WorldWideScience

Sample records for monocytogenes strain scott

  1. Further Evidence of How Unbuffered Starvation at 4°C Influences Listeria monocytogenes EGD-e, HCC23, F2365, and Scott A.

    Science.gov (United States)

    Jarvis, Nathan A; O'Bryan, Corliss A; Martin, Elizabeth M; Ricke, Steven C; Johnson, Michael G; Crandall, Philip G

    2017-10-01

    The soilborne pathogen Listeria monocytogenes frequently contaminates food products and food processing environments and is able to survive desiccation, high osmotic pressures, and starvation. However, little is known about how this pathogen survives starvation at 4°C. This study provides evidence that L. monocytogenes is able to survive total nutrient starvation for 4 weeks. L. monocytogenes strains EGD-e, Scott A, F2365, and HCC23 were starved individually in sterile water. Colony counts declined over 4 weeks, with Scott A declining the most rapidly. Transmission electron microscopy images revealed degradation of starving cell membranes and altered cytosols. Starving cells were subjected to the metabolic inhibitors fluoride, arsenite, 2,4-dinitrophenol, iodoacetate, and cyanide individually. Iodoacetate, which inhibits glyceraldehyde-3-phosphate dehydrogenase, completely reduced cultivable counts below the level of detection compared with the control starving cells; 2,4-dinitrophenol, which dissipates proton motive force, almost completely reduced cultivable counts. These results suggest that L. monocytogenes strains EGD-e, Scott A, F2365, and HCC23 are actively using part of the glycolysis pathway while starving. These results suggest that starving L. monocytogenes cells retain aspects of active metabolism.

  2. The species-specific mode of action of the antimicrobial peptide subtilosin against Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Noll, K.S.; Chikindas, M.L.

    2012-01-01

    Aims: To elucidate the molecular mechanism of action of the antimicrobial peptide subtilosin against the foodborne pathogen Listeria monocytogenes Scott A. Methods and Results: Subtilosin was purified from a culture of Bacillus amylliquefaciens. The minimal inhibitory concentration of subtilosin aga

  3. Betaine and L-carnitine transport by Listeria monocytogenes Scott A in response to osmotic signals

    NARCIS (Netherlands)

    Verheul, Annette; Glaasker, Erwin; Poolman, Bert; Abee, Tjakko

    1997-01-01

    The naturally occurring compatible solutes betaine and L-carnitine allow the food-borne pathogen Listeria monocytogenes to adjust to environments of high osmotic strength. Previously, it was demonstrated that L. monocytogenes possesses an ATP-dependent L-carnitine transporter. The present study reve

  4. Betaine and L-carnitine transport by Listeria monocytogenes Scott A in response to osmotic signals

    NARCIS (Netherlands)

    Verheul, Annette; Glaasker, Erwin; Poolman, Bert; Abee, Tjakko

    1997-01-01

    The naturally occurring compatible solutes betaine and L-carnitine allow the food-borne pathogen Listeria monocytogenes to adjust to environments of high osmotic strength. Previously, it was demonstrated that L. monocytogenes possesses an ATP-dependent L-carnitine transporter. The present study

  5. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  6. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation.

  7. A processing plant persistent strain of Listeria monocytogenes crosses the fetoplacental barrier in a pregnant guinea pig model

    DEFF Research Database (Denmark)

    Jensen, Anne; Williams, D.; Irving, E. A.;

    2008-01-01

    independent fish processing plants. The purpose of the present study was to determine the virulence potential of one RAPD type 9 strain (La111), one human clinical strain (Scott A), and one monkey clinical strain (12443) in a pregnant guinea pig model. Animals were orally exposed to 10(8) CFU of L...... was isolated from 16 and 20% of placentas for 12443 and La111, respectively. The study demonstrates that a food processing plant persistent strain of L. monocytogenes is able to cross the fetoplacental barrier in pregnant guinea pigs. Furthermore, we demonstrate that although information can be gained from...

  8. Quantifying strain variability in modeling growth of Listeria monocytogenes

    NARCIS (Netherlands)

    Aryani, D.; Besten, den H.M.W.; Hazeleger, W.C.; Zwietering, M.H.

    2015-01-01

    Prediction of microbial growth kinetics can differ from the actual behavior of the target microorganisms. In the present study, the impact of strain variability on maximum specific growth rate (µmax) (h- 1) was quantified using twenty Listeria monocytogenes strains. The µmax was determined as functi

  9. Highly Invasive Listeria monocytogenes Strains Have Growth and Invasion Advantages in Strain Competition.

    Science.gov (United States)

    Zilelidou, Evangelia A; Rychli, Kathrin; Manthou, Evanthia; Ciolacu, Luminita; Wagner, Martin; Skandamis, Panagiotis N

    2015-01-01

    Multiple Listeria monocytogenes strains can be present in the same food sample; moreover, infection with more than one L. monocytogenes strain can also occur. In this study we investigated the impact of strain competition on the growth and in vitro virulence potential of L. monocytogenes. We identified two strong competitor strains, whose growth was not (or only slightly) influenced by the presence of other strains and two weak competitor strains, which were outcompeted by other strains. Cell contact was essential for growth inhibition. In vitro virulence assays using human intestinal epithelial Caco2 cells showed a correlation between the invasion efficiency and growth inhibition: the strong growth competitor strains showed high invasiveness. Moreover, invasion efficiency of the highly invasive strain was further increased in certain combinations by the presence of a low invasive strain. In all tested combinations, the less invasive strain was outcompeted by the higher invasive strain. Studying the effect of cell contact on in vitro virulence competition revealed a complex pattern in which the observed effects depended only partially on cell-contact suggesting that competition occurs at two different levels: i) during co-cultivation prior to infection, which might influence the expression of virulence factors, and ii) during infection, when bacterial cells compete for the host cell. In conclusion, we show that growth of L. monocytogenes can be inhibited by strains of the same species leading potentially to biased recovery during enrichment procedures. Furthermore, the presence of more than one L. monocytogenes strain in food can lead to increased infection rates due to synergistic effects on the virulence potential.

  10. Gene expression profiling of a nisin-sensitive Listeria monocytogenes Scott A CtsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. Nisin is the only bacteriocin that can be used as a food preservative. Due to its antimicrobial activity, it can be used to control Listeria monocytogenes in food; however, the antimicrobial mechanism of nisin ...

  11. Controlling Listeria monocytogenes Scott A on Surfaces of Fully Cooked Turkey Deli Product Using Organic Acid-Containing Marinades as Postlethality Dips.

    Science.gov (United States)

    Casco, Gerardo; Johnson, Jennifer L; Taylor, T Matthew; Gaytán, Carlos N; Brashears, Mindy M; Alvarado, Christine Z

    2015-01-01

    This study evaluated the efficacy of organic acids applied singly or in combination as postlethality dips to sliced uncured turkey deli loaves to inhibit the growth of Listeria monocytogenes (Lm) Scott A. Treatments consisted of sodium lactate (SL; 3.6%), potassium lactate (PL; 3.6%), sodium citrate (SC; 0.75%), a combination of SL and sodium diacetate (SDA; 0.25%), and a combination of SL/PL/SDA, alongside appropriate negative and positive controls. Products were inoculated with 10(4)-10(5) CFU/mL streptomycin-resistant (1500 μg/mL) Lm Scott A prior to treatment. Products were then stored at ~4°C and sampled at 0, 7, 14, 21, 28, 42, and 56 d. The SL/SDA combination applied to turkey slices extended the lag phase through 21 days of refrigerated storage. Numbers of Lm Scott A rose by 0.7 log10 CFU/g through the 56 d storage period. The application of the SL/PL/SDA treatment to turkey product surfaces extended the lag phase through 42 d, with pathogen numbers declining after 21 d. Combination organic acid dips prolonged the lag phase for 2 to 6 wk on turkey product surfaces and can be useful as antimicrobial agents for Lm control on postlethality exposed sliced deli products.

  12. Controlling Listeria monocytogenes Scott A on Surfaces of Fully Cooked Turkey Deli Product Using Organic Acid-Containing Marinades as Postlethality Dips

    Directory of Open Access Journals (Sweden)

    Gerardo Casco

    2015-01-01

    Full Text Available This study evaluated the efficacy of organic acids applied singly or in combination as postlethality dips to sliced uncured turkey deli loaves to inhibit the growth of Listeria monocytogenes (Lm Scott A. Treatments consisted of sodium lactate (SL; 3.6%, potassium lactate (PL; 3.6%, sodium citrate (SC; 0.75%, a combination of SL and sodium diacetate (SDA; 0.25%, and a combination of SL/PL/SDA, alongside appropriate negative and positive controls. Products were inoculated with 104–105 CFU/mL streptomycin-resistant (1500 μg/mL Lm Scott A prior to treatment. Products were then stored at ~4°C and sampled at 0, 7, 14, 21, 28, 42, and 56 d. The SL/SDA combination applied to turkey slices extended the lag phase through 21 days of refrigerated storage. Numbers of Lm Scott A rose by 0.7 log10 CFU/g through the 56 d storage period. The application of the SL/PL/SDA treatment to turkey product surfaces extended the lag phase through 42 d, with pathogen numbers declining after 21 d. Combination organic acid dips prolonged the lag phase for 2 to 6 wk on turkey product surfaces and can be useful as antimicrobial agents for Lm control on postlethality exposed sliced deli products.

  13. The fate of Listeria monocytogenes in brine and on Gouda cheese following artificial contamination during brining

    NARCIS (Netherlands)

    Wemmenhove, E.; Beumer, R.R.; Hooijdonk, van A.C.M.; Zwietering, M.H.; Wells-Bennik, M.H.J.

    2014-01-01

    The fate of 3 different Listeria monocytogenes strains (Scott A, 2F and 6E) was studied independently in brine and on factory-scale Gouda cheeses that had been submerged in brine that was artificially contaminated with these individual strains. Viable numbers of L. monocytogenes in the brine

  14. Genome comparison of Listeria monocytogenes serotype 4a strain HCC23 with selected lineage I and lineage II L. monocytogenes strains and other Listeria strains

    Directory of Open Access Journals (Sweden)

    Debarati Paul

    2014-12-01

    Full Text Available More than 98% of reported human listeriosis cases are caused by specific serotypes within genetic lineages I and II. The genome sequence of Listeria monocytogenes lineage III strain HCC23 (serotype 4a enables whole genomic comparisons across all three L. monocytogenes lineages. Protein cluster analysis indicated that strain HCC23 has the most unique protein pairs with nonpathogenic species Listeria innocua. Orthology analysis of the genome sequences of representative strains from the three L. monocytogenes genetic lineages and L. innocua (CLIP11262 identified 319 proteins unique to nonpathogenic strains HCC23 and CLIP11262 and 58 proteins unique to pathogenic strains F2365 and EGD-e. BLAST comparison of these proteins with all the sequenced L. monocytogenes and L. innocua revealed 126 proteins unique to serotype 4a and/or L. innocua; 14 proteins were only found in pathogenic serotypes. Some of the 58 proteins unique to pathogenic strains F2365 and EGD-e were previously published and are already known to contribute to listerial virulence.

  15. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that wer

  16. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  17. Bias in the Listeria monocytogenes enrichment procedure: Lineage 2 strains outcompete lineage 1 strains in University of Vermont selective enrichments

    DEFF Research Database (Denmark)

    Bruhn, Jesper Bartholin; Vogel, Birte Fonnesbech; Gram, Lone

    2005-01-01

    Listeria monocytogenes can be isolated from a range of food products and may cause food-borne outbreaks or sporadic cases of listeriosis. L. monocytogenes is divided into three genetic lineages and 13 serotypes. Strains of three serotypes (1/2a, 1/2b, and 4b) are associated with most human cases...... of listeriosis. Of these, strains of serotypes 1/2b and 4b belong to lineage 1, whereas strains of serotype 1/2a and many other strains isolated from foods belong to lineage 2. L. monocytogenes is isolated from foods by selective enrichment procedures and from patients by nonselective methods. The aim......, as lineage 1 strains, which are often isolated from clinical cases of listeriosis, may be suppressed during enrichment by other L. monocytogenes lineages present in a food sample...

  18. Effects of bilimbi (Averrhoa bilimbi L.) and tamarind (Tamarindus indica L.) juice on Listeria monocytogenes Scott A and Salmonella Typhimurium ATCC 14028 and the sensory properties of raw shrimps.

    Science.gov (United States)

    Norhana, M N Wan; Azman, Mohd Nor A; Poole, Susan E; Deeth, Hilton C; Dykes, Gary A

    2009-11-30

    The potential of using juice of bilimbi (Averrhoa bilimbi L.) and tamarind (Tamarindus indica L.) to reduce Listeria monocytogenes Scott A and Salmonella Typhimurium ATCC 14028 populations on raw shrimps after washing and during storage (4 degrees C) was investigated. The uninoculated raw shrimps and those inoculated with approximately 9 log cfu/ml of L. monocytogenes Scott A and S. Typhimurium ATCC 14028 were washed (dipped or rubbed) in distilled water (SDW) (control), bilimbi or tamarind juice at 1:4 (w/v) concentrations for 10 and 5 min. Naturally occurring aerobic bacteria (APC), L. monocytogenes Scott A and S. Typhimurium ATCC 14028 counts, pH values and sensory analysis of washed shrimps were determined immediately after washing (day 0), and on days 3 and 7 of storage. Compared to SDW, bilimbi and tamarind juice significantly (p0.05) throughout the storage except for odour (plemony smell was noticed in bilimbi- and tamarind-washed shrimps and not in control shrimps.

  19. Thermal resistance of Listeria monocytogenes Scott A in ultrafiltered milk as related to the effect of different milk components.

    Science.gov (United States)

    Szlachta, Kinga; Keller, Susanne E; Shazer, Arlette; Chirtel, Stuart

    2010-11-01

    Pasteurization parameters for grade A milk are well established and set by regulation. However, as solids levels increase, an increased amount of heat is required to destroy any pathogens present. This effect is not well characterized. In this work, the effect of increased dairy solids levels on the thermal resistance of Listeria monocytogenes was examined through the use of ultrafiltered (UF) milk, reconstituted milk powder, and the milk components lactose and caseinate. From the results obtained, lactose and caseinate did not appear to affect thermal resistance. In addition, the level of milk fat, up to 10% of the total solids in UF whole milk, did not result in statistically significant changes to thermal resistance when compared with UF skim milk. Reconstituted skim milk powder at 27% total solids (D⁶²-value = 1.16 ± 0.2 [SD] min, z = 5.7) did result in increased thermal resistance, as compared with reconstituted skim milk powder at 17.5% (D⁶²-value = 0.86 ± 0.02 min, z = 5.57) and UF whole milk at 27% total solids (D⁶²-value = 0.66 ± 0.07 min, z = 5.16). However, that increase appeared to be due to the increase in salt levels, not to increases in caseinate, fat, or lactose. Consequently, total solids, as a single measure, could not be used to predict increased thermal resistance of L. monocytogenes in concentrated milk.

  20. Listeriosis outbreak in dairy cattle caused by an unusual Listeria monocytogenes serotype 4b strain.

    Science.gov (United States)

    Bundrant, Brittany N; Hutchins, Tony; den Bakker, Henk C; Fortes, Esther; Wiedmann, Martin

    2011-01-01

    A listeriosis outbreak, in dairy cattle, with a high case mortality and acute death after onset of symptoms was investigated using gross pathology and bacteriologic approaches, including molecular characterization of a clinical Listeria monocytogenes isolate. In a herd of 315 animals, 9 animals showed clinical symptoms consistent with listeriosis, including 3 animals that died within 2-4 days after acute onset of clinical signs, 4 animals that were euthanized, and 2 that survived. Initial EcoRI ribotyping and serotyping indicated that this outbreak was caused by an unusual L. monocytogenes serotype 4b strain, which was classified into lineage III. Further characterization of this isolate by DNA sequencing-based subtyping methods indicated that the strain responsible for this outbreak represented a unique genotype as supported by its classification into a new sigB allelic type, which has not been identified previously among >290 isolates, and by compelling phylogenetic evidence. While lineage III isolates are generally rare, they seem to be more common among L. monocytogenes isolates from animals with clinical signs of listeriosis. This is the first report of a particularly severe clinical course of disease associated with infection by a lineage III strain. The high prevalence of Listeria spp., including L. monocytogenes, in the farm environments may favor emergence and evolution of novel, and possibly more virulent, L. monocytogenes strains. Continued monitoring of animal listeriosis cases and outbreaks may not only improve animal health but also aid in the early discovery of newly emerging L. monocytogenes strains.

  1. Characterization of a Mutant Listeria monocytogenes Strain Expressing Green Fluorescent Protein

    Institute of Scientific and Technical Information of China (English)

    Ling-Li JIANG; Hou-Hui SONG; Xue-Yan CHEN; Chun-Lin KE; Jing-Jing XU; Ning CHEN; Wei-Huan FANG

    2005-01-01

    To construct a recombinant strain of Listeria monocytogenes for the expression of heterologous genes, homologous recombination was utilized for insertional mutation, targeting its listeriolysin O gene(hly). The gene encoding green fluorescent protein (GFP) was used as the indicator of heterologous gene expression. The gene gfp was inserted into hly downstream from its promoter and signal sequence by an overlapping extension polymerase chain reaction, and was then cloned into the shuttle plasmid pKSV7 for allelic exchange with the L. monocytogenes chromosome. Homologous recombination was achieved by growing the electro-transformed L. monocytogenes cells on chloramphenicol plates at a non-permissive temperature.Sequencing analysis indicated correct insertion of the target gene in-frame with the signal sequence. The recombinant strain expressed GFP constitutively as revealed by fluorescence microscopy. The mutant strain L. monocytogenes hly-gfp lost its hemolytic activity as visualized on the blood agar or when analyzed with the culture supernatant samples. Such insertional mutation resulted in a reduced virulence of about 2 logs less than its parent strain L. monocytogenes 10403s as shown by the 50%-lethal-dose assays in the mouse and embryonated chicken egg models. These results thus demonstrate that mutated L. monocytogenes could be a potential carrier for the expression of heterologous passenger genes or could act as an indicator organism in the food industry.

  2. Heat resistance of an outbreak strain of Listeria monocytogenes in hot dog batter.

    Science.gov (United States)

    Mazzotta, A S; Gombas, D E

    2001-03-01

    The heat resistance of a strain of Listeria monocytogenes responsible for a listeriosis outbreak in hot dogs was not higher than the heat resistance of other L. monocytogenes strains when tested in tryptic soy broth and in laboratory-prepared hot dog batter. For the thermal death time experiments, the cells were grown to stationary phase or were starved in phosphate-buffered saline, pH 7, for 6 h at 30 degrees C. Starvation increased the heat resistance of L. monocytogenes in broth but not in hot dog batter. D-values in hot dog batter were higher than in broth. For the hot dog formulation used in this study, cooking the hot dog batter for 30 s at 71.1 degrees C (160 degrees F), or its equivalent using a z-value of 6 degrees C (11 degrees F), would inactivate 5 logs of L. monocytogenes.

  3. Growth differences and competition between Listeria monocytogenes strains determine their predominance on ham slices and lead to bias during selective enrichment with the ISO protocol.

    Science.gov (United States)

    Zilelidou, Evangelia; Manthou, Evanthia; Skandamis, Panagiotis

    2016-10-17

    Listeria monocytogenes strains are widespread in the environment where they live well mixed, often resulting in multiple strains contaminating a single food sample. The occurrence of different strains in the same food might trigger strain competition, contributing to uneven growth of strains in food and to bias during selective procedures. We tested the growth of seven L. monocytogenes strains (C5, 6179, ScottA, PL24, PL25, PL26, PL27) on ham slices and on nutrient-rich agar at 10°C, singly and in combinations. Strains were made resistant to different antibiotics for their selective enumeration. In addition, growth of single strains (axenic culture) and competition between strains in xenic cultures of two strains was evaluated in enrichment broth and on selective agar. According to ISO 11290-1:1996/Amd 1:2004 standard protocol for detection of L. monocytogenes, two enrichment steps both followed by streaking on ALOA were performed. Strain cultures were directly added in the enrichment broth or used to inoculate minced beef and sliced hams which were then mixed with enrichment broth. 180-360 colonies were used to determine the relative percentage of each strain recovered on plates per enrichment step. The data showed a significant impact of co-cultivation on the growth of six out of seven strains on ham and a bias towards certain strains during selective enrichment. Competition was manifested by: (i) cessation of growth for the outcompeted strain when the dominant strain reached stationary phase, (ii) reduction of growth rates or (iii) total suppression of growth (both on ham and in enrichment broth or ALOA). Outgrowth of strains by their competitors on ALOA resulted in limited to no recovery, with the outcompeting strain accounting for up to 100% of the total recovered colonies. The observed bias was associated with the enrichment conditions (i.e. food type added to the enrichment broth) and the strain-combination. The outcome of growth competition on food or

  4. Draft Genome Sequences of Two Historical Listeria monocytogenes Strains from Human Listeriosis Cases in 1933

    Science.gov (United States)

    Lee, Sangmi; Ward, Todd J.; Orwig, Nathane; Altermann, Eric; Jima, Dereje; Parsons, Cameron; Kathariou, Sophia

    2016-01-01

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent clonal complex 1 (CC1) and CC2. PMID:27932656

  5. Population Genetic Structure of Listeria monocytogenes Strains as Determined by Pulsed-Field Gel Electrophoresis and Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Henri, Clémentine; Félix, Benjamin; Guillier, Laurent

    2016-01-01

    Listeria monocytogenes is a ubiquitous bacterium that may cause the foodborne illness listeriosis. Only a small amount of data about the population genetic structure of strains isolated from food is available. This study aimed to provide an accurate view of the L. monocytogenes food strain...

  6. Stress survival islet 1 (SSI-1) survey in Listeria monocytogenes reveals an insert common to listeria innocua in sequence type 121 L. monocytogenes strains.

    Science.gov (United States)

    Hein, Ingeborg; Klinger, Sonja; Dooms, Maxime; Flekna, Gabriele; Stessl, Beatrix; Leclercq, Alexandre; Hill, Colin; Allerberger, Franz; Wagner, Martin

    2011-03-01

    Listeria monocytogenes strains (n = 117) were screened for the presence of stress survival islet 1 (SSI-1). SSI-1(+) strains (32.5%) belonged mainly to serotypes 1/2c, 3b, and 3c. All sequence type 121 (ST-121) strains included (n = 7) possessed homologues to Listeria innocua genes lin0464 and lin0465 instead of SSI-1.

  7. Genome sequesnce of lineage III Listeria monocytogenes strain HCC23

    Science.gov (United States)

    More than 98% of reported human listeriosis cases are caused by Listeria monocytogenes serotypes within lineages I and II. Serotypes within lineage III (4a and 4c) are commonly isolated from environmental and food specimens. We report the first complete genome sequence of a lineage III isolate, HCC2...

  8. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Science.gov (United States)

    2012-01-01

    Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99) and 4b (CLIP80459), and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence of attenuated lineages

  9. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  10. Prevalence of Listeria monocytogenes in fresh and fermented Italian sausages and ribotyping of contaminating strains.

    Science.gov (United States)

    De Cesare, Alessandra; Mioni, Renzo; Manfreda, Gerardo

    2007-11-30

    Listeria monocytogenes has been detected in fresh as well as dry and semidry fermented sausages, rendering preparation and consumption of these products as a potential risk to human health. The aims of this study were (1) to evaluate the L. monocytogenes prevalence in 288 fresh and 237 fermented sausages produced in northern Italy; (2) to quantify the average pathogen Most Probable Number (MPN) per g of sausage; (3) to evaluate the sausage strain genetic diversity by automated PvuII ribotyping; and (4) to predict the pathogenicity lineage of these isolates determining their DuPont Identification Library Codes (DUP-IDs) by EcoRI ribotyping. The overall prevalence of L. monocytogenes in the sampled sausages was 28.2%. The percentage of L. monocytogenes positive fresh sausages was significantly higher than that of fermented sausages (i.e. 38.9 vs 15.2%), which had a pathogen load always lower than 10 MPN/g. In contrast, 16.1% of fresh sausages were contaminated by 10 to 100 MPN/g and 20.5% had more than 100 MPN/g. PvuII successfully discriminated sausage isolates with a Simpson's numerical index of discrimination of 0.637. A total of 12 and 9 different PvuII ribogroups were identified among 47 fresh and 24 fermented randomly selected sausage strains, respectively. Six of those ribogroups were shared between strains contaminating both kinds of sausages. According to the evaluation of the strain DUP-IDs, the majority of the isolates investigated in this study were part of the type II L. monocytogenes pathogenicity lineage, but type I lineage strains were identified among fermented sausage isolates. In conclusion, L. monocytogenes prevalence in Italian sausages was estimated to be around 28.2%. However, 84.2% of the samples were contaminated by less than 100 MPN of L. monocytogenes per g and the majority of L. monocytogenes contaminating strains would be classified in the type II pathogenicity lineage, including serotypes 1/2a, 1/2c and 3a.

  11. Low, medium and high heat tolerant strains of Listeria monocytogenes and increased heat stress resistance after exposure to sublethal heat

    Science.gov (United States)

    Listeria monocytogenes exhibits sophisticated adaptive mechanisms to counteract higher levels of lethal acid, heat, salt or oxidative stresses after pre-exposure to sublethal concentrations of homogenous stress. A group of 37 strains representing all 13 serotypes of Listeria monocytogenes with initi...

  12. Evaluation of the antibacterial activity of bergamot essential oils on different Listeria monocytogenes strains

    Directory of Open Access Journals (Sweden)

    Stefania M. Marotta

    2016-12-01

    Full Text Available Essential oils are aromatic and volatile substances extracted from plants and characterized by antimicrobial activity. The aim of the present study was to evaluate the antibacterial activity (agar disc-diffusion method of seven different bergamot essential oils (BEOs on eight Listeria monocytogenes strains. Minimal inhibitory concentration (MIC of most efficient BEOs was estimated. Extremely variable results for agar disc-diffusion method for L. monocytogenes strains were reported. One of the tested microorganisms resulted insensible to all the BEOs; 3 strains showed an inhibition from weak to null and the remaining 4 a variable susceptibility. Among the BEOs tested, one showed a strong activity against four pathogenic strains. Four BEOs revealed weak, moderate or null activity in all the 7 sensitive strains, while for two oils only a weak or no activity was reported. MIC values were 0.625 μL/mL for the most efficient BEO, 2.5 and 5 μL/mL for the other samples that showed moderate inhibition. Experiment results are significantly related to the strains tested (P<0.01, rather than the BEO employed (P>0.01. In conclusion, we can consider BEO as a natural technological hurdle for Listeria monocytogenes in combination with other preservation strategies. Finally, this study underlines the necessity to evaluate the antimicrobial activity of EOs on a significant strains number of the same bacteria.

  13. Evaluation of the Antibacterial Activity of Bergamot Essential Oils on Different Listeria Monocytogenes Strains.

    Science.gov (United States)

    Marotta, Stefania M; Giarratana, Filippo; Parco, Alessio; Neri, Domenico; Ziino, Graziella; Giuffrida, Alessandro; Panebianco, Antonio

    2016-09-20

    Essential oils are aromatic and volatile substances extracted from plants and characterized by antimicrobial activity. The aim of the present study was to evaluate the antibacterial activity (agar disc-diffusion method) of seven different bergamot essential oils (BEOs) on eight Listeria monocytogenes strains. Minimal inhibitory concentration (MIC) of most efficient BEOs was estimated. Extremely variable results for agar disc-diffusion method for L. monocytogenes strains were reported. One of the tested microorganisms resulted insensible to all the BEOs; 3 strains showed an inhibition from weak to null and the remaining 4 a variable susceptibility. Among the BEOs tested, one showed a strong activity against four pathogenic strains. Four BEOs revealed weak, moderate or null activity in all the 7 sensitive strains, while for two oils only a weak or no activity was reported. MIC values were 0.625 μL/mL for the most efficient BEO, 2.5 and 5 μL/mL for the other samples that showed moderate inhibition. Experiment results are significantly related to the strains tested (P0.01). In conclusion, we can consider BEO as a natural technological hurdle for Listeria monocytogenes in combination with other preservation strategies. Finally, this study underlines the necessity to evaluate the antimicrobial activity of EOs on a significant strains number of the same bacteria.

  14. Outbreak investigation identifies a single Listeria monocytogenes strain in sheep with different clinical manifestations, soil and water.

