm formation. Transcriptomic analysis revealed that genes regulated by the SaeRS two-component system are repressed by norlichexanthone when compared to untreated cells, an effect that was mitigated in strain Newman carrying a partially constitutive...... SaeRS system. Our data show that norlichexanthone treatment reduces expression of key virulence factors in CA-MRSA strain USA300 via AgrA binding and represses biofilm formation....

  7. Comparative transcript profiling of Candida albicans and Candida dubliniensis identifies SFL2, a C. albicans gene required for virulence in a reconstituted epithelial infection model.

    LENUS (Irish Health Repository)

    Spiering, Martin J

    2010-02-01

    Candida albicans and Candida dubliniensis are closely related species displaying differences in virulence and genome content, therefore providing potential opportunities to identify novel C. albicans virulence genes. C. albicans gene arrays were used for comparative analysis of global gene expression in the two species in reconstituted human oral epithelium (RHE). C. albicans (SC5314) showed upregulation of hypha-specific and virulence genes within 30 min postinoculation, coinciding with rapid induction of filamentation and increased RHE damage. C. dubliniensis (CD36) showed no detectable upregulation of hypha-specific genes, grew as yeast, and caused limited RHE damage. Several genes absent or highly divergent in C. dubliniensis were upregulated in C. albicans. One such gene, SFL2 (orf19.3969), encoding a putative heat shock factor, was deleted in C. albicans. DeltaDeltasfl2 cells failed to filament under a range of hypha-inducing conditions and exhibited greatly reduced RHE damage, reversed by reintroduction of SFL2 into the DeltaDeltasfl2 strain. Moreover, SFL2 overexpression in C. albicans triggered hyphal morphogenesis. Although SFL2 deletion had no apparent effect on host survival in the murine model of systemic infection, DeltaDeltasfl2 strain-infected kidney tissues contained only yeast cells. These results suggest a role for SFL2 in morphogenesis and an indirect role in C. albicans pathogenesis in epithelial tissues.

  8. Evolving ideas about genetics underlying insect virulence to plant resistance in rice-brown planthopper interactions.

    Science.gov (United States)

    Kobayashi, Tetsuya

    2016-01-01

    Many plant-parasite interactions that include major plant resistance genes have subsequently been shown to exhibit features of gene-for-gene interactions between plant Resistance genes and parasite Avirulence genes. The brown planthopper (BPH) Nilaparvata lugens is an important pest of rice (Oryza sativa). Historically, major Resistance genes have played an important role in agriculture. As is common in gene-for-gene interactions, evolution of BPH virulence compromises the effectiveness of singly-deployed resistance genes. It is therefore surprising that laboratory studies of BPH have supported the conclusion that virulence is conferred by changes in many genes rather than a change in a single gene, as is proposed by the gene-for-gene model. Here we review the behaviour, physiology and genetics of the BPH in the context of host plant resistance. A problem for genetic understanding has been the use of various insect populations that differ in frequencies of virulent genotypes. We show that the previously proposed polygenic inheritance of BPH virulence can be explained by the heterogeneity of parental populations. Genetic mapping of Avirulence genes indicates that virulence is a monogenic trait. These evolving concepts, which have brought the gene-for-gene model back into the picture, are accelerating our understanding of rice-BPH interactions at the molecular level. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Occurrence of diarrhoeagenic Escherichia coli virulence genes in water and bed sediments of a river used by communities in Gauteng, South Africa.

    Science.gov (United States)

    Abia, Akebe Luther King; Ubomba-Jaswa, Eunice; Momba, Maggy Ndombo Benteke

    2016-08-01

    In most developing countries, especially in Southern Africa, little is known about the presence of diarrhoeagenic Escherichia coli (DEC) pathotypes in riverbed sediments. The present study sought to investigate the presence of DEC virulence genes in riverbed sediments of the Apies River, a river used by many communities in Gauteng, South Africa. Water and sediment samples were collected from the river between July and August 2013 (dry season) and also between January and February 2014 (wet season) following standard procedures. Isolation of E. coli was done using the Colilert®-18 Quanti-Tray® 2000 system. DNA was extracted from E. coli isolates using the InstaGene™ matrix from Bio-Rad and used as template DNA for real-time PCR. Water pH, temperature, dissolved oxygen, electrical conductivity and turbidity were measured in situ. Over 59 % of 180 samples analysed were positive for at least one of the seven DEC virulence genes investigated. The eaeA gene was the most isolated gene (29.44 %) while the ipaH gene the least isolated (8.33 %). The ipaH gene (p = 0.012) and the ST gene (stIa, p = 0.0001, and stIb, p = 0.019) were positively correlated with temperature. The detection of diarrhoeagenic E. coli virulence genes in the sediments of the Apies River shows that the sediments of this river might not only be a reservoir of faecal indicator bacteria like E. coli but also pathogenic strains of this bacterium. These organisms could represent a public health risk for poor communities relying on this water source for various purposes such as drinking and recreational use. There is therefore an urgent need to monitor these DEC pathotypes especially in areas without adequate water supplies.

  10. Cell Density Control of Staphylococcal Virulence Mediated by an Octapeptide Pheromone

    Science.gov (United States)

    Ji, Guangyong; Beavis, Ronald C.; Novick, Richard P.

    1995-12-01

    Some bacterial pathogens elaborate and secrete virulence factors in response to environmental signals, others in response to a specific host product, and still others in response to no discernible cue. In this study, we have demonstrated that the synthesis of Staphylococcus aureus virulence factors is controlled by a density-sensing system that utilizes an octapeptide produced by the organism itself. The octapeptide activates expression of the agr locus, a global regulator of the virulence response. This response involves the reciprocal regulation of genes encoding surface proteins and those encoding secreted virulence factors. As cells enter the postexponential phase, surface protein genes are repressed by agr and secretory protein genes are subsequently activated. The intracellular agr effector is a regulatory RNA, RNAIII, whose transcription is activated by an agr-encoded signal transduction system for which the octapeptide is the ligand.

  11. Molecular Characterization of Putative Virulence Determinants in Burkholderia pseudomallei

    Directory of Open Access Journals (Sweden)

    Suat Moi Puah

    2014-01-01

    Full Text Available The Gram-negative saprophyte Burkholderia pseudomallei is the causative agent of melioidosis, an infectious disease which is endemic in Southeast Asia and northern Australia. This bacterium possesses many virulence factors which are thought to contribute to its survival and pathogenicity. Using a virulent clinical isolate of B. pseudomallei and an attenuated strain of the same B. pseudomallei isolate, 6 genes BPSL2033, BP1026B_I2784, BP1026B_I2780, BURPS1106A_A0094, BURPS1106A_1131, and BURPS1710A_1419 were identified earlier by PCR-based subtractive hybridization. These genes were extensively characterized at the molecular level, together with an additional gene BPSL3147 that had been identified by other investigators. Through a reverse genetic approach, single-gene knockout mutants were successfully constructed by using site-specific insertion mutagenesis and were confirmed by PCR. BPSL2033::Km and BURPS1710A_1419::Km mutants showed reduced rates of survival inside macrophage RAW 264.7 cells and also low levels of virulence in the nematode infection model. BPSL2033::Km demonstrated weak statistical significance (P=0.049 at 8 hours after infection in macrophage infection study but this was not seen in BURPS1710A_1419::Km. Nevertheless, complemented strains of both genes were able to partially restore the gene defects in both in vitro and in vivo studies, thus suggesting that they individually play a minor role in the virulence of B. pseudomallei.

  12. Hemolytic Porcine Intestinal Escherichia coli without Virulence-Associated Genes Typical of Intestinal Pathogenic E. coli ▿ †

    Science.gov (United States)

    Schierack, Peter; Weinreich, Joerg; Ewers, Christa; Tachu, Babila; Nicholson, Bryon; Barth, Stefanie

    2011-01-01

    Testing 1,666 fecal or intestinal samples from healthy and diarrheic pigs, we obtained hemolytic Escherichia coli isolates from 593 samples. Focusing on hemolytic E. coli isolates without virulence-associated genes (VAGs) typical for enteropathogens, we found that such isolates carried a broad variety of VAGs typical for extraintestinal pathogenic E. coli. PMID:21965399

  13. A processing plant persistent strain of Listeria monocytogenes crosses the fetoplacental barrier in a pregnant guinea pig model

    DEFF Research Database (Denmark)

    Jensen, Anne; Williams, D.; Irving, E. A.

    2008-01-01

    independent fish processing plants. The purpose of the present study was to determine the virulence potential of one RAPD type 9 strain (La111), one human clinical strain (Scott A), and one monkey clinical strain (12443) in a pregnant guinea pig model. Animals were orally exposed to 10(8) CFU of L...... was isolated from 16 and 20% of placentas for 12443 and La111, respectively. The study demonstrates that a food processing plant persistent strain of L. monocytogenes is able to cross the fetoplacental barrier in pregnant guinea pigs. Furthermore, we demonstrate that although information can be gained from...

  14. Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii

    Science.gov (United States)

    Kröger, Carsten; Kary, Stefani C.; Schauer, Kristina; Cameron, Andrew D. S.

    2016-01-01

    Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance. PMID:28036056

  15. Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

    Science.gov (United States)

    Ericson, Megan E.; Frank, Matthew W.

    2016-01-01

    Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

  16. Comparison of virulence factors and capsular types of Streptococcus agalactiae isolated from human and bovine infections.

    Science.gov (United States)

    Emaneini, Mohammad; Khoramian, Babak; Jabalameli, Fereshteh; Abani, Samira; Dabiri, Hossein; Beigverdi, Reza

    2016-02-01

    Streptococcus agalactiae is a leading cause of human and bovine infections. A total of 194 S. agalactiae isolates, 55 isolates from bovines and 139 from humans, were analyzed for capsular types, virulence genes (scpB, hly, rib, bca and bac) and mobile genetic elements (IS1548 and GBSi1) using polymerase chain reaction (PCR) and multiplex PCR. Capsular type III was predominant (61%), followed by types V, II, Ib, and IV. The scpB, hly, bca and bac virulence genes were only found among human isolates. Twelve and 2 distinct virulence gene profiles were identified among human and bovine isolates respectively. The virulence gene profiles scpB- hly- IS1548- rib-bca (51%) and scpB- hly- IS1548- bca (19%) were only predominant among human isolates. The rib gene was the most common virulence gene in both human and bovine isolates. The study showed a high prevalence of virulence genes in S. agalactiae strains isolated from human infections, these result can support the idea that S. agalactiae isolated from humans and bovines are generally unrelated and probably belonged to separate populations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Genome Analysis of Listeria monocytogenes Sequence Type 8 Strains Persisting in Salmon and Poultry Processing Environments and Comparison with Related Strains

    Science.gov (United States)

    Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety

  18. Application of Chemical Genomics to Plant-Bacteria Communication: A High-Throughput System to Identify Novel Molecules Modulating the Induction of Bacterial Virulence Genes by Plant Signals.