    Science.gov (United States)

    Dreyer, M; Thomann, A; Böttcher, S; Frey, J; Oevermann, A

    2015-08-31

    Listeria (L.) monocytogenes causes orally acquired infections and is of major importance in ruminants. Little is known about L. monocytogenes transmission between farm environment and ruminants. In order to determine potential sources of infection, we investigated the distribution of L. monocytogenes genetic subtypes in a sheep farm during a listeriosis outbreak by applying four subtyping methods (MALDI-TOF-MS, MLST, MLVA and PFGE). L. monocytogenes was isolated from a lamb with septicemia and from the brainstem of three sheep with encephalitis. Samples from the farm environment were screened for the presence of L. monocytogenes during the listeriosis outbreak, four weeks and eight months after. L. monocytogenes was found only in soil and water tank swabs during the outbreak. Four weeks later, following thorough cleaning of the barn, as well as eight months later, L. monocytogenes was absent in environmental samples. All environmental and clinical L. monocytogenes isolates were found to be the same strain. Our results show that the outbreak involving two different clinical syndromes was caused by a single L. monocytogenes strain and that soil and water tanks were potential infection sources during this outbreak. However, silage cannot be completely ruled out as the bales fed prior to the outbreak were not available for analysis. Faeces samples were negative, suggesting that sheep did not act as amplification hosts contributing to environmental contamination. In conclusion, farm management appears to be a crucial factor for the limitation of a listeriosis outbreak.

  15. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  16. Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

    Science.gov (United States)

    Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

    2017-04-01

    Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

  17. Antibiotic susceptibility in benzalkonium chloride-resistant and -susceptible Listeria monocytogenes strains.

    Science.gov (United States)

    Ortiz, Sagrario; López, Pilar; López, Victoria; Martínez-Suárez, Joaquín V

    2014-07-01

    This study aimed to investigate whether Listeria monocytogenes strains with resistance to a commonly used biocide display any cross-resistance to antibiotics. Using pulsed-field gel electrophoresis (PFGE), 29 different PFGE types were previously identified in an Iberian pig abattoir and processing plant. Only three PFGE types were resistant to benzalkonium chloride (BAC), but they represented a significant proportion of the PFGE types surviving in the plant after 4 years. In the present study, a subset of 29 strains, representing the 29 different PFGE types, underwent antibiotic susceptibility testing. Antibiotic susceptibility was assessed by Etest, utilizing 12 commonly prescribed antibiotics. All of the 29 strains were susceptible to all of the antibiotics tested. The study revealed that this group of different PFGE types of L. monocytogenes, including those resistant to BAC, possesses uniform sensitivity to antibiotics.

  18. Role of a GntR-family response regulator LbrA in Listeria monocytogenes biofilm formation.

    Directory of Open Access Journals (Sweden)

    Andrew Wassinger

    Full Text Available The formation of Listeria monocytogenes biofilms contributes to persistent contamination in food processing facilities. A microarray comparison of L. monocytogenes between the transcriptome of the strong biofilm forming strain (Bfm(s Scott A and the weak biofilm forming (Bfm(w strain F2365 was conducted to identify genes potentially involved in biofilm formation. Among 951 genes with significant difference in expression between the two strains, a GntR-family response regulator encoding gene (LMOf2365_0414, designated lbrA, was found to be highly expressed in Scott A relative to F2365. A Scott A lbrA-deletion mutant, designated AW3, formed biofilm to a much lesser extent as compared to the parent strain by a rapid attachment assay and scanning electron microscopy. Complementation with lbrA from Scott A restored the Bfm(s phenotype in the AW3 derivative. A second microarray assessment using the lbrA deletion mutant AW3 and the wild type Scott A revealed a total of 304 genes with expression significantly different between the two strains, indicating the potential regulatory role of LbrA in L. monocytogenes. A cloned copy of Scott A lbrA was unable to confer enhanced biofilm forming potential in F2365, suggesting that additional factors contributed to weak biofilm formation by F2365.

  19. Cell-surface alterations in class IIa bacteriocin-resistant Listeria monocytogenes strains.

    Science.gov (United States)

    Vadyvaloo, Viveka; Arous, Safia; Gravesen, Anne; Héchard, Yann; Chauhan-Haubrock, Ramola; Hastings, John W; Rautenbach, Marina

    2004-09-01

    Strains of the food-borne pathogen Listeria monocytogenes, showing either intermediate or high-level resistance to class IIa bacteriocins, were investigated to determine characteristics that correlated with their sensitivity levels. Two intermediate and one highly resistant spontaneous mutant of L. monocytogenes B73, a highly resistant mutant of L. monocytogenes 412, and a highly resistant, defined (mptA) mutant of L. monocytogenes EGDe were compared with their respective wild-type strains in order to investigate the contribution of different factors to resistance. Decreased mannose-specific phosphotransferase system gene expression (mptA, EIIAB(Man) component) was implicated in all levels of resistance, confirming previous studies by the authors' group. However, a clear correlation between d-alanine content in teichoic acid (TA), in particular the alanine : phosphorus ratio, and a more positive cell surface, as determined by cytochrome c binding, were found for the highly resistant strains. Furthermore, two of the three highly resistant strains showed a significant increase in sensitivity towards d-cycloserine (DCS). However, real-time PCR of the dltA (d-alanine esterification), and dal and ddlA genes (peptidoglycan biosynthesis) showed no change in transcriptional levels. The link between DCS sensitivity and increased d-alanine esterification of TA may be that DCS competes with alanine for transport via the alanine transporter. A possible tendency towards increased lysinylation of membrane phospholipid in the highly resistant strains was also found. A previous study reported that cell membranes of all the resistant strains, including the intermediate resistant strains, contained more unsaturated phosphatidylglycerol, which is an indication of a more fluid cell membrane. The results of that study correlate with the possible lysinylation, decreased mptA expression, d-alanine esterification of TA and more positive cell surface charge found in this study for

  20. Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

    Science.gov (United States)

    Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

    2015-02-01

    Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

  1. Detection of premature stop codons leading to truncated internalin A among food and clinical strains of Listeria monocytogenes.

    Science.gov (United States)

    Ferreira da Silva, Margarida; Ferreira, Vânia; Magalhães, Rui; Almeida, Gonçalo; Alves, Artur; Teixeira, Paula

    2017-05-01

    Listeria monocytogenes is a food-borne pathogen responsible for outbreaks and sporadic cases of listeriosis, a severe invasive disease. Internalin A (InlA) a protein encoded by inlA has a key role in the mechanism of pathogenesis in L. monocytogenes infection, specifically in the invasion of human intestinal epithelial cells. Studies on inlA have shown that mutations leading to premature stop codons (PMSCs) occur naturally and are associated with impaired virulence of L. monocytogenes strains. Increasing evidence suggests that inlA PMSCs mutations are frequent in strains from foods, but rare among clinical isolates. In this study, 22 L. monocytogenes strains collected in Portugal from the processing environment of a bakery industry (n = 1), different food products (n = 10) and human clinical cases (n = 11) were analysed for mutations in inlA and invasion efficiency in Caco-2 cells. Sequencing revealed previously reported mutations types leading to PMSCs in three food and one clinical strain presenting different molecular serotypes (i.e., IIa, IIb and IIc). The remaining 18 isolates did not show PMSCs in inlA. The four strains with PMSCs in inlA presented lower invasiveness efficiencies in Caco-2 cells (below 8.9%) when compared to the control strain (full-length InlA). In addition, one clinical isolate showed reduced invasion efficiency but no PMSCs in inlA. This isolate showed increased inlA transcript levels to that obtained for the laboratory control strain. Our data support the hypothesis that L. monocytogenes isolated from food have attenuated invasion due to the presence of inlA PMSCs. This information would be critically needed for adequate risk-assessments of the foodborne illness burden associated with L. monocytogenes strains. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Molecular serotyping and identification of the 85M gragment in different Colombian isolates of Listeria monocytogenes strains: A descriptive study

    Directory of Open Access Journals (Sweden)

    María Consuelo Vanegas

    2012-02-01

    Full Text Available Introduction: Listeria monocytogenes is a pathogen acquired through the consumption of contaminated foods. Thirteen serotypes have been reported, of which 1/2a, 1/2b, and 4b are responsible for 98% of human listeriosis cases. This study examines the association between serotypes and virulent clones, offering greater information and providing tools to prevent and control diseases caused by L. monocytogenes serotype 4b.Objective: To identify the serotypes from L. monocytogene strains isolated from different samples by performing the molecular subtyping technique; to determine the 85M fragment that codifies for epidemic clone I.Methods : 108 strains of L. monocytogenes were used, isolated from samples of animals, body fluids, foods, and food processing plant equipment and spaces. The samples were identified by following the Bacteriological Analytical Manual protocol described by the Food and Drug Administration (FDA. The strains were identified by PolymeraseChain Reaction (PCR using primers and a standardized protocol from a previous research project. Serotype identification was performed by multiplex PCR. The determination of the 85M fragment of the SSCS cassette was done by following the protocol by Yildrim et al.Results : Of the 108 L. monocytogenes strains analyzed, 60.2% (65 strains belonged to the 4b-4d-4e serotype, 17.6% (19 strains were identified as 1/2a-3a serotype, 14.8% (16 strains were 4a-4c serotype, 3.7% (4 strains belonged to the 1/2c-3c serotype, and (3.7% corresponded to the 1/2b-3b-7 serotype. It was determined that the L. monocytogenes strains serotype 4b-4d-4e and 1/2a-3b have the 85M fragment of the SSCS cassette.Conclusion : This study reports the predominant existence of L. monocytogenes strains serotype 4b-4d-4e in food, environmental, and clinical samples. The presence of an epidemic clone I region was also found in L. monocytogenes strains.

  3. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

    DEFF Research Database (Denmark)

    Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

    2009-01-01

    Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model f...

  4. Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

    Science.gov (United States)

    Nyarko, Esmond; Donnelly, Catherine

    2015-03-01

    Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

  5. Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

    Directory of Open Access Journals (Sweden)

    Ninoska eCordero

    2016-03-01

    Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

  6. MudPIT analysis of alkaline tolerance by Listeria monocytogenes strains recovered as persistent food factory contaminants.

    Science.gov (United States)

    Nilsson, Rolf E; Latham, Roger; Mellefont, Lyndal; Ross, Tom; Bowman, John P

    2012-05-01

    Alkaline solutions are used to clean food production environments but the role of alkaline resistance in persistent food factory contamination by Listeria monocytogenes is unknown. We used shotgun proteomics to characterise alkaline adapted L. monocytogenes recovered as persistent and transient food factory contaminants. Three unrelated strains were studied including two persistent and a transient food factory contaminant determined using multilocus sequence typing (MLST). The strains were adapted to growth at pH 8.5 and harvested in exponential phase. Protein extracts were analysed using multidimensional protein identification technology (MudPIT) and protein abundance compared by spectra counting. The strains elicited core responses to alkaline growth including modulation of intracellular pH, stabilisation of cellular processes and reduced cell-division, independent to lineage, MLST or whether the strains were transient or persistent contaminants. Alkaline adaptation by all strains corresponded to that expected in stringent-response induced cells, with protein expression supporting metabolic shifts concordant with elevated alarmone production and indicating that the alkaline-stringent response results from energy rather than nutrient limitation. We believe this is the first report describing induction of a stringent response in different L. monocytogenes strains by alkaline pH under non-limiting growth conditions. The work emphasises the need for early intervention to avoid persistent food factory contamination by L. monocytogenes.

  7. [Biofilm formation capacity of Listeria monocytogens strains isolated from soft cheese from Costa Rica].

    Science.gov (United States)

    Carrillo Zeledón, Gabriela; Redondo Solano, Mauricio; Arias Echandi, María Laura

    2010-06-01

    Listeria monocytogenes is a bacteria associated with the production of severe infectious disease in human being, but also with the formation of biofilms in different surfaces related to the food production environment. Biofilm represents a serious problem in food industry, since it is a constant and important contamination source and also, bacteria present in it have an increased resistance towards physical and chemical agents of common use. The capacity of biofilm formation of L. monocytogenes strains previously isolated from soft cheese samples from Costa Rica was studied under different temperature and culture conditions. The microplate technique was performed using different culture media (BHIB, TSB 1:20 and cheese serum) and at different incubation temperatures (refrigeration, environmental and 35 degrees C). Biofilm formation capacity was classified according to the optical density obtained at 620 nm. None of the strains evaluated was classified as strong biofilm former under any of the variables studied, nevertheless, weak and moderate formers were detected. The results obtained show the influence of the nutrient content of the culture media used over biofilm formation; BHIB was the only culture media that allowed the expression of moderate biofilm forms, contrary to cheese serum that did not promote biofilm production. Biofilm formation is a multifactorial process, where adsorption level depends on several variables and its study must be promoted in order to develop methodologies that allow its reduction or elimination, so food industries may offer safe food products to consumers.

  8. Differential Listeria monocytogenes strain survival and growth in Katiki, a traditional Greek soft cheese, at different storage temperatures.

    Science.gov (United States)

    Kagkli, Dafni-Maria; Iliopoulos, Vassilios; Stergiou, Virginia; Lazaridou, Anna; Nychas, George-John

    2009-06-01

    Katiki Domokou is a traditional Greek cheese, which has received the Protected Designation of Origin recognition since 1994. Its microfloras have not been studied although its structure and composition may enable (or even favor) the survival and growth of several pathogens, including Listeria monocytogenes. The persistence of L. monocytogenes during storage at different temperatures has been the subject of many studies since temperature abuse of food products is often encountered. In the present study, five strains of L. monocytogenes were aseptically inoculated individually and as a cocktail in Katiki Domokou cheese, which was then stored at 5, 10, 15, and 20 degrees C. Pulsed-field gel electrophoresis was used to monitor strain evolution or persistence during storage at different temperatures in the case of the cocktail inoculum. The results suggested that strain survival of L. monocytogenes was temperature dependent since different strains predominated at different temperatures. Such information is of great importance in risk assessment studies, which typically consider only the presence or absence of the pathogen.

  9. One group of genetically similar Listeria monocytogenes strains frequently dominates and persists in several fish slaughter- and smokehouses

    DEFF Research Database (Denmark)

    Wulff, Gitte; Gram, Lone; Ahrens, Peter;

    2006-01-01

    Contamination of foods with the human pathogen Listeria monocytogenes may occur during processing, and the purpose of this study was to determine whether genetically similar strains colonize different processing plants or whether specific persistent strains are unique to each processing plant. We...... smokehouses and two slaughterhouses and was predominant in three of these plants. A subset of 35 strains was also analyzed by amplified fragment length polymorphism typing, which confirmed the genetic similarity of the groups. Moreover, strains of the dominant RAPD type were indistinguishable from strains...... related may be especially adapted to colonizing the processing equipment or especially resistant to cleaning and disinfection....

  10. Effects of growth temperature on the ingestion and killing of clinical isolates of Listeria monocytogenes by human neutrophils.

    OpenAIRE

    Stecha, P F; Heynen, C A; Roll, J T; Brown, J F; Czuprynski, C J

    1989-01-01

    In this study, we compared three human isolates (F5380, Scott A, and Murray B) and one laboratory strain (EGD) of Listeria monocytogenes for their resistance to ingestion and killing by human neutrophils. We observed no substantial difference in killing among these strains when they were grown at 37 degrees C. Because it is likely that listerial growth occurs at lower temperatures during food-borne outbreaks of listeriosis, we also compared these strains after they were grown at 22 and 4 degr...

  11. Comparison of antimicrobial resistance in Escherichia coli, Staphylococcus aureus, and Listeria monocytogenes strains isolated from organic and conventional poultry meat.

    Science.gov (United States)

    Miranda, J M; Vázquez, B I; Fente, C A; Calo-Mata, P; Cepeda, A; Franco, C M

    2008-12-01

    The presence of Escherichia coli, Staphylococcus aureus, and Listeria monocytogenes was determined in 55 samples of organic poultry meat and in 61 samples of conventional poultry meat. A total of 220 E. coli, 192 S. aureus, and 71 L. monocytogenes strains were analyzed by an agar disk diffusion assay for their resistance to ampicillin, cephalothin, chloramphenicol, ciprofloxacin, doxycycline, fosfomycin, gentamicin, nitrofurantoin, streptomycin, and sulfisoxazole (E. coli); chloramphenicol, ciprofloxacin, clindamycin, doxycycline, erythromycin, gentamicin, nitrofurantoin, oxacillin, and sulfisoxazole (S. aureus); and chloramphenicol, doxycycline, erythromycin, gentamicin, sulfisoxazole, and vancomycin (L. monocytogenes). The results indicated a significantly higher (P poultry meat as compared with conventional poultry meat. E. coli isolated from organic poultry meat exhibited lower levels of antimicrobial resistance against 7 of the 10 antimicrobials tested as compared with isolates recovered from conventional meat. In the case of S. aureus and L. monocytogenes isolated from conventional poultry, antimicrobial resistance was significantly higher only for doxycycline as compared with strains isolated from organic poultry. In the case of E. coli, the presence of multiresistant strains was significantly higher (P poultry meat as compared with organic poultry meat. Organically farmed poultry samples showed significantly lower development of antimicrobial resistance in intestinal bacteria such as E. coli.

  12. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  13. Scott Whittaker

    Institute of Scientific and Technical Information of China (English)

    2014-01-01

    Scott Whittaker在亚洲脱离”蛮荒“之际来到泰国,5年后泰国成为金融危机的重灾区,作为建筑师兼设计公司创始人,Scott以西方人的视角审视这场危机深陷其中,他用不同东方人的视角和姿态见证、亲历这场劫后重生记。

  14. Reduced growth of Listeria monocytogenes in two model cheese microcosms is not associated with individual microbial strains.

    Science.gov (United States)

    Imran, Muhammad; Bré, Jean-Michel; Guéguen, Marielle; Vernoux, Jean-Paul; Desmasures, Nathalie

    2013-02-01

    Two model antilisterial microbial communities consisting of two yeasts, two Gram positive and two Gram negative bacteria, and originating from Livarot cheese smear were previously designed. They were used in the present study to analyse the impact of microbial population dynamics on growth of Listeria monocytogenes in cheese microcosm. Specific culture media and PCR primers were developed for simultaneous culture-dependent and real-time PCR quantification of strains belonging to Marinomonas sp., Paenibacillus sp., Staphylococcus equorum, Arthrobacter arilaitensis, Pseudomonas putida, Serratia liquefaciens, Candida natalensis, and Geotrichum candidum, in cheese microcosms. All strains were enumerated after 3, 5, 8 and 14 days at 15 °C. They established well at high counts in all cheese microcosms. Growth dynamics for all strains in presence of L. monocytogenes WSLC 1685 were compared to those of microbial communities obtained by omitting in turn one of the six members of the initial community. The growth of the microbial strains was neither markedly disturbed by Listeria presence nor by the removal of each strain in turn. Furthermore, these communities had a significant reducing effect on growth of L. monocytogenes independently of pH, as confirmed by mathematical modelling. A barrier effect was observed, that could be explained by specific competition for nutrients.

  15. Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil

    Directory of Open Access Journals (Sweden)

    Cristhiane Moura Falavina dos Reis

    2011-04-01

    Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.

  16. Characteristics of Cell-mediated, Anti-listerial Immunity Induced by A Naturally Avirulent Listeria monocytogenes Serotype 4a Strain HCC23

    Science.gov (United States)

    The characteristics of cell-mediated, anti-listerial immune response initiated by an avirulent Listeria monocytogenes serotype 4a strain HCC23 was assessed. Similar to virulent strain EGD, avirulent strain HCC23 grew readily within macrophage-like J774 cells, but nonhemolytic strain ATCC 15313 did n...

  17. ANTILISTERIAL ACTYVITY OF LACTIC ACID BACTERIA ISOLATED FROM GILTHEAD BREAMS AND SEA BASSES FILLETS PACKAGED MAP AGAINST PRIMITIVE STRAINS OF LISTERIA MONOCYTOGENES

    OpenAIRE

    M. Barile; A. Mormile; R Mercogliano; N. Murru

    2011-01-01

    Listeria monocytogenes is the causative agent of listeriosis typically caused by ready-to-eat processed food that have a refrigerated shelf-life, but lightly preserved fish products also belong to a high-risk category. Aim of the work was to evaluate antimicrobial activity linked bacteriocin-producing of LAB isolated from gilthead breams and sea basses fillets packaged in modified atmospheres. Fifty-five LAB strains were screened against 21 strains of Listeria monocytogenes, 1 Listeria innocu...

  18. Genotypic characterization, invasion index and antimicrobial resistance pattern in Listeria monocytogenes strains isolated from clinical samples

    Institute of Scientific and Technical Information of China (English)

    Behrooz Sadeghi Kalani; Abazar Pournajaf; Mansour Sedighi; Abbas Bahador; Gholamreza Irajian; Firuzeh Valian

    2015-01-01

    Objective: To evaluate antimicrobial resistance, invasion index and genetic profile in Listeriamonocytogenes isolated from clinical samples. Methods: At all, 170 clinical samples were collected from patients with spontaneous abortions hospitalized in Shariati hospital in Tehran during June 2010 to August 2013. Invasion index was determined using HeLa cells. The multiple-locus variable-number tandem-repeats analysis (MLVA) was used for evaluation of genetic relatedness. Results: Out of 14 L. monocytogenes isolates, 4 (28.57%), 2 (14.28%), 0 (0%), 5 (35.71%) and 3 (21.42%) were isolated from placental tissue, urine, blood, vaginal and rectal swabs, respectively. High resistance to penicillin and multidrug resistant were found amongst isolates. The invasion index was in the range of 0.001-0.007. Seven different types were obtained by MLVA assay and type 2 and 3 with 4 strains were the most frequent type. Strains isolated from the vagina and the placenta of the same type were also more resistant to penicillin. Conclusions: Since MLVA is a high-throughput screening method that is fairly inexpensive, easy to accomplish, rapid, and trustworthy, it is well suited to interlaboratory comparisons during epidemiological investigations. Also further studies of larger samples from a variety of sources such as food and animal specimens recommended comparing by MLVA method.

  19. Inhibition of Listeria monocytogenes by Carnobacterium spp. strains in a simulated cold smoked fish system stored at 4 degrees C.

    Science.gov (United States)

    Duffes, F; Leroi, F; Boyaval, P; Dousset, X

    1999-03-01

    Preservation of smoked salmon from bacterial spoilage, and especially from Listeria monocytogenes by bacteriocin producers is a promising challenge. Over a hundred lactic acid bacteria, isolated from commercial vacuum packaged cold smoked salmon, were screened for their antagonistic activity against L. innocua. Twenty-two strains were able to produce bacteriocin-like proteinaceous substances. These strains were characterized physiologically and biochemically as Carnobacterium strains. Three different groups were determined by pulsed-field gel electrophoresis after Sma I and Apa I DNA digestion. Peptidoglycan hydrolases patterns completed the characterization of these strains. All were confirmed as being Carnobacterium piscicola. Growth and bacteriocin production of three strains of each group and two well known bacteriocin producers (C. divergens V41 and C. piscicola V1) were tested in a simulated cold smoked fish system at 4 degrees C. These strains were able to reach 10(8) cfu ml(-1) in 21 days and to produce as much bacteriocin activities in the cold smoked fish system as in the rich media. Carnobacterium divergens V41 and C. piscicola V1 were the most effective strains in co-culture experiments, inhibiting L. monocytogenes as early as day 4, whereas C. piscicola SF668 inhibiting effect was observed at day 13. The potential for using such biopreservation treatments on whole smoked salmon is discussed.

  20. Control of Listeria monocytogenes contamination in an Iberian pork processing plant and selection of benzalkonium chloride-resistant strains.

    Science.gov (United States)

    Ortiz, Sagrario; López, Victoria; Martínez-Suárez, Joaquín V

    2014-05-01

    The aims of this study were to characterize the different strains of Listeria monocytogenes collected at an Iberian pork processing plant and to investigate whether their specific characteristics were associated with prolonged survival in the plant. Using pulsed-field gel electrophoresis (PFGE), 29 PFGE types were previously identified during a three-year period. Eight of these PFGE types persisted in the plant during that period. In the present study, a subset of 29 PFGE type strains, which represented the 29 different PFGE types, was further characterized by assessing the potential virulence, and using motility, surface attachment, and antimicrobial susceptibility tests. After changing the disinfection procedures in the plant, the isolation rate of L. monocytogenes decreased, and only four of the 29 PFGE types, including three of the eight persistent PFGE types, were found the following year. These four "surviving" PFGE types included three from PCR serogroup IIa that were characterized by their low virulence mutations and low-level resistance to benzalkonium chloride (BAC). Furthermore, these PFGE types comprised the only BAC-resistant isolates found in the study, and they appear to have been selected due to the control of Listeria contamination. The resistance to increased sublethal concentrations of disinfectants may lead to prolonged survival of L. monocytogenes in food plants.

  1. Michael Scott

    Directory of Open Access Journals (Sweden)

    Ersin Hussein

    2015-04-01

    Full Text Available Associate Professor Michael Scott is a researcher and lecturer based in the department of Classics and Ancient History at the University of Warwick. He is also President of the Lytham St Annes Classical Association. Prior to his appointment at Warwick, Michael was the Moses and Mary Finley Research Fellow in ancient history at Darwin College, as well as an Affiliated Lecturer in the Faculty of Classics, at Cambridge University.Michael's research and teaching engages with interdisciplinary approaches to the literary, epigraphic and material evidence to investigate ancient Greek and Roman society, particularly focusing on Delphi and Olympia as religious spaces.While Michael has contributed significantly to the field of classics and ancient history by publishing extensively, he has also enjoyed great success in engaging wider audiences with the ancient world. He regularly talks in schools around the country, writes books intended for the popular market as well as articles for national and international newspapers and magazines. Michael's experience in writing and presenting a range of programmes intended for TV and radio audiences has made him a household name. He has written and presented programmes for the National Geographic, History Channel, Nova, and the BBC including Delphi: bellybutton of the ancient world (BBC4; Guilty Pleasures: luxury in the ancient and medieval words (BBC4; Jesus: rise to power (Natural Geographic; Ancient Discoveries (History Channel; Who were the Greeks? (BBC2; The Mystery of the X Tombs (BBC2/Nova; The Greatest Show on Earth (BBC4, in conjunction with the Open University. He has also presented a radio series for BBC Radio 4, Spin the Globe. Michael's most recent programme, Roman Britain from the Air, was aired on ITV in December 2014.In this interview, I talk to him about his engagement with other disciplines within the humanities, his forthcoming book project, and his experiences writing and presenting TV and radio

  2. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  3. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  4. Inactivation of several strains of Listeria monocytogenes attached to the surface of packaging material by Na-Chlorophyllin-based photosensitization.

    Science.gov (United States)

    Luksiene, Zivile; Buchovec, Irina; Paskeviciute, Egle

    2010-12-02

    This study was focused on the possibility to inactivate thermosensitive Listeria monocytogenes ATC(L3)C 7644 and thermoresistant 56 Ly strain by Na-Chlorophyllin (Na-Chl)-based photosensitization in vitro and on the surface of packaging. Comparative analysis of antimicrobial efficiency of photosensitization with conventional surface cleaning was performed. Data indicate that both Listeria strains, after incubation with Na-Chl and following illumination (λ=400nm, 20mWcm(-2)), were inactivated by 7 log in vitro. This treatment cleaned both Listeria strains from packaging surfaces. Comparative analysis indicates that washing with water diminishes pathogens by less than 1 log, 200ppm Na-hypochlorite by 1.7 log, Na-Chl-based photosensitization by 4.5 log. Listeria biofilms were totally removed from the surface by photosensitization at higher photosensitizer concentrations and longer incubation times. In conclusion, both strains of L. monocytogenes can be effectively inactivated by photosensitization in vitro and on the surface of packaging. Listeria biofilms are susceptible to this treatment as well. Comparison of different surface decontamination treatments reveals that photosensitization is much more effective against both Listeria strains than washing with water or 200ppm Na-hypochlorite. Our data support the idea that Na-Chl-based photosensitization is an effective antimicrobial tool which may serve in the future for the development of human and environmentally friendly surface decontamination techniques.

  5. Global transcriptional analysis of spontaneous sakacin P-resistant mutant strains of Listeria monocytogenes during growth on different sugars.