    Science.gov (United States)

    Vandelle, Elodie; Puttilli, Maria Rita; Chini, Andrea; Devescovi, Giulia; Venturi, Vittorio; Polverari, Annalisa

    2017-01-01

    The life cycle of bacterial phytopathogens consists of a benign epiphytic phase, during which the bacteria grow in the soil or on the plant surface, and a virulent endophytic phase involving the penetration of host defenses and the colonization of plant tissues. Innovative strategies are urgently required to integrate copper treatments that control the epiphytic phase with complementary tools that control the virulent endophytic phase, thus reducing the quantity of chemicals applied to economically and ecologically acceptable levels. Such strategies include targeted treatments that weaken bacterial pathogens, particularly those inhibiting early infection steps rather than tackling established infections. This chapter describes a reporter gene-based chemical genomic high-throughput screen for the induction of bacterial virulence by plant molecules. Specifically, we describe a chemical genomic screening method to identify agonist and antagonist molecules for the induction of targeted bacterial virulence genes by plant extracts, focusing on the experimental controls required to avoid false positives and thus ensuring the results are reliable and reproducible.

  19. PfSETvs methylation of histone H3K36 represses virulence genes in Plasmodium falciparum

    DEFF Research Database (Denmark)

    Jiang, Lubin; Mu, Jianbing; Zhang, Qingfeng

    2013-01-01

    The variant antigen Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), which is expressed on the surface of P. falciparum-infected red blood cells, is a critical virulence factor for malaria. Each parasite has 60 antigenically distinct var genes that each code for a different PfEMP1...... parasite nuclei and their expression as proteins on the surface of individual infected red blood cells. PfSETvs-dependent H3K36me3 is present along the entire gene body, including the transcription start site, to silence var genes. With low occupancy of PfSETvs at both the transcription start site of var...... protein. During infection the clonal parasite population expresses only one gene at a time before switching to the expression of a new variant antigen as an immune-evasion mechanism to avoid the host antibody response. The mechanism by which 59 of the 60 var genes are silenced remains largely unknown...

  20. The worm has turned--microbial virulence modeled in Caenorhabditis elegans.

    Science.gov (United States)

    Sifri, Costi D; Begun, Jakob; Ausubel, Frederick M

    2005-03-01

    The nematode Caenorhabditis elegans is emerging as a facile and economical model host for the study of evolutionarily conserved mechanisms of microbial pathogenesis and innate immunity. A rapidly growing number of human and animal microbial pathogens have been shown to injure and kill nematodes. In many cases, microbial genes known to be important for full virulence in mammalian models have been shown to be similarly required for maximum pathogenicity in nematodes. C. elegans has been used in mutation-based screening systems to identify novel virulence-related microbial genes and immune-related host genes, many of which have been validated in mammalian models of disease. C. elegans-based pathogenesis systems hold the potential to simultaneously explore the molecular genetic determinants of both pathogen virulence and host defense.

  1. Studies on the pathogenesis and survival of different culture forms of Listeria monocytogenes to pulsed UV-light irradiation after exposure to mild-food processing stresses.

    Science.gov (United States)

    Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J

    2012-06-01

    The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Prevalence, Virulence Genes, Antimicrobial Susceptibility, and Genetic Diversity of Bacillus cereus Isolated From Pasteurized Milk in China

    Directory of Open Access Journals (Sweden)

    Tiantian Gao

    2018-03-01

    Full Text Available Bacillus cereus is a common and important food-borne pathogen that can be found in various food products. Due to low-temperature sterilization for a short period of time, pasteurization is not sufficient for complete elimination of B. cereus in milk, thereby cause severe economic loss and food safety problems. It is therefore of paramount importance to perform risk assessment of B. cereus in pasteurized milk. In this study, we isolated B. cereus from pasteurized milk samples in different regions of China, and evaluated the contamination situation, existence of virulence genes, antibiotic resistance profile and genetic polymorphism of B. cereus isolates. Intriguingly, 70 samples (27% were found to be contaminated by B. cereus and the average contamination level was 111 MPN/g. The distribution of virulence genes was assessed toward 10 enterotoxigenic genes (hblA, hblC, hblD, nheA, nheB, nheC, cytK, entFM, bceT, and hlyII and one emetic gene (cesB. Forty five percent strains harbored enterotoxigenic genes hblACD and 93% isolates contained nheABC gene cluster. The positive rate of cytK, entFM, bceT, hlyII, and cesB genes were 73, 96, 75, 54, and 5%, respectively. Antibiotic susceptibility assessment showed that most of the isolates were resistant to β-lactam antibiotics and rifampicin, but susceptible to other antibiotics such as ciprofloxacin, gentamicin and chloramphenicol. Total multidrug-resistant population was about 34%. In addition, B. cereus isolates in pasteurized milk showed a high genetic diversity. In conclusion, our findings provide the first reference on the prevalence, contamination level and characteristics of B. cereus isolated from pasteurized milk in China, suggesting a potential high risk of B. cereus to public health and dairy industry.

  3. Necrotic enteritis locus 1 diguanylate cyclase and phosphodiesterase (cyclic-di-GMP) gene mutation attenuates virulence in an avian necrotic enteritis isolate of Clostridium perfringens.

    Science.gov (United States)

    Parreira, Valeria R; Ojha, Shivani; Lepp, Dion; Mehdizadeh Gohari, Iman; Zhou, Hongzhuan; Susta, Leonardo; Gong, Jianhua; Prescott, John F

    2017-09-01

    Necrotic enteritis (NE) caused by netB-positive strains of Clostridium perfringens is an important disease of intensively-reared broiler chickens. It is widely controlled by antibiotic use, but this practice that has come under increasing scrutiny and alternative approaches are required. As part of the search for alternative approaches over the last decade, advances have been made in understanding its pathogenesis but much remains to be understood and applied to the control of NE. The objective of this work was to assess the effect on virulence of mutation of the cyclic-di-GMP signaling genes present on the large pathogenicity locus (NELoc-1) in the tcp-encoding conjugative virulence plasmid, pNetB. For this purpose, the diguanylate cyclase (dgc) and phosphodiesterase (pde) genes were individually insertionally inactivated and the two mutants were subsequently complemented with their respective genes. Southern blotting showed that a single gene insertion was present. Mutation of either gene resulted in almost total attenuation of the mutants to cause NE in experimentally-infected broiler chickens, which was fully restored in each case by complementation of the respective mutated gene. Production of NetB-associated cytotoxicity for Leghorn male hepatoma (LMH) cells was unaffected in mutants. We conclude that the cyclic-di-GMP signaling system is important in controlling virulence in a NE C. perfringens strain and might be a target for control of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.

    Science.gov (United States)

    Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja

    2017-09-25

    Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.

  5. Control of Virulence Gene Expression by the Master Regulator, CfaD, in the Prototypical Enterotoxigenic Escherichia coli Strain, H10407

    Directory of Open Access Journals (Sweden)

    Carla Hodson

    2017-08-01

    Full Text Available Enterotoxigenic Escherichia coli (ETEC is the most common bacterial cause of diarrhea in children in developing countries, as well as in travelers to these countries. To cause disease, ETEC needs to produce a series of virulence proteins including enterotoxins, colonization factors and secretion pathways, which enable this pathogen to colonize the human small intestine and deliver enterotoxins to epithelial cells. Previously, a number of studies have demonstrated that CfaD, an AraC-like transcriptional regulator, plays a key role in virulence gene expression by ETEC. In this study, we carried out a transcriptomic analysis of ETEC strain, H10407, grown under different conditions, and determined the complete set of genes that are regulated by CfaD. In this way, we identified a number of new target genes, including rnr-1, rnr-2, etpBAC, agn43, flu, traM and ETEC_3214, whose expression is strongly activated by CfaD. Using promoter-lacZ reporters, primer extension and electrophoretic mobility shift assays, we characterized the CfaD-mediated activation of several selected target promoters. We also showed that the gut-associated environmental signal, sodium bicarbonate, stimulates CfaD-mediated upregulation of its virulence target operons. Finally, we screened a commercial small molecule library and identified a compound (CH-1 that specifically inhibited the regulatory function of CfaD, and by 2-D analoging, we identified a second inhibitor (CH-2 with greater potency.

  6. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui

    2008-01-01

    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

  7. Multiplex reverse transcription polymerase chain reaction to study the expression of virulence and stress response genes in Staphylococcus aureus.

    Science.gov (United States)

    Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep

    2012-02-01

    Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®

  8. Comparative Genomics of Mycoplasma bovis Strains Reveals That Decreased Virulence with Increasing Passages Might Correlate with Potential Virulence-Related Factors

    Directory of Open Access Journals (Sweden)

    Muhammad A. Rasheed

    2017-05-01

    Full Text Available Mycoplasma bovis is an important cause of bovine respiratory disease worldwide. To understand its virulence mechanisms, we sequenced three attenuated M. bovis strains, P115, P150, and P180, which were passaged in vitro 115, 150, and 180 times, respectively, and exhibited progressively decreasing virulence. Comparative genomics was performed among the wild-type M. bovis HB0801 (P1 strain and the P115, P150, and P180 strains, and one 14.2-kb deleted region covering 14 genes was detected in the passaged strains. Additionally, 46 non-sense single-nucleotide polymorphisms and indels were detected, which confirmed that more passages result in more mutations. A subsequent collective bioinformatics analysis of paralogs, metabolic pathways, protein-protein interactions, secretory proteins, functionally conserved domains, and virulence-related factors identified 11 genes that likely contributed to the increased attenuation in the passaged strains. These genes encode ascorbate-specific phosphotransferase system enzyme IIB and IIA components, enolase, L-lactate dehydrogenase, pyruvate kinase, glycerol, and multiple sugar ATP-binding cassette transporters, ATP binding proteins, NADH dehydrogenase, phosphate acetyltransferase, transketolase, and a variable surface protein. Fifteen genes were shown to be enriched in 15 metabolic pathways, and they included the aforementioned genes encoding pyruvate kinase, transketolase, enolase, and L-lactate dehydrogenase. Hydrogen peroxide (H2O2 production in M. bovis strains representing seven passages from P1 to P180 decreased progressively with increasing numbers of passages and increased attenuation. However, eight mutants specific to eight individual genes within the 14.2-kb deleted region did not exhibit altered H2O2 production. These results enrich the M. bovis genomics database, and they increase our understanding of the mechanisms underlying M. bovis virulence.

  9. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  10. A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

    Science.gov (United States)

    Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

    2017-03-21

    Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role

  11. Identification of Xylella fastidiosa antivirulence genes: hemagglutinin adhesins contribute a biofilm maturation to X. fastidios and colonization and attenuate virulence.

    Science.gov (United States)

    Guilhabert, Magalie R; Kirkpatrick, Bruce C

    2005-08-01

    Xylella fastidosa, a gram-negative, xylem-limited bacterium, is the causal agent of several economically important plant diseases, including Pierce's disease (PD) and citrus variegated chlorosis (CVC). Until recently, the inability to transform or produce transposon mutants of X. fastidosa had been a major impediment to identifying X. fastidosa genes that mediate pathogen and plant interactions. A random transposon (Tn5) library of X. fastidosa was constructed and screened for mutants showing more severe symptoms and earlier grapevine death (hypervirulence) than did vines infected with the wild type. Seven hypervirulent mutants identified in this screen moved faster and reached higher populations than the wild type in grapevines. These results suggest that X. fastidosa attenuates its virulence in planta and that movement is important in X. fastidosa virulence. The mutated genes were sequenced and none had been described previously as antivirulence genes, although six of them showed similarity with genes of known functions in other organisms. One transposon insertion inactivated a hemagglutinin adhesin gene (PD2118), which we named HxfA. Another mutant in a second putative X. fastidosa hemagglutinin gene, PD1792 (HxfB), was constructed, and further characterization of these hxf mutants suggests that X. fastidosa hemagglutinins mediate contact between X. fastidosa cells, which results in colony formation and biofilm maturation within the xylem vessels.

  12. KdpE and a putative RsbQ homologue contribute to growth of Listeria monocytogenes at high osmolarity and low temperature

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Kallipolitis, Birgitte H; Ingmer, Hanne

    2003-01-01

    The kdp locus of Listeria monocytogenes encodes products with homology to structural proteins of a high-affinity potassium uptake system and to a two-component signal transduction system commonly involved in controlling gene expression. We have investigated the role of kdpE, encoding the transcri......The kdp locus of Listeria monocytogenes encodes products with homology to structural proteins of a high-affinity potassium uptake system and to a two-component signal transduction system commonly involved in controlling gene expression. We have investigated the role of kdpE, encoding...... the transcriptional response regulator, as well as of the downstream gene, orfX, in adaptation of L. monocytogenes EGD to NaCl and low temperature. When grown in chemically defined medium the addition of NaCl to 2% decreased the growth rate of a mutant with an insertional inactivated kdpE, while mutants carrying in......-frame deletions of either kdpE or orfX were unaffected by high osmolarity. Transcriptional analysis of kdpE and orfX revealed that their products are encoded by the same transcript. Thus, our data indicate that the absence of both KdpE and OrfX influences growth under osmotic pressure. Interestingly, Orf...

  13. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  14. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  15. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Directory of Open Access Journals (Sweden)

    Shi Wu

    Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  16. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  17. Prevalence of Salmonella enterica, Listeria monocytogenes, and pathogenic Escherichia coli in bulk tank milk and milk filters from US dairy operations in the National Animal Health Monitoring System Dairy 2014 study.

    Science.gov (United States)

    Sonnier, Jakeitha L; Karns, Jeffrey S; Lombard, Jason E; Kopral, Christine A; Haley, Bradd J; Kim, Seon-Woo; Van Kessel, Jo Ann S

    2018-03-01

    The dairy farm environment is a well-documented reservoir for zoonotic pathogens such as Salmonella enterica, Shiga-toxigenic Escherichia coli, and Listeria monocytogenes, and humans may be exposed to these pathogens via consumption of unpasteurized milk and dairy products. As part of the National Animal Health Monitoring System Dairy 2014 study, bulk tank milk (BTM, n = 234) and milk filters (n = 254) were collected from a total of 234 dairy operations in 17 major dairy states and analyzed for the presence of these pathogens. The invA gene was detected in samples from 18.5% of operations and Salmonella enterica was isolated from 18.0% of operations. Salmonella Dublin was detected in 0.7% of operations. Sixteen Salmonella serotypes were isolated, and the most common serotypes were Cerro, Montevideo, and Newport. Representative Salmonella isolates (n = 137) were tested against a panel of 14 antimicrobials. Most (85%) were pansusceptible; the remaining were resistant to 1 to 9 antimicrobials, and within the resistant strains the most common profile was resistance to ampicillin/clavulanic acid, ampicillin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline. Listeria spp. were isolated from 19.9% of operations, and L. monocytogenes was isolated from 3.0% of operations. Serogroups 1/2a and 1/2b were the most common, followed by 4b and 4a. One or more E. coli virulence genes were detected in the BTM from 30.5% of operations and in the filters from 75.3% of operations. A combination of stx 2 , eaeA, and γ-tir genes was detected in the BTM from 0.5% of operations and in the filters from 6.6% of operations. The results of this study indicate an appreciable prevalence of bacterial pathogens in BTM and filters, including serovars known to infect humans. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. RNAi-Based Functional Genomics Identifies New Virulence Determinants in Mucormycosis.

    Directory of Open Access Journals (Sweden)

    Trung Anh Trieu

    2017-01-01

    Full Text Available Mucorales are an emerging group of human pathogens that are responsible for the lethal disease mucormycosis. Unfortunately, functional studies on the genetic factors behind the virulence of these organisms are hampered by their limited genetic tractability, since they are reluctant to classical genetic tools like transposable elements or gene mapping. Here, we describe an RNAi-based functional genomic platform that allows the identification of new virulence factors through a forward genetic approach firstly described in Mucorales. This platform contains a whole-genome collection of Mucor circinelloides silenced transformants that presented a broad assortment of phenotypes related to the main physiological processes in fungi, including virulence, hyphae morphology, mycelial and yeast growth, carotenogenesis and asexual sporulation. Selection of transformants with reduced virulence allowed the identification of mcplD, which encodes a Phospholipase D, and mcmyo5, encoding a probably essential cargo transporter of the Myosin V family, as required for a fully virulent phenotype of M. circinelloides. Knock-out mutants for those genes showed reduced virulence in both Galleria mellonella and Mus musculus models, probably due to a delayed germination and polarized growth within macrophages. This study provides a robust approach to study virulence in Mucorales and as a proof of concept identified new virulence determinants in M. circinelloides that could represent promising targets for future antifungal therapies.

  19. Microarray Evaluation of Antimicrobial Resistance and Virulence of Escherichia coli Isolates from Portuguese Poultry

    Directory of Open Access Journals (Sweden)

    Nuno Mendonça

    2016-01-01

    Full Text Available The presence of antimicrobial resistance and virulence factors of 174 Escherichia coli strains isolated from healthy Portuguese Gallus gallus was evaluated. Resistance profiles were determined against 33 antimicrobials by microbroth dilution. Resistance was prevalent for tetracycline (70% and ampicillin (63%. Extended-spectrum beta-lactamase (ESBL phenotype was observed in 18% of the isolates. Multidrug resistance was found in 56% of isolates. A subset of 74 isolates were screened by DNA microarrays for the carriage of 88 antibiotic resistance genes and 62 virulence genes. Overall, 37 different resistance genes were detected. The most common were tet(A (72%, blaTEM (68%, and sul1 (47%, while 21% isolates harbored an ESBL gene (blaCTX-M group 1, group 2, or group 9. Of these, 96% carried the increased serum survival (iss virulence gene, while 89% presented the enterobactin siderophore receptor protein (iroN, 70% the temperature-sensitive hemagglutinin (tsh, and 68% the long polar fimbriae (lpfA virulence genes associated with extraintestinal pathogenic E. coli. In conclusion, prevalence of antibiotic resistant E. coli from the microbiota of Portuguese chickens was high, including to extended spectrum cephalosporins. The majority of isolates seems to have the potential to trigger extraintestinal human infection due to the presence of some virulence genes. However, the absence of genes specific for enteropathogenic E. coli reduces the risk for human intestinal infection.

  20. Yersinia enterocolitica: Mode of Transmission, Molecular Insights of Virulence, and Pathogenesis of Infection

    Directory of Open Access Journals (Sweden)

    Yeasmin Sabina

    2011-01-01

    Full Text Available Although Yersinia enterocolitica is usually transmitted through contaminated food and untreated water, occasional transmission such as human-to-human, animal-to-human and blood transfusion associated transmission have also identified in human disease. Of the six Y. enterocolitica biotypes, the virulence of the pathogenic biotypes, namely, 1B and 2–5 is attributed to the presence of a highly conserved 70-kb virulence plasmid, termed pYV/pCD and certain chromosomal genes. Some biotype 1A strains, despite lacking virulence plasmid (pYV and traditional chromosomal virulence genes, are isolated frequently from humans with gastrointestinal diseases similar to that produced by isolates belonging known pathogenic biotypes. Y. enterocolitica pathogenic biotypes have evolved two major properties: the ability to penetrate the intestinal wall, which is thought to be controlled by plasmid genes, and the production of heat-stable enterotoxin, which is controlled by chromosomal genes.

  1. Occurrence of Putative Virulence Genes in Arcobacter Species Isolated from Humans and Animals

    Science.gov (United States)

    Douidah, Laid; de Zutter, Lieven; Baré, Julie; De Vos, Paul; Vandamme, Peter; Vandenberg, Olivier; Van den Abeele, Anne-Marie

    2012-01-01

    Interest in arcobacters in veterinary and human public health has increased since the first report of the isolation of arcobacters from food of animal origin. Since then, studies worldwide have reported the occurrence of arcobacters on food and in food production animals and have highlighted possible transmission, especially of Arcobacter butzleri, to the human population. In humans, arcobacters are associated with enteritis and septicemia. To assess their clinical relevance for humans and animals, evaluation of potential virulence factors is required. However, up to now, little has been known about the mechanisms of pathogenicity. Because of their close phylogenetic affiliation to the food-borne pathogen Campylobacter and their similar clinical manifestations, the presence of nine putative Campylobacter virulence genes (cadF, ciaB, cj1349, hecA, hecB, irgA, mviN, pldA, and tlyA) previously identified in the recent Arcobacter butzleri ATCC 49616 genome sequence was determined in a large set of human and animal Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii strains after the development of rapid and accurate PCR assays and confirmed by sequencing and dot blot hybridization. PMID:22170914

  2. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  3. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

    Science.gov (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

    2016-01-18

    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. A SNARE-Like Protein and Biotin Are Implicated in Soybean Cyst Nematode Virulence.

    Directory of Open Access Journals (Sweden)

    Sadia Bekal

    Full Text Available Phytoparasitic nematodes that are able to infect and reproduce on plants that are considered resistant are referred to as virulent. The mechanism(s that virulent nematodes employ to evade or suppress host plant defenses are not well understood. Here we report the use of a genetic strategy (allelic imbalance analysis to associate single nucleotide polymorphisms (SNPs with nematode virulence genes in Heterodera glycines, the soybean cyst nematode (SCN. To accomplish this analysis, a custom SCN SNP array was developed and used to genotype SCN F3-derived populations grown on resistant and susceptible soybean plants. Three SNPs reproducibly showed allele imbalances between nematodes grown on resistant and susceptible plants. Two candidate SCN virulence genes that were tightly linked to the SNPs were identified. One SCN gene encoded biotin synthase (HgBioB, and the other encoded a bacterial-like protein containing a putative SNARE domain (HgSLP-1. The two genes mapped to two different linkage groups. HgBioB contained sequence polymorphisms between avirulent and virulent nematodes. However, the gene encoding HgSLP-1 had reduced copy number in virulent nematode populations and appears to produce multiple forms of the protein via intron retention and alternative splicing. We show that HgSLP-1 is an esophageal-gland protein that is secreted by the nematode during plant parasitism. Furthermore, in bacterial co-expression experiments, HgSLP-1 co-purified with the SCN resistance protein Rhg1 α-SNAP, suggesting that these two proteins physically interact. Collectively our data suggest that multiple SCN genes are involved in SCN virulence, and that HgSLP-1 may function as an avirulence protein and when absent it helps SCN evade host defenses.