    Directory of Open Access Journals (Sweden)

    Girum Tadesse Tessema

    Full Text Available Subclass IIa bacteriocins have strong antilisterial activity and can control the growth of Listeria monocytogenes in food. However, L. monocytogenes may develop resistance towards such bacteriocins. In this follow-up study, the transcriptomes of a high level (L502-1 and a low level (L502-6 spontaneous sakacin P-resistant mutant strain of L. monocytogenes were compared to the wild-type (L502. The growth of the resistant strains was reduced on mannose but not affected on cellobiose and the transcriptomics was performed during growth on these sugars. The mannose phosphotransferase system (PTS encoded by the mptACD operon (mpt is known for transporting mannose and also act as a receptor to class IIa bacteriocins. The mpt was repressed in L502-1 and this is in accordance with abolition of the bacteriocin receptor with resistance to class IIa bacteriocins. In contrast, the mpt was induced in L502-6. Despite the induction of the mpt, L502-6 showed 1,000 times more resistance phenotype and reduced growth on mannose suggesting the mannose-PTS may not be functional in L502-6. The microarray data suggests the presence of other transcriptional responses that may be linked to the sakacin P resistance phenotype particularly in L502-6. Most of commonly regulated genes encode proteins involved in transport and energy metabolism. The resistant strains displayed shift in general carbon catabolite control possibly mediated by the mpt. Our data suggest that the resistant strains may have a reduced virulence potential. Growth sugar- and mutant-specific responses were also revealed. The two resistant strains also displayed difference in stability of the sakacin P resistance phenotype, growth in the presence of both the lytic bacteriophage P100 and activated charcoal. Taken together, the present study showed that a single time exposure to the class IIa bacteriocin sakacin P may elicit contrasting phenotypic and transcriptome responses in L. monocytogenes possibly

  6. The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

    Directory of Open Access Journals (Sweden)

    abazar pournajaf

    2013-09-01

    Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

  7. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  8. Influence of flow direction and flow rate on the initial adhesion of seven Listeria monocytogenes strains to fine polished stainless steel

    DEFF Research Database (Denmark)

    Skovager, Anne; Whitehead, Kathryn; Siegumfeldt, Henrik

    2012-01-01

    (IAR) was studied. A method, including fluorescence microscopy and a flow perfusion system, was developed and used to examine the real-time initial cell adhesion of different L. monocytogenes species in situ to opaque surfaces under flow conditions. The results demonstrated that shear stress......The effects of flow direction and shear stress on the adhesion of different strains of Listeria monocytogenes to fine polished stainless steel under liquid flow conditions were investigated. Furthermore, the relationship between cell surface properties and cell size and the initial adhesion rate...... was the determining factor for the initial adhesion of L. monocytogenes under flow conditions. The flow direction in relation to the orientation of surface features (the scratches) could be disregarded. IARs were dependent on the shear stress and strain type. The strain EGDe, which had the lowest IAR, had the largest...

  9. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytogenes single cells.

    Science.gov (United States)

    Nielsen, Dennis S; Cho, Gyu-Sung; Hanak, Alexander; Huch, Melanie; Franz, Charles M A P; Arneborg, Nils

    2010-07-31

    A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins and/or bacteriocin-producing LAB as "natural" food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure of the physiological state of sessile and planktonic L. monocytogenes (strains EGDe and N53-1) during co-culturing with plantaricin-producing L. plantarum (strains BFE 5092 and PCS 20) was investigated using fluorescence ratio imaging microscopy (FRIM). Mono-cultures of L. monocytogenes were used as control. Expression levels of plantaricin-encoding genes by sessile and planktonic L. plantarum were determined using qRT-PCR. L.plantarum BFE 5092 possesses the genes for plantaricin EF, JK and N, while L. plantarum PCS 20 contains the genes for plantaricin EF, although determination of the nucleotide sequence of the PCS 20 plantaricin E gene showed that this peptide is probably non-functional. When cultured as mono-culture, both L. monocytogenes strains maintained pH(i) at a constant level around 7.2-7.6 throughout the experiment, independently of the matrix. On a solid surface, L. plantarum BFE 5092 strongly affected pH(i) of L. monocytogenes N53-1 with only 20% of the cells being able to maintain pH(i) in the physiological optimal range with pH>7 and 52% of the cells with pH(i) approximately pH(ex,) showing that the cells had no proton gradient towards the environment. The effect on L. monocytogenes EGDe was less pronounced, but still notable. L.plantarum PCS 20 left both strains of L. monocytogenes virtually unaffected when co-cultured on a solid surface. In liquid, both L. plantarum

  10. Listeria monocytogenes Strains Underrepresented during Selective Enrichment with an ISO Method Might Dominate during Passage through Simulated Gastric Fluid and In Vitro Infection of Caco-2 Cells

    Science.gov (United States)

    Zilelidou, Evangelia; Karmiri, Christina-Vasiliki; Zoumpopoulou, Georgia; Mavrogonatou, Eleni; Kletsas, Dimitris; Tsakalidou, Effie; Papadimitriou, Konstantinos; Drosinos, Eleftherios

    2016-01-01

    ABSTRACT Various Listeria monocytogenes strains may contaminate a single food product, potentially resulting in simultaneous exposure of consumers to multiple strains. However, due to bias in strain recovery, L. monocytogenes strains isolated from foods by selective enrichment (SE) might not always represent those that can better survive the immune system of a patient. We investigated the effect of cocultivation in tryptic soy broth with 0.6% yeast extract (TSB-Y) at 10°C for 8 days on (i) the detection of L. monocytogenes strains during SE with the ISO 11290-1:1996/Amd 1:2004 protocol and (ii) the in vitro virulence of strains toward the Caco-2 human colon epithelial cancer cell line following exposure to simulated gastric fluid (SGF; pH 2.0)-HCl (37°C). We determined whether the strains which were favored by SE would be effective competitors under the conditions of challenges related to gastrointestinal passage of the pathogen. Interstrain competition of L. monocytogenes in TSB-Y determined the relative population of each strain at the beginning of SE. This in turn impacted the outcome of SE (i.e., favoring survival of competitors with better fitness) and the levels exposed subsequently to SGF. However, strong growth competitors could be outcompeted after SGF exposure and infection of Caco-2 cells by strains outgrown in TSB-Y and underdetected (or even missed) during enrichment. Our data demonstrate a preferential selection of certain L. monocytogenes strains during enrichments, often not reflecting a selective advantage of strains during infection. These findings highlight a noteworthy scenario associated with the difficulty of matching the source of infection (food) with the L. monocytogenes isolate appearing to be the causative agent during listeriosis outbreak investigations. IMPORTANCE This report is relevant to understanding the processes involved in selection and prevalence of certain L. monocytogenes strains in different environments (i.e., foods or

  11. Differential Gene Expression of Three Gene Targets among Persistent and Nonpersistent Listeria monocytogenes Strains in the Presence or Absence of Benzethonium Chloride.

    Science.gov (United States)

    Mazza, Roberta; Mazzette, Rina; McAuliffe, Olivia; Jordan, Kieran; Fox, Edward M

    2015-08-01

    Persistence of Listeria monocytogenes strains in food processing environments remains relatively common but is difficult to control. Understanding the basis for such persistence represents an important step in the potential control or eradication of this pathogen from these environments. In this study, reverse transcription PCR was used to determine the relative and absolute expression of selected gene targets (pocR, eutJ, and qacH) among five persistent and four presumed nonpersistent L. monocytogenes strains. The quantification of these genes as markers for the persistent phenotype and the effect of benzethonium chloride (BZT) on their expression was investigated. Although no markers correlated with the ability of strains to persist in food processing facilities were found, expression of pocR was upregulated in three of the five persistent strains, in contrast to the four presumed nonpersistent strains, which showed down-regulation of this gene. These results provide further knowledge of the differential expression of genes of persistent and presumed nonpersistent strains of L. monocytogenes grown in the presence or absence of BZT and identifies upregulation of pocR as a potential response of persistent strains of L. monocytogenes to exposure to BZT.

  12. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  13. Inhibition of Listeria monocytogenes by fatty acids and monoglycerides.

    OpenAIRE

    Wang, L. L.; Johnson, E. A.

    1992-01-01

    Fatty acids and monoglycerides were evaluated in brain heart infusion broth and in milk for antimicrobial activity against the Scott A strain of Listeria monocytogenes. C12:0, C18:3, and glyceryl monolaurate (monolaurin) had the strongest activity in brain heart infusion broth and were bactericidal at 10 to 20 micrograms/ml, whereas potassium (K)-conjugated linoleic acids and C18:2 were bactericidal at 50 to 200 micrograms/ml. C14:0, C16:0, C18:0, C18:1, glyceryl monomyristate, and glyceryl m...

  14. Evaluation of Antibacterial Activity of Satureja Khuzestanica J. Essential Oil against Standard and Isolated Strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sheida Akbari-Shahabi

    2014-10-01

    Full Text Available Background: The purpose of this study was to determine antibacterial activity of essential oil of Satureja khuzestanica against Listeria monocytogenes (PTCC1295 and strains isolated from breast milk show that. Materials and Methods: In this descriptive-analytic study, Essence of leave’s plant was extracted and identified its compounds and then carvacrol was isolated. Antibacterial activities were examined by agar dilution method against L. monocytogenes. Minimum inhibitory concentration (MIC and minimum bacterial concentration (MBC were carried out by micro dilution method. Then bacterial suspension injected the BALB/c mice. Forty-eight h after seeing the listeriosis disease signs were started the treatment. Ampicillin (10 μg/disc and trimethoprim (5 g were used as controls. Results: The results showed that the inhibitory zone diameter standard and essential oils for strains isolated species were respectively 59 and 50 mm. This amount was determined by carvacrol, respectively, 60 and 48 mm. Inhibition zone diameter measurements for standard strains of ampicillin and trimethoprim tedious strains, respectively, 21, 40, 18 and 33 mm, respectively. The minimum inhibitory concentration of essential oils, carvacrol and ampicillin than standard strains, respectively 1.56, 1.56 and 155×10˗8 μg/mL and MBC 3.125, 3.125 and 125×10-7 μg/mL was determined by the ratio of the strain 3.125, 3.125 and 0.0062 μg/mL and MBC was 6.25, 6.25 and 0.025 μg/mL. Conclusion: This study showed that bacterial cleansing properties of essential oil of this plant have a strong and effective combination that is carvacrol.

  15. Biofilm formation of the L. monocytogenes strain 15G01 is influenced by changes in environmental conditions.

    Science.gov (United States)

    Nowak, Jessika; Cruz, Cristina D; Palmer, Jon; Fletcher, Graham C; Flint, Steve

    2015-12-01

    Listeria monocytogenes 15G01, a strain belonging to the persistent pulsotype 5132, was isolated from a seafood processing plant in New Zealand. Simple monoculture assays using crystal violet staining showed good biofilm formation for this strain and it was therefore chosen to be further investigated in regard to its biofilm forming ability. To evaluate its behaviour in different conditions commonly encountered in food processing environments, biofilm assays and growth studies were performed using common laboratory media under a range of temperatures (20 °C, 30 °C and 37 °C). Furthermore, the effects of incubation time and different environmental conditions including static, dynamic and anaerobic incubation on biofilm formation were investigated. Changes in the environmental conditions resulted in different biofilm phenotypes of L. monocytogenes 15G01. We demonstrated that increasing temperature and incubation time led to a higher biofilm mass and that dynamic incubation has little effect on biofilm formation at 37 °C but encourages biofilm formation at 30 °C. Biofilm production at 20 °C was minimal regardless of the medium used. We furthermore observed that anaerobic environment led to reduced biofilm mass at 30 °C for all tested media but not at 37 °C. Biofilm formation could not be narrowed down to one factor but was rather dependent on multiple factors with temperature and medium having the biggest effects.

  16. Protective effect of Carnobacterium spp. against Listeria monocytogenes during host cell invasion using in vitro HT29 model

    Directory of Open Access Journals (Sweden)

    Tereza Pilchova

    2016-08-01

    Full Text Available The pathogenesis of listeriosis results mainly from the ability of Listeria monocytogenes to attach, invade, replicate and survive within various cell types in mammalian tissues. In this work, the effect of two bacteriocin-producing Carnobacterium (C. divergens V41 and C. maltaromaticum V1 and three non-bacteriocinogenic strains: (C. divergens V41C9, C. divergens 2763 and C. maltaromaticum 2762 was investigated on the reduction of L. monocytogenes Scott A plaque-forming during human infection using the HT-29 in vitro model. All Carnobacteria tested resulted in a reduction in the epithelial cell invasion caused by L. monocytogenes Scott A. To understand better the mechanism underlying the level of L. monocytogenes infection inhibition by Carnobacteria, infection assays from various pretreatments of Carnobacteria were assessed. The results revealed the influence of bacteriocin production combined with a passive mechanism of mammalian cell monolayers protection by Carnobacteria. These initial results showing a reduction in L. monocytogenes virulence on epithelial cells by Carnobacteria would be worthwhile analyzing further as a promising probiotic tool for human health.

  17. Diversity of Listeria monocytogenes Strains of Clinical and Food Chain Origins in Belgium between 1985 and 2014

    Science.gov (United States)

    Ceyssens, P. J.; Yde, M.; Dierick, K.; Boyen, F.; Vanderpas, J.; Vanhoof, R.; Mattheus, W.

    2016-01-01

    Listeriosis is a rare but severe disease, mainly caused by Listeria monocytogenes. This study shows the results of the laboratory-based surveillance of Listeriosis in Belgium over the period 1985–2014. Besides the incidence and some demographic data we present also more detailed microbiological and molecular characteristics of human strains isolated since 2000. The strains from the latter period were compared to food and animal strains from the same period. Our study shows that different food matrices were commonly contaminated with L. monocytogenes presenting the same PFGE profile as in patient’s isolates. Since 1985, we observed a significant decrease in incidence of the Materno-Neonatal cases (from 0.15 to 0.04 cases /100,000 inhabitants-year), which is probably to be attributed to active prevention campaigns targeting pregnant women. Despite the strengthening of different control measures by the food industry, the incidence of non-Materno-Neonatal listeriosis increased in Belgium (from 0.3 to 0.7 cases /100,000 inhabitants-year), probably due to the rise of highly susceptible patients in an aging population. This significant increase found in non-Materno-Neonatal cases (slope coefficient 7.42%/year, Pmonocytogenes isolates, a trend to increasing MIC values is evident with chloramphenicol, amoxicillin, tetracycline and ciprofloxacin. We show that fluoroquinolone resistance is not linked to chromosomal mutations, but caused by a variety of efflux pumps. Our study also shows that huge majority of known underlying pathologies (426 out of 785 cases) were cancers (185/426, 43.1%) and haematological malignancies (75/185, 40.5%). Moreover the risk population is susceptible to low levels of contamination in food stressing the need of prevention campaigns specifically targeting these persons. PMID:27723768

  18. Loss of viability of Listeria monocytogenes in contaminated processed cheese during storage at 4, 12 and 22 degrees C.

    Science.gov (United States)

    Angelidis, Apostolos S; Boutsiouki, Paraskevi; Papageorgiou, Demetrios K

    2010-09-01

    The behaviour of Listeria monocytogenes in a processed cheese product was evaluated over time by inoculating the product with three different L. monocytogenes strains (Scott A, CA and a strain isolated from processed cheese) at three different inoculation levels (ca. 6x10(5), ca. 6x10(3) and 10(2)CFU/g of cheese or less) and after storage of the contaminated products at 4, 12 or 22 degrees C. Growth of L. monocytogenes was not observed in any of the experimental trials (experiments involving different combinations of strain, inoculum level and storage temperature) throughout the storage period. L. monocytogenes populations decreased over time with a rate that was strain- and storage temperature-dependent. Nonetheless, for cheeses that had been inoculated with the higher inoculum and stored at 4 degrees C viable populations of L. monocytogenes could be detected for up to nine months post-inoculation. The L. monocytogenes survival curves obtained from the different trials were characterised by a post-inoculation phase during which the populations remained essentially unchanged (lag phase) followed by a phase of logarithmic decline. The duration of the lag phase and the rate of inactivation of L. monocytogenes in the different trials were estimated based on data from the linear descending portions of the survival curves. In addition, a non-linear Weibull-type equation was fitted to the data from each survival curve with satisfactory results. The results of the present study emphasize that, according to the definition laid down in the European Union Regulation 1441/2007, the processed cheese product tested in this work should be considered and classified as one that does not support the growth of L. monocytogenes under reasonable foreseeable conditions of distribution and storage. However, post-processing contamination of the product should be austerely avoided as the pathogen can survive in the product for extended periods of time, particularly under refrigerated

  19. Inhibition of Listeria monocytogenes by fatty acids and monoglycerides.

    Science.gov (United States)

    Wang, L L; Johnson, E A

    1992-02-01

    Fatty acids and monoglycerides were evaluated in brain heart infusion broth and in milk for antimicrobial activity against the Scott A strain of Listeria monocytogenes. C12:0, C18:3, and glyceryl monolaurate (monolaurin) had the strongest activity in brain heart infusion broth and were bactericidal at 10 to 20 micrograms/ml, whereas potassium (K)-conjugated linoleic acids and C18:2 were bactericidal at 50 to 200 micrograms/ml. C14:0, C16:0, C18:0, C18:1, glyceryl monomyristate, and glyceryl monopalmitate were not inhibitory at 200 micrograms/ml. The bactericidal activity in brain heart infusion broth was higher at pH 5 than at pH 6. In whole milk and skim milk, K-conjugated linoleic acid was bacteriostatic and prolonged the lag phase especially at 4 degrees C. Monolaurin inactivated L. monocytogenes in skim milk at 4 degrees C, but was less inhibitory at 23 degrees C. Monolaurin did not inhibit L. monocytogenes in whole milk because of the higher fat content. Other fatty acids tested were not effective in whole or skim milk. Our results suggest that K-conjugated linoleic acids or monolaurin could be used as an inhibitory agent against L. monocytogenes in dairy foods.

  20. Poor Invasion of Trophoblastic Cells but Normal Plaque Formation in Fibroblastic Cells despite actA Deletion in a Group of Listeria monocytogenes Strains Persisting in Some Food Processing Environments

    DEFF Research Database (Denmark)

    Holch, Anne; Gottlieb, Caroline Trebbien; Larsen, Marianne Halberg

    2010-01-01

    L. monocytogenes strains, including clinical strains, and they carry a premature stop codon in inlA. Eight of 15 strains, including the RAPD 9 and maternofetal strains, had a 105-nucleotide deletion in actA that did not affect cell-to-cell spread in mouse fibroblasts. The RAPD 9 strains may still...

  1. Genetic Characterization of Plasmid-Associated Benzalkonium Chloride Resistance Determinants in a Listeria monocytogenes Strain from the 1998-1999 Outbreak ▿

    Science.gov (United States)

    Elhanafi, Driss; Dutta, Vikrant; Kathariou, Sophia

    2010-01-01

    Quaternary ammonium compounds such as benzalkonium chloride (BC) are widely used as disinfectants in both food processing and medical environments. BC-resistant strains of Listeria monocytogenes have been implicated in multistate outbreaks of listeriosis and have been frequently isolated from food processing plants. However, the genetic basis for BC resistance in L. monocytogenes remains poorly understood. In this study, we have characterized a plasmid (pLM80)-associated BC resistance cassette in L. monocytogenes H7550, a strain implicated in the 1998-1999 multistate outbreak involving contaminated hot dogs. The BC resistance cassette (bcrABC) restored resistance to BC (MIC, 40 μg/ml) in a plasmid-cured derivative of H7550. All three genes of the cassette were essential for imparting BC resistance. The transcription of H7550 BC resistance genes was increased under sublethal (10 μg/ml) BC exposure and was higher at reduced temperatures (4, 8, or 25°C) than at 37°C. The level of transcription was higher at 10 μg/ml than at 20 or 40 μg/ml. In silico analysis suggested that the BC resistance cassette was harbored by an IS1216 composite transposon along with other genes whose functions are yet to be determined. The findings from this study will further our understanding of the adaptations of this organism to disinfectants such as BC and may contribute to the elucidation of possible BC resistance dissemination in L. monocytogenes. PMID:20971860

  2. Genomic characterization of Listeria monocytogenes strains involved in a multistate listeriosis outbreak associated with cantaloupe in US.

    Directory of Open Access Journals (Sweden)

    Pongpan Laksanalamai

    Full Text Available A multistate listeriosis outbreak associated with cantaloupe consumption was reported in the United States in September, 2011. The outbreak investigation recorded a total of 146 invasive illnesses, 30 deaths and one miscarriage. Subtyping of the outbreak associated clinical, food and environmental isolates revealed two serotypes (1/2a and 1/2b and four pulsed-field gel electrophoresis two-enzyme pattern combinations I, II, III, and IV, including one rarely seen before this outbreak. A DNA-microarray, Listeria GeneChip®, developed by FDA from 24 Listeria monocytogenes genome sequences, was used to further characterize a representative sample of the outbreak isolates. The microarray data (in the form of present or absent calls of specific DNA sequences separated the isolates into two distinct groups as per their serotypes. The gene content of the outbreak-associated isolates was distinct from that of the previously-reported outbreak strains belonging to the same serotypes. Although the 1/2b outbreak associated isolates are closely related to each other, the 1/2a isolates could be further divided into two distinct genomic groups, one represented by pattern combination I strains and the other represented by highly similar pattern combinations III and IV strains. Gene content analysis of these groups revealed unique genomic sequences associated with these two 1/2a genovars. This work underscores the utility of multiple approaches, such as serotyping, PFGE and DNA microarray analysis to characterize the composition of complex polyclonal listeriosis outbreaks.

  3. Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

    Directory of Open Access Journals (Sweden)

    Puga eCH

    2016-02-01

    Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

  4. Listeria monocytogenes serotype 1/2b and 4b isolates from human clinical cases and foods show differences in tolerance to refrigeration and salt stress.

    Science.gov (United States)

    Ribeiro, V B; Destro, M T

    2014-09-01

    Control of Listeria monocytogenes in food processing facilities is a difficult issue because of the ability of this microorganism to form biofilms and adapt to adverse environmental conditions. Survival at high concentrations of sodium chloride and growth at refrigeration temperatures are two other important characteristics of L. monocytogenes isolates. The aim of this study was to compare the growth characteristics under stress conditions at different temperatures of L. monocytogenes serotypes responsible for the majority of clinical cases from different sources. Twenty-two L. monocytogenes isolates, 12 from clinical cases (8 serotype 4b and 4 serotype 1/2a) and 10 from food (6 serotype 4b and 4 serotype 1/2a), and an L. monocytogenes Scott A (serotype 4b) reference strain were analyzed for the ability to grow in brain heart infusion broth plus 1.9 M NaCl (11%) at 4, 10, and 25°C for 73, 42, and 15 days, respectively. The majority of L. monocytogenes strains was viable or even grew at 4°C and under the high osmotic conditions usually used to control pathogens in the food industry. At 10°C, most strains could adapt and grow; however, no significant difference (P > 0.05) was found for lag-phase duration, maximum growth rate, and maximum cell density. At 25°C, all strains were able to grow, and populations increased by up 5 log CFU/ml. Clinical strains had a significantly longer lag phase and lower maximum cell density (P food strains. Regarding virulence potential, no significant differences in hemolytic activity were found among serotypes; however, serotype 4b strains were more invasive in Caco-2 cells than were serotype 1/2a strains (P processed foods for health reasons may facilitate L. monocytogenes survival and growth in these products. Therefore, food companies must consider additional microbial growth barriers to assure product safety.

  5. Comparison of Widely Used Listeria monocytogenes Strains EGD, 10403S, and EGD-e Highlights Genomic Differences Underlying Variations in Pathogenicity

    Science.gov (United States)

    Bécavin, Christophe; Bouchier, Christiane; Lechat, Pierre; Archambaud, Cristel; Creno, Sophie; Gouin, Edith; Wu, Zongfu; Kühbacher, Andreas; Brisse, Sylvain; Pucciarelli, M. Graciela; García-del Portillo, Francisco; Hain, Torsten; Portnoy, Daniel A.; Chakraborty, Trinad; Lecuit, Marc; Pizarro-Cerdá, Javier; Moszer, Ivan; Bierne, Hélène; Cossart, Pascale

    2014-01-01

    ABSTRACT For nearly 3 decades, listeriologists and immunologists have used mainly three strains of the same serovar (1/2a) to analyze the virulence of the bacterial pathogen Listeria monocytogenes. The genomes of two of these strains, EGD-e and 10403S, were released in 2001 and 2008, respectively. Here we report the genome sequence of the third reference strain, EGD, and extensive genomic and phenotypic comparisons of the three strains. Strikingly, EGD-e is genetically highly distinct from EGD (29,016 single nucleotide polymorphisms [SNPs]) and 10403S (30,296 SNPs), and is more related to serovar 1/2c than 1/2a strains. We also found that while EGD and 10403S strains are genetically very close (317 SNPs), EGD has a point mutation in the transcriptional regulator PrfA (PrfA*), leading to constitutive expression of several major virulence genes. We generated an EGD-e PrfA* mutant and showed that EGD behaves like this strain in vitro, with slower growth in broth and higher invasiveness in human cells than those of EGD-e and 10403S. In contrast, bacterial counts in blood, liver, and spleen during infection in mice revealed that EGD and 10403S are less virulent than EGD-e, which is itself less virulent than EGD-e PrfA*. Thus, constitutive expression of PrfA-regulated virulence genes does not appear to provide a significant advantage to the EGD strain during infection in vivo, highlighting the fact that in vitro invasion assays are not sufficient for evaluating the pathogenic potential of L. monocytogenes strains. Together, our results pave the way for deciphering unexplained differences or discrepancies in experiments using different L. monocytogenes strains. PMID:24667708

  6. Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks.

    Directory of Open Access Journals (Sweden)

    Laurel S Burall

    Full Text Available In an effort to build a comprehensive genomic approach to food safety challenges, the FDA has implemented a whole genome sequencing effort, GenomeTrakr, which involves the sequencing and analysis of genomes of foodborne pathogens. As a part of this effort, we routinely sequence whole genomes of Listeria monocytogenes (Lm isolates associated with human listeriosis outbreaks, as well as those isolated through other sources. To rapidly establish genetic relatedness of these genomes, we evaluated tetranucleotide frequency analysis via the JSpecies program to provide a cursory analysis of strain relatedness. The JSpecies tetranucleotide (tetra analysis plots standardized (z-score tetramer word frequencies of two strains against each other and uses linear regression analysis to determine similarity (r2. This tool was able to validate the close relationships between outbreak related strains from four different outbreaks. Included in this study was the analysis of Lm strains isolated during the recent caramel apple outbreak and stone fruit incident in 2014. We identified that many of the isolates from these two outbreaks shared a common 4b variant (4bV serotype, also designated as IVb-v1, using a qPCR protocol developed in our laboratory. The 4bV serotype is characterized by the presence of a 6.3 Kb DNA segment normally found in serotype 1/2a, 3a, 1/2c and 3c strains but not in serotype 4b or 1/2b strains. We decided to compare these strains at a genomic level using the JSpecies Tetra tool. Specifically, we compared several 4bV and 4b isolates and identified a high level of similarity between the stone fruit and apple 4bV strains, but not the 4b strains co-identified in the caramel apple outbreak or other 4b or 4bV strains in our collection. This finding was further substantiated by a SNP-based analysis. Additionally, we were able to identify close relatedness between isolates from clinical cases from 1993-1994 and a single case from 2011 as well as

  7. Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks.

    Science.gov (United States)

    Burall, Laurel S; Grim, Christopher J; Mammel, Mark K; Datta, Atin R

    2016-01-01

    In an effort to build a comprehensive genomic approach to food safety challenges, the FDA has implemented a whole genome sequencing effort, GenomeTrakr, which involves the sequencing and analysis of genomes of foodborne pathogens. As a part of this effort, we routinely sequence whole genomes of Listeria monocytogenes (Lm) isolates associated with human listeriosis outbreaks, as well as those isolated through other sources. To rapidly establish genetic relatedness of these genomes, we evaluated tetranucleotide frequency analysis via the JSpecies program to provide a cursory analysis of strain relatedness. The JSpecies tetranucleotide (tetra) analysis plots standardized (z-score) tetramer word frequencies of two strains against each other and uses linear regression analysis to determine similarity (r2). This tool was able to validate the close relationships between outbreak related strains from four different outbreaks. Included in this study was the analysis of Lm strains isolated during the recent caramel apple outbreak and stone fruit incident in 2014. We identified that many of the isolates from these two outbreaks shared a common 4b variant (4bV) serotype, also designated as IVb-v1, using a qPCR protocol developed in our laboratory. The 4bV serotype is characterized by the presence of a 6.3 Kb DNA segment normally found in serotype 1/2a, 3a, 1/2c and 3c strains but not in serotype 4b or 1/2b strains. We decided to compare these strains at a genomic level using the JSpecies Tetra tool. Specifically, we compared several 4bV and 4b isolates and identified a high level of similarity between the stone fruit and apple 4bV strains, but not the 4b strains co-identified in the caramel apple outbreak or other 4b or 4bV strains in our collection. This finding was further substantiated by a SNP-based analysis. Additionally, we were able to identify close relatedness between isolates from clinical cases from 1993-1994 and a single case from 2011 as well as links between two

  8. ANTILISTERIAL ACTYVITY OF LACTIC ACID BACTERIA ISOLATED FROM GILTHEAD BREAMS AND SEA BASSES FILLETS PACKAGED MAP AGAINST PRIMITIVE STRAINS OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    M. Barile

    2011-04-01

    Full Text Available Listeria monocytogenes is the causative agent of listeriosis typically caused by ready-to-eat processed food that have a refrigerated shelf-life, but lightly preserved fish products also belong to a high-risk category. Aim of the work was to evaluate antimicrobial activity linked bacteriocin-producing of LAB isolated from gilthead breams and sea basses fillets packaged in modified atmospheres. Fifty-five LAB strains were screened against 21 strains of Listeria monocytogenes, 1 Listeria innocua held in the culture collection of Department of Zootechnical Sciences and Food Ispection (SIA and submitted to antagonistic activity using the spot on lawn and the agar well diffusion assay. Lactococcus lactis sub. lactis Sa31 was able to produce bacteriocin in agar and different broth medium. The bacteriocin man31 showed sensitivity to trypsin, pronase E and papain, inactivation at temperatures ≥ 100°C, bactericidal mode of action and antilisterial act, rapidly. The bacteriocin man31 caused a reduction of L. monocytogenes ½ c growth about log10 > 3 UFC/ml, when was applied on indicator strain at 20,480 AU/ml concentration, in vitro.