  5. The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

    Directory of Open Access Journals (Sweden)

    abazar pournajaf

    2013-09-01

    Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

  6. Identification of immunogenic and virulence-associated Campylobacter jejuni proteins

    DEFF Research Database (Denmark)

    Nielsen, Lene Nørby; Luijkx, Thomas A.; Vegge, Christina Skovgaard

    2012-01-01

    With the aim of identifying proteins important for host interaction and virulence, we have screened an expression library of NCTC 11168 Campylobacter jejuni genes for highly immunogenic proteins. A commercial C. jejuni open reading frame (ORF) library consisting of more than 1,600 genes was trans......With the aim of identifying proteins important for host interaction and virulence, we have screened an expression library of NCTC 11168 Campylobacter jejuni genes for highly immunogenic proteins. A commercial C. jejuni open reading frame (ORF) library consisting of more than 1,600 genes...

  7. Listeria monocytogenes - Danger for health safety vegetable production.

    Science.gov (United States)

    Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

    2018-04-22

    The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

  8. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  9. Characterization of the rcsA Gene from Pantoea sp. Strain PPE7 and Its Influence on Extracellular Polysaccharide Production and Virulence on Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Min Keun Kim

    2017-06-01

    Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.

  10. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.

    Science.gov (United States)

    Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N

    2017-01-01

    Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  11. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death

    Directory of Open Access Journals (Sweden)

    Svitlana Vdovikova

    2017-05-01

    Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  12. Patterns of variation at Ustilago maydis virulence clusters 2A and 19A largely reflect the demographic history of its populations.

    Directory of Open Access Journals (Sweden)

    Ronny Kellner

    Full Text Available The maintenance of an intimate interaction between plant-biotrophic fungi and their hosts over evolutionary times involves strong selection and adaptative evolution of virulence-related genes. The highly specialised maize pathogen Ustilago maydis is assigned with a high evolutionary capability to overcome host resistances due to its high rates of sexual recombination, large population sizes and long distance dispersal. Unlike most studied fungus-plant interactions, the U. maydis - Zea mays pathosystem lacks a typical gene-for-gene interaction. It exerts a large set of secreted fungal virulence factors that are mostly organised in gene clusters. Their contribution to virulence has been experimentally demonstrated but their genetic diversity within U. maydis remains poorly understood. Here, we report on the intraspecific diversity of 34 potential virulence factor genes of U. maydis. We analysed their sequence polymorphisms in 17 isolates of U. maydis from Europe, North and Latin America. We focused on gene cluster 2A, associated with virulence attenuation, cluster 19A that is crucial for virulence, and the cluster-independent effector gene pep1. Although higher compared to four house-keeping genes, the overall levels of intraspecific genetic variation of virulence clusters 2A and 19A, and pep1 are remarkably low and commensurate to the levels of 14 studied non-virulence genes. In addition, each gene is present in all studied isolates and synteny in cluster 2A is conserved. Furthermore, 7 out of 34 virulence genes contain either no polymorphisms or only synonymous substitutions among all isolates. However, genetic variation of clusters 2A and 19A each resolve the large scale population structure of U. maydis indicating subpopulations with decreased gene flow. Hence, the genetic diversity of these virulence-related genes largely reflect the demographic history of U. maydis populations.

  13. The Influences of Bacillus subtilis on the Virulence of Aeromonas hydrophila and Expression of luxS Gene of Both Bacteria Under Co-cultivation.

    Science.gov (United States)

    Ren, Yuwei; Li, Sisi; Wu, Zhixin; Zhou, Chengchong; Zhang, Ding; Chen, Xiaoxuan

    2017-06-01

    The aim of this study was to explore the influence of Bacillus subtilis CH9 on Aeromonas hydrophila SC2005. The transcription level of virulence genes of A. hydrophila SC2005 and its hemolysin activity as well as its cytotoxicity were analyzed when B. subtilis CH9 and A. hydrophila SC2005 were co-cultured. The results indicated that the transcription levels of four virulence genes of A. hydrophila, including aer, ahyB, hcp, and emp, decreased when A. hydrophila was cultured with B. subtilis CH9. Furthermore, the extracellular products of A. hydrophila showed attenuated hemolysin activity as well as cytotoxicity when A. hydrophila was cultured with B. subtilis CH9. Finally, the transcriptional levels of luxS genes of B. subtilis CH9 and A. hydrophila SC2005 were determined when these two species were co-cultured. RT-qPCR results suggested that the transcription level of A. hydrophila was down-regulated significantly. On the contrary, the transcription level of B. subtilis CH9 was up-regulated significantly. These results suggested that the probiotic role of B. subtilis CH9 is related to the inhibition of growth and virulence of A. hydrophila SC2005, and quorum sensing may be involved.

  14. Inactivation and Gene Expression of a Virulent WastewaterEscherichia coliStrain and the Nonvirulent CommensalEscherichia coliDSM1103 Strain upon Solar Irradiation

    KAUST Repository

    Aljassim, Nada I.; Mantilla-Calderon, David; Wang, Tiannyu; Hong, Pei-Ying

    2017-01-01

    This study examined the decay kinetics and molecular responses of two Escherichia coli strains upon solar irradiation. The first is E. coli PI-7, a virulent and antibiotic-resistant strain that was isolated from wastewater and carries the emerging NDM-1 antibiotic resistance gene. The other strain, E. coli DSM1103, displayed lower virulence and antibiotic resistance than E. coli PI-7. In a buffer solution, E. coli PI-7 displayed a longer lag phase prior to decay and a longer half-life compared with E. coli DSM1103 (6.64 ± 0.63 h and 2.85 ± 0.46 min vs 1.33 ± 0.52 h and 2.04 ± 0.36 min). In wastewater, both E. coli strains decayed slower than they did in buffer. Although solar irradiation remained effective in reducing the numbers of both strains by more than 5-log10 in <24 h, comparative genomics and transcriptomics revealed differences in the genomes and overall regulation of genes between the two E. coli strains. A wider arsenal of genes related to oxidative stress, cellular repair and protective mechanisms were upregulated in E. coli PI-7. Subpopulations of E. coli PI-7 expressed genes related to dormancy and persister cell formation during the late decay phase, which may have accounted for its prolonged persistence. Upon prolonged solar irradiation, both E. coli strains displayed upregulation of genes related to horizontal gene transfer and antibiotic resistance. Virulence functions unique to E. coli PI-7 were also upregulated. Our findings collectively indicated that, whereas solar irradiation is able to reduce total cell numbers, viable E. coli remained and expressed genes that enable survival despite solar treatment. There remains a need for heightened levels of concern regarding risks arising from the dissemination of E. coli that may remain viable in wastewater after solar irradiation.

  15. Inactivation and Gene Expression of a Virulent WastewaterEscherichia coliStrain and the Nonvirulent CommensalEscherichia coliDSM1103 Strain upon Solar Irradiation

    KAUST Repository

    Aljassim, Nada I.

    2017-03-06

    This study examined the decay kinetics and molecular responses of two Escherichia coli strains upon solar irradiation. The first is E. coli PI-7, a virulent and antibiotic-resistant strain that was isolated from wastewater and carries the emerging NDM-1 antibiotic resistance gene. The other strain, E. coli DSM1103, displayed lower virulence and antibiotic resistance than E. coli PI-7. In a buffer solution, E. coli PI-7 displayed a longer lag phase prior to decay and a longer half-life compared with E. coli DSM1103 (6.64 ± 0.63 h and 2.85 ± 0.46 min vs 1.33 ± 0.52 h and 2.04 ± 0.36 min). In wastewater, both E. coli strains decayed slower than they did in buffer. Although solar irradiation remained effective in reducing the numbers of both strains by more than 5-log10 in <24 h, comparative genomics and transcriptomics revealed differences in the genomes and overall regulation of genes between the two E. coli strains. A wider arsenal of genes related to oxidative stress, cellular repair and protective mechanisms were upregulated in E. coli PI-7. Subpopulations of E. coli PI-7 expressed genes related to dormancy and persister cell formation during the late decay phase, which may have accounted for its prolonged persistence. Upon prolonged solar irradiation, both E. coli strains displayed upregulation of genes related to horizontal gene transfer and antibiotic resistance. Virulence functions unique to E. coli PI-7 were also upregulated. Our findings collectively indicated that, whereas solar irradiation is able to reduce total cell numbers, viable E. coli remained and expressed genes that enable survival despite solar treatment. There remains a need for heightened levels of concern regarding risks arising from the dissemination of E. coli that may remain viable in wastewater after solar irradiation.

  16. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  17. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2015-03-01

    Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  18. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

    Science.gov (United States)

    Meloni, Domenico

    2015-03-12

    The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  19. Reduced host cell invasiveness and oxidative stress tolerance in double and triple csp gene family deletion mutants of Listeria monocytogenes.

    Science.gov (United States)

    Loepfe, Chantal; Raimann, Eveline; Stephan, Roger; Tasara, Taurai

    2010-07-01

    The cold shock protein (Csp) family comprises small, highly conserved proteins that bind nucleic acids to modulate various bacterial gene expressions. In addition to cold adaptation functions, this group of proteins is thought to facilitate various cellular processes to promote normal growth and stress adaptation responses. Three proteins making up the Listeria monocytogenes Csp family (CspA, CspB, and CspD) promote both cold and osmotic stress adaptation functions in this bacterium. The contribution of these three Csps in the host cell invasion processes of L. monocytogenes was investigated based on human Caco-2 and murine macrophage in vitro cell infection models. The DeltacspB, DeltacspD, DeltacspAB, DeltacspAD, DeltacspBD, and DeltacspABD strains were all significantly impaired in Caco-2 cell invasion compared with the wild-type strain, whereas in the murine macrophage infection assay only, the double (DeltacspBD) and triple (DeltacspABD) csp mutants were also significantly impaired in cell invasion compared with the wild-type strain. The DeltacspBD and DeltacspABD mutants displayed the most severely impaired invasion phenotypes. The invasion ability of these two mutant strains was also further analyzed using cold-stress-exposed organisms. In both cell infection models a significant reduction in invasiveness was observed after cold stress exposure of Listeria organisms. The negative impact of cold stress on subsequent cell invasion ability was, however, more severe in cold-sensitive csp mutants (DeltacspBD and DeltacspABD) compared with the wild type. The impaired macrophage invasion and intracellular growth of DeltacspBD and DeltacspABD also led us to examine oxidative stress resistance capacity in these two mutant strains. Both strains also displayed higher oxidative stress sensitivity relative to the wild-type strain. Our data indicate that besides cold and osmotic stress adaptation roles, Csp family proteins also promote efficient host cell invasion and

  20. Regulation of Yersina pestis Virulence by AI-2 Mediated Quorum Sensing

    Energy Technology Data Exchange (ETDEWEB)

    Segelke, B; Hok, S; Lao, V; Corzett, M; Garcia, E

    2010-03-29

    The proposed research was motivated by an interest in understanding Y. pestis virulence mechanisms and bacteria cell-cell communication. It is expected that a greater understanding of virulence mechanisms will ultimately lead to biothreat countermeasures and novel therapeutics. Y. pestis is the etiological agent of plague, the most devastating disease in human history. Y. pestis infection has a high mortality rate and a short incubation before mortality. There is no widely available and effective vaccine for Y. pestis and multi-drug resistant strains are emerging. Y. pestis is a recognized biothreat agent based on the wide distribution of the bacteria in research laboratories around the world and on the knowledge that methods exist to produce and aerosolize large amounts of bacteria. We hypothesized that cell-cell communication via signaling molecules, or quorum sensing, by Y. pestis is important for the regulation of virulence factor gene expression during host invasion, though a causative link had never been established. Quorum sensing is a mode of intercellular communication which enables orchestration of gene expression for many bacteria as a function of population density and available evidence suggests there may be a link between quorum sensing and regulation of Y. pesits virulence. Several pathogenic bacteria have been shown to regulate expression of virulence factor genes, including genes encoding type III secretion, via quorum sensing. The Y. pestis genome encodes several cell-cell signaling pathways and the interaction of at least three of these are thought to be involved in one or more modes of host invasion. Furthermore, Y. pestis gene expression array studies carried out at LLNL have established a correlation between expression of known virulence factors and genes involved in processing of the AI-2 quorum sensing signal. This was a basic research project that was intended to provide new insights into bacterial intercellular communication and how it is

  1. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  2. Enhanced Control of Listeria monocytogenes by Enterococcus faecium KE82, a Multiple Enterocin-Producing Strain, in Different Milk Environments.

    Science.gov (United States)

    Vandera, Elpiniki; Lianou, Alexandra; Kakouri, Athanasia; Feng, Jinbo; Koukkou, Anna-Irini; Samelis, John

    2017-01-01

    Enterococcus faecium KE82, isolated from traditional Greek Graviera cheese, was identified in pure broth cultures in vitro as a multiple enterocin-producing bacterial strain possessing the structural entA, entB, and entP enterocin genes. E. faecium KE82 was further assessed for in situ antilisterial activity in raw milk (RM) and commercially thermized milk (TM; 63°C for 30 s) in the presence of the indigenous microbiota and in sterile raw milk (SRM; 121°C for 5 min) with or without the addition of two commercial starter culture (CSC) strains Streptococcus thermophilus and Lactococcus lactis . Growth of Listeria monocytogenes was completely inhibited in RM incubated at 37°C for 6 h, whereas the pathogen was significantly inactivated in RM+KE82 samples during further incubation at 18°C for 66 h. In contrast, L. monocytogenes levels increased by approximately 2 log CFU/ml in TM, but in TM+KE82 samples, pathogen growth was retarded during the first 6 h at 37°C followed by growth cessation and partial inactivation at 18°C. After 48 to 72 h, growth of L. monocytogenes in SRM+CSC samples decreased by 4 to 5 log CFU/ml compared with the SRM control, whereas additional 10-fold decreases in the pathogen were observed in SRM+CSC+KE82 samples. Reverse transcription PCR analysis of SRM+KE82 and SRM+CSC+KE82 samples confirmed that the entA and entB genes were transcribed, but entP gene transcription was not detected. All RM and SRM samples inoculated with E. faecium KE82 displayed strong in situ inhibitory activity against L. monocytogenes in well diffusion bioassays, whereas activity was weaker to undetectable in comparable or additional TM+KE82 samples; no milk sample without E. faecium KE82 had activity against L. monocytogenes . The findings of this study indicate that E. faecium KE82 is an antilisterial agent that could be used in traditional dairy foods because it concomitantly produces enterocins A and B in situ in milk.

  3. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  4. Stress Survival Islet 2, Predominantly Present in Listeria monocytogenes Strains of Sequence Type 121, Is Involved in the Alkaline and Oxidative Stress Responses.

    Science.gov (United States)

    Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin

    2017-08-15

    The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation

  5. Carbon nanoparticles as detection labels in antibody microarrays. Detection of genes encoding virulence factors in Shiga toxin-producing Escherichia coli.

    NARCIS (Netherlands)

    Noguera, P.S.; Posthuma-Trumpie, G.A.; Tuil, Van M.; Wal, van der F.J.; Boer, De A.; Moers, A.P.H.A.; Amerongen, Van A.

    2011-01-01

    The present study demonstrates that carbon nanoparticles (CNPs) can be used as labels in microarrays. CNPs were used in nucleic acid microarray immunoassays (NAMIAs) for the detection of different Shiga toxin-producing Escherichia coli (STEC) virulence factors: four genes specific for STEC (vt1,

  6. Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes

    Energy Technology Data Exchange (ETDEWEB)

    Lowden, Michael J.; Skorupski, Karen; Pellegrini, Maria; Chiorazzo, Michael G.; Taylor, Ronald K.; Kull, F. Jon (Dartmouth)

    2010-03-04

    Cholera is an acute intestinal infection caused by the bacterium Vibrio cholerae. In order for V. cholerae to cause disease, it must produce two virulence factors, the toxin-coregulated pilus (TCP) and cholera toxin (CT), whose expression is controlled by a transcriptional cascade culminating with the expression of the AraC-family regulator, ToxT. We have solved the 1.9 {angstrom} resolution crystal structure of ToxT, which reveals folds in the N- and C-terminal domains that share a number of features in common with AraC, MarA, and Rob as well as the unexpected presence of a buried 16-carbon fatty acid, cis-palmitoleate. The finding that cis-palmitoleic acid reduces TCP and CT expression in V. cholerae and prevents ToxT from binding to DNA in vitro provides a direct link between the host environment of V. cholerae and regulation of virulence gene expression.

  7. Reconstruction of the metabolic network of Pseudomonas aeruginosa to interrogate virulence factor synthesis

    DEFF Research Database (Denmark)

    Bartell, Jennifer; Blazier, Anna S; Yen, Phillip

    2017-01-01

    Virulence-linked pathways in opportunistic pathogens are putative therapeutic targets that may be associated with less potential for resistance than targets in growth-essential pathways. However, efficacy of virulence-linked targets may be affected by the contribution of virulence-related genes t...

  8. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

    Science.gov (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

    2014-09-01

    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Analysis of Transcriptional Signatures in Response to Listeria monocytogenes Infection Reveals Temporal Changes That Result from Type I Interferon Signaling

    Science.gov (United States)

    Potempa, Krzysztof; Graham, Christine M.; Moreira-Teixeira, Lucia; McNab, Finlay W.; Howes, Ashleigh; Stavropoulos, Evangelos; Pascual, Virginia; Banchereau, Jacques; Chaussabel, Damien; O’Garra, Anne

    2016-01-01

    Analysis of the mouse transcriptional response to Listeria monocytogenes infection reveals that a large set of genes are perturbed in both blood and tissue and that these transcriptional responses are enriched for pathways of the immune response. Further we identified enrichment for both type I and type II interferon (IFN) signaling molecules in the blood and tissues upon infection. Since type I IFN signaling has been reported widely to impair bacterial clearance we examined gene expression from blood and tissues of wild type (WT) and type I IFNαβ receptor-deficient (Ifnar1-/-) mice at the basal level and upon infection with L. monocytogenes. Measurement of the fold change response upon infection in the absence of type I IFN signaling demonstrated an upregulation of specific genes at day 1 post infection. A less marked reduction of the global gene expression signature in blood or tissues from infected Ifnar1-/- as compared to WT mice was observed at days 2 and 3 after infection, with marked reduction in key genes such as Oasg1 and Stat2. Moreover, on in depth analysis, changes in gene expression in uninfected mice of key IFN regulatory genes including Irf9, Irf7, Stat1 and others were identified, and although induced by an equivalent degree upon infection this resulted in significantly lower final gene expression levels upon infection of Ifnar1-/- mice. These data highlight how dysregulation of this network in the steady state and temporally upon infection may determine the outcome of this bacterial infection and how basal levels of type I IFN-inducible genes may perturb an optimal host immune response to control intracellular bacterial infections such as L. monocytogenes. PMID:26918359

  10. Antimicrobial resistance, virulence, and phylogenetic characteristics of Escherichia coli isolates from clinically healthy swine.

    Science.gov (United States)

    Lay, Khin Khin; Koowattananukul, Chailai; Chansong, Nisit; Chuanchuen, Rungtip

    2012-11-01

    A total of 344 commensal Escherichia coli isolates from clinically healthy pigs were examined for antimicrobial resistance phenotypes, class 1 integrons, resistance genes, virulence gene profile, and phylogenetic groups. The majority of E. coli isolates were resistant to tetracycline (96.2%) and ampicillin (91.6%). Up to 98% were multidrug resistant. Seventy-three percent of the isolates carried class 1 integrons. Inserted-gene cassette arrays in variable regions included incomplete sat, aadA22, aadA1, dfrA12-aadA2, and sat-psp-aadA2, of which the aadA2 gene cassette was most prevalent (42.9%). Horizontal transfer was detected in eight E. coli isolates carrying class 1 integrons with dfrA12-aadA2 gene cassette array. Sixteen resistance genes were identified among the E. coli isolates with corresponding resistance phenotype. Ten virulence genes (including elt, estA, estB, astA, faeG, fasA, fedA, eaeA, paa, and sepA) were detected, of which fasA was most commonly found (98.3%). Most of the E. coli isolates belonged to phylogenetic group B1. Significantly positive associations were observed between some virulence genes and some resistance phenotypes and genotypes (p antimicrobial resistance-encoding genes and virulence determinants.

  11. SOLiD sequencing of four Vibrio vulnificus genomes enables comparative genomic analysis and identification of candidate clade-specific virulence genes

    Directory of Open Access Journals (Sweden)

    Telonis-Scott Marina

    2010-09-01

    Full Text Available Abstract Background Vibrio vulnificus is the leading cause of reported death from consumption of seafood in the United States. Despite several decades of research on molecular pathogenesis, much remains to be learned about the mechanisms of virulence of this opportunistic bacterial pathogen. The two complete and annotated genomic DNA sequences of V. vulnificus belong to strains of clade 2, which is the predominant clade among clinical strains. Clade 2 strains generally possess higher virulence potential in animal models of disease compared with clade 1, which predominates among environmental strains. SOLiD sequencing of four V. vulnificus strains representing different clades (1 and 2 and biotypes (1 and 2 was used for comparative genomic analysis. Results Greater than 4,100,000 bases were sequenced of each strain, yielding approximately 100-fold coverage for each of the four genomes. Although the read lengths of SOLiD genomic sequencing were only 35 nt, we were able to make significant conclusions about the unique and shared sequences among the genomes, including identification of single nucleotide polymorphisms. Comparative analysis of the newly sequenced genomes to the existing reference genomes enabled the identification of 3,459 core V. vulnificus genes shared among all six strains and 80 clade 2-specific genes. We identified 523,161 SNPs among the six genomes. Conclusions We were able to glean much information about the genomic content of each strain using next generation sequencing. Flp pili, GGDEF proteins, and genomic island XII were identified as possible virulence factors because of their presence in virulent sequenced strains. Genomic comparisons also point toward the involvement of sialic acid catabolism in pathogenesis.