  9. Listeria monocytogenes Strains Selected on Ciprofloxacin or the Disinfectant Benzalkonium Chloride Exhibit Reduced Susceptibility to Ciprofloxacin, Gentamicin, Benzalkonium Chloride, and Other Toxic Compounds▿

    Science.gov (United States)

    Rakic-Martinez, Mira; Drevets, Douglas A.; Dutta, Vikrant; Katic, Vera; Kathariou, Sophia

    2011-01-01

    Listeria monocytogenes is a leading agent for severe food-borne illness and death in the United States and other nations. Even though drug resistance has not yet threatened therapeutic interventions for listeriosis, selective pressure associated with exposure to antibiotics and disinfectants may result in reduced susceptibility to these agents. In this study, selection of several L. monocytogenes strains on either ciprofloxacin (2 μg/ml) or the quaternary ammonium disinfectant benzalkonium chloride (BC; 10 μg/ml) led to derivatives with increased MICs not only to these agents but also to several other toxic compounds, including gentamicin, the dye ethidium bromide, and the chemotherapeutic drug tetraphenylphosphonium chloride. The spectrum of compounds to which these derivatives exhibited reduced susceptibility was the same regardless of whether they were selected on ciprofloxacin or on BC. Inclusion of strains harboring the large plasmid pLM80 revealed that MICs to ciprofloxacin and gentamicin did not differ between the parental and plasmid-cured strains. However, ciprofloxacin-selected derivatives of pLM80-harboring strains had higher MICs than those derived from the plasmid-cured strains. Susceptibility to the antimicrobials was partially restored in the presence of the potent efflux inhibitor reserpine. Taken together, these data suggest that mutations in efflux systems are responsible for the multidrug resistance phenotype of strains selected on ciprofloxacin or BC. PMID:22003016

  10. Persistent and transient Listeria monocytogenes strains from retail deli environments vary in their ability to adhere and form biofilms and rarely have inlA premature stop codons.

    Science.gov (United States)

    Wang, Jingjin; Ray, Andrea J; Hammons, Susan R; Oliver, Haley F

    2015-02-01

    Based on recent risk assessments, up to 83% of listeriosis cases from deli meat in the United States are predicted to be from ready-to-eat deli meats contaminated during processing at retail grocery stores. Listeria monocytogenes is known to use sanitizer tolerance and biofilm formation to survive, but interplay of these mechanisms along with virulence potential and persistence mechanisms specific to deli environments had yet to be elucidated. In this study, 442 isolates from food and nonfood contact surfaces in 30 retail delis over 9 months were tested for inlA premature stop codons (PMSCs); inlA encodes InlA, which is necessary to cause listeriosis. A total of 96 isolates, composed of 23 persistent and 73 transient strains, were tested for adhesion and biofilm-forming ability and sanitizer tolerance. Only 10/442 isolates had inlA PMSCs (pdelis with other persistent strains. Most (7/10) PMSC-containing isolates were collected from food contact surfaces (pdelis (p<0.05). Persistent strains had enhanced adhesion on day 1 of a 5-day adhesion-biofilm formation assay. However, there was no significant difference in sanitizer tolerance between persistent and transient strains. Results suggest that foods contaminated with persistent L. monocytogenes strains from the retail environment are (1) likely to have wild-type virulence potential and (2) may persist due to increased adhesion and biofilm formation capacity rather than sanitizer tolerance, thus posing a significant public health risk.

  11. Evaluating the growth of Listeria monocytogenes in refrigerated ready-to-eat frankfurters: influence of strain, temperature, packaging, lactate and diacetate, and background microflora.

    Science.gov (United States)

    Pal, Amit; Labuza, Theodore P; Diez-Gonzalez, Francisco

    2008-09-01

    This research was conducted to study the growth of Listeria monocytogenes inoculated on frankfurters stored at different conditions as a basis for a safety-based consume by shelf life date label. Three L. monocytogenes strains were separately inoculated at 10 to 20 CFU/cm2 onto frankfurters that were previously formulated with or without high pressure and with or without added 2% potassium lactate (PL) and 0.2% sodium diacetate (SD). Inoculated frankfurters were air or vacuum packaged; stored at 4, 8, or 12 degrees C; and L. monocytogenes and psychrotrophic plate counts were determined for 90, 60, and 45 days, respectively, or until the stationary phase was reached. The data (log CFU per square centimeter versus time) were fitted using the Baranyi-Roberts model to determine maximum growth rates and lag-phase time. The maximum growth rates and the lag time under each growth condition were used to calculate the time to reach 100-fold the initial Listeria population. In frankfurters lacking PL and SD, the count of all strains increased by 2 log after 18 to 50 days at 4 degrees C and 4 to 13 days at 8 degrees C. The growth was inhibited at 4 and 8 degrees C in frankfurters containing PL and SD, but one ribotype was capable of growing, with the time to reach 100-fold the initial Listeria population ranging from 19 to 35 days at 12 degrees C. In most cases, the time to reach 100-fold the initial Listeria population of L. monocytogenes was significantly longer in vacuum-packaged frankfurters as compared with air-packaged samples. Inclusion of PL and SD also inhibited the growth of psychrotrophs, but at all temperatures the psychrotrophic plate counts were greater than 4 log CFU/cm2 at the end of the experiments. These results indicated that despite the use of antimicrobials, certain L. monocytogenes strains could be capable of growing under storage-abuse conditions. Growth kinetics data could be useful for establishing a shelf life date label protocol under different

  12. Genetic classification of Listeria monocytogenes serotype 4b strains, including epidemic clones, isolated from retail meat in the Tokyo metropolitan area.

    Science.gov (United States)

    Ochiai, Yoshitsugu; Mochizuki, Mariko; Yamada, Fumiya; Takano, Takashi; Hondo, Ryo; Ueda, Fukiko

    2014-01-01

    A food-borne pathogen, Listeria monocytogenes serotype 4b, has been frequently isolated from patients with listeriosis, and numerous outbreaks of listeriosis are associated with this serotype. In the present study, we performed subtyping of L. monocytogenes serotype 4b strains on the basis of genetic analyses. Thirty-four isolates of serotype 4b were classified into 8 genotypes, namely genotypes 12, 15, 16, 17, 18, 23, 24, and 25, on the basis of the sequence for the partial iap gene. Genetic analyses revealed that genotype 16 and genotypes 24 and 25 belong to epidemic clone I (ECI) and ECII, respectively, which have been frequently associated with listeriosis outbreaks in the United States and Europe. The genotype isolated most frequently from retail meats in the Tokyo metropolitan area was genotype 12 (52%), followed by genotype 16 (29%), which belongs to ECI. We suggest that ECI is a common subtype of L. monocytogenes in retail meat in the area under investigation. On the other hand, ECII isolates were confirmed to be present in retail meat in Japan but were rare.

  13. Virulence for mice, resistance to synthetic gastric fluid, and biofilm formation of Listeria monocytogenes H7550, a serotype 4b strain isolated from frankfurters associated with the BilMar listeriosis outbreak

    Science.gov (United States)

    Introduction: One of the largest and most severe listeriosis outbreaks in the United States occurred in 1998 as a result of contamination of frankfurters with a serotype 4b strain of Listeria monocytogenes. However, there has been little characterization of the virulence attributes of strains reta...

  14. Astronaut Scott Carpenter

    Science.gov (United States)

    1959-01-01

    Astronaut Scott Carpenter, one of the original seven astronauts for Mercury Project selected by NASA on April 27, 1959. Boosted by the Mercury-Atlas vehicle, the MA-7 mission made the second marned orbital flight by the United States, and carried Astronaut Carpenter aboard Aurora 7 spacecraft to orbit the Earth three times.

  15. EFFECT OF ESSENTIAL OIL ON BIOFILM PRODUCTION BY DIFFERENT LISTERIA MONOCYTOGENES STRAINS

    Directory of Open Access Journals (Sweden)

    G. Comi

    2008-12-01

    Full Text Available The effects of different essential oil (hexanal, 2-(E-hexenal, carvacrol, citron, red orange, thymol and limonene on biofilm production of some Lmonocytogenes strains are evaluated. The formation of biofilm on certain surfaces or on the food, seems to be related with cross-contamination during processing or with the contamination of the final product, with potential risk for the consumer. Many studies were done on the antimicrobial activity of essential oils and their components, but not too much is known about their capacity to influence and reduce the microbial production of biofilm. Our data showed that essential oils can inhibit or limit the biofilm production.

  16. A naturally occurring prfA truncation in a Listeria monocytogenes field strain contributes to reduced replication and cell-to-cell spread.

    Science.gov (United States)

    Rupp, Sebastian; Aguilar-Bultet, Lisandra; Jagannathan, Vidhya; Guldimann, Claudia; Drögemüller, Cord; Pfarrer, Christiane; Vidondo, Beatriz; Seuberlich, Torsten; Frey, Joachim; Oevermann, Anna

    2015-08-31

    Listeria (L.) monocytogenes is an environmental bacterium that may become an intracellular pathogen upon ingestion to cause gastroenteritis, septicaemia, abortions, and/or fatal infections of the central nervous system. We here describe a L. monocytogenes field strain (JF5171) isolated from a bovine placenta in the context of abortion, which exhibited attenuation in bovine brain-slice cultures. The whole genome of strain JF5171 was sequenced, and the invasion, replication, and intercellular spread of JF5171 were further analyzed by quantification of colony forming units and immunofluorescence studies. Phospholipase and hemolysis activity of JF5171 were also quantified along with transcription levels of actA, hly and prfA. The data obtained were compared to those of the widely used L. monocytogenes reference strain, EGD-e. JF5171 exhibited reduced replication and lower levels of phospholipase and hemolysis activity. Invasion and cell-to-cell spread was strongly decreased compared to EGD-e, and actin polymerization was absent. A frame shift deletion was identified in the JF5171 coding region of the major regulator for virulence, prfA. This resulted in a truncated C-terminus sequence (WEN* vs. WGKLN*). In addition, a point mutation resulted in a lysine to arginine substitution at amino acid position 197. Complementation with prfA from EGD-e and with (EGD-e) prfA-K197N increased the replication and spread efficiency of JF5171. In contrast, complementation with the truncated version of prfA had no effect. Taken together, these results suggest that the truncated C-terminus of prfA considerably contributes to the strongly attenuated phenotype observed in vitro. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Persistent and non-persistent strains of Listeria monocytogenes: A focus on growth kinetics under different temperature, salt, and pH conditions and their sensitivity to sanitizers.

    Science.gov (United States)

    Magalhães, R; Ferreira, V; Brandão, T R S; Palencia, R Casquete; Almeida, G; Teixeira, P

    2016-08-01

    This study aimed to investigate the effect of different conditions, including temperature (37 °C, 22 °C, and 4 °C), NaCl concentrations (2.5%, 4%, and 8%), and acidity (pH = 5), on the growth response of persistent and non-persistent isolates of Listeria monocytogenes. The resistance to two common sanitizers (benzalkonium chloride and hydrogen peroxide) was also investigated. A selected group of 41 persistent and non-persistent L. monocytogenes isolates recovered from three cheese processing plants during a previous longitudinal study was assembled. Average lag time was similar for persistent and non-persistent isolates grown at 37 °C, 22 °C and 4 °C but significantly shorter (p < 0.05) for persistent isolates grown at 2.5%, 4% and 8% NaCl, and at pH 5. Average growth rates were significantly higher (p < 0.05) for persistent than for non-persistent isolates when grown at 22 °C, 2.5%, 4% and 8% NaCl, and at pH 5. These results suggest that persistent strains may be better adapted to grow under stressful conditions frequently encountered in food processing environments than non-persistent strains. No relation between persistence and resistance to the tested sanitizers was found. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Examination of food chain-derived Listeria monocytogenes strains of different serotypes reveals considerable diversity in inlA genotypes, mutability, and adaptation to cold temperatures.

    Science.gov (United States)

    Kovacevic, Jovana; Arguedas-Villa, Carolina; Wozniak, Anna; Tasara, Taurai; Allen, Kevin J

    2013-03-01

    Listeria monocytogenes strains belonging to serotypes 1/2a and 4b are frequently linked to listeriosis. While inlA mutations leading to premature stop codons (PMSCs) and attenuated virulence are common in 1/2a, they are rare in serotype 4b. We observed PMSCs in 35% of L. monocytogenes isolates (n = 54) recovered from the British Columbia food supply, including serotypes 1/2a (30%), 1/2c (100%), and 3a (100%), and a 3-codon deletion (amino acid positions 738 to 740) seen in 57% of 4b isolates from fish-processing facilities. Caco-2 invasion assays showed that two isolates with the deletion were significantly more invasive than EGD-SmR (P cold temperature following a downshift from 37°C to 4°C. Overall, three distinct cold-adapting groups (CAG) were observed: 46% were fast (200 h) adaptors. Intermediate CAG strains (70%) more frequently possessed inlA PMSCs than did fast (20%) and slow (10%) CAGs; in contrast, 87% of fast adaptors lacked inlA PMSCs. In conclusion, we report food chain-derived 1/2a and 4b serotypes with a 3-codon deletion possessing invasive behavior and the novel association of inlA genotypes encoding a full-length InlA with fast cold-adaptation phenotypes.

  19. A single substitution in 5'-untranslated region of plcB is involved in enhanced broad-range phospholipase C activity in Listeria monocytogenes strain H4

    Institute of Scientific and Technical Information of China (English)

    Fan Bai; Jianshun Chen; Qiaomiao Chen; Xiaokai Luo; Weihuan Fang; Lingli Jiang

    2011-01-01

    To examine whether the in vitro phospholipase activity in Listeria monocytogenes strain H4 was due to two nucleotide mutations (C to T at position -26 and A to G at position + 1) in plcB or resulted from regulatory activation, two mutants H4-plcB-ml (single mutation at position -26) and H4-plcB-m2 (substitution at both positions) were constructed by site-directed mutagenesis. It was found that the two mutants had significantly lower transcription of plcB than their parent strain H4 and did not show phospho-Hpase activity on the egg yolk agar, implying that the apparent phospholipase activity of strain H4 could be related to single substitution at position -26 ofplcB, most probably by its 5t-untranslated region (5'-UTR) regulation mechanism. Tn917-based transposon mutagenesis generated eight L. monocytogenes mutants lacking phospholipase activity among 560 mutant candidates. Seven mutants had transposon insertion into prfA (encoding positive regulatory factor A) open reading frame, whereas only one mutant (WF-L127) was inserted into the P1 promoter region ofprfA (prfAP1). Transcription of major virulence genes was significantly lower in both types of mutants than in their parent strain H4. Disruption of prfAP1 in WFL127 abolished its phospholipase C activity but did not change its hemolytic phenotype, indicating that plcB was more dependent on prfA regulation than hly. Taken together, this study presents some evidence for the regulation ofplcB expression by its 5'-UTR mechanism.

  20. Viability of a multi-strain mixture of Listeria monocytogenes, Salmonella typhimurium, or Escherichia coli O157:H7 inoculated into the batter or onto the surface of a soudjouk-style fermented semi-dry sausage

    Science.gov (United States)

    Multi-strain mixtures of Listeria monocytogenes, Salmonella typhimurium, or Escherichia coli O157:H7 were separately inoculated either into soudjouk batter or onto the surface of slices of commercial soudjouk to levels of ca. 6.0 log10 CFU per gram or slice, respectively. After fermentation and dryi...

  1. Building a molecular Listeria monocytogenes database to centralize and share PFGE typing data from food, environmental and animal strains throughout Europe.

    Science.gov (United States)

    Félix, Benjamin; Danan, Corinne; Van Walle, Ivo; Lailler, Renaud; Texier, Thomas; Lombard, Bertrand; Brisabois, Anne; Roussel, Sophie

    2014-09-01

    The European Union Reference Laboratory (EURL) for Listeria monocytogenes (Lm) collaborates with a network of 35 National Reference Laboratories (NRLs) throughout Europe. Most of these NRLs are in charge of detecting and typing Lm strains from food, environment and animals, which are isolated nationally. The past few years EURL activities have enabled NRLs to reinforce typing capabilities according to standardised protocols. Consequently the need to exchange typing data within the NRL network has emerged. That is why the EURL has recently set up a EURL Lm Database (EURL Lm DB). Each NRL contributes data, which is then shared within the network. Data include strain-typing-results (PFGE and serotyping) and epidemiological information on the strains. This article describes (1) the EURL typing activities that led to the creation of the EURL Lm DB, (2) the different steps involved in developing the EURL Lm DB, and (3) the usefulness of this database for public health. The combined use of this database, with databases on human strains, is being integrated into the European surveillance system of Lm strains circulating throughout Europe. It should improve the detection of this pathogen and provide support for outbreak investigations.

  2. Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil Susceptibilidade antimicrobiana de cepas humanas de Listeria monocytogenes isoladas no período de 1970 a 2008 no Brasil

    Directory of Open Access Journals (Sweden)

    Cristhiane Moura Falavina dos Reis

    2011-04-01

    Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.INTRODUÇÃO: Listeria monocytogenes é o agente etiológico da listeriose, doença de origem alimentar que acomete principalmente grávidas, pacientes imunodeprimidos e idosos. O tratamento primário é a associação de

  3. Control of Listeria monocytogenes growth in soft cheeses by bacteriophage P100

    Directory of Open Access Journals (Sweden)

    Elaine Nóbrega Gibson Silva

    2014-01-01

    Full Text Available The purpose of this study was to determine the effect of bacteriophage P100 on strains of Listeria monocytogenes in artificially inoculated soft cheeses. A mix of L. monocytogenes 1/2a and Scott A was inoculated in Minas Frescal and Coalho cheeses (approximately 10(5 cfu/g with the bacteriophage added thereafter (8.3 x 10(7 PFU/g. Samples were analyzed immediately, and then stored at 10 ºC for seven days. At time zero, 30 min post-infection, the bacteriophage P100 reduced L. monocytogenes counts by 2.3 log units in Minas Frescal cheese and by 2.1 log units in Coalho cheese, compared to controls without bacteriophage. However, in samples stored under refrigeration for seven days, the bacteriophage P100 was only weakly antilisterial, with the lowest decimal reduction (DR for the cheeses: 1.0 log unit for Minas Frescal and 0.8 log units for Coalho cheese. The treatment produced a statistically significant decrease in the counts of viable cells (p < 0.05 and in all assays performed, we observed an increase of approximately one log cycle in the number of viable cells of L. monocytogenes in the samples under refrigeration for seven days. Moreover, a smaller effect of phages was observed. These results, along with other published data, indicate that the effectiveness of the phage treatment depends on the initial concentration of L. monocytogenes, and that a high concentration of phages per unit area is required to ensure sustained inactivation of target pathogens on food surfaces.

  4. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

    Directory of Open Access Journals (Sweden)

    David eMontero

    2015-04-01

    Full Text Available Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE such as sausage, cheese, fresh salads and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR identified that strains belonging to serotype 4b, and containing one or more genes encoded by LIPI-1, were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE, it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1 pathogenicity island, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent

  5. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile

    Science.gov (United States)

    Montero, David; Bodero, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M.; Vidal, Maricel

    2015-01-01

    Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance. PMID

  6. [Listeria monocytogenes in food].

    Science.gov (United States)

    Mícková, V

    1992-12-01

    As in recent years laboratory diagnostics of listeria has become part of food microbiology, the frequency of occurrence of the bacteria Listeria monocytogenes has been followed in various kinds of foods for a year. A total of 51 strains of L. monocytogenes (7.2%) was isolated from 700 kinds of samples (raw milk, pasteurized milk, meat surface, poultry, cheeses, thermally not treated meat products, food--industry machinery). As can be seen in Tab. I, the highest number of strains was isolated from meat surfaces (13.5%), followed by meat--industry machinery (12.72%), poultry (10%) and cheeses (5%). The lower numbers of strains were found out in thermally not treated meat products (3.8%) and in raw milk (3.3%). Pasteurized milk did not contain any strains. Our findings in raw milk (3.3%) and in pasteurized milk (0) are in agreement with the data cited e. g. by authors from the USA (Lovett et al., 1987), who mention the value of 4.2% in raw milk and the zero value in pasteurized milk. The percentage of strains monitored in cheeses (5%) can be evaluated as low as the assortment of investigated cheeses was small (all strains were isolated from soft ripening cheeses). German authors (Tham et al., 1988) speak about the 2.5% percentage of L. monocytogenes strains; this is in keeping with our findings. The findings in thermally not treated meat products (3.8%) can be evaluated as low although the number of strains found in raw meat was high.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    DEFF Research Database (Denmark)

    Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.;

    2008-01-01

    ) to the human β-defensin 3 (HBD-3). All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model...... Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs......Background Host defense peptides (HDPs), or antimicrobial peptides (AMPs), are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases...

  8. The biofilm formation ability of Listeria monocytogenes isolated from meat, poultry, fish and processing plant environments is related to serotype and pathogenic profile of the strains

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2012-10-01

    Full Text Available In the present study, the relationships between serotype, pathogenic profile and in vitro biofilm formation of 106 Listeria monocytogenes strains, having no epidemiological correlation and isolated from different environmental and food sources, were analyzed. The quantitative assessment of the in vitro biofilm formation was carried out by using a microtiter plate assay with spectrophotometric reading (OD620. The isolates were also submitted to serogrouping using the target genes lmo0737, lmo1118, ORF2819, ORF2110, prs, and to the evaluation of the presence of the following virulence genes: prfA, hlyA, rrn, inlA, inlB, iap, plcA, plcB, actA and mpl, by multiplex PCRs. The 62% of the strains showed weak or moderate in vitro ability in biofilm formation, in particular serotypes 1/2b and 4b, frequently associated with sporadic or epidemic listeriosis cases. The 25% of these isolates showed polymorphism for the actA gene, producing a fragment of 268-bp instead of the expected 385-bp. The deletion of nucleotides in this gene seems to be related to enhanced virulence properties among these strains. Strains belonging to serotypes associated with human infections and characterized by pathogenic potential are capable to persist within the processing plants forming biofilm.

  9. Walter Scott, Ivanhoe

    OpenAIRE

    2015-01-01

    On saluera tout d’abord la démarche de contextualisation, résolument didactique, adoptée par l’auteur, qui permet au lecteur d’avoir une bonne compréhension de l’arrière-plan historique de l’œuvre et de bénéficier des informations essentielles sur le contexte dans lequel a évolué Walter Scott. Le lecteur appréciera également les explications sur le contexte linguistique du xiie siècle (11), les précisions sur la dynastie des Plantagenêt d’Anjou et celle des Saxons (12), les réflexions sur l’É...

  10. Influence of Organic Material and Biofilms on Disinfectant Efficacy Against Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hilda Nyati

    2012-04-01

    Full Text Available The effects of organic material and biofilm formation on the efficacy of Suma Tab D4 chlorine tablets and Suma Bac D10 quaternary ammonium compound (QAC against Listeria monocytogenes was determined in suspension and on stainless steel and polystyrene surfaces according to standard disinfectant test methodology. Exposure to 200 and 740 mg L-1 QAC and to 150 mg L-1 active chlorine resulted in a > 5.0 log10 CFU mL-1 and > 5.0 log10 CFU/coupon reduction of six L. monocytogenes strains within one minute, in suspension tests, and on stainless steel surfaces, respectively. Additionally, there was a reduction by as much as 5 log10 CFU/coupon or 5 log10 CFU/well of reference strains EGDe and Scott A biofilms within five minutes on stainless steel and polystyrene surfaces. Organic material, added as bovine serum albumin at 0.3% (w/v completely prevented the inactivation of L. monocytogenes in 150 mg L-1 chlorine, while reductions of only 0.6 +- 0.1 log10 CFU mL-1 were recorded in the presence of UHT milk at 3% (v/v. In contrast, reductions of 5 log10 CFU mL-1 were recorded within one minute on exposure to 740 mg L-1 QAC in the presence of 0.3% (w/v bovine serum albumin and within two minutes in the presence of 20 % (v/v UHT milk. Although Suma D4 chlorine tablets and Suma Bac D10 QAC are effective listericidal agents at recommended concentrations, Suma Tab D4 chlorine efficacy against L. monocytogenes is impaired by the presence of low concentrations of organic material, while Suma Bac D10 QAC maintains its listericidal activity in high organic loads.

  11. ERIC-PCR技术对单增李斯特菌的溯源分析%Biotracing the source of Listeria monocytogenes strains by enterobacterial repetitive intergenic consensus sequence-based PCR

    Institute of Scientific and Technical Information of China (English)

    刘海泉; 朱颖; 姜文洁; 孙晓红; 吴启华; 潘迎捷; 赵勇

    2013-01-01

    Enterobacterial repetitive intergenic consensus sequence (ERIC )-PCR was used to genotype 17 strains of Listeria monocytogenes,which were isolated from pork samples of the three market,and we investigated the correlation between the genotype,regional distribution and prevalence among L monocytogenes strains. L monocytogenes ATCC 19115 was used as positive control. The result showed that 17 isolates were identified as six special genotypes,and genotype IV was the dominant one as the main pollution group,which were isolated from the third market. The strains isolated from the first and second market were genotype I and genotype IV .respcetively. The result suggested that ERIC-PCR was suitable to investigate the biotracing of L. monocytogenes and it was a more rapid,efficient,and accurate molecular typing method than traditional serotyping methods.%以质控菌株ATCC 19115为对照,采用ERIC-PCR方法对从三个市场猪肉样品分离到的17株单增李斯特菌(Listeria monocytogenes)进行了基因分型,探讨了单增李斯特菌基因型与区域分布及流行性的关联性.结果表明,17株单增李斯特菌菌株可分为六个主要基因类群,其中Ⅳ型菌株最多,为主要污染类群,而这些菌株来自于市场三;市场一和市场二分离到的菌株主要分别为Ⅰ型和Ⅳ型.因此,ERIC-PCR方法适用于对单增李斯特菌的溯源分析和流行病学调查,具有简单、方便、快捷、准确的特点.

  12. Performance of a growth-no growth model for Listeria monocytogenes developed for mayonnaise-based salads: influence of strain variability, food matrix, inoculation level, and presence of sorbic and benzoic acid.

    Science.gov (United States)

    Vermeulen, A; Smigic, N; Rajkovic, A; Gysemans, K; Bernaerts, K; Geeraerd, A; Van Impe, J; Debevere, J; Devlieghere, F

    2007-09-01

    A previously developed growth-no growth model for Listeria monocytogenes, based on nutrient broth data and describing the influence of water activity (a(w)), pH, and acetic acid concentrations, was validated (i) for a variety of L. monocytogenes strains and (ii) in a laboratory-made, mayonnaise-based surimi salad (as an example of a mayonnaise-based salad). In these challenge tests, the influence of the inoculation level was tested as well. Also, the influence of chemical preservatives on the growth probability of L. monocytogenes in mayonnaise-based salads was determined. To evaluate the growth-no growth model performance on the validation data, four quantitative criteria are determined: concordance index, % correct predictions, % fail-dangerous, and % fail-safe. First, the growth probability of 11 L. monocytogenes strains, not used for model development, was assessed in nutrient broth under conditions within the interpolation region. Experimental results were compared with model predictions. Second, the growth-no growth model was assessed in a laboratory-made, sterile, mayonnaise-based surimi salad to identify a possible model completeness error related to the food matrix, making use of the above-mentioned validation criteria. Finally, the effect on L. monocytogenes of common chemical preservatives (sorbic and benzoic acid) at different concentrations under conditions typical of mayonnaise-based salads was determined. The study showed that the growth-no growth zone was properly predicted and consistent for all L. monocytogenes strains. A larger prediction error was observed under conditions within the transition zone between growth-no growth. However, in all cases, the classification between no growth (P = 0) and any growth (P > 0) occurred properly, which is most important for the food industry, where outgrowth needs to be prevented in all instances. The results in the sterile mayonnaise-based salad showed again that the growth-no growth zone was well predicted

  13. Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada

    DEFF Research Database (Denmark)

    Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.

    2017-01-01

    of the SSI-1 (Stress Survival Islet) and LGI1/CC8 (Listeria Genomic Island 1 in a clonal complex 8 background) genetic markers. Genetic sequences from four strains representing different phenotypes were also probed for predicted amino acid differences in biofilm, desiccation, and membrane related genes....... The water isolates were among the most desiccation susceptible strains, while strains exhibiting desiccation resistance harboured SSI-1 or both the SSI-1 and LGI1/CC8 markers. BAC resistance was greatest in planktonic LGI1/CC8 cells (relative to non-LGI1/CC8 cells), and higher BAC concentrations were also...