  12. Type VI Secretion is a Major Virulence Determinant in Burkholderia Mallei

    National Research Council Canada - National Science Library

    Schell, Mark A; Ulrich, Ricky L; Ribot, Wilson J; Brueggemann, Ernst E; Hines, Harry B; Chen, Dan; Lipscomb, Lyla; Kim, H. S; Mrazek, Jan; Nierman, William C; DeShazer, David

    2007-01-01

    Burkholderia mallei is a host-adapted pathogen and a category B biothreat agent. Although the B. mallei VirAG two-component regulatory system is required for virulence in hamsters, the virulence genes it regulates are unknown...

  13. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  14. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba

    2013-09-01

    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  15. Quorum-sensing regulators control virulence gene expression in Vibrio cholerae

    OpenAIRE

    Zhu, Jun; Miller, Melissa B.; Vance, Russell E.; Dziejman, Michelle; Bassler, Bonnie L.; Mekalanos, John J.

    2002-01-01

    The production of virulence factors including cholera toxin and the toxin-coregulated pilus in the human pathogen Vibrio cholerae is strongly influenced by environmental conditions. The well-characterized ToxR signal transduction cascade is responsible for sensing and integrating the environmental information and controlling the virulence regulon. We show here that, in addition to the known components of the ToxR signaling circuit, quorum-sensing regulators are involved in regulation of V. ch...

  16. Relationship between oviposition, virulence gene expression and parasitism success in Cotesia typhae nov. sp. parasitoid strains.

    Science.gov (United States)

    Benoist, R; Chantre, C; Capdevielle-Dulac, C; Bodet, M; Mougel, F; Calatayud, P A; Dupas, S; Huguet, E; Jeannette, R; Obonyo, J; Odorico, C; Silvain, J F; Le Ru, B; Kaiser, L

    2017-12-01

    Studying mechanisms that drive host adaptation in parasitoids is crucial for the efficient use of parasitoids in biocontrol programs. Cotesia typhae nov. sp. (Fernández-Triana) (Hymenoptera: Braconidae) is a newly described parasitoid of the Mediterranean corn borer Sesamia nonagrioides (Lefebvre) (Lepidoptera: Noctuidae). Braconidae are known for their domesticated bracovirus, which is injected with eggs in the host larva to overcome its resistance. In this context, we compared reproductive success traits of four Kenyan strains of C. typhae on a French and a Kenyan populations of its host. Differences were found between the four strains and the two most contrasted ones were studied more thoroughly on the French host population. Parasitoid offspring size was correlated with parasitism success and the expression of bracovirus virulence genes (CrV1 and Cystatin) in the host larva after parasitism. Hybrids between these two parasitoid strains showed phenotype and gene expression profiles similar to the most successful parental strain, suggesting the involvement of dominant alleles in the reproductive traits. Ovary dissections revealed that the most successful strain injected more eggs in a single host larva than the less successful one, despite an equal initial ovocyte number in ovaries. It can be expected that the amount of viral particles increase with the number of eggs injected. The ability to bypass the resistance of the allopatric host may in consequence be related to the oviposition behaviour (eggs allocation). The influence of the number of injected eggs on parasitism success and on virulence gene expression was evaluated by oviposition interruption experiments.

  17. Frequency of virulence genes of Escherichia coli among newborn piglets from an intensive pig farm in Argentina Frecuencia de genes de virulencia de Escherichia coli en lechones neonatos de un criadero intensivo de Argentina

    Directory of Open Access Journals (Sweden)

    Fabrisio E Alustiza

    2012-12-01

    Full Text Available The enterotoxigenic and porcine enteropathogenic Escherichia coli (ETEC and PEPEC strains are agents associated with swine neonatal diarrhea, causing economic losses in swine production. The main goal of this study was to identify virulence genes of ETEC, verotoxigenic (VTEC and PEPEC in intestinal strains responsible for swine diseases, by molecular typing using PCR in newborn piglets from an intensive farm system. Two hundred and sixty seven rectal swabbings from 7-15 days- old Landrace x Large White crossbred piglets were taken, and 123 randomly selected samples, biochemically compatible with E. coli, were tested for E. coli virulence genes by PCR. A frequency (% compatible with: 68 ETEC, 24 VTEC, and 8 EPEc were found. Of all E. coli strains studied, 19.51 % carried at least one virulence gene. These data showed conclusively that, in spite of the application of strict sanitary measures in the intensive farm, genes encoding virulence factors of intestinal pathogens compatible with ETEC are still dETECted; therefore these strains will probably keep circulating among animals.El objetivo del trabajo fue identificar genes de virulencia de cepas intestinales de Escherichia coli de los grupos enterotoxigénico (ETEC, verotoxigénico (VTEC y enteropatogénico porcino (PEPEC, responsables de patologías en cerdos, mediante tipificación molecular por PCR. Para ello se trabajó en un criadero intensivo, donde se tomaron 267 hisopados rectales de lechones cruza Landrace por Large White de 7-15 días de edad. Del total de aislamientos obtenidos se seleccionaron al azar 123 de ellos, bioquímicamente compatibles con E. coli, los que fueron analizados por PCR. La frecuencia de genes compatibles con ETEC, VTEC y PEPEC fue de 68 %, 24 % y 8 %, respectivamente. De las cepas de E. coli seleccionadas, el 19,51 % portaban al menos un gen codificante de un factor de virulencia. Estos hallazgos muestran de manera concluyente que la aplicación de estrictas

  18. The Listeria monocytogenes Bile Stimulon under Acidic Conditions Is Characterized by Strain-Specific Patterns and the Upregulation of Motility, Cell Wall Modification Functions, and the PrfA Regulon

    Science.gov (United States)

    Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.

    2018-01-01

    Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736

  19. Population structure and virulence gene profiles of Streptococcus agalactiae collected from different hosts worldwide.

    Science.gov (United States)

    Morach, Marina; Stephan, Roger; Schmitt, Sarah; Ewers, Christa; Zschöck, Michael; Reyes-Velez, Julian; Gilli, Urs; Del Pilar Crespo-Ortiz, María; Crumlish, Margaret; Gunturu, Revathi; Daubenberger, Claudia A; Ip, Margaret; Regli, Walter; Johler, Sophia

    2018-03-01

    Streptococcus agalactiae is a leading cause of morbidity and mortality among neonates and causes severe infections in pregnant women and nonpregnant predisposed adults, in addition to various animal species worldwide. Still, information on the population structure of S. agalactiae and the geographical distribution of different clones is limited. Further data are urgently needed to identify particularly successful clones and obtain insights into possible routes of transmission within one host species and across species borders. We aimed to determine the population structure and virulence gene profiles of S. agalactiae strains from a diverse set of sources and geographical origins. To this end, 373 S. agalactiae isolates obtained from humans and animals from five different continents were typed by DNA microarray profiling. A total of 242 different S. agalactiae strains were identified and further analyzed. Particularly successful clonal lineages, hybridization patterns, and strains were identified that were spread across different continents and/or were present in more than one host species. In particular, several strains were detected in both humans and cattle, and several canine strains were also detected in samples from human, bovine, and porcine hosts. The findings of our study suggest that although S. agalactiae is well adapted to various hosts including humans, cattle, dogs, rodents, and fish, interspecies transmission is possible and occurs between humans and cows, dogs, and rabbits. The virulence and resistance gene profiles presented enable new insights into interspecies transmission and make a crucial contribution to the identification of suitable targets for therapeutic agents and vaccines.

  20. Methicillin-resistant Staphylococcus aureus in cows with mastitis, the presence of the mecA gene and the gene for virulence

    Directory of Open Access Journals (Sweden)

    Vesna Jaki Tkalec

    2015-11-01

    Full Text Available The physiological properties of 47 Staphylococcus aureus strains were investigated. The test strains were grown on bacteriological media and identified by the ID32 STAF system for biochemical identification of bacteria. Sensitivity to antimicrobial agents was performed by the disc diffusion method. The nuc gene and the virulence factors coa, hla, hlb, hld, hlg, hlg-2, tst, eta, etb, lukF-PV and lukS-PV and mecA gene were detected by the polymerase chain reaction. Furthermore, the spa type of the studied isolates was also set. According to the obtained results, all strains had the nuc, coa, hla and hld gene. Ten strains (21.3 % had also the tst gene, while 37 strains (78.7 % had the hlg gene and 35 strains (74.5 % had the hlb and hlg-2 genes. All of the investigated S. aureus isolates were penicillin resistant (100 %, with 29 strains which were also resistant to oxacillin (61.7 %. Methicillin (oxacillin resistance was detected by the mecA gene detection, which is also the first MRSA result from the secretion samples of cows’ mammary glands in Croatia. The researched MRSA strains proved to belong to different spa types, and the most common were spa types t005, t011 and t521, and a new spa type t9498 was detected.

  1. Sporangiospore size dimorphism is linked to virulence of Mucor circinelloides.

    Science.gov (United States)

    Li, Charles H; Cervantes, Maria; Springer, Deborah J; Boekhout, Teun; Ruiz-Vazquez, Rosa M; Torres-Martinez, Santiago R; Heitman, Joseph; Lee, Soo Chan

    2011-06-01

    Mucor circinelloides is a zygomycete fungus and an emerging opportunistic pathogen in immunocompromised patients, especially transplant recipients and in some cases otherwise healthy individuals. We have discovered a novel example of size dimorphism linked to virulence. M. circinelloides is a heterothallic fungus: (+) sex allele encodes SexP and (-) sex allele SexM, both of which are HMG domain protein sex determinants. M. circinelloides f. lusitanicus (Mcl) (-) mating type isolates produce larger asexual sporangiospores that are more virulent in the wax moth host compared to (+) isolates that produce smaller less virulent sporangiospores. The larger sporangiospores germinate inside and lyse macrophages, whereas the smaller sporangiospores do not. sexMΔ mutants are sterile and still produce larger virulent sporangiospores, suggesting that either the sex locus is not involved in virulence/spore size or the sexP allele plays an inhibitory role. Phylogenetic analysis supports that at least three extant subspecies populate the M. circinelloides complex in nature: Mcl, M. circinelloides f. griseocyanus, and M. circinelloides f. circinelloides (Mcc). Mcc was found to be more prevalent among clinical Mucor isolates, and more virulent than Mcl in a diabetic murine model in contrast to the wax moth host. The M. circinelloides sex locus encodes an HMG domain protein (SexP for plus and SexM for minus mating types) flanked by genes encoding triose phosphate transporter (TPT) and RNA helicase homologs. The borders of the sex locus between the three subspecies differ: the Mcg sex locus includes the promoters of both the TPT and the RNA helicase genes, whereas the Mcl and Mcc sex locus includes only the TPT gene promoter. Mating between subspecies was restricted compared to mating within subspecies. These findings demonstrate that spore size dimorphism is linked to virulence of M. circinelloides species and that plasticity of the sex locus and adaptations in pathogenicity have

  2. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  3. ICESag37, a Novel Integrative and Conjugative Element Carrying Antimicrobial Resistance Genes and Potential Virulence Factors in Streptococcus agalactiae.

    Science.gov (United States)

    Zhou, Kaixin; Xie, Lianyan; Han, Lizhong; Guo, Xiaokui; Wang, Yong; Sun, Jingyong

    2017-01-01

    ICE Sag37 , a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae . Two clinical strains of S. agalactiae , Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. Sma I-PFGE revealed a new Sma I fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICE Sag37 , which was characterized using several molecular methods and in silico analyses. ICE Sag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae . Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA , which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICE Sag37 carried genes for resistance to multiple antibiotics, including erythromycin [ erm(B) ], tetracycline [ tet(O) ], and aminoglycosides [ aadE, aphA , and ant(6) ]. Potential virulence factors, including a two-component signal transduction system ( nisK/nisR ), were also observed in ICE Sag37 . S1-PFGE analysis ruled out the existence of plasmids. ICE Sag37 is the first ICE Sa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae .

  4. Characterisation of virulence genes in methicillin susceptible and resistant Staphylococcus aureus isolates from a paediatric population in a university hospital of Medellín, Colombia

    OpenAIRE

    Jiménez,Judy Natalia; Ocampo,Ana María; Vanegas,Johanna Marcela; Rodríguez,Erika Andrea; Garcés,Carlos Guillermo; Patiño,Luz Adriana; Ospina,Sigifredo; Correa,Margarita María

    2011-01-01

    Virulence and antibiotic resistance are significant determinants of the types of infections caused by Staphylococcus aureus and paediatric groups remain among the most commonly affected populations. The goal of this study was to characterise virulence genes of methicillin-susceptible S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) strains isolated from a paediatric population of a Colombian University Hospital during 2009. Sixty MSSA and MRSA isolates were obtained from paediatric...

  5. A Zinc-Finger-Family Transcription Factor, AbVf19, Is Required for the Induction of a Gene Subset Important for Virulence in Alternaria brassicicola

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Akhil [Univ. of Hawaii, Manoa, HI (United States); Ohm, Robin A. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Oxiles, Lindsay [Univ. of Hawaii, Manoa, HI (United States); Brooks, Fred [Univ. of Hawaii, Manoa, HI (United States); Lawrence, Christopher B. [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Grigoriev, Igor V. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Cho, Yangrae [Univ. of Hawaii, Manoa, HI (United States)

    2011-10-26

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen with a broad host range within the family Brassicaceae. It produces secondary metabolites that marginally affect virulence. Cell wall degrading enzymes (CDWE) have been considered important for pathogenesis but none of them individually have been identified as significant virulence factors in A. brassicicola. In this study, knockout mutants of a gene, AbVf19, were created and produced considerably smaller lesions than the wild type on inoculated host plants. The presence of tandem zinc-finger domains in the predicted amino acid sequence and nuclear localization of AbVf19- reporter protein suggested that it was a transcription factor. Gene expression comparisons using RNA-seq identified 74 genes being downregulated in the mutant during a late stage of infection. Among the 74 downregulated genes, 28 were putative CWDE genes. These were hydrolytic enzyme genes that composed a small fraction of genes within each family of cellulases, pectinases, cutinases, and proteinases. The mutants grew slower than the wild type on an axenic medium with pectin as a major carbon source. This study demonstrated the existence and the importance of a transcription factor that regulates a suite of genes that are important for decomposing and utilizing plant material during the late stage of plant infection.

  6. Uptake and Metabolism of Antibiotics Roseoflavin and 8-Demethyl-8-Aminoriboflavin in Riboflavin-Auxotrophic Listeria monocytogenes.

    Science.gov (United States)

    Matern, Andreas; Pedrolli, Danielle; Großhennig, Stephanie; Johansson, Jörgen; Mack, Matthias

    2016-12-01

    The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are produced by the bacteria Streptomyces davawensis and Streptomyces cinnabarinus Riboflavin analogs have the potential to be used as broad-spectrum antibiotics, and we therefore studied the metabolism of riboflavin (vitamin B 2 ), RoF, and AF in the human pathogen Listeria monocytogenes, a bacterium which is a riboflavin auxotroph. We show that the L. monocytogenes protein Lmo1945 is responsible for the uptake of riboflavin, RoF, and AF. Following import, these flavins are phosphorylated/adenylylated by the bifunctional flavokinase/flavin adenine dinucleotide (FAD) synthetase Lmo1329 and adenylylated by the unique FAD synthetase Lmo0728, the first monofunctional FAD synthetase to be described in bacteria. Lmo1329 generates the cofactors flavin mononucleotide (FMN) and FAD, whereas Lmo0728 produces FAD only. The combined activities of Lmo1329 and Lmo0728 are responsible for the intracellular formation of the toxic cofactor analogs roseoflavin mononucleotide (RoFMN), roseoflavin adenine dinucleotide (RoFAD), 8-demethyl-8-aminoriboflavin mononucleotide (AFMN), and 8-demethyl-8-aminoriboflavin adenine dinucleotide (AFAD). In vivo reporter gene assays and in vitro transcription/translation experiments show that the L. monocytogenes FMN riboswitch Rli96, which controls expression of the riboflavin transport gene lmo1945, is negatively affected by riboflavin/FMN and RoF/RoFMN but not by AF/AFMN. Treatment of L. monocytogenes with RoF or AF leads to drastically reduced FMN/FAD levels. We suggest that the reduced flavin cofactor levels in combination with concomitant synthesis of inactive cofactor analogs (RoFMN, RoFAD, AFMN, and AFAD) explain why RoF and AF contribute to antibiotic activity in L. monocytogenes IMPORTANCE: The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are small molecules which are produced by Streptomyces davawensis and Streptomyces cinnabarinus

  7. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence.

    OpenAIRE

    Hube, B; Sanglard, D; Odds, F C; Hess, D; Monod, M; Schäfer, W; Brown, A J; Gow, N A

    1997-01-01

    Secreted aspartyl proteinases (Saps), encoded by a gene family with at least nine members (SAP1 to SAP9), are one of the most discussed virulence factors produced by the human pathogen Candida albicans. In order to study the role of each Sap isoenzyme in pathogenicity, we have constructed strains which harbor mutations at selected SAP genes. SAP1, SAP2, and SAP3, which are regulated differentially in vitro, were mutated by targeted gene disruption. The growth rates of all homozygous null muta...

  8. Detection of some virulence factors in Staphylococcus aureus ...

    African Journals Online (AJOL)

    Detection of some virulence factors in Staphylococcus aureus isolated from clinical and subclinical bovine mastitis in Iran. ... Mastitis is one of the common diseases of dairy cattle and an inflammatory response of the mammary glands tissue. ... and B genes, 10 samples contained agrI gene, 42 samples contained agrII gene, ...

  9. A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

    Science.gov (United States)

    Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

    2017-11-01

    Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

  10. Influence of freezing stress on morphological alteration and biofilm formation by Listeria monocytogenes: relationship with cell surface hydrophobicity and membrane fluidity.

    Science.gov (United States)

    Miladi, Hanene; Ammar, Emna; Ben Slama, Rihab; Sakly, Nawfel; Bakhrouf, Amina

    2013-11-01

    The morphological changes and adhesive property of three Listeria monocytogenes strains submitted to freezing stress (-20 °C) were studied. The atomic force micrographs showed a reduction in the cell size and an evolution to coccoid shape. The phenotypic slime production of L. monocytogenes and the expression of the adhesive gene were investigated before and after 10 months of incubation in salmon at -20°. Our results showed that after ten months, stressed stains become more adherent and able to produce slime. In addition, we noted that this pathogen presents same physiological changes to adapt to starvation conditions. The cellular fatty acids composition of adhered and floating cells of three L. monocytogenes strains was taken into consideration. The stressed strains presented different chain lengths and therefore an increase in the hydrophobicity level. Moreover, we noted that the adhesive property of L. monocytogenes strains affects the Benzalkonium chloride bacterial sensitivity which increased after biofilm formation.

  11. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  12. Identification of Salmonella typhimurium Genes Required for Colonization of the Chicken Alimentary Tract and for Virulence in Newly Hatched Chicks

    Science.gov (United States)

    Turner, Arthur K.; Lovell, Margaret A.; Hulme, Scott D.; Zhang-Barber, Li; Barrow, Paul A.

    1998-01-01

    From a collection of 2,800 Tn5-TC1 transposon mutants of Salmonella typhimurium F98, 18 that showed reduced intestinal colonization of 3-week-old chicks were identified. The sites of transposon insertion were determined for most of the mutants and included insertions in the lipopolysaccharide biosynthesis genes rfaK, rfaY, rfbK, and rfbB and the genes dksA, clpB, hupA, and sipC. In addition, identification was made of an insertion into a novel gene that encodes a protein showing similarity to the IIC component of the mannose class of phosphoenolpyruvate-carbohydrate phosphotransferase systems, which we putatively called ptsC. Transduction of most of the transposon mutations to a fresh S. typhimurium F98 genetic background and construction of defined mutations in the rfbK, dksA, hupA, sipC, and ptsC genes of S. typhimurium F98 supported the role in colonization of all but the pts locus. The virulence of the rfbK, dksA, hupA, sipC, and ptsC defined mutants and clpB and rfaY transductants in 1-day-old chicks was tested. All but the ptsC and rfaY mutants were attenuated for virulence. A number of other phenotypes associated with some of the mutations are described. PMID:9573095

  13. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany.

    Directory of Open Access Journals (Sweden)

    Jessica Joerling

    Full Text Available Swine dysentery (SD is an economically important diarrheal disease in pigs caused by different strongly hemolytic Brachyspira (B. species, such as B. hyodysenteriae, B. suanatina and B. hampsonii. Possible associations of epidemiologic data, such as multilocus sequence types (STs to virulence gene profiles and antimicrobial susceptibility are rather scarce, particularly for B. hyodysenteriae isolates from Germany. In this study, B. hyodysenteriae (n = 116 isolated from diarrheic pigs between 1990 and 2016 in Germany were investigated for their STs, susceptibility to the major drugs used for treatment of SD (tiamulin and valnemulin and genes that were previously linked with virulence and encode for hemolysins (tlyA, tlyB, tlyC, hlyA, BHWA1_RS02885, BHWA1_RS09085, BHWA1_RS04705, and BHWA1_RS02195, outer membrane proteins (OMPs (bhlp16, bhlp17.6, bhlp29.7, bhmp39f, and bhmp39h as well as iron acquisition factors (ftnA and bitC. Multilocus sequence typing (MLST revealed that 79.4% of the isolates belonged to only three STs, namely ST52 (41.4%, ST8 (12.1%, and ST112 (25.9% which have been observed in other European countries before. Another 24 isolates belonged to twelve new STs (ST113-118, ST120-123, ST131, and ST193. The temporal distribution of STs revealed the presence of new STs as well as the regular presence of ST52 over three decades (1990s-2000s. The proportion of strains that showed resistance to both tiamulin und valnemulin (39.1% varied considerably among the most frequent STs ranging from 0% (0/14 isolates resistant in ST8 isolates to 46.7% (14/30, 52.1% (25/48, and 85.7% (6/7 in isolates belonging to ST112, ST52, and ST114, respectively. All hemolysin genes as well as the iron-related gene ftnA and the OMP gene bhlp29.7 were regularly present in the isolates, while the OMP genes bhlp17.6 and bhmp39h could not be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB, BHWA1_RS02885, BHWA1_RS