  14. Oxygen restriction increases the infective potential of Listeria monocytogenes in vitro in Caco-2 cells and in vivo in guinea pigs

    DEFF Research Database (Denmark)

    Andersen, Jens Bo; Roldgaard, Bent; Christensen, Bjarke Bak

    2007-01-01

    Background: Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated...

  15. Processing plant persistent strains of Listeria monocytogenes appear to have a lower virulence potential than clinical strains in selected virulence models

    DEFF Research Database (Denmark)

    Jensen, Anne; Thomsen, L.E.; Jørgensen, R.L.

    2008-01-01

    cell line, Caco-2; time to death in a nematode model, Caenorhabditis elegans and in a fruit fly model, Drosophila melanogaster and fecal shedding in a guinea pig model. All strains adhered to and grew in Caco-2 cells in similar levels. When exposed to 10(6) CFU/ml, two strains representing...

  16. Evaluation of transcription levels of inlA, inlB, hly, bsh and prfA genes in Listeria monocytogenes strains using quantitative reverse-transcription PCR and ability of invasion into human CaCo-2 cells.

    Science.gov (United States)

    Tamburro, Manuela; Sammarco, Michela Lucia; Ammendolia, Maria Grazia; Fanelli, Incoronata; Minelli, Fabio; Ripabelli, Giancarlo

    2015-03-01

    Listeria monocytogenes virulence depends on the activity of well-characterized virulence factors. In this study, transcription levels of inlA, inlB, hly, bsh and prfA genes in L. monocytogenes strains, and the ability of invasion into CaCo-2 cells were investigated. Serotyping, multiplex-PCR for serovar identification and restriction fragment analysis of inlA were performed. Transcription levels and invasiveness were evaluated by quantitative reverse-transcription PCR and by in vitro assays, respectively. The isolates were of serovars 1/2a, 4b, 1/2c, 1/2b and 3a. Full-length inlA profiles were found for nine of ten clinical isolates, while five of seven cultures from foods showed truncated profile. The analysis of transcription levels of virulence factors encoding genes demonstrated a substantial inter-strain heterogeneity, with clinical strains showing higher levels for almost all genes than isolates from food. A correlation between transcription levels of inlA and inlB, as well as between bsh and prfA, was observed. Significant differences between clinical strains and food isolates in the invasion of CaCo-2 cells were found. Analysis of gene transcription and invasiveness of human cells suggests different virulence phenotypes among L. monocytogenes populations, and this characterization could be a useful tool for risk assessment purposes and for the development of public health strategies. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Blanco White and Walter Scott Blanco white y Walter Scott

    Directory of Open Access Journals (Sweden)

    Fernando DURÁN LÓPEZ

    2011-01-01

    Full Text Available The first edition of Ivanhoe; a romance. By the author of Waverley was published in Edinburgh in 1820. From the beginning of year 1823, José María Blanco White translated several excerpts from Ivanhoe in the numbers 1-3 of the magazine Variedades, owned by the publisher Rudolph Ackermann. in these articles and other later writings, the translator praised Scott as a model for a new way of painting history in a narrative. This paper studies his ideas on Scott’s historical novel, as well as his translation technique, compared with that of José Joaquín de Mora. En 1820 se publicó en Edimburgo la primera edición de Ivanhoe; a romance. By the author of Waverley. Desde comienzos de 1823, en los tres primeros números de su revista Variedades, promovida por el editor Rudolph Ackermann, José María Blanco White tradujo varios fragmentos de Ivanhoe entre grandes elogios. Asimismo, Blanco White tomó a Scott como modelo de referencia de una nueva manera de pintar la historia por medio de la novela en otros varios escritos críticos de años posteriores. El artículo estudia las ideas de Blanco White acerca de la novela histórica de Scott y su técnica como traductor, comparada con la de José Joaquín Mora.

  18. Collaborations Between Scott and Skidmore

    Directory of Open Access Journals (Sweden)

    Alicia Robinson

    2017-04-01

    Full Text Available This essay examines the collaboration between architect and designer George Gilbert Scott and metalworker Francis Skidmore. It compares their metalwork screens at the cathedrals of Hereford, Lichfield, and Salisbury—projects which sometimes overlapped and were all completed in the relatively short time span between 1861 and 1870—within the wider context of Skidmore’s career. While Scott was lauded in his lifetime and has been much studied since, Skidmore has not often been written about, despite having achieved an impressive scale and pace of work in British cathedrals, parish churches, and town halls. This essay therefore shines particular light on Skidmore’s work as designer and maker, and particularly the high profile commissions for these great cathedrals, restored and enhanced with the aesthetics and ambition of the Victorian era.

  19. Evolutionary relationships of outbreak-associated Listeria monocytogenes strains of serotypes 1/2a and 1/2b determined by whole genome sequencing

    Science.gov (United States)

    Listeria monocytogenes (Lm) is a bacterial pathogen that is almost exclusively transmitted by food. Although listeriosis is relatively rare (~1600 cases occur annually in the U.S.), ~20% of cases are fatal and outbreaks are not uncommon. Molecular subtyping differentiates Lm into four lineages (LI –...

  20. Listeria monocytogenes strains encoding premature stop codons in inlA invade mice and guinea pig fetuses in orally dosed dams

    DEFF Research Database (Denmark)

    Holch, Anne; Ingmer, Hanne; Licht, Tine Rask

    2013-01-01

    Listeria monocytogenes is an important food-borne bacterial pathogen and listeriosis can result in abortions in pregnant women. The bacterium can colonize food-processing environments, where specific molecular subtypes can persist for years. The purpose of this study was to determine the virulence...

  1. Blanco White and Walter Scott

    Directory of Open Access Journals (Sweden)

    Fernando DURÁN LÓPEZ

    2011-01-01

    Full Text Available The first edition of Ivanhoe; a romance. By the author of Waverley was published in Edinburgh in 1820. From the beginning of year 1823, José María Blanco White translated several excerpts from Ivanhoe in the numbers 1-3 of the magazine Variedades, owned by the publisher Rudolph Ackermann. in these articles and other later writings, the translator praised Scott as a model for a new way of painting history in a narrative. This paper studies his ideas on Scott’s historical novel, as well as his translation technique, compared with that of José Joaquín de Mora.

  2. Determination of Listeria monocytogenes Growth during Mushroom Production and Distribution

    Directory of Open Access Journals (Sweden)

    Dara Leong

    2013-11-01

    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if its numbers do not exceed 100 CFU/g throughout the shelf-life of the food. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Challenge studies to determine the ability of a food to support growth of L. monocytogenes are essential as predictive modelling often overestimates the growth ability of L. monocytogenes. The aim of this study was to determine if growth of L. monocytogenes was supported during the production and distribution of mushrooms. A three-strain mixture of L. monocytogenes was inoculated onto three independent batches of whole mushrooms, sliced mushrooms, mushroom casing and mushroom substrate at a concentration of about 100–1000 CFU/g. The batches were incubated at potential abuse temperatures, as a worst case scenario, and at intervals during storage L. monocytogenes numbers, % moisture and pH were determined. The results showed that the sliced and whole mushrooms had the ability to support growth, while mushroom casing allowed survival but did not support growth. Mushroom substrate showed a rich background microflora that grew on Listeria selective media and this hindered enumeration of L. monocytogenes. In the case of this study, Combase predictions were not always accurate, indicating that challenge studies may be a necessary part of growth determination of L. monocytogenes.

  3. Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments

    Directory of Open Access Journals (Sweden)

    Lucilla Iacumin

    2016-01-01

    Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

  4. Characterization of a plasmid carrying cat, ermB and tetS genes in a foodborne Listeria monocytogenes strain and uptake of the plasmid by cariogenic Streptococcus mutans

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Shi, Lei

    2016-01-01

    A multi-drug resistant (MDR) Listeria monocytogenes isolate (serotype 1/2c) was recovered from a quick-frozen rice flour product collected from Langfang city in northern China. PCR screening identified the presence of cat, ermB and tetS genes. The plasmid profile of the strain showed the presence...... management of listeriosis....

  5. 'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

    Science.gov (United States)

    Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

    2014-03-01

    The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

  6. Spontaneous bacteriocin resistance in Listeria monocytogenes as a susceptibility screen for identifying different mechanisms of resistance and modes of action by bacteriocins of lactic acid bacteria.

    Science.gov (United States)

    Macwana, Sunita; Muriana, Peter M

    2012-01-01

    A practical system was devised for grouping bacteriocins of lactic acid bacteria (LAB) based on mode of action as determined by changes in inhibitory activity to spontaneously-acquired bacteriocin resistance (Bac(R)). Wild type Listeria monocytogenes 39-2 was sensitive to five bacteriocins produced by 3 genera of LAB: pediocin PA-1 and pediocin Bac3 (Pediococcus), lacticin FS97 and lacticin FS56 (Lactococcus), and curvaticin FS47 (Lactobacillus). A spontaneous Bac(R) derivative of L. monocytogenes 39-2 obtained by selective recovery against lacticin FS56 provided complete resistance to the bacteriocin made by Lactococcus lactis FS56. The lacticin FS56-resistant strain of L. monocyotgenes 39-2 was also cross-resistant to curvaticin FS47 and pediocin PA-1, but not to lacticin FS97 or pediocin Bac3. The same pattern of cross-resistance was also observed with Bac(R) isolates obtained with L. monocytogenes Scott A-2. A spontaneous mutation that renders a strain cross-resistant to different bacteriocins indicates that they share a common mechanism of resistance due to similar modes of action of the bacteriocins. Spontaneous resistance was acquired to other bacteriocins (in aggregate) by following the same procedure against which the Bac(R) strain was still sensitive. In subsequent challenge assays, mixtures of bacteriocins of different modes of action provided greater inhibition than mixtures of bacteriocins of the same mode of action (as determined by our screening method). This study identifies a methodical approach to classify bacteriocins into functional groups based on mechanism of resistance (i.e., mode of action) that could be used for identifying the best mixture of bacteriocins for use as biopreservatives.

  7. Effect of inoculation of Carnobacterium divergens V41, a bio-preservative strain against Listeria monocytogenes risk, on the microbiological, chemical and sensory quality of cold-smoked salmon.

    Science.gov (United States)

    Brillet, Anne; Pilet, Marie-France; Prevost, Hervé; Cardinal, Mireille; Leroi, Françoise

    2005-10-25

    The aim of this study was to develop a bio-preservation strategy for cold-smoked salmon (CSS) by the use of lactic acid bacteria previously selected for their capability to inhibit the growth of Listeria monocytogenes in the product. The spoiling potential of three Carnobacterium strains (Carnobacterium divergens V41, Carnobacterium piscicola V1 and SF668) was tested in sterile CSS blocks inoculated by 10(4-5) CFU g(-)(1) and stored under vacuum for 9 days at 4 degrees C followed by 19 days at 8 degrees C. C. divergens V41 grew a little faster than the other strains and none of the three carnobacteria showed any adverse effect on quality of the product, i.e. no off-odour detected by a trained panel, no total volatile basic nitrogen (TVBN) production, no acidification and no biogenic amine except a slight production of tyramine. An application on commercial CSS was tested by spraying C. divergens V41 (10(4-5) CFU g(-1)) on slices of four batches freshly processed in different smoke-houses. Microbial, chemical and sensory characteristics were weekly compared to a control during 4 weeks of vacuum storage. When the natural microflora was initially weak (two batches10(4-5) CFU g(-1)), no effect on the microflora, TVBN and biogenic amine production, nor on the sensory characteristics was observed in presence of C. divergens V41. In conclusion, bio-preservation of CSS using lactic acid bacteria such as C. divergens V41 is a promising way to inhibit the growth of pathogenic bacteria such as L. monocytogenes with low effect on the quality of the product.

  8. Inactivation of Listeria monocytogenes in Skim Milk and Liquid Egg White by Antimicrobial Bottle Coating with Polylactic Acid and Nisin

    Science.gov (United States)

    This study was to develop an antimicrobial bottle coating method to reduce the risk of outbreaks of human listeriosis caused by contaminated liquid foods. Liquid egg white and skim milk were inoculated with Listeria monocytogenes Scott A and stored in glass jars that were coated with a mixture of po...

  9. Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Jozi Fagundes de Mello

    2008-03-01

    Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

  10. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  11. Faults--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the faults for the geologic and geomorphic map of the Offshore of Scott Creek map area, California. The vector data file is...

  12. Folds--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the folds for the geologic and geomorphic map of the Offshore of Scott Creek map area, California. The vector data file is...

  13. Folds--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the folds for the geologic and geomorphic map of the Offshore of Scott Creek map area, California. The vector data file is...

  14. Faults--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the faults for the geologic and geomorphic map of the Offshore of Scott Creek map area, California. The vector data file is...

  15. Habitat--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the habitat map of the seafloor of the Offshore of Scott Creek map area, California. The vector data file is included in...

  16. Bathymetry--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the bathymetry and shaded-relief maps of Offshore Scott Creek, California. The raster data file is included in...

  17. Bathymetry Hillshade--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the bathymetry and shaded-relief maps of Offshore Scott Creek, California. The raster data file is included in...

  18. Contours--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the bathymetric contours for several seafloor maps of the Offshore Scott Creek map area, California. The vector data file is...

  19. Bathymetry--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the bathymetry and shaded-relief maps of Offshore Scott Creek, California. The raster data file is included in...

  20. Habitat--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the habitat map of the seafloor of the Offshore of Scott Creek map area, California. The vector data file is included in...

  1. Contours--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the bathymetric contours for several seafloor maps of the Offshore Scott Creek map area, California. The vector data file is...

  2. Bathymetry Hillshade--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the bathymetry and shaded-relief maps of Offshore Scott Creek, California. The raster data file is included in...

  3. ASK Talks with W. Scott Cameron

    Science.gov (United States)

    Cameron, W. Scott

    2002-01-01

    This paper presents an interview with Scott Cameron who is the Capital Systems Manager for the Food and Beverage Global Business Unit of Procter and Gamble. He has been managing capital projects and mentoring other project managers for the past 20 years at Procter and Gamble within its Beauty Care, Health Care, Food and Beverage, and Fabric and Home Care Businesses. Scott also has been an Academy Sharing Knowledge (ASK) feature writer since Volume One.

  4. Oral Immunization with Recombinant Listeria monocytogenes Controls Virus Load after Vaginal Challenge with Feline Immunodeficiency Virus

    OpenAIRE

    Stevens, Rosemary; Howard, Kristina E.; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A

    2004-01-01

    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and del...

  5. Listeria monocytogenes in Smoked Salmon and Other Smoked Fish at Retail in Italy: Frequency of Contamination and Strain Characterization in Products from Different Manufacturers.

    Science.gov (United States)

    Acciari, Vicdalia Aniela; Torresi, Marina; Iannetti, Luigi; Scattolini, Silvia; Pomilio, Francesco; Decastelli, Lucia; Colmegna, Silvia; Muliari, Riccardo; Bossù, Teresa; Proroga, Yolande; Montagna, Cosimo; Cardamone, Cinzia; Cogoni, Paola; Prencipe, Vincenza Annunziata; Migliorati, Giacomo

    2017-02-01

    Seven hundred seventy-eight samples of packaged smoked fish (774 smoked salmon and 4 smoked swordfish) on sale in Italy, from 50 different manufacturers located in 12 European Union countries, were purchased from the Italian market between May and December 2011. The surface temperatures of the samples on sale ranged from 0 to 13°C (3.4 ± 1.5°C, mean ± SD). Six hundred eighty (87.4%) of 778 samples were stored at ≤4°C. One hundred fifty-seven samples (20.2%, 95% confidence interval 17.5 to 23.1%) were contaminated by Listeria monocytogenes , with 26 samples (3.3%, 95% confidence interval 2.3 to 4.8%) at levels >100 CFU/g. The maximum level of contamination was 1.3 ×10(6) CFU/g. The differences in the level of contamination of smoked fish between countries (χ(2) = 91.54, P frequency of detection for products from different manufacturing premises ranged from 0 to 76.9%. Serotyping by serological agglutination revealed that the main serotypes detected were 1/2a (65.3%) and 1/2b (22.4%). Pulsed-field gel electrophoresis typing with restriction enzymes AscI and ApaI yielded 36 pulsotypes from 144 isolates, clustering into 17 groups. Eight main pulsotypes accounted for 70.8% of the isolates. Three of the main pulsotypes were exclusively from products of a single manufacturer. In general, products from the same manufacturer showed genetic homogeneity, with one strongly prevalent pulsotype. Different manufacturers usually showed very different levels of contamination of the final product, confirming the importance of the management of process hygiene for controlling L. monocytogenes contamination.

  6. Evolutionary dynamics of the accessory genome of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Henk C den Bakker

    Full Text Available Listeria monocytogenes, a foodborne bacterial pathogen, is comprised of four phylogenetic lineages that vary with regard to their serotypes and distribution among sources. In order to characterize lineage-specific genomic diversity within L. monocytogenes, we sequenced the genomes of eight strains from several lineages and serotypes, and characterized the accessory genome, which was hypothesized to contribute to phenotypic differences across lineages. The eight L. monocytogenes genomes sequenced range in size from 2.85-3.14 Mb, encode 2,822-3,187 genes, and include the first publicly available sequenced representatives of serotypes 1/2c, 3a and 4c. Mapping of the distribution of accessory genes revealed two distinct regions of the L. monocytogenes chromosome: an accessory-rich region in the first 65° adjacent to the origin of replication and a more stable region in the remaining 295°. This pattern of genome organization is distinct from that of related bacteria Staphylococcus aureus and Bacillus cereus. The accessory genome of all lineages is enriched for cell surface-related genes and phosphotransferase systems, and transcriptional regulators, highlighting the selective pressures faced by contemporary strains from their hosts, other microbes, and their environment. Phylogenetic analysis of O-antigen genes and gene clusters predicts that serotype 4 was ancestral in L. monocytogenes and serotype 1/2 associated gene clusters were putatively introduced through horizontal gene transfer in the ancestral population of L. monocytogenes lineage I and II.

  7. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

    Science.gov (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  8. Determination of thermal inactivation kinetics of Listeria monocytogenes in chicken meat by isothermal and dynamic methods

    Science.gov (United States)

    The objective of this research is to determine the thermal inactivation kinetics of Listeria monocytogenes in chicken breast meat using both isothermal and dynamic conditions. A four-strain cocktail of L. monocytogenes was inoculated to chicken breast meat. Isothermal studies were performed by sub...

  9. The Ornery American: Orson Scott Card

    Science.gov (United States)

    Oatman, Eric

    2008-01-01

    This article profiles Orson Scott Card, the winner of this year's Margaret A. Edwards Award for his outstanding contributions to teen literature, specifically for Ender's Game and Ender's Shadow (1999, both Tor), a companion tale. Card, the magician behind both of these best sellers, is one of the nation's most prolific--and contentious--authors.…

  10. Reframing Michael Scott: Exploring Inappropriate Workplace Communication

    Science.gov (United States)

    Schaefer, Zachary A.

    2010-01-01

    Individuals who work in professional settings interact with others who may exhibit a variety of cultural beliefs and decision-making approaches. Page (2007) argues that cognitive diversity (i.e., how people approach and attempt to solve problems) is a vital asset in effective organizations. Michael Scott, who portrays the inept main character on…

  11. Astronaut Scott Carpenter tests balance mechanism performance

    Science.gov (United States)

    1961-01-01

    Astronaut M. Scott Carpenter's balance mechanism performance is tested by his walking on a narrow board in his bare feet. He is performing this test at the School of Aviation Medicine, Pensicola, Florida (04570); Carpenter walks a straight line by putting one foot directly in front of the other to test his balance (04571).

  12. Interview met professor Joan Wallach Scott

    NARCIS (Netherlands)

    Bijl, Greetje; Tijhoff, Esmeralda

    2012-01-01

    Joan Scott, professor at the School of Social Science in the Institute for Avanced Study in Princeton, New Jersey (USA), was the keynote speaker at the conference 'Uitsluitend emancipatie' in de Beurs van Berlage in Amsterdam in October 2012. An interview on gender, history, feminism and her book

  13. Poles apart: Scott, Amundsen and science.

    Science.gov (United States)

    Larson, Edward J

    2011-12-01

    One hundred years ago, teams led by Roald Amundsen and Robert Scott may have been heading in the same direction but they were poles apart in the way they sought their goals. Amundsen led a five-person team of expert Nordic skiers and dog-sledders with a single goal: getting to the South Pole first. He planned and executed the effort brilliantly. Scott, in contrast, led a complex and multi-faceted Antarctic expedition with 33 explorers and scientists, many of whom were focused on ambitious and often taxing scientific research projects that had nothing whatsoever to do with reaching the Pole. Although Scott failed to reach the South Pole first and died with four men on the return trip, his expedition made significant contributions to Antarctic science. Indeed, at least some of Scott's failure to reach the Pole first and the subsequent death of his polar party on the return trip can be attributed to burden of trying to do too much and not focusing on reaching the pole.

  14. Interview met professor Joan Wallach Scott

    NARCIS (Netherlands)

    Bijl, Greetje; Tijhoff, Esmeralda

    2012-01-01

    Joan Scott, professor at the School of Social Science in the Institute for Avanced Study in Princeton, New Jersey (USA), was the keynote speaker at the conference 'Uitsluitend emancipatie' in de Beurs van Berlage in Amsterdam in October 2012. An interview on gender, history, feminism and her book Th

  15. The Ornery American: Orson Scott Card

    Science.gov (United States)

    Oatman, Eric

    2008-01-01

    This article profiles Orson Scott Card, the winner of this year's Margaret A. Edwards Award for his outstanding contributions to teen literature, specifically for Ender's Game and Ender's Shadow (1999, both Tor), a companion tale. Card, the magician behind both of these best sellers, is one of the nation's most prolific--and contentious--authors.…

  16. Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga.

    Science.gov (United States)

    Akya, Alisha; Pointon, Andrew; Thomas, Connor

    2010-03-01

    Listeria monocytogenes is a ubiquitous bacterium capable of infecting humans, particularly pregnant women and immunocompromised individuals. Although the intracellular invasion and pathogenesis of listeriosis in mammalian tissues has been well studied, little is known about the ecology of L. monocytogenes , and in particular the environmental reservoir for this bacterium has not been identified. This study used short-term co-culture at 15, 22 and 37 degrees C to examine the interaction of L. monocytogenes strains with Acanthamoeba polyphaga ACO12. Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within a few hours post-phagocytosis, irrespective of the incubation temperature used. Wild-type L. monocytogenes and a phenotypic listeriolysin O mutant were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls were able to survive and multiply within A. polyphaga trophozoites. The data presented indicate that A. polyphaga ACO12 is unlikely to harbour L. monocytogenes, or act as an environmental reservoir for this bacterium.

  17. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  18. Listeria monocytogenes endocarditis.

    Science.gov (United States)

    Sheinman, B D; Evans, T; Sage, R

    1985-01-01

    A fatal case of endocarditis due to Listeria monocytogenes is reported. Case reports of endocarditis due to this organism are rare but indicate a higher mortality than with many other causes of bacterial endocarditis. The size of the problem may be underestimated because the organism has a "diphtheroid' appearance and may be incorrectly dismissed as a contaminant.

  19. Inflammasome-Mediated Inhibition of Listeria monocytogenes-Stimulated Immunity Is Independent of Myelomonocytic Function

    Science.gov (United States)

    Williams, Cassandra R.; Dustin, Michael L.; Sauer, John-Demian

    2013-01-01

    Activation of the Nlrc4 inflammasome results in the secretion of IL-1β and IL-18 through caspase-1 and induction of pyroptosis. L. monocytogenes engineered to activate Nlrc4 by expression of Legionella pneumophilia flagellin (L. monocytogenes L.p.FlaA) are less immunogenic for CD8+ T cell responses than wt L. monocytogenes. It is also known that IL-1β orchestrates recruitment of myelomonocytic cells (MMC), which have been shown to interfere with T cell-dendritic cells (DC) interactions in splenic white pulp (WP), limiting T cell priming and protective immunity. We have further analyzed the role of MMCs in the immunogenicity of L. monocytogenes L.p.FlaA. We confirmed that MMCs infiltrate the WP between 24–48 hours in response to wt L. monocytogenes infection and that depletion of MMCs enhances CD8+ T cell priming and protective memory. L. monocytogenes L.p.FlaA elicited accelerated recruitment of MMCs into the WP. While MMCs contribute to control of L. monocytogenes L.p.FlaA, MMC depletion did not increase immunogenicity of L.p.FlaA expressing strains. There was a significant decrease in L. monocytogenes L.p.FlaA in CD8α+ DCs independent of MMCs. These findings suggest that limiting inflammasome activation is important for bacterial accumulation in CD8α+ DCs, which are known to be critical for T cell response to L. monocytogenes. PMID:24349458

  20. Inflammasome-mediated inhibition of Listeria monocytogenes-stimulated immunity is independent of myelomonocytic function.

    Directory of Open Access Journals (Sweden)

    Cassandra R Williams

    Full Text Available Activation of the Nlrc4 inflammasome results in the secretion of IL-1β and IL-18 through caspase-1 and induction of pyroptosis. L. monocytogenes engineered to activate Nlrc4 by expression of Legionella pneumophilia flagellin (L. monocytogenes L.p.FlaA are less immunogenic for CD8(+ T cell responses than wt L. monocytogenes. It is also known that IL-1β orchestrates recruitment of myelomonocytic cells (MMC, which have been shown to interfere with T cell-dendritic cells (DC interactions in splenic white pulp (WP, limiting T cell priming and protective immunity. We have further analyzed the role of MMCs in the immunogenicity of L. monocytogenes L.p.FlaA. We confirmed that MMCs infiltrate the WP between 24-48 hours in response to wt L. monocytogenes infection and that depletion of MMCs enhances CD8(+ T cell priming and protective memory. L. monocytogenes L.p.FlaA elicited accelerated recruitment of MMCs into the WP. While MMCs contribute to control of L. monocytogenes L.p.FlaA, MMC depletion did not increase immunogenicity of L.p.FlaA expressing strains. There was a significant decrease in L. monocytogenes L.p.FlaA in CD8α(+ DCs independent of MMCs. These findings suggest that limiting inflammasome activation is important for bacterial accumulation in CD8α(+ DCs, which are known to be critical for T cell response to L. monocytogenes.

  1. Case of Contamination by Listeria Monocytogenes in Mozzarella Cheese

    Science.gov (United States)

    Tolli, Rita; Bossù, Teresa; Rodas, Eda Maria Flores; Di Giamberardino, Fabiola; Di Sirio, Alessandro; Vita, Silvia; De Angelis, Veronica; Bilei, Stefano; Sonnessa, Michele; Gattuso, Antonietta; Lanni, Luigi

    2014-01-01

    Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control). In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination. PMID:27800317

  2. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    DEFF Research Database (Denmark)

    Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.

    2008-01-01

    -type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10) were similar in activity profile (MIC value spectrum......) to the human β-defensin 3 (HBD-3). All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model...

  3. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  4. Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

    DEFF Research Database (Denmark)

    Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

    2013-01-01

    that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...

  5. Characterization of Antimicrobial Resistance of Listeria monocytogenes Strains Isolated from a Pork Processing Plant and Its Respective Meat Markets in Southern China

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei;

    2016-01-01

    ) being predominant (42.3%, 33/78). Antimicrobial resistance was most frequently observed for tetracycline (20.5%, 16/78), streptomycin (9.0%, 7/78), cefotaxime (7.7%, 6/78), and gentamicin (6.4%, 5/78). Multiple resistances occurred among 10.2% (8/78) isolates. All strains were sensitive to ampicillin...

  6. Alternative methodology for Scott-Knott test

    Directory of Open Access Journals (Sweden)

    Leonardo Lopes Bhering

    2008-01-01

    Full Text Available The test proposed by Scott Knott (1974, a procedure of means grouping, is an effective alternative to performprocedures of multiple comparisons without ambiguity. This study aimed to propose a modification related to the partitioningand means grouping in the said procedure, to obtain results without ambiguity among treatments, organized in morehomogeneous groups. In the proposed methodology, treatments that did not participate in the initial group are joined for a newanalysis, which allows for a better group distribution. In a comparative study, four experiments were simulated in a randomizedcomplete block design. The first consisted of 10 and the other 3 of 100 treatments. All experiments were performed in threereplications at a significance level of 0.05 for the means grouping test. Only in the third experiment of those of 100 treatmentsthe groups formed by Scott-Knott did not differ from the methodology proposed here. The proposed methodology is consideredeffective, aiming at the identification of elite cultivar groups for recommendation.

  7. In Vitro Evaluation of Bacteriocins Activity Against Listeria monocytogenes Biofilm Formation.

    Science.gov (United States)

    Camargo, Anderson Carlos; de Paula, Otávio Almeida Lino; Todorov, Svetoslav Dimitrov; Nero, Luís Augusto

    2016-03-01

    The present study aimed to assess the activity of cell-free supernatant (CFS) containing bacteriocins on the formation and maintenance of biofilms developed by Listeria monocytogenes, and the associated effect of bacteriocins and ethylene-diamine-tetra-acetic acid (EDTA) on the formed biofilm. CFS from 9 lactic acid bacteria (LAB) strains was tested for inhibitory activity against 85 L. monocytogenes isolates and 21 LAB strains. Then, 12 L. monocytogenes strains were selected based on genetic profiles and sensitivity to CFS and were subjected to an in vitro assay to assess biofilm formation in microtiter plates, considering different culture media and incubation conditions. Based on these results, 6 L. monocytogenes strains were subjected to the same in vitro procedure to assess biofilm formation, being co-inoculated with CFS. In addition, these strains were subjected to the same in vitro procedure, modified by adding the CFS after biofilm formation. Relevant decrease in biofilm formation was observed in the first experiment, but CFS added after biofilm formation did not eliminate them. CFS from Lactobacillus curvatus ET31 were selected due to its anti-biofilm activity, being associated to EDTA at different concentrations and tested for biofilm control of three strains of L. monocytogenes, using the same in vitro procedure described previously. Concentrated bacteriocin presented poor performance in eliminating formed biofilms, and EDTA concentration presented no evident interference on biofilm elimination. Twelve selected L. monocytogenes strains were positive for investigated virulence makers and negative for luxS gene, recognized as being involved in biofilm formation. Selected L. monocytogenes strains were able to produce biofilms under different conditions. CFSs have the potential to prevent biofilm formation, but they were not able to destroy already formed biofilms. Nevertheless, low concentrations of CFS combined with EDTA caused a relevant reduction in

  8. Inhibition of Listeria monocytogenes growth by using combined bacteriocin-producing strains in raw beef%产抗菌素乳酸菌的组合应用对牛肉中李斯特菌污染的抑制作用研究

    Institute of Scientific and Technical Information of China (English)

    张佩华; 谷贵章; 张进杰; 陈健初

    2011-01-01

    The synergy inhibition of two lactic acid bacteria strains, Lactobacillus curvatus and Pediococcus acidilactici H,on the growth of Listeria monocytogenes in frozen beef was investigated. A Lactobacillus curvatus strain( producing the bacteriocin sakacin P)and a Pediococcus acidilactici H (producing bacteriocin pediocin AcH)were inoculated alone or together in a Listeria-seeded raw pork meat which was stored at 4℃ for 6 weeks.The growth of Listeria monocytogenes was controlled by adding either LAB strain alone,yet the rebound appeared after one-week storage. However,the time of inhibition was prolonged by adding combined these two LAB strains to 6 weeks, after when the Listeria monocytogenes had a rebound with the cfu count lower than 10cfu · g-1.Therefore, using the combined these two LAB strains can effectively delay the rebound of Listeria monocytogenes in the beef.%研究了弯曲乳酸杆菌和乳酸片球菌对低温冷藏牛肉中李斯特菌的混合协同抑制作用.李斯特菌、弯曲乳酸杆菌(产细菌素sakacin P)和乳酸片球菌(产生片球菌素AcH),单独或混合接种于冷鲜牛肉中,4℃下储藏6周.单一接种弯曲乳酸杆菌或乳酸片球菌均能对李斯特菌起到抑制作用,但一周后均出现李斯特菌再次污染现象;然而混合接种弯曲乳酸杆菌和乳酸片球菌能将对李斯特菌的抑制期延长至第六周,之后才出现反弹现象,且李斯特菌数低于10cfu·g-1.因此,应用组合产细菌素菌株能有效延长对李斯特菌的抑制作用.

  9. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    DEFF Research Database (Denmark)

    Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.;

    2008-01-01

    Background Host defense peptides (HDPs), or antimicrobial peptides (AMPs), are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases......-type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10) were similar in activity profile (MIC value spectrum...

  10. Role of Efflux Pumps in Adaptation and Resistance of Listeria monocytogenes to Benzalkonium Chloride

    Science.gov (United States)

    Romanova, N. A.; Wolffs, P. F. G.; Brovko, L. Y.; Griffiths, M. W.

    2006-01-01

    In this study, potential mechanisms underlying resistance and adaptation to benzalkonium chloride (BC) in Listeria monocytogenes were investigated. Two groups of strains were studied. The first group consisted of strains naturally sensitive to BC which could be adapted to BC. The second group consisted of naturally resistant strains. For all adapted isolates, there was a correlation between the resistance to BC and ethidium bromide, but this was not the case for the naturally resistant isolates. To investigate the role of efflux pumps in adaptation or resistance, reserpine, an efflux pump inhibitor, was added to the strains. Addition of reserpine to the sensitive and adapted strains resulted in a decrease in the MIC for BC, whereas no such decrease was observed for the resistant strains, indicating that efflux pumps played no role in the innate resistance of certain strains of L. monocytogenes to this compound. Two efflux pumps (MdrL and Lde) have been described in L. monocytogenes. Studies showed low and intermediate levels of expression of the genes encoding the efflux pumps for two selected resistant strains, H7764 and H7962, respectively. Adaptation to BC of sensitive isolates of L. monocytogenes resulted in significant increases in expression of mdrl (P < 0.05), but no such increase was observed for lde for two adapted strains of L. monocytogenes, LJH 381 (P = 0.91) and C719 (P = 0.11). This indicates that the efflux pump Mdrl is at least partly responsible for the adaptation to BC. PMID:16672496

  11. 单核细胞增生性李斯特菌prfA基因缺失株的构建及其生物学特性%Construction and characterization of Listeria monocytogenes ΔprfA mutant strains

    Institute of Scientific and Technical Information of China (English)

    白春光; 殷月兰; 贾艳艳; 付红; 高云飞; 焦新安

    2011-01-01

    [目的]单核细胞增生性李斯特菌(Lm)是人兽共患李斯特菌病的病原菌,其致病性与调控因子PrfA蛋白作用下毒力基因的表达有着密切关系,本文初步探讨了PrfA蛋白对细菌毒力因子的调控作用.[方法]利用同源重组技术对血清型分别为1/2a和4b的LM4、F4636进行prfA基因的敲除,并构建其回复突变株,对获得的突变株LM4ΔprfA、F4636ΔprfA进行生物学特性研究.[结果]实验结果表明:两株缺失株的溶血活性丧失、回复突变株的溶血活性得到恢复,突变株还丧失磷脂酶活性,黏附和侵袭特性显著下降(P<0.05),对BALB/c小鼠的半数致死剂量提高了105个数量级.[结论]由此表明,PrfA蛋白对hly、plcB、inl家族基因的表达及细菌毒力具有重要的调控作用.prfA基因缺失株的构建为进一步研究PrfA蛋白的调控功能提供了材料,为研究其在Lm致病性中的作用奠定了基础.%[Objective] Listeria monocytogenes ( Lm) is an important pathogen that can cause serious listeriosis in humans and animals. The pathogenicity of Lm has a close relationship with the PrfA protein regulating the expression of virulence genes. Therefore, we studied the regulation functions of PrfA and its role on Lm's virulence. [Methods] The prfA genes of LM4, serotype l/2a, and F4636, serotype 4b, were deleted by homologous recombination technology, and the biological characteristics of the mutants were further studied. [ Results ] The prfA gene deleted strains LM4△prfA and F4636△prfA and their back mutation strains were successfully constructed. The results show that the hemolysis activity was lost in prfA deleted strains and was recovered in the reverse mutant strains. The prfA deleted strains lost phospholipase activity; their adhesion and invasion ability significantly decreased. Furthermore, their 50% lethal doses ( LD50) were 5 logs higher comparing with wild type strains. [Conclusion] PrfA regulates hly, plcB and inl gene

  12. Molecular Serotyping and Pathogenic Potential of Listeria monocytogenes Isolated from Milk and Milk Products in Tamil Nadu, India.

    Science.gov (United States)

    Karthikeyan, Raman; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2015-06-01

    Listeria monocytogenes, an important bacterial pathogen, is responsible for foodborne illnesses worldwide. Examination of food samples for the presence of L. monocytogenes and assessment of their pathogenicity is usually an effective strategy in the prevention of listeriosis. In the present study, we have tested 307 samples of milk and milk products from various places in Tamil Nadu, India for the presence of L. monocytogenes using ISO 11290 and U.S. Food and Drug Administration Bacteriological Analytical Manual methods. 16S rDNA sequencing and duplex polymerase chain reaction (PCR) analysis for prs and iap genes were used to identify L. monocytogenes at the species level. Fifteen of the 307 samples screen tested positive for L. monocytogenes. Molecular serotyping of the L. monocytogenes isolates by multiplex PCR revealed the predominance of the serogroups 1/2a and 4b. Fourteen of the 15 isolates contained all the virulence genes (inlA, inlB, hlyA, and plcA) screened for using multiplex PCR. Only one isolate of L. monocytogenes was negative for the plcA gene and in vitro phosphatidylinositol-phospholipase C activity. L. monocytogenes strains that belong to the serogroup 4b exhibited higher nematocidal activity against Caenorhabditis elegans than the serogroup 1/2a. Worms infected with L. monocytogenes were symptomatic with aberrant contraction of body muscles, loss of pharyngeal pumping, and decreased locomotion, which highlights the pathogenic potential of the L. monocytogenes isolates.

  13. Transferable tetracycline resistance in Listeria monocytogenes from food in Italy.

    Science.gov (United States)

    Pourshaban, Manoocheher; Ferrini, Anna Maria; Mannoni, Veruscka; Oliva, Brunello; Aureli, Paolo

    2002-07-01

    Mechanisms of tetracycline resistance were investigated in two recent Listeria monocytogenes isolates from food, with L. innocua 52P tet(r) as a control. Tetracycline resistance was transferred conjugatively from all three strains to L. ivanovii and from one isolate and the control to Enterococcus faecalis. Molecular analysis demonstrated a chromosomal location for the tet determinant, which was identified as tetM in all cases. These studies are the first to show that L. monocytogenes from food could be a source of tetracycline resistance genes able to spread to other micro-organisms.

  14. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne

    2010-01-01

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L...... monocytogenes in food processing environments and the purpose of the present study was to determine ability of L monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative...... humidities (RHs) during desiccation decreased significantly (p...

  15. Population Structure of Listeria monocytogenes Serotype 4b Isolates from Sporadic Human Listeriosis in the United States, 2003-2008

    Science.gov (United States)

    Listeria monocytogenes can cause severe foodborne disease (listeriosis). Serotype 4b strains have resulted in numerous outbreaks, repeatedly involving three epidemic clones (ECI, ECII, and ECIa). Little is known about population structure of L. monocytogenes serotype 4b from sporadic listeriosis, ev...

  16. Growth control of Listeria monocytogenes on cold-smoked salmon using a competitive lactic acid bacteria flora

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Gram, Lone; Huss, Hans Henrik

    1999-01-01

    . sake LKE5 caused strong sulfurous off-flavors and was rejected as a culture for biopreservation of cold-smoked salmon. A bacteriocin-producing strain of C. piscicola (A9b) initially caused a 7-day lag phase of L. monocytogenes, followed by a reduction in numbers of L. monocytogenes from 10(3) CFU...

  17. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)

    Bahador

    2015-08-01

    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  18. Evolution and Diversity of Listeria monocytogenes from Clinical and Food Samples in Shanghai, China

    Directory of Open Access Journals (Sweden)

    Jianmin Zhang

    2016-07-01

    Full Text Available Listeria monocytogenes is a significant foodborne pathogen causing severe systemic infections in humans with high mortality rates. The objectives of this work were to establish a phylogenetic framework of L. monocytogenes from China and to investigate sequence diversity among different serotypes. We selected 17 L. monocytogenes strains recovered from patients and foods in China representing serotypes 1/2a, 1/2b, and 1/2c. Draft genome sequences were determined using Illumina MiSeq technique and associated protocols. Open reading frames were assigned using prokaryotic genome annotation pipeline by NCBI. Twenty-four published genomes were included for comparative genomic and phylogenetic analysis. More than 154,000 single nucleotide polymorphisms (SNPs were identified from multiple genome alignment and used to reconstruct maximum likelihood phylogenetic tree. The 41 genomes were differentiated into lineages I and II, which consisted of 4 and 11 subgroups, respectively. A clinical strain from China (SHL009 contained significant SNP differences compared to the rest genomes, whereas clinical strain SHL001 shared most recent common ancestor with strain SHL017 from food. Moreover, clinical strains SHL004 and SHL015 clustered together with two strains (08-5578 and 08-5923 recovered from an outbreak in Canada. Partial sequences of a plasmid found in the Canadian strain were also present in SHL004. We investigated the presence of various genes and gene clusters associated with virulence and subgroup-specific genes, including internalins, L. monocytogenes pathogenicity islands (LIPIs, L. monocytogenes genomic islands (LGIs, stress survival islet 1 (SSI-1, and clustered regularly interspaced short palindromic repeats (CRISPR/cas system. A novel genomic island, denoted as LGI-2 was identified. Comparative sequence analysis revealed differences among the L. monocytogenes strains related to virulence, survival abilities, and attributes against foreign genetic

  19. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model - Towards an international standard

    DEFF Research Database (Denmark)

    D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.;

    2004-01-01

    A PCR assay with an internal amplification control was developed for Listeria monocytogenes. The assay has a 99% detection probability of seven cells per reaction. When tested against 38 L. monocytogenes strains and 52 nontarget strains, the PCR assay was 100% inclusive (positive signal from target...... be appropriate for international standardization....

  20. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  1. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  2. Modeling the growth of Listeria monocytogenes on cut cantaloupe, honeydew and watermelon.

    Science.gov (United States)

    Danyluk, Michelle D; Friedrich, Loretta M; Schaffner, Donald W

    2014-04-01

    A recent outbreak linked to whole cantaloupes underscores the importance of understanding growth kinetics of Listeria monocytogenes in cut melons at different temperatures. Whole cantaloupe, watermelon, and honeydew purchased from a local supermarket were cut into 10 ± 1 g cubes. A four-strain cocktail of L. monocytogenes from food related outbreaks was used to inoculate fruit, resulting in ~10(3) CFU/10 g. Samples were stored at 4, 10, 15, 20, or 25 °C and L. monocytogenes were enumerated at appropriate time intervals. The square root model was used to describe L. monocytogenes growth rate as a function of temperature. The model was compared to prior models for Salmonella and Escherichia coli O157:H7 growth on cut melon, as well as models for L. monocytogenes on cantaloupe and L. monocytogenes ComBase models. The current model predicts faster growth of L. monocytogenes vs. Salmonella and E. coli O157:H7 at temperatures below 20 °C, and agrees with estimates from ComBase Predictor, and a corrected published model for L. monocytogenes on cut cantaloupe. The model predicts ~4 log CFU increase following 15 days at 5 °C, and ∼1 log CFU increase following 6 days at 4 °C. The model can also be used in subsequent quantitative microbial risk assessments.

  3. Susceptibility of Listeria monocytogenes biofilms and planktonic cultures to hydrogen peroxide in food processing environments.

    Science.gov (United States)

    Yun, Hyun Sun; Kim, Younghoon; Oh, Sejong; Jeon, Woo Min; Frank, Joseph F; Kim, Sae Hun

    2012-01-01

    Recent studies have indicated that Listeria monocytogenes formed biofilms on the surface of food processing equipment, and may survive sanitization treatments. The purpose of this study was to compare the susceptibility of L. monocytogenes grown in either a biofilm or planktonic culture when exposed to hydrogen peroxide (H(2)O(2)). Twelve strains of biofilm-forming L. monocytogenes and their planktonic counterparts were treated with various concentrations of H(2)O(2) (1, 6, and 10%), and the cell survival was then determined at 10-min exposure intervals. When grown as a biofilm, L. monocytogenes was significantly more resistant to H(2)O(2) than under planktonic culture conditions. Planktonic L. monocytogenes strains exhibited significantly different susceptibility to 1% H(2)O(2). Equally interestingly, biofilms of the 12 L. monocytogenes strains also inhibited different survival rates after being treated with 6 and 10% H(2)O(2). However, most of the biofilms recovered to a population of 2-9 log CFU/glass fiber filter (GFF) after a 24-h re-growth period. These results indicate that there was no significant correlation between the H(2)O(2) resistance of biofilm- and planktonic-cultured cells, and suggest that different mechanisms for the resistance to sanitation or disinfection underly the persistence of certain strains in food-processing environments.

  4. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile

    NARCIS (Netherlands)

    Montero, David; Bodero Baeza, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M.; Vidal, Maricel

    2015-01-01

    Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low

  5. Listeria monocytogenes Infection in a Sugar Glider (Petaurus breviceps) - New Mexico, 2011.

    Science.gov (United States)

    Nichols, M; Takacs, N; Ragsdale, J; Levenson, D; Marquez, C; Roache, K; Tarr, C L

    2015-06-01

    Listeria monocytogenes is a Gram-positive, facultative anaerobic, rod-shaped bacterium that can infect and cause disease in many species. In this case report, we describe a case of L. monocytogenes infection causing sepsis in a sugar glider (Petaurus breviceps). The sugar glider consumed a varied diet consisting of human food items, including cantaloupe. A nationwide outbreak of L. monocytogenes foodborne illness associated with cantaloupes occurred simultaneously with this incident case. In this case, the bacterial strains from the outbreak and glider were genetically distinct. Although rare, veterinarians should be aware of the emergence of foodborne pathogens' ability to infect exotic animals residing in domestic environments.

  6. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nascimento Maria da Graça F.

    1994-01-01

    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.

  7. Philip Glass, Scott Walker ja Sigur Ros! / Immo Mihkelson

    Index Scriptorium Estoniae

    Mihkelson, Immo, 1959-

    2007-01-01

    Pimedate Ööde 11. filmifestivali muusikafilme - Austraalia "Glass: Philipi portree 12 osas" (rež. Scott Hicks), Islandi "Sigur Ros kodus" (rež. Dean DeBois), Suurbritannia "Scott Walker: 30 Century Man" (rež. Stephen Kijak)

  8. Philip Glass, Scott Walker ja Sigur Ros! / Immo Mihkelson

    Index Scriptorium Estoniae

    Mihkelson, Immo, 1959-

    2007-01-01

    Pimedate Ööde 11. filmifestivali muusikafilme - Austraalia "Glass: Philipi portree 12 osas" (rež. Scott Hicks), Islandi "Sigur Ros kodus" (rež. Dean DeBois), Suurbritannia "Scott Walker: 30 Century Man" (rež. Stephen Kijak)

  9. Diversity and distribution of Listeria monocytogenes in meat processing plants.

    Science.gov (United States)

    Martín, Belén; Perich, Adriana; Gómez, Diego; Yangüela, Javier; Rodríguez, Alicia; Garriga, Margarita; Aymerich, Teresa

    2014-12-01

    Listeria monocytogenes is a major concern for the meat processing industry because many listeriosis outbreaks have been linked to meat product consumption. The aim of this study was to elucidate L. monocytogenes diversity and distribution across different Spanish meat processing plants. L. monocytogenes isolates (N = 106) collected from food contact surfaces of meat processing plants and meat products were serotyped and then characterised by multilocus sequence typing (MLST). The isolates were serotyped as 1/2a (36.8%), 1/2c (34%), 1/2b (17.9%) and 4b (11.3%). MLST identified ST9 as the most predominant allelic profile (33% of isolates) followed by ST121 (16%), both of which were detected from several processing plants and meat products sampled in different years, suggesting that those STs are highly adapted to the meat processing environment. Food contact surfaces during processing were established as an important source of L. monocytogenes in meat products because the same STs were obtained in isolates recovered from surfaces and products. L. monocytogenes was recovered after cleaning and disinfection procedures in two processing plants, highlighting the importance of thorough cleaning and disinfection procedures. Epidemic clone (EC) marker ECI was identified in 8.5%, ECIII was identified in 2.8%, and ECV was identified in 7.5% of the 106 isolates. Furthermore, a selection of presumably unrelated ST9 isolates was analysed by multi-virulence-locus sequence typing (MVLST). Most ST9 isolates had the same virulence type (VT11), confirming the clonal origin of ST9 isolates; however, one ST9 isolate was assigned to a new VT (VT95). Consequently, MLST is a reliable tool for identification of contamination routes and niches in processing plants, and MVLST clearly differentiates EC strains, which both contribute to the improvement of L. monocytogenes control programs in the meat industry. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  11. [Hematometra & Listeria monocytogenes].

    Science.gov (United States)

    Gómez Arzapalo, E; Pérez Mendizábal, A; Herrera Avalos, I; Gorozpe Calvillo, J I

    2001-05-01

    The hematometra is a nosological entity that may not always be attributed to an embryonic defect of the paramesonefros; cervical-vaginal infections such as etiological possibilities due to Listeria monocytogenes (Lm), cervix malignant neoplasias, iatrogenias due to endometrial ablation with Lasser, traumatic bloody uterine curetage and because of cervical cryocoagulation or electrocoagulation are also mentioned. The case to be reported is from a woman in reproductive stage, who is 32 years old, and had menarca at the age of 13, starting her sexual life at 31, not using any method to control her fertility. When having an eight-week amenorrhea after 8 months of marriage, she visited the doctor for assumed pregnancy, within the prenatal analysis a pelvic echographic study was requested, finding out images that we concluded as hematometra, having been drained and demonstrated the presence of LM by anti-Lm antibodies, being administered Azitromicina and Espiramicina.

  12. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  13. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model

    Science.gov (United States)

    Rakic Martinez, Mira; Ferguson, Martine; Datta, Atin R.

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study. PMID:28898264

  14. Viability of multi-strain mixtures of Listeria monocytogenes, Salmonella typhimurium, or Escherichia coli O157:H7 inoculated into the batter or onto the surface of a soudjouk-style fermented semi-dry sausage.

    Science.gov (United States)

    Porto-Fett, A C S; Hwang, C-A; Call, J E; Juneja, V K; Ingham, S C; Ingham, B H; Luchansky, J B

    2008-09-01

    The fate of Listeria monocytogenes, Salmonella typhimurium, or Escherichia coli O157:H7 were separately monitored both in and on soudjouk. Fermentation and drying alone reduced numbers of L. monocytogenes by 0.07 and 0.74 log(10)CFU/g for sausages fermented to pH 5.3 and 4.8, respectively, whereas numbers of S. typhimurium and E. coli O157:H7 were reduced by 1.52 and 3.51 log(10)CFU/g and 0.03 and 1.11 log(10)CFU/g, respectively. When sausages fermented to pH 5.3 or 4.8 were stored at 4, 10, or 21 degrees C, numbers of L. monocytogenes, S. typhimurium, and E. coli O157:H7 decreased by an additional 0.08-1.80, 0.88-3.74, and 0.68-3.17 log(10)CFU/g, respectively, within 30 days. Storage for 90 days of commercially manufactured soudjouk that was sliced and then surface inoculated with L. monocytogenes, S. typhimurium, and E. coli O157:H7 generated average D-values of ca. 10.1, 7.6, and 5.9 days at 4 degrees C; 6.4, 4.3, and 2.9 days at 10 degrees C; 1.4, 0.9, and 1.6 days at 21 degrees C; and 0.9, 1.4, and 0.25 days at 30 degrees C. Overall, fermentation to pH 4.8 and storage at 21 degrees C was the most effective treatment for reducing numbers of L. monocytogenes (2.54 log(10)CFU/g reduction), S. typhimurium (> or =5.23 log(10)CFU/g reduction), and E. coli O157:H7 (3.48 log(10)CFU/g reduction). In summary, soudjouk-style sausage does not provide a favorable environment for outgrowth/survival of these three pathogens.

  15. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  16. Relativistic Scott correction in self-generated magnetic fields

    DEFF Research Database (Denmark)

    Erdos, Laszlo; Fournais, Søren; Solovej, Jan Philip

    2012-01-01

    /3}$ and it is unchanged by including the self-generated magnetic field. We prove the first correction term to this energy, the so-called Scott correction of the form $S(\\alpha Z) Z^2$. The current paper extends the result of \\cite{SSS} on the Scott correction for relativistic molecules to include a self......-generated magnetic field. Furthermore, we show that the corresponding Scott correction function $S$, first identified in \\cite{SSS}, is unchanged by including a magnetic field. We also prove new Lieb-Thirring inequalities for the relativistic kinetic energy with magnetic fields....

  17. Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933

    Science.gov (United States)

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

  18. Thermal inactivation of Listeria monocytogenes and Salmonella spp. in sous-vide processed marinated chicken breast

    Science.gov (United States)

    The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60C in one h...

  19. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

    Science.gov (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

    2016-01-18

    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use.

  20. Inhibition of Listeria monocytogenes in cold-smoked salmon by Carnobacterium piscicola CS526 isolated from frozen surimi.

    Science.gov (United States)

    Yamazaki, Koji; Suzuki, Minako; Kawai, Yuji; Inoue, Norio; Montville, Thomas J

    2003-08-01

    Strain CS526 was isolated from frozen surimi and identified as a bacteriocin producer that had strong inhibitory activity against Listeria monocytogenes. Strain CS526 was identified as Carnobacterium piscicola by partial 16S rDNA sequence similarity. The ability of this bacteriocinogenic strain and nonbacteriocinogenic C. piscicola JCM5348 to inhibit the growth of L. monocytogenes was examined in culture broth incubated at 12 degrees C and cold-smoked salmon stored at 4, 12, and 20 degrees C. L. monocytogenes viable counts in the culture broth rapidly declined from 10(6) colony-forming units per ml to less than 10 colony-forming units per ml within 1 day at 12 degrees C in the presence of C. piscicola CS526. At 4 and 12 degrees C, inhibition of L. monocytogenes on salmon depended on the initial inoculum level of C. piscicola CS526. However, C. piscicola CS526 was bactericidal to L. monocytogenes within 21 and 12 days at 4 and 12 degrees C in cold-smoked salmon, respectively, even when the initial inoculum levels were low. C. piscicola CS526 suppressed the maximum cell number of L. monocytogenes by two and three log cycles, even at 20 degrees C. However, C. piscicola JCM5348 did not prevent the growth of the pathogen, except at 4 degrees C. Bacteriocin was detected in the samples coinoculated with C. piscicola CS526. The study shows that C. piscicola CS526 might have potential for biopreservation of refrigerated foods against L. monocytogenes.

  1. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  2. The Continuous Challenge of Characterizing the Foodborne Pathogen Listeria monocytogenes.

    Science.gov (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Nero, Luís Augusto

    2016-08-01

    Listeria monocytogenes is an important foodborne pathogen commonly isolated from food processing environments and food products. This organism can multiply at refrigeration temperatures, form biofilms on different materials and under various conditions, resist a range of environmental stresses, and contaminate food products by cross-contamination. L. monocytogenes is recognized as the causative agent of listeriosis, a serious disease that affects mainly individuals from high-risk groups, such as pregnant women, newborns, the elderly, and immunocompromised individuals. Listeriosis can be considered a disease that has emerged along with changing eating habits and large-scale industrial food processing. This disease causes losses of billions of dollars every year with recalls of contaminated foods and patient medical treatment expenses. In addition to the immune status of the host and the infecting dose, the virulence potential of each strain is crucial for the development of disease symptoms. While many isolates are naturally virulent, other isolates are avirulent and unable to cause disease; this may vary according to the presence of molecular determinants associated with virulence. In the last decade, the characterization of genetic profiles through the use of molecular methods has helped track and demonstrate the genetic diversity among L. monocytogenes isolates obtained from various sources. The purposes of this review were to summarize the main methods used for isolation, identification, and typing of L. monocytogenes and also describe its most relevant virulence characteristics.

  3. A note on challenge trials to determine the growth of Listeria monocytogenes on mushrooms (Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Leong Dara

    2015-12-01

    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if the number of micro-organisms does not exceed 100 colony forming units (cfu/g throughout its shelf-life. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Guidelines for conducting challenge tests for growth assessment of L. monocytogenes on foods were published by the European Union Reference Laboratory (EURL in 2014. The aim of this study was to use these guidelines to determine if refrigerated, fresh, whole, closed-cap, prepackaged mushrooms (Agaricus bisporus support the growth of L. monocytogenes. Three batches of mushrooms were artificially inoculated at approximately 100 cfu/g with a three-strain mix of L. monocytogenes and incubated for 2 days at 8°C followed by 4 days at 12°C. L. monocytogenes numbers were determined (in triplicate for each batch on days 0, 2 and 6. Water activity, pH and total bacterial counts were also determined. There was no increase in the number of L. monocytogenes above the threshold of 0.5 log cfu/g in any of the replicates. In 8 of 9 replicates, the numbers decreased indicating that A. bisporus do not support the growth of L. monocytogenes. As the EU regulations allow < 100 cfu/g if the food cannot support growth of L. monocytogenes, the significance of this study is that mushrooms with < 100 cfu/g may be within the regulations and therefore, quantitative rather than qualitative determination may be required.