  14. Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany

    Science.gov (United States)

    Joerling, Jessica; Barth, Stefanie A.; Schlez, Karen; Willems, Hermann

    2018-01-01

    Swine dysentery (SD) is an economically important diarrheal disease in pigs caused by different strongly hemolytic Brachyspira (B.) species, such as B. hyodysenteriae, B. suanatina and B. hampsonii. Possible associations of epidemiologic data, such as multilocus sequence types (STs) to virulence gene profiles and antimicrobial susceptibility are rather scarce, particularly for B. hyodysenteriae isolates from Germany. In this study, B. hyodysenteriae (n = 116) isolated from diarrheic pigs between 1990 and 2016 in Germany were investigated for their STs, susceptibility to the major drugs used for treatment of SD (tiamulin and valnemulin) and genes that were previously linked with virulence and encode for hemolysins (tlyA, tlyB, tlyC, hlyA, BHWA1_RS02885, BHWA1_RS09085, BHWA1_RS04705, and BHWA1_RS02195), outer membrane proteins (OMPs) (bhlp16, bhlp17.6, bhlp29.7, bhmp39f, and bhmp39h) as well as iron acquisition factors (ftnA and bitC). Multilocus sequence typing (MLST) revealed that 79.4% of the isolates belonged to only three STs, namely ST52 (41.4%), ST8 (12.1%), and ST112 (25.9%) which have been observed in other European countries before. Another 24 isolates belonged to twelve new STs (ST113-118, ST120-123, ST131, and ST193). The temporal distribution of STs revealed the presence of new STs as well as the regular presence of ST52 over three decades (1990s–2000s). The proportion of strains that showed resistance to both tiamulin und valnemulin (39.1%) varied considerably among the most frequent STs ranging from 0% (0/14 isolates resistant) in ST8 isolates to 46.7% (14/30), 52.1% (25/48), and 85.7% (6/7) in isolates belonging to ST112, ST52, and ST114, respectively. All hemolysin genes as well as the iron-related gene ftnA and the OMP gene bhlp29.7 were regularly present in the isolates, while the OMP genes bhlp17.6 and bhmp39h could not be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB, BHWA1_RS02885, BHWA1_RS

  15. Cycles of light and dark co-ordinate reversible colony differentiation in Listeria monocytogenes.

    Science.gov (United States)

    Tiensuu, Teresa; Andersson, Christopher; Rydén, Patrik; Johansson, Jörgen

    2013-02-01

    Recently, several light receptors have been identified in non-phototrophic bacteria, but their physiological roles still remain rather elusive. Here we show that colonies of the saprophytic bacterium Listeria monocytogenes undergo synchronized multicellular behaviour on agar plates, in response to oscillating light/dark conditions, giving rise to alternating ring formation (opaque and translucent rings). On agar plates, bacteria from opaque rings survive increased levels of reactive oxygen species (ROS), as well as repeated cycles of light and dark, better than bacteria from translucent rings. The ring formation is strictly dependent on a blue-light receptor, Lmo0799, acting through the stress-sigma factor, σ(B) . A transposon screening identified 48 mutants unable to form rings at alternating light conditions, with several of them showing a decreased σ(B) activity/level. However, some of the tested mutants displayed a varied σ(B) activity depending on which of the two stress conditions tested (light or H(2) O(2) exposure). Intriguingly, the transcriptional regulator PrfA and the virulence factor ActA were shown to be required for ring formation by a mechanism involving activation of σ(B) . All in all, this suggests a distinct pathway for Lmo0799 that converge into a common signalling pathway for σ(B) activation. Our results show that night and day cycles co-ordinate a reversible differentiation of a L. monocytogenes colony at room temperature, by a process synchronized by a blue-light receptor and σ(B) . © 2013 Blackwell Publishing Ltd.

  16. Comparative genomics and transcriptomics of Escherichia coli isolates carrying virulence factors of both enteropathogenic and enterotoxigenic E. coli.

    Science.gov (United States)

    Hazen, Tracy H; Michalski, Jane; Luo, Qingwei; Shetty, Amol C; Daugherty, Sean C; Fleckenstein, James M; Rasko, David A

    2017-06-14

    Escherichia coli that are capable of causing human disease are often classified into pathogenic variants (pathovars) based on their virulence gene content. However, disease-associated hybrid E. coli, containing unique combinations of multiple canonical virulence factors have also been described. Such was the case of the E. coli O104:H4 outbreak in 2011, which caused significant morbidity and mortality. Among the pathovars of diarrheagenic E. coli that cause significant human disease are the enteropathogenic E. coli (EPEC) and enterotoxigenic E. coli (ETEC). In the current study we use comparative genomics, transcriptomics, and functional studies to characterize isolates that contain virulence factors of both EPEC and ETEC. Based on phylogenomic analysis, these hybrid isolates are more genomically-related to EPEC, but appear to have acquired ETEC virulence genes. Global transcriptional analysis using RNA sequencing, demonstrated that the EPEC and ETEC virulence genes of these hybrid isolates were differentially-expressed under virulence-inducing laboratory conditions, similar to reference isolates. Immunoblot assays further verified that the virulence gene products were produced and that the T3SS effector EspB of EPEC, and heat-labile toxin of ETEC were secreted. These findings document the existence and virulence potential of an E. coli pathovar hybrid that blurs the distinction between E. coli pathovars.

  17. Genetic organization of ascB-dapE internalin cluster serves as a potential marker for Listeria monocytogenes sublineages IIA, IIB, and IIC.

    Science.gov (United States)

    Chen, Jianshun; Fang, Chun; Zhu, Ningyu; Lv, Yonghui; Cheng, Changyong; Bei, Yijiang; Zheng, Tianlun; Fang, Weihuan

    2012-05-01

    Listeria monocytogenes is an important foodborne pathogen that comprises four genetic lineages: I, II, III, and IV. Of these, lineage II is frequently recovered from foods and environments and responsible for the increasing incidence of human listeriosis. In this study, the phylogenetic structure of lineage II was determined through sequencing analysis of the ascB-dapE internalin cluster. Fifteen sequence types proposed by multilocus sequence typing based on nine housekeeping genes were grouped into three distinct sublineages, IIA, IIB, and IIC. Organization of the ascBdapE internalin cluster could serve as a molecular marker for these sublineages, with inlGHE, inlGC2DE, and inlC2DE for IIA, IIB, and IIC, respectively. These sublineages displayed specific genetic and phenotypic characteristics. IIA and IIC showed a higher frequency of recombination (rho/theta). However, recombination events had greater effect (r/m) on IIB, leading to its high nucleotide diversity. Moreover, IIA and IIB harbored a wider range of internalin and stress-response genes, and possessed higher nisin tolerance, whereas IIC contained the largest portion of low-virulent strains owing to premature stop codons in inlA. The results of this study indicate that IIA, IIB, and IIC might occupy different ecological niches, and IIB might have a better adaptation to a broad range of environmental niches.

  18. Antimicrobial peptide GH12 suppresses cariogenic virulence factors of Streptococcus mutans

    Science.gov (United States)

    Wang, Yufei; Wang, Xiuqing; Jiang, Wentao; Wang, Kun; Luo, Junyuan; Li, Wei; Zhou, Xuedong; Zhang, Linglin

    2018-01-01

    ABSTRACT Cariogenic virulence factors of Streptococcus mutans include acidogenicity, aciduricity, and extracellular polysaccharides (EPS) synthesis. The de novo designed antimicrobial peptide GH12 has shown bactericidal effects on S. mutans, but its interaction with virulence and regulatory systems of S. mutans remains to be elucidated. The objectives were to investigate the effects of GH12 on virulence factors of S. mutans, and further explore the function mechanisms at enzymatic and transcriptional levels. To avoid decrease in bacterial viability, we limited GH12 to subinhibitory levels. We evaluated effects of GH12 on acidogenicity of S. mutans by pH drop, lactic acid measurement and lactate dehydrogenase (LDH) assay, on aciduricity through survival rate at pH 5.0 and F1F0-ATPase assay, and on EPS synthesis using quantitative measurement, morphology observation, vertical distribution analyses and biomass calculation. Afterwards, we conducted quantitative real-time PCR to acquire the expression profile of related genes. GH12 at 1/2 MIC (4 mg/L) inhibited acid production, survival rate, EPS synthesis, and biofilm formation. The enzymatic activity of LDH and F1F0-ATPase was inhibited, and ldh, gtfBCD, vicR, liaR, and comDE genes were significantly downregulated. In conclusion, GH12 inhibited virulence factors of S. mutans, through reducing the activity of related enzymes, downregulating virulence genes, and inactivating specific regulatory systems. PMID:29503706

  19. Characterisation of the transcriptomes of genetically diverse Listeria monocytogenes exposed to hyperosmotic and low temperature conditions reveal global stress-adaptation mechanisms.

    Directory of Open Access Journals (Sweden)

    Juliana Durack

    Full Text Available The ability of Listeria monocytogenes to adapt to various food and food- processing environments has been attributed to its robustness, persistence and prevalence in the food supply chain. To improve the present understanding of molecular mechanisms involved in hyperosmotic and low-temperature stress adaptation of L. monocytogenes, we undertook transcriptomics analysis on three strains adapted to sub-lethal levels of these stress stimuli and assessed functional gene response. Adaptation to hyperosmotic and cold-temperature stress has revealed many parallels in terms of gene expression profiles in strains possessing different levels of stress tolerance. Gene sets associated with ribosomes and translation, transcription, cell division as well as fatty acid biosynthesis and peptide transport showed activation in cells adapted to either cold or hyperosmotic stress. Repression of genes associated with carbohydrate metabolism and transport as well as flagella was evident in stressed cells, likely linked to activation of CodY regulon and consequential cellular energy conservation.

  20. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia

    Directory of Open Access Journals (Sweden)

    Tze Y. Thung

    2018-01-01

    Full Text Available The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60 were randomly collected. The multiplex polymerase chain reaction (mPCR in combination with the most probable number (MPN method was employed to detect Salmonella spp., S. Enteritidis and S. Typhimurium in the meat samples. The prevalence of Salmonella spp., S. Enteritidis and S. Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of <3 to 15 MPN/g. Eight different serovars of Salmonella were identified among the 23 isolates, and S. Agona was the predominant serovar (26.09%. Interestingly, all the Salmonella isolates were resistant to penicillin, erythromycin and vancomycin, but the sensitivity was observed for tetracycline, gentamicin and amoxicillin/clavulanic acid. All 23 isolates were resistant to at least three antibiotics. Two S. Typhimurium isolates (8.70% exhibited the highest multiple antibiotic resistance (MAR index value of 0.56 which shown resistance to nine antibiotics. PCR analysis of virulence genes showed that all Salmonella isolates (100% were positive for the invA gene. Meanwhile, pefA was only identified in S. Enteritidis and S. Typhimurium. The findings in this study indicate that retail beef products tested were widely contaminated with multi-drug resistant (MDR Salmonella and various virulence genes are present among the isolated Salmonella serovars.