  4. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

    2000-01-01

    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  5. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui

    2008-01-01

    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC......-transporter permease) presented in the sequenced strain L. monocytogenes str. 4b F2365. This disrupted gene, denoted lm.G_1771, encoded a protein with 10 transmembrane helixes. The revertant, LM-49RE, was obtained by replacing lm.G_1771::Tn917 with lm.G_1771 via homologous recombination. We found that LM-49RE formed...

  6. Control of Listeria monocytogenes in fresh cheese using protective lactic acid bacteria.

    Science.gov (United States)

    Coelho, M C; Silva, C C G; Ribeiro, S C; Dapkevicius, M L N E; Rosa, H J D

    2014-11-17

    In the past years, there has been a particular focus on the application of bacteriocins produced by lactic acid bacteria (LAB) in controlling the growth of pathogenic bacteria in foods. The aim of this study was to select LAB strains with antimicrobial activity, previously isolated from a traditional Azorean artisanal cheese (Pico cheese), in order to identify those with the greatest potential in reducing Listeria monocytogenes in fresh cheese. Eight bacteriocin producer strains identified as Lactococcus lactis (1) and Enterococcus faecalis (7) were tested. In general, the bacteriocin-producing strains presented a moderate growth in fresh cheese at refrigeration temperatures (4 °C), increasing one log count in three days. They exhibited slow acidification capacity, despite the increased production of lactic acid displayed by some strains after 24h. Bacteriocin activity was only detected in the whey of fresh cheese inoculated with two Enterococcus strains, but all cheeses made with bacteriocin-producing strains inhibited L. monocytogenes growth in the agar diffusion bioassay. No significant differences were found in overall sensory evaluation made by a non-trained panel of 50-52 tasters using the isolates as adjunct culture in fresh cheese, with the exception of one Enterococcus strain. To test the effect of in situ bacteriocin production against L. monocytogenes, fresh cheese was made from pasteurized cows' milk inoculated with bacteriocin-producing LAB and artificially contaminated with approximately 10(6) CFU/mL of L. monocytogenes. The numbers of L. monocytogenes were monitored during storage of fresh cheese at refrigeration temperature (4 °C) for up to 15 days. All strains controlled the growth of L. monocytogenes, although some Enterococcus were more effective in reducing the pathogen counts. After 7 days, this reduction was of approximately 4 log units compared to the positive control. In comparison, an increase of 4 log CFU/mL in pathogen numbers was

  7. Antimicrobial Activity of Chitosan Films With Essential Oils Against Listeria monocytogenes on Cabbage

    Science.gov (United States)

    Jovanovic, Gordana D.; Klaus, Anita S.; P. Niksic, Miomir

    2016-01-01

    Background The highest incidence of listeriosis, due to consumption of ready-to-eat foods and fresh, shredded, minimally processed vegetables, occurs among pregnant women and the elderly. In order to reduce the prevalence of listeriosis among consumers, better protective measures are recommended. Chitosan films, with or without added essential oils, represent a modern, safe method of preserving the quality of such vegetables and significantly reducing the incidence of Listeria monocytogenes in these foods. Objectives The present study was conducted to evaluate the antimicrobial properties of composite chitosan-gelatin films with and without essential oils against two strains of L. monocytogenes, ATCC 19115 and ATCC 19112, in fresh shredded cabbage. Methods Shredded cabbage was inoculated with L. monocytogenes and packed between two layers of the chitosan composite film, then placed in Petri dishes. The prepared samples were stored at 4°C then analyzed for total viable count on PALCAM agar while incubated at 37°C, every 24 hours for 7 days. Results Average L. monocytogenes content ranged from 4.2 - 5.4 log CFU/g, reaching values of 7.2 - 8.6 log CFU/g in samples of untreated cabbage. A complete reduction of L. monocytogenes ATCC 19115 on cabbage was achieved after 120 hours in the presence of 0.5% chitosan film, whereas reduction of L. monocytogenes ATCC 19112 was achieved after 144 hours. In the presence of 1% chitosan film, the bacteria withered more quickly and complete reduction of both species of L. monocytogenes was achieved after 96 hours. Conclusions All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of both strains of L. monocytogenes on cabbage. The best effect was achieved with a 1% chitosan concentration. The addition of essential oils increased the antimicrobial activity of all tested films. PMID:27800143

  8. Archaeology at Scott's Lake Exploratory Research 1972, 1973

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is an unpublished report that contains a review of the Institute of Archeology and Anthropology's work relating to the Scott's Lake Site. The changes of the...

  9. Astronaut Scott Carpenter and technician Joe Schmidt during suiting exercise

    Science.gov (United States)

    1961-01-01

    Mercury Astronaut M. Scott Carpenter, prime pilot for the Mercury-Atlas 7 flight, and Crew Equipment Specialist Joe Schmidt are before a suiting exercise. Schmidt is seen checking the gloves on the Carpenter's pressure suit.

  10. BackscatterA [8101]--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the acoustic-backscatter map of Offshore of Scott Creek map area, California. Backscatter data are provided as three separate...

  11. BackscatterB [7125]--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the acoustic-backscatter map of Offshore of Scott Creek map area, California. Backscatter data are provided as three separate...

  12. Geology and geomorphology--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the geologic and geomorphic map of the Offshore of Scott Creek map area, California. The vector data file is included in...

  13. BackscatterB [7125]--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the acoustic-backscatter map of Offshore of Scott Creek map area, California. Backscatter data are provided as three separate...

  14. BackscatterC [SWATH]--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the acoustic-backscatter map of Offshore of Scott Creek map area, California. Backscatter data are provided as three separate...

  15. Parcels and Land Ownership, Published in 2011, Scott County Government.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Parcels and Land Ownership dataset as of 2011. The extent of these data is generally Scott County, IA. This metadata was auto-generated through the Ramona GIS...

  16. Geology and geomorphology--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the geologic and geomorphic map of the Offshore of Scott Creek map area, California. The vector data file is included in...

  17. BackscatterA [8101]--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the acoustic-backscatter map of Offshore of Scott Creek map area, California. Backscatter data are provided as three separate...

  18. BackscatterC [SWATH]--Offshore Scott Creek, California

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This part of DS 781 presents data for the acoustic-backscatter map of Offshore of Scott Creek map area, California. Backscatter data are provided as three separate...

  19. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Anneliese Müller

    Full Text Available Controlling the food-borne pathogen Listeria (L. monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S. aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs (28.5 ± 4.7 mg/l than strains without Tn6188 (14 ± 3.2 mg/l. Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L

  20. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Science.gov (United States)

    Müller, Anneliese; Rychli, Kathrin; Muhterem-Uyar, Meryem; Zaiser, Andreas; Stessl, Beatrix; Guinane, Caitriona M; Cotter, Paul D; Wagner, Martin; Schmitz-Esser, Stephan

    2013-01-01

    Controlling the food-borne pathogen Listeria (L.) monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC) has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S.) aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC) as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR) transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs) (28.5 ± 4.7 mg/l) than strains without Tn6188 (14 ± 3.2 mg/l). Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L. monocytogenes

  1. Prevalence of Listeria monocytogenes in poultry production in France.

    Science.gov (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

    2008-10-01

    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  2. Sensitivity of Listeria monocytogenes to sanitizers used in the meat processing industry.

    Science.gov (United States)

    Romanova, Nadya; Favrin, Stacy; Griffiths, Mansel W

    2002-12-01

    Nineteen Listeria monocytogenes strains were characterized by automated ribotyping, pulsed-field gel electrophoresis, and plasmid profiling to determine the relationship between genotype and sanitizer resistance. Isolates within a ribogroup had a consistent sensitivity or resistance phenotype except for ribogroup C isolates. All isolates with resistance phenotypes harbored two plasmids. The sensitivity of L. monocytogenes strains to quaternary ammonium compounds (QACs) was correlated with sensitivity to sanitizers and antibiotics with other modes of action. All isolates tested contained the mdrL gene, which encodes an efflux pump that confers resistance to QACs and is both chromosome and plasmid borne.

  3. A correlation between the virulence and the adhesion of Listeria monocytogenes to silicon nitride: an atomic force microscopy study.

    Science.gov (United States)

    Park, Bong-Jae; Haines, Travis; Abu-Lail, Nehal I

    2009-10-15

    Listeria monocytogenes is a facultative intracellular Gram-positive bacterium that is widely distributed in the environment. Despite being pathogenic at the species level, L. monocytogenes in fact comprises a diversity of strains from pathogenic ones that can result in disease and/or mortality to others that are relatively avirulent. The main goal of the current study was to answer the question on whether enhanced binding or attachment of L. monocytogenes to inert surfaces bears any relationship to pathogenicity in food-borne isolates. To answer this question, the nanoscale adhesion forces of eight L. monocytogenes strains that vary in their pathogenicity levels to a model surface of silicon nitride were quantified using atomic force microscopy. The strains used were the highly pathogenic (EGDe, 874, 1002, ATCC 19115), the intermediate pathogenic (ATCC 19112, ATCC 19118), and the non pathogenic (ATCC 15313 and HCC25). Our results indicate that the average nanoscale adhesion (in nN) and the 50% lethal dose (LD50) of strain virulence quantified in mice are logarithmically correlated according to: (nN)=-0.032ln(LD50)+1.040, r(2)=0.96. Such correlation indicates that nanoscale adhesion could potentially be used as a design criterion to distinguish between virulent and avirulent L. monocytogenes strains. Finally, stronger adhesion of virulent strains to inert surfaces modeled by silicon nitride might be a way for pathogenic strains to survive better in the environment and thus increase their likelihood of infecting animals or humans.

  4. Molecular characterization of Listeria monocytogenes isolated from animal products in a city of Northern Brazil

    Directory of Open Access Journals (Sweden)

    Lilyan Rosmery Luizaga de Monteiro

    2013-08-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen causes listeriosis, a fatal disease in about 30% of cases that affects mainly immunocompromised persons. The aim of this research was to characterize L. monocytogenes pulsed-field gel electrophoresis (PFGE types isolated from meat products collected at public markets in Araguaina city, TO. Sixty samples of raw ground beef and frescal sausage were analyzed during the second half of 2008. Five out of 30 samples (16.7% of raw ground beef tested positive for L. monocytogenes, three of which were classified as serotype 1/2b and two as serotype 4b. Among the 30 samples of sausage collected, two strains of L. monocytogenes were isolated (6.7%, one of them belonging to serotype 1/2a and the other belonging to serotype 1/2b. The restriction enzymes used were ApaI and SmaI. Similarities among the strains were determined by Dice coefficient. The macro restriction profile obtained by using SmaI enzyme allowed the distribution of seven strains in two clusters, two pulsotypes and two subtypes. The result indicates that L. monocytogenes isolates, belonging to serotype 4b, 1/2a and 1/2b, are strongly correlated within the same serotype group, and in some cases among different serotypes, suggesting that they have a common source.

  5. Cross-contamination between processing equipment and deli meats by Listeria monocytogenes.

    Science.gov (United States)

    Lin, Chia-Min; Takeuchi, Kazue; Zhang, Lei; Dohm, Cynthia B; Meyer, Joseph D; Hall, Paul A; Doyle, Michael P

    2006-01-01

    Contamination of luncheon meats by Listeria monocytogenes has resulted in outbreaks of listeriosis and major product recalls. Listeriae can survive on processing equipment such as meat slicers which serve as a potential contamination source. This study was conducted to determine (i) the dynamics of cross-contamination of L. monocytogenes from a commercial slicer and associated equipment onto sliced meat products, (ii) the influence of sample size on the efficacy of the BAX-PCR and U.S. Department of Agriculture-Food Safety and Inspection Service enrichment culture assays to detect L. monocytogenes on deli meat, and (iii) the fate of L. monocytogenes on sliced deli meats of different types during refrigerated storage. Three types of deli meats, uncured oven-roasted turkey, salami, and bologna containing sodium diacetate and potassium lactate, were tested. A five-strain mixture of L. monocytogenes was inoculated at ca.10(3) CFU onto the blade of a commercial slicer. Five consecutive meat slices were packed per package, then vacuum sealed, stored at 4 degrees C, and sampled at 1 and 30 days postslicing. Two sample sizes, 25 g and contents of the entire package of meat, were assayed. Total numbers of L. monocytogenes-positive samples, including the two sample sizes and two sampling times, were 80, 9, and 3 for turkey, salami, and bologna, respectively. A higher percentage of turkey meat samples were L. monocytogenes positive when contents of the entire package were assayed than when the 25-g sample was assayed (12.5 and 7.5%, respectively). Lower inoculum populations of ca. 10(1) or 10(2) CFU of L. monocytogenes on the slicer blade were used for an additional evaluation of oven-roasted turkey using two additional sampling times of 60 and 90 days postslicing. L. monocytogenes-positive samples were not detected until 60 days postslicing, and more positive samples were detected at 90 days than at 60 days postslicing. When BAX-PCR and enrichment culture assays were

  6. The influence of subminimal inhibitory concentrations of benzalkonium chloride on biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Ortiz, Sagrario; López, Victoria; Martínez-Suárez, Joaquín V

    2014-10-17

    Disinfectants, such as benzalkonium chloride (BAC), are commonly used to control Listeria monocytogenes and other pathogens in food processing plants. Prior studies have demonstrated that the resistance to BAC of L. monocytogenes was associated with the prolonged survival of three strains of molecular serotype 1/2a in an Iberian pork processing plant. Because survival in such environments is related to biofilm formation, we hypothesised that the influence of BAC on the biofilm formation potential of L. monocytogenes might differ between BAC-resistant strains (BAC-R, MIC≥10mg/L) and BAC-sensitive strains (BAC-S, MIC≤2.5mg/L). To evaluate this possibility, three BAC-R strains and eight BAC-S strains, which represented all of the molecular serotype 1/2a strains detected in the sampled plant, were compared. Biofilm production was measured using the crystal violet staining method in 96-well microtitre plates. The BAC-R strains produced significantly (p<0.05) less biofilm than the BAC-S in the absence of BAC, independent of the rate of planktonic growth. In contrast, when the biofilm values were measured in the presence of BAC, one BAC-R strain (S10-1) was able to form biofilm at 5mg/L of BAC, which prevented biofilm formation among the rest of the strains. A genetic determinant of BAC resistance recently described in L. monocytogenes (Tn6188) was detected in S10-1. When a BAC-S strain and its spontaneous mutant BAC-R derivative were compared, resistance to BAC led to biofilm formation at 5mg/L of BAC and to a significant (p<0.05) stimulation of biofilm formation at 1.25mg/L of BAC, which significantly (p<0.05) reduced the biofilm level in the parent BAC-S strain. Our results suggest that the effect of subminimal inhibitory concentrations of BAC on biofilm production by L. monocytogenes might differ between strains with different MICs and even between resistant strains with similar MICs but different genetic determinants of BAC resistance. For BAC-R strains similar

  7. Neuroinfections due to Listeria monocytogenes.

    Science.gov (United States)

    Streharova, A; Babjakova, A; Moravcikova, A; Harnicarova, A; Holeckova, K; Lesnakova, A; Sladeckova, V; Seckova, S; Kisac, P; Beno, P

    2007-11-01

    Listeria monocytogenes is not a rare pathogen causing meningitis, mainly in small children and in close contacts to livestock. The pathogen is naturally resistant to cephalosporins and some glycopeptides as well, therefore despite of syndromologic diagnosis of meningitis and initial therapy with 3rd generation cephalosporins according to the guidelines therapeutic failures with clinical consequences may occur.

  8. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba

    2013-09-01

    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  9. Teichoic acid is the major polysaccharide present in the Listeria monocytogenes biofilm matrix.

    Science.gov (United States)

    Brauge, Thomas; Sadovskaya, Irina; Faille, Christine; Benezech, Thierry; Maes, Emmanuel; Guerardel, Yann; Midelet-Bourdin, Graziella

    2016-01-01

    The aim of this study was to characterize the Listeria monocytogenes biofilm and particularly the nature of the carbohydrates in the biofilm extracellular matrix and culture supernatant versus to cell wall carbohydrates. Listeria monocytogenes serotype 1/2a and 4b strains were able to form complex biofilms embedded in an extracellular matrix. The soluble carbohydrates from biofilm extracellular matrix and culture supernatant were identified as teichoic acids, structurally identical to cell wall teichoic acids. In addition, the DSS 1130 BFA2 strain had a serotype 1/2a teichoic acid lacking N-acetyl glucosamine glycosylation due to a mutation in the lmo2550 gene. Consequently, we hypothesized that the extracellular teichoic acids in L. monocytogenes biofilms have the same origin as cell wall teichoic acid. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Maria da Graça F. Nascimento

    1994-12-01

    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

  11. Exploring the chicken embryo as a possible model for studying Listeria monocytogenes pathogenicity

    Directory of Open Access Journals (Sweden)

    Jonas eGripenland

    2014-12-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen capable of causing severe infections in humans, often with fatal outcomes. Many different animal models exist to study L. monocytogenes pathogenicity, and we have investigated the chicken embryo as an infection model: What are the benefits and possible drawbacks? We have compared a defined wild-type strain with its isogenic strains lacking well-characterized virulence factors. Our results show that wild-type L. monocytogenes, already at a relatively low infection dose (~5 x 102 cfu, caused death of the chicken embryo within 36 hours, in contrast to strains lacking the main transcriptional activator of virulence, PrfA, or the cytolysin LLO. Surprisingly, strains lacking the major adhesins InlA and InlB caused similar mortality as the wild-type strain. In conclusion, our results suggest that the chicken embryo is a practical model to study L. monocytogenes infections, especially when analyzing alternative virulence pathways independent of the InlA and InlB adhesins. However, the route of infection might be different from a human infection. The chicken embryo model and other Listeria infection models are discussed.

  12. Minimal inhibitory concentrations of undissociated lactic, acetic, citric and propionic acid for Listeria monocytogenes under conditions relevant to cheese.

    Science.gov (United States)

    Wemmenhove, Ellen; van Valenberg, Hein J F; Zwietering, Marcel H; van Hooijdonk, Toon C M; Wells-Bennik, Marjon H J

    2016-09-01

    Minimal inhibitory concentrations (MICs) of undissociated lactic acid were determined for six different Listeria monocytogenes strains at 30 °C and in a pH range of 4.2-5.8. Small increments in pH and acid concentrations were used to accurately establish the growth/no growth limits of L. monocytogenes for these acids. The MICs of undissociated lactic acid in the pH range of 5.2-5.8 were generally higher than at pH 4.6 for the different L. monocytogenes strains. The average MIC of undissociated lactic acid was 5.0 (SD 1.5) mM in the pH range 5.2-5.6, which is relevant to Gouda cheese. Significant differences in MICs of undissociated lactic acid were found between strains of L. monocytogenes at a given pH, with a maximum observed level of 9.0 mM. Variations in MICs were mostly due to strain variation. In the pH range 5.2-5.6, the MICs of undissociated lactic acid were not significantly different at 12 °C and 30 °C. The average MICs of undissociated acetic acid, citric acid, and propionic acid were 19.0 (SD 6.5) mM, 3.8 (SD 0.9) mM, and 11.0 (SD 6.3) mM, respectively, for the six L. monocytogenes strains tested in the pH range 5.2-5.6. Variations in MICs of these organic acids for L. monocytogenes were also mostly due to strain variation. The generated data contribute to improved predictions of growth/no growth of L. monocytogenes in cheese and other foods containing these organic acids.

  13. Listeria monocytogenes in renal transplant recipients Listeria monocytogenes em pacientes pós-transplante renal

    Directory of Open Access Journals (Sweden)

    Cristina Barroso HOFER

    1999-11-01

    Full Text Available Five cases of Listeria monocytogenes bacteriemia were observed from April to December 1985, among renal transplant recipients from the same hospital in São Paulo, Brazil. The patients were adults (mean age: 40.6 years, and the basic complain was fever, with no report of meningeal syndrome. Laboratory tests revealed the presence of two serovars, 1/2a and 4b, which were classified into three lysotypes. The four strains of serovar 4b showed the same antibiotype, with resistance to cefoxitin, clindamycin, oxacillin and penicillin.No período de abril a dezembro de 1985, foram observados cinco casos de listeriose em transplantados renais num mesmo hospital de São Paulo, SP. Os pacientes eram adultos (média de 40,6 anos tendo como queixa básica a febre. Laboratorialmente, em todos foram reconhecidos Listeria monocytogenes, caracterizada por dois sorovares 1/2a e 4b e três lisotipos distintos. As amostras do sorovar 4b apresentaram o mesmo antibiotipo: resistentes à cefoxitina, clindamicina, oxacilina e penicilina.

  14. Comparative Evaluation of Veriflow® Listeria monocytogenes to USDA and AOAC Culture Based Methods for the Detection of Listeria monocytogenes in Food.

    Science.gov (United States)

    Joelsson, Adam C; Brown, Ashley S; Puri, Amrita; Keough, Martin P; Gaudioso, Zara E; Siciliano, Nicholas A; Snook, Adam E

    2015-01-01

    Veriflow® Listeria monocytogenes (LM) is a molecular based assay for the presumptive detection of Listeria monocytogenes from environmental surfaces, dairy, and ready-to-eat (RTE) food matrixes (hot dogs and deli meat). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post PCR amplification and requires only 24 h of enrichment for maximum sensitivity. The Veriflow LM system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification, and does not require complex data analysis. This Performance Tested Method(SM) validation study demonstrated the ability of the Veriflow LM method to detect low levels of artificially inoculated L. monocytogenes in seven distinct environmental and food matrixes. In each unpaired reference comparison study, probability of detection analysis indicated no significant difference between the Veriflow LM method and the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook 8.08 or AOAC 993.12 reference method. Fifty strains of L. monocytogenes were detected in the inclusivity study, while 39 nonspecific organisms were undetected in the exclusivity study. The study results show that Veriflow LM is a sensitive, selective, and robust assay for the presumptive detection of L. monocytogenes sampled from environmental, dairy, or RTE (hot dogs and deli meat) food matrixes.

  15. Expression of virulence-related genes in Listeria monocytogenes grown on Danish hard cheese as affected by NaCl content

    DEFF Research Database (Denmark)

    Larsen, Nadja; Jespersen, Lene

    2015-01-01

    Expression of virulence-related genes in Listeria monocytogenes incubated on cheese was assessed by real-time quantitative polymerase chain reaction. The objective of the study was to investigate the impact of sodium chloride concentration in cheese on transcription of virulence genes and, thereby......, virulence potential of L. monocytogenes. The expression studies were performed with L. monocytogenes strains characterized by different tolerance to salt stress. Strains ATCC(®) 51779 and DSMZ 15675 were incubated on the Danish hard-cheese type Samsoe, with low (high (3.6% [wt....../wt]) content of NaCl. Genes differentially expressed (p

  16. Detection of Listeria monocytogenes by direct colony hybridization on hydrophobic grid-membrane filters by using a chromogen-labeled DNA probe.

    Science.gov (United States)

    Peterkin, P I; Idziak, E S; Sharpe, A N

    1991-02-01

    A DNA probe specific for Listeria monocytogenes was isolated from a beta-hemolytic recombinant clone of an L. monocytogenes gene bank. It was labeled with horseradish peroxidase and used in a direct colony hybridization method on hydrophobic grid-membrane filters for the detection of the organism. Following color development of the chromogen, a commercial counter (HGMF Interpreter) was able to detect and count the organisms electronically. The method gave a positive reaction with 70 L. monocytogenes strains, while showing a negative reaction with 10 strains of other Listeria spp. and with 20 organisms of other genera.

  17. Inhibition of Listeria monocytogenes biofilms by bacteriocin-producing bacteria isolated from mushroom substrate.

    Science.gov (United States)

    Bolocan, A S; Pennone, V; O'Connor, P M; Coffey, A; Nicolau, A I; McAuliffe, O; Jordan, K

    2017-01-01

    This study was designed to investigate the ability of naturally occurring bacteria isolated from mushroom substrate to prevent biofilm formation by Listeria monocytogenes or to remove existing biofilms in mushroom production facilities. It is generally recognized that L. monocytogenes forms biofilms that can facilitate its survival in food-processing environments. Eleven bacteriocin-producing isolates were identified and the bacteriocins characterized based on heat and enzyme inactivation studies. Further characterization was undertaken by MALDI-TOF mass spectrometry, PCR and sequencing. Production of nisin Z (by Lactococcus lactis isolates), subtilomycin (by Bacillus subtilis isolates) and lichenicidin (by Bacillus licheniformis and Bacillus sonorensis isolates) was detected. In co-culture with L. monocytogenes, the bacteriocin-producing strains could prevent biofilm formation and reduce pre-formed biofilms. Mushroom substrate can be a source of bacteriocin-producing bacteria that can antagonize L. monocytogenes. The results highlight the potential of bacteriocin-producing strains from mushroom substrate to reduce L. monocytogenes biofilm in food production environments, contributing to a reduction in the risk of food contamination from the environment. © 2016 The Society for Applied Microbiology.

  18. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    Directory of Open Access Journals (Sweden)

    Budniak Sylwia

    2016-12-01

    Full Text Available Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Specific amplification products were obtained for both multiplex PCR assays, which confirmed the tested strains as Listeria spp. and L. monocytogenes, respectively. Isolates of other species did not yield PCR products. Conclusion: Both multiplex PCR assays proved to be significantly sensitive and highly-specific methods for the detection of Listeria strains.

  19. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  20. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  1. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes.

    Science.gov (United States)

    Moslehi-Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-10-03

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus after incubation with viable L. monocytogenes cells and by addition of cell-free culture supernatant of L. monocytogenes, whereas incubation with heat killed cells of L. monocytogenes had no effect on the transcriptional level. This could indicate that the up-regulation of luxS is due to a response to a secreted compound produced by L. monocytogenes cells.

  2. Wave-splitting in the bistable Gray-Scott model

    DEFF Research Database (Denmark)

    Rasmussen, K.E.; Mazin, W.; Mosekilde, Erik

    1996-01-01

    The Gray-Scott model describes a chemical reaction in which an activator species grows autocatalytically on a continuously fed substrate. For certain feed rates and activator life times the model shows the coexistence of two homogeneous steady states. The blue state, where the activator concentra......The Gray-Scott model describes a chemical reaction in which an activator species grows autocatalytically on a continuously fed substrate. For certain feed rates and activator life times the model shows the coexistence of two homogeneous steady states. The blue state, where the activator...

  3. Diverse Geno- and Phenotypes of Persistent Listeria monocytogenes Isolates from Fermented Meat Sausage Production Facilities in Portugal ▿

    Science.gov (United States)

    Ferreira, V.; Barbosa, J.; Stasiewicz, M.; Vongkamjan, K.; Moreno Switt, A.; Hogg, T.; Gibbs, P.; Teixeira, P.; Wiedmann, M.

    2011-01-01

    The persistence of Listeria monocytogenes in food-associated environments represents a key factor in transmission of this pathogen. To identify persistent and transient strains associated with production of fermented meat sausages in northern Portugal, 1,723 L. monocytogenes isolates from raw material and finished products from 11 processors were initially characterized by random amplification of polymorphic DNA (RAPD), PCR-based molecular serotyping, and epidemic clone characterization, as well as cadmium, arsenic, and tetracycline resistance typing. Pulsed-field gel electrophoresis (PFGE) typing of 240 representative isolates provided evidence for persistence of L. monocytogenes for periods of time ranging from 10 to 32 months for all seven processors for which isolates from different production dates were available. Among 50 L. monocytogenes isolates that included one representative for each PFGE pattern obtained from a given sample, 12 isolates showed reduced invasion efficiency in Caco-2 cells, including 8 isolates with premature stop codons in inlA. Among 41 isolates representing sporadic and persistent PFGE types, 22 isolates represented lysogens. Neither strains with reduced invasion nor lysogens were overrepresented among persistent isolates. While the susceptibility of isolates to lysogenic phages also did not correlate with persistence, it appeared to be associated with molecular serotype. Our data show the following. (i) RAPD may not be suitable for analysis of large sets of L. monocytogenes isolates. (ii) While a large diversity of L. monocytogenes subtypes is found in Portuguese fermented meat sausages, persistence of L. monocytogenes in this food chain is common. (iii) Persistent L. monocytogenes strains are diverse and do not appear to be characterized by unique genetic or phenotypic characteristics. PMID:21378045

  4. Growth control of Listeria monocytogenes on cold-smoked salmon using a competitive lactic acid bacteria flora

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Gram, Lone; Huss, Hans Henrik

    1999-01-01

    diffusion assay. Cell-free supernatants of two strains of C. piscicola and L. sake LKE5 were also antilisterial because of the production of bacteriocins. The presence of high cell numbers of strains of C. piscicola had no influence on the sensory quality of cold-smoked salmon stored at 5 degrees C, but L....... sake LKE5 caused strong sulfurous off-flavors and was rejected as a culture for biopreservation of cold-smoked salmon. A bacteriocin-producing strain of C. piscicola (A9b) initially caused a 7-day lag phase of L. monocytogenes, followed by a reduction in numbers of L. monocytogenes from 10(3) CFU...

  5. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  6. Use of molecular typing methods to trace the dissemination of Listeria monocytogenes in a shrimp processing plant.

    Science.gov (United States)

    Destro, M T; Leitão, M F; Farber, J M

    1996-02-01

    Molecular typing of bacteria has been widely used in epidemiological studies but not as extensively for tracing the transmission of pathogenic bacteria in food plants. This study was conducted to examine the potential use of two molecular typing methods, random amplified polymorphic DNA (RAPD) analysis and pulsed-field gel electrophoresis (PFGE), to trace Listeria monocytogenes contamination in a shrimp processing plant. Ribotyping and phase typing were also performed on a select number of strains. One hundred fifteen strains of L. monocytogenes collected in different areas of a shrimp processing plant were first serotyped and then subtyped by molecular typing. RAPD and PFGE showed great promise for typing L. monocytogenes isolates since distinguishable and reproducible DNA polymorphisms were obtained. When the composite profile from both (RAPD and PFGE) methods was generated, there was an increase in the discriminatory power to discern differences between strains of L. monocytogenes. The results indicated that environmental strains all fell into composite profile groupings unique to the environment, while strains from both water and utensils shared another composite profile group. L. monocytogenes fresh shrimp isolates belonging to one profile group were found in different areas of the processing line. This same profile group was also present in food handlers from the processing and packaging areas of the plant.

  7. Isolation and characterization of a nisin-like bacteriocin produced by a Lactococcus lactis strain isolated from charqui, a Brazilian fermented, salted and dried meat product.

    Science.gov (United States)

    Biscola, V; Todorov, S D; Capuano, V S C; Abriouel, H; Gálvez, A; Franco, B D G M

    2013-03-01

    A Lactococcus lactis subsp. lactis strain (L. lactis 69) capable to produce a heat-stable bacteriocin was isolated from charqui, a Brazilian fermented, salted and sun-dried meat product. The bacteriocin inhibited, in vitro, Listeria monocytogenes, Staphylococcus aureus, several lactic acid bacteria isolated from foods and spoilage halotolerant bacteria isolated from charqui. The activity of the bacteriocin was not affected by pH (2.0-10.0), heating (100 °C), and chemical agents (1% w/v). Treatment of growing cells of L. monocytogenes ScottA with the cell-free supernatant of L. lactis 69 resulted in complete cell inactivation. L. lactis 69 harbored the gene for the production of a nisin-like bacteriocin, and the amino acid sequence of the active peptide was identical to sequences previously described for nisin Z. However, differences were observed regarding the leader peptide. Besides, the isolate was able to survive and produce bacteriocins in culture medium with NaCl content up to 20%, evidencing a potential application as an additional hurdle in the preservation of charqui. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. High hydrostatic pressure effects on Listeria monocytogenes and L. innocua: Evidence for variability in inactivation behaviour and in resistance to pediocin bacHA-6111-2.

    Science.gov (United States)

    Bruschi, Carolina; Komora, Norton; Castro, Sónia Marília; Saraiva, Jorge; Ferreira, Vânia Borges; Teixeira, Paula

    2017-06-01

    The effect of high hydrostatic pressure (HHP) on the survival of 14 strains of Listeria monocytogenes from food or clinical origins, selected to represent different pheno and genotypes, was evaluated. Stationary phase cells were submitted to 300, 400 and 500 MPa at 10 °C, for 5 min. A high variability in the resistance of L. monocytogenes to pressure was observed, and particularly two strains isolated from food were significantly more baroresistant than the rest. Strains of L. monocytogenes resistant to one or more antibiotics exhibited significantly higher levels of survival after the high pressure treatment at 400 MPa. No correlation was found between strains' origin or thermal tolerance and resistance to HHP. The suitability of two strains of L. innocua as surrogates of L. monocytogenes, was also investigated. These exhibited significantly higher sensitivities to HHP than observed for some L. monocytogenes. The antimicrobial effect of the antilisterial bacteriocin (bacHA-6111-2) increased after L. monocytogenes cells had been exposed to pressure. The data obtained underlines the importance of strain selection for studies aiming to evaluate HHP efficacy to ensure safety of HHP-treated foods. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Multiparameter viability assay for stress profiling applied to the food pathogen Listeria monocytogenes F2365

    NARCIS (Netherlands)

    Nocker, A.; Caspers, M.; Esveld-Amanatidou, A.; Vossen, J. van der; Schuren, F.; Montijn, R.; Kort, R.

    2011-01-01

    A novel generic approach for stress profiling was applied to Listeria monocytogenes strain F2365. This food-borne pathogen was exposed to gradients of five different stresses of increasing intensity, typically ranging from moderate to lethal conditions. The stress factors included heat, acidic pH, a

  10. Variations in the Nanomechanical Properties of Virulent and Avirulent Listeria monocytogenes.

    Science.gov (United States)

    Park, Bong-Jae; Abu-Lail, Nehal I

    2010-01-01

    Atomic force microscopy (AFM) was used to quantify both the nanomechanical properties of pathogenic (ATCC 51776 & EGDe) and non-pathogenic (ATCC 15313 & HCC25) Listeria monocytogenes strains and the conformational properties of their surface biopolymers. The nanomechanical properties of the various L. monocytogenes strains were quantified in terms of Young's moduli of cells. To estimate Young's moduli, the classic Hertz model of contact mechanics and a modified version of it that takes into account substrate effects were used to fit the AFM nanoindentation-force measurements collected while pushing onto the bacterial surface biopolymer brush. When compared, the classic Hertz model always predicted higher Young's moduli values of bacterial cell elasticity compared to the modified Hertz model. On average, the modified Hertz model showed that virulent strains are approximately twice as rigid (88.1 ± 14.5 KPa) as the avirulent strains (47.3 ± 7.6 kPa). To quantify the conformational properties of L. monocytogenes' strains surface biopolymers, two models were used. First, the entropic-based, statistical mechanical, random walk formulation, the wormlike chain (WLC) model was used to estimate the elastic properties of the bacterial surface molecules. The WLC model results indicated that the virulent strains are characterized by a more flexible surface biopolymers as indicated by shorter persistence lengths (L(p) = 0.21 ± 0.08 nm) compared to the avirulent strains (L(p) = 0.24 ± 0.14 nm). Second, a steric model developed to describe the repulsive forces measured between the AFM tip and bacterial surface biopolymers indicated that the virulent strains are characterized by crowded and longer biopolymer brushes compared to those of the avirulent strains. Finally, scaling relationships developed for grafted polyelectrolyte brushes indicated L. monocytogenes strains' biopolymer brushes are charged. Collectively, our data indicate that the conformational properties of the

  11. Antimicrobial Tolerance in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Curtis, Thomas Darwin

    There are two ways in which bacteria survive killing by antibiotics. The most well-known, is antibiotic resistance, which results from the acquisition of a resistance gene or mutation that allows bacteria to grow and divide in the presence of antibiotic concentrations that would normally kill other...... that are completely refractory to antibiotics due to the inactivity of cellular processes. Persister cells have been linked to treatment failures in several bacterial infections including Mycobacterium tuberculosis, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. Preceding the start of this Ph......D project, Listeria monocytogenes was observed to form these antibiotic tolerant persister cells. L. monocytogenes is a Gram-positive, foodborne pathogen that causes listeriosis, a rare, but often lethal disease, even with antibiotic treatment. It typically affects pregnant women, neonates, the elderly...

  12. The influence of mayonnaise pH and storage temperature on the growth of Listeria monocytogenes in seafood salad.

    Science.gov (United States)

    Hwang, Cheng-An; Tamplin, Mark L

    2005-07-25

    Seafood salad has been identified as a ready-to-eat food with a relatively high incidence of contamination by Listeria monocytogenes; however, little is known about the behavior of this pathogen in seafood salad as a function of product pH and storage temperature. To produce data towards the development of a predictive growth model, a 6-strain cocktail of L. monocytogenes was inoculated onto the surface of a shrimp-crabmeat product, mixed with mayonnaise that was previously adjusted with NaOH to pH 3.7, 4.0, 4.4, 4.7 or 5.1, and then stored at 4 degrees , 8 degrees or 12 degrees C under both aerobic and vacuum conditions. At each storage temperature, L. monocytogenes was able to grow in the seafood salad under both aerobic and vacuum conditions. The slowest growth of L. monocytogenes was observed in seafood salad with a mayonnaise pH of 3.7 and a storage temperature of 4 degrees C under vacuum condition. In salad with the same mayonnaise pH, the growth rate (GR, log10 cfu/h) of L. monocytogenes increased as a function of storage temperature. At the same storage temperature, the lag phase duration (LPD, h) of L. monocytogenes decreased as mayonnaise pH increased. At the same mayonnaise pH and temperature, LPD of L. monocytogenes was greater under aerobic than under vacuum conditions. Regression analyses indicated that mayonnaise pH is the main effector on the LPD of L. monocytogenes in seafood salad, and storage temperature was the main effector on the GR. Secondary models that describe LPD and GR of L. monocytogenes in seafood salad as a function of mayonnaise pH and storage temperature were produced.

  13. Scott Morgan Johnson Middle School: Personalization Leads to Unlimited Success

    Science.gov (United States)

    Principal Leadership, 2013

    2013-01-01

    The well-known lyrics may be "The Eyes of Texas Are Upon You," but at Scott Morgan Johnson Middle School in McKinney, TX, it's definitely the "eye of the tiger" that sets the bar for Tiger PRIDE (perseverance, respect, integrity, determination, and excellence). This article describes how those ideals have been infused…

  14. A Brief Response to Bailey, Jaggars, and Scott-Clayton

    Science.gov (United States)

    Goudas, Alexandros M.; Boylan, Hunter R.

    2013-01-01

    Shortly after we published "Addressing Flawed Research in Developmental Education" (2012) in the "Journal of Developmental Education," Thomas Bailey, Shanna Smith Jaggars, and Judith Scott- Clayton from the Community College Research Center (CCRC) wrote a response rebutting several of our claims. Though their response corrects…

  15. Astronauts Scott Carpenter and Walter Schirra completes water egress test

    Science.gov (United States)

    1962-01-01

    Project Mercury Astronauts M. Scott Carpenter, prime pilot of the Mercury-Atlas 7, prepares to go through a water egress test. Astronaut Walter M. Schirra (back to camera), the backup MA-7 pilot is also present. Carpenter and Schirra are in the Mercury pressure suit, without the helmet. Behind them is an inflated life raft.

  16. Astronaut Scott Carpenter inserted into Aurora 7 spacecraft

    Science.gov (United States)

    1962-01-01

    Astronaut M. Scott Carpenter, pilot of the Mercury-Atlas 7 space flight, is inserted into Aurora 7 spacecraft during the prelaunch countdown. Carpenter is assisted into the spacecraft by Astronaut John Glenn and Gunter Vendt, McDonnell Douglas pad capsule test conducter.

  17. Astronaut Scott Carpenter in pressure suit awaiting simulated mission

    Science.gov (United States)

    1962-01-01

    Project Mercury Astronaut M. Scott Carpenter smiles, in his pressure suit, prior to participating in a simulated mission run at Cape Canaveral, Florida. Astronaut Carpenter had been selected as the prime pilot on the nation's second attempt to put a man into orbit around the earth.

  18. Astronaut Scott Carpenter examines protective material on pressure bulkhead

    Science.gov (United States)

    1962-01-01

    Mercury Astronaut M. Scott Carpenter examines the honeycomb protective material on the main pressure bulkhead in the white room facility at Hanger S, Cape Canaveral, Florida. This is the spacecraft which will carry astronaut Carpenter on the nation's second manned orbital flight.

  19. Astronaut Scott Carpenter practices in the ALFA trainer at Langley

    Science.gov (United States)

    1962-01-01

    Project Mercury Astronaut M. Scott Carpenter practices in the Air Lubricated Free Attitude (ALFA) trainer located at NASA's Manned Spacecraft Center at Langley AFB, Virginia. This trainer allows the astronaut to see the image of the earth's surface at his feet while manually controlling the spacecraft.

  20. The Relationship between Scott and Narrator in Rob Roy

    Institute of Scientific and Technical Information of China (English)

    YI XIN-Hua

    2015-01-01

    Based on the postcolonial theory, this thesis focuses on a close examination of the relationship between Francis the narrator of Rob Roy and Scott the author.This thesis hopes to provide readers and researchers with a new perspective to Rob Roy and reevaluate Scott’s attitude towards England and Scotland.

  1. Walter Dill Scott and the Student Personnel Movement

    Science.gov (United States)

    Biddix, J. Patrick; Schwartz, Robert A.

    2012-01-01

    Walter Dill Scott (1869-1955), tenth president of Northwestern University and pioneer of industrial psychology, is an essential architect of student personnel work. This study of his accomplishments, drawing on records from the Northwestern University archives, tells a story about the people he influenced and his involvement in codifying what was…

  2. Female counterpart of shawl scrotum in aarskog-scott syndrome

    Directory of Open Access Journals (Sweden)

    Suzana G. Moraes

    2006-08-01

    Full Text Available Aarskog-Scott syndrome (ASS is an X-linked disorder characterized by facial, skeletal and genital anomalies, including penoscrotal transposition in males. We report on a girl from a family with ASS who exhibits a transposition of the clitoris.

  3. Theorizing Steampunk in Scott Westerfeld's YA Series Leviathan

    Science.gov (United States)

    Mielke, Tammy L.; LaHaie, Jeanne M.

    2015-01-01

    In this article, we offer an explanation of steampunk and theorize the genre and its functions within Scott Westerfeld's YA series Leviathan. In order to do so, we examine the "cogs" of the genre machine and its use of nostalgic longing for a revised past/future to rebel against present day cultural norms. Critics note that steampunk…

  4. Order Topology and Bi-Scott Topology on a Poset

    Institute of Scientific and Technical Information of China (English)

    Bin ZHAO; Kai Yun WANG

    2011-01-01

    In this paper,some properties of order topology and bi-Scott topology on a poset are obtained.Order-convergence in posets is further studied.Especially,a sufficient and necessary condition for order-convergence to be topological is given for some kind of posets.

  5. [Enterocin-35, a bacteriocin with activity against Listeria monocytogenes. Possible use in the food industry].

    Science.gov (United States)

    Concha, R; Farías, M E; Kümmerlin, R; Sesma, F

    1999-01-01

    The in vitro inhibitory activity of enterocin-35 produced by Enterococcus faecium CRL 35, was studied against Listeria monocytogenes, isolated from seafoods. Optimal growth conditions of the enterocin-35 producing strain, for higher bacteriocin production and improve the extraction and purification of these peptides, were applied. A crude extract of enterocin-35 was assayed in a frozen seafood artificially contaminated with Listeria monocytogenes isolate, simulating at laboratory scale an eventual application of this biopreservant in a routine production process at factory level. The feasibility of biopreservation of seafoods by means of bacteriocins is proposed and discussed.

  6. Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

    Science.gov (United States)

    Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

    2017-01-16

    The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and monocytogenes when the sample BC levels were high (>100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Growth control of Listeria monocytogenes on cold-smoked salmon using a competitive lactic acid bacteria flora.

    Science.gov (United States)

    Nilsson, L; Gram, L; Huss, H H

    1999-04-01

    A Lactobacillus sake strain LKE5 and four strains of Carnobacterium piscicola were evaluated as biopreservation cultures to control the growth of Listeria monocytogenes on vacuum-packed, cold-smoked salmon stored at 5 degrees C. All five strains were antilisterial as live cultures in an agar diffusion assay. Cell-free supernatants of two strains of C. piscicola and L. sake LKE5 were also antilisterial because of the production of bacteriocins. The presence of high cell numbers of strains of C. piscicola had no influence on the sensory quality of cold-smoked salmon stored at 5 degrees C, but L. sake LKE5 caused strong sulfurous off-flavors and was rejected as a culture for biopreservation of cold-smoked salmon. A bacteriocin-producing strain of C. piscicola (A9b) initially caused a 7-day lag phase of L. monocytogenes, followed by a reduction in numbers of L. monocytogenes from 10(3) CFU/ml to below 10 CFU/ml after 32 days of incubation, coinciding with the detection of antilisterial compounds. The presence of a nonbacteriocin-producing strain of C. piscicola (A10a) prevented the growth of L. monocytogenes during the 32-day incubation. The growth of L. monocytogenes was strongly repressed on cold-smoked salmon in the presence of C. piscicola A9b and A 10a, respectively. The initial cell numbers of L. monocytogenes that were found on Oxford plates incubated at 25 degrees C reached low maximum cell counts of 10(4) and 2 x 10(3) after 14 and 20 days of storage in mixed culture with C. piscicola A9b and A10a.

  8. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  9. Antibacterial activity of aromatic plants essential oils from Serbia against the Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Klaus Anita

    2009-01-01

    Full Text Available The purpose of this study was to examine the effectiveness of selected essential oils for the control of the growth and survival of pathogenic bacteria Listeria monocytogenes ATCC 19112 and Listeria monocytogenes ATCC 19115, which are of significant importance in food hygiene. Essential oils extracted from Salvia officinalis L., Rosmarinus officinalis L., Majorana hortensis Moench., Thymus vulgaris L., Carum carvi L., Pimpinella anisum L. and Coriandrum sativum L. were evaluated. Antibacterial activity was done by the disk diffusion method in the presence of pure essential oils and four suspensions in alcohol. The best results obtained with Thymus vulgaris and Majorana hortensis essential oils, which were acting microbicidaly on both observed strains of Listeria monocytogenes, even in the small concentration. Because some of the essential oils were highly inhibitory even in small quantities to selected pathogenic bacteria, they may provide alternatives to conventional antimicrobial additives in foods. .

  10. Isolation and Identification of Listeria monocytogenes in Processed Meat by a Combined Cultural-molecular Method

    Directory of Open Access Journals (Sweden)

    Angela Ingianni

    2007-01-01

    Full Text Available The isolation and identification of Listeria monocytogenes in processed meat samples by a combined cultural-molecular method is described. It allows the identification of Listeria strains by means of a hybridization technique with a specific DNA probe directed to the listerial internalin gene. The specificity of this method was found to be 100% and sensitivity was as low as 1 CFU/2.5 g of food sample. A total of 278 meat samples were tested in comparison with PCR and conventional cultural assays. A total of 42 (15.4% L. monocytogenes were detected. PCR analysis gave 3 false negative results and culture failed to detect the Listeria in 5 cases. With this cultural-molecular method the identification and quantitative detection of L. monocytogenes were achieved within 36 hours and no false positive or negative tests were obtained, thus fitting most food industry requirements.

  11. Thermal inactivation and growth potential of Listeria monocytogenes in smoked tench

    Directory of Open Access Journals (Sweden)

    Raffaella Branciari

    2016-08-01

    Full Text Available An experimental study for the evaluation of Listeria monocytogenes inactivation during a hot smoking process in tench was performed using Listeria innocua strains. Furthermore, the survival of L. monocytogenes in smoked tench was determined after post-processing in contaminated samples, evaluating the growth potential during storage. L. innocua was not detected after the smoking process. In the challenge test, the growth potential of L. monocytogenes was 5.68 log colony forming unit g−1. The results showed that hot smoking at an inner temperature around 72°C is able to eliminate the microorganism. Nevertheless, the product is able to support the growth of the pathogen if post-process contamination occurs, as the food is suitable for Listeria multiplication. Product recontamination should be prevented by means of appropriate application of hygiene measures.

  12. Epidemiological Survey of Listeria monocytogenes in a gravlax salmon processing line Epidemiologia de Listeria monocytogenes em uma linha de processamento de salmão gravlax

    Directory of Open Access Journals (Sweden)

    C.D. Cruz

    2008-06-01

    Full Text Available Listeria monocytogenes is a cause of concern to food industries, mainly for those producing ready-to-eat (RTE products. This microorganism can survive processing steps such as curing and cold smoking and is capable of growing under refrigeration temperatures. Its presence in RTE fish products with extended shelf life may be a risk to the susceptible population. One example of such a product is gravlax salmon; a refrigerated fish product not exposed to listericidal processes and was the subject of this study. In order to evaluate the incidence and dissemination of L. monocytogenes 415 samples were collected at different steps of a gravlax salmon processing line in São Paulo state, Brazil. L. monocytogenes was confirmed in salmon samples (41%, food contact surfaces (32%, non-food contact surfaces (43% and of food handlers' samples (34%, but could not be detected in any ingredient. 179 L. monocytogenes isolates randomly selected were serogrouped and typed by PFGE. Most of L. monocytogenes strains belonged to serogroup 1 (73%. 61 combined pulsotypes were found and a dendrogram identified six clusters: most of the strains (120 belonged to cluster A. It was suggested that strains arriving into the plant via raw material could establish themselves in the processing environment contaminating the final product. The wide dissemination of L. monocytogenes in this plant indicates that a great effort has to be taken to eliminate the microorganism from these premises, even though it was not observed multiplication of the microorganism in the final product stored at 4ºC up to 90 days.Listeria monocytogenes é um patógenode grande preocupação para as indústrias alimentícias, principalmente aquelas produtoras de alimentos prontos para consumo (RTE. Este microrganismo pode sobreviver às etapas de cura e defumação a frio, além de tolerar temperaturas de refrigeração. A presença de L. monocytogenes em pescados RTE com vida de prateleira longa

  13. The study of effect bacteriocin producing Lactoco ccus lactis on Listeria monocytogenes and Bacillus cereus

    Directory of Open Access Journals (Sweden)

    M. Mirhossieni, M.Sc

    2007-01-01

    Full Text Available AbstractBackground and purpose: Dairy products often associated with problems such as short shelf life and poor hygiene control. A novel approach is to utilize bacteriocin or bacteriocin producer strains, to control undesirable micro flora as Listeria monocytogenes and Bacillus cereus in foods. Hence, we studied the effect of nisin like producing Lactococcus lactis against Listeria monocytogenes and Bacillus cereus, in order to compare the isolated strain within different countries.Materials and Methods: In this research we studied the effect of nisin like producing Lactococcus lactis, with producer spot test method. We also used supernatant from 24 h culture of Lactoccus lactis. Moreover, we studied the effect of bacteriocin on Listeria monocytogenes and Bacillus cereus growth curves.Results: The growth of both strains was inhibited by the bacteriocin. Conclusion: According to our results, the bacteriocin could be used in liquid food with bacteriocin added directly or as a starter culture in fermentation. This would inhibit the growth of Listeria monocytogenes; furthermore, Bacillus cereus is used to reduce food poisoning for fermented food products.

  14. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Science.gov (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-07-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  15. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

    2009-07-15

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  16. High-pressure processing of Gorgonzola cheese: influence on Listeria monocytogenes inactivation and on sensory characteristics.

    Science.gov (United States)

    Carminati, D; Gatti, M; Bonvini, B; Neviani, E; Mucchetti, G

    2004-08-01

    The presence of Listeria monocytogenes on the rind of Gorgonzola cheese is difficult to avoid. This contamination can easily occur as a consequence of handling during ripening. The aims of this study were to determine the efficiency of high-pressure processing (HPP) for inactivation of L. monocytogenes on cheese rind and to evaluate the influence of HPP treatments on sensory characteristics. Gorgonzola cheese rinds, after removal, were inoculated (about 7.0 log CFU/g) with L. monocytogenes strains previously isolated from other Gorgonzola cheeses. The inoculated cheese rinds were processed with an HPP apparatus under conditions of pressure and time ranging from 400 to 700 MPa for 1 to 15 min. Pressures higher than 600 MPa for 10 min or 700 MPa for 5 min reduced L. monocytogenes more than 99%. A reduction higher than 99.999% was achieved pressurizing cheese rinds at 700 MPa for 15 min. Lower pressure or time treatments were less effective and varied in effectiveness with the cheese sample. Changes in sensory properties possibly induced by the HPP were evaluated on four different Gorgonzola cheeses. A panel of 18 members judged the treated and untreated cheeses in a triangle test. Only one of the four pressurized cheeses was evaluated as different from the untreated sample. HPP was effective in the reduction of L. monocytogenes on Gorgonzola cheese rinds without significantly changing its sensory properties. High-pressure technology is a useful tool to improve the safety of this type of cheese.

  17. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  18. A new bovine conjunctiva model shows that Listeria monocytogenes invasion is associated with lysozyme resistance.

    Science.gov (United States)

    Warren, Jessica; Owen, A Rhys; Glanvill, Amy; Francis, Asher; Maboni, Grazieli; Nova, Rodrigo J; Wapenaar, Wendela; Rees, Catherine; Tötemeyer, Sabine

    2015-08-31

    Listerial keratoconjunctivitis ('silage eye') is a wide spread problem in ruminants causing economic losses to farmers and impacts negatively on animal welfare. It results from direct entry of Listeria monocytogenes into the eye, often following consumption of contaminated silage. An isolation protocol for bovine conjunctival swabbing was developed and used to sample both infected and healthy eyes bovine eyes (n=46). L. monocytogenes was only isolated from one healthy eye sample, and suggests that this organism can be present without causing disease. To initiate a study of this disease, an infection model was developed using isolated conjunctiva explants obtained from cattle eyes post slaughter. Conjunctiva were cultured and infected for 20 h with a range of L. monocytogenes isolates (n=11), including the healthy bovine eye isolate and also strains isolated from other bovine sources, such as milk or clinical infections. Two L. monocytogenes isolates (one from a healthy eye and one from a cattle abortion) were markedly less able to invade conjunctiva explants, but one of those was able to efficiently infect Caco2 cells indicating that it was fully virulent. These two isolates were also significantly more sensitive to lysozyme compared to most other isolates tested, suggesting that lysozyme resistance is an important factor when infecting bovine conjunctiva. In conclusion, we present the first bovine conjunctiva explant model for infection studies and demonstrate that clinical L. monocytogenes isolates from cases of bovine keratoconjunctivitis are able to infect these tissues.

  19. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  20. Fluorescence amplified fragment length polymorphism compared to pulsed field gel electrophoresis for Listeria monocytogenes subtyping

    Directory of Open Access Journals (Sweden)

    Roussel Sophie

    2013-01-01

    Full Text Available Abstract Background Listeriosis is a severe infection which mainly affects pregnant women, neonates and immuno-compromised adults. ANSES’s Laboratory for Food safety has been the European Union Reference Laboratory (EURL for L. monocytogenes in the food chain since 2006. Pulsed Field Gel Electrophoresis (PFGE is routinely used in the EURL for the surveillance of L. monocytogenes isolated from foods, animals and the environment. One of the main EURL activities is to evaluate alternative molecular subtyping methods to PFGE, and integrate their use within the National Reference Laboratories (NRL network. Since 2008, the United Kingdom (UK-NRL for L. monocytogenes at the Health Protection Agency (HPA, London, has used fluorescent Amplified Fragment Length Polymorphism (fAFLP for the routine surveillance of L. monocytogenes isolated from human clinical cases, food and food processing environments in the UK. This study compares fAFLP with PFGE for subtyping L. monocytogenes. Results A panel of 109 L. monocytogenes isolates from either human cases of listeriosis, foods, food processing environments and animals were used for the comparative evaluation. Among these, 2 strains were tested from duplicate culture by both methods. The panel also included field isolates, isolates associated with outbreaks or sporadic cases and reference strains. The two strains tested in duplicate displayed the same fAFLP and PFGE types. Strains known to be epidemiologically associated with one another were found to have unique PFGE and fAFLP types. FAFLP and PFGE divided the strains into 76 and 82 distinct profiles, or types, respectively. The discriminatory index calculated was 0.993 and 0.996 for fAFLP and PFGE, respectively. Conclusions The discriminatory ability of fAFLP was similar to that of PFGE for the subtyping of L. monocytogenes isolates. As a less labour intensive technique fAFLP may be a better method to use than PFGE in investigating outbreaks of human

  1. EFFECTIVENESS OF ELECTROLYZED OXIDIZING WATER FOR INACTIVATING Listeria monocytogenes IN LETTUCE

    Directory of Open Access Journals (Sweden)

    Casadiego Laíd Paola

    2005-06-01

    Full Text Available The effectiveness of electrolyzed oxidizing (EO water for the inactivation of L. monocytogenes in suspension and when inoculated on lettuce leaves was evaluated. An electrolytic cell for the production of EO water was built and a solution of 5% NaCl was used. The EO water produced had a residual chlorine concentration of 29 parts per million (ppm and pH 2.83. Ten strains of L. monocytogenes isolated from processed chicken (109 CFU/ml were inoculated into 9 ml of EO water or 9 ml of deionized water (control and incubated at 15°C for 5, 10, 15 and 20 min. The surviving population of each strain was determined on Columbia agar. An exposure time of 5 min reduced the populations by approximately 6.6 log CFU/ml. The most resistant strains to sodium hypochlorite (NaOCl were selected and used in a strain mixture (9.56 log CFU/ml, 109UFC/ml approximately for the inoculation of 35 lettuce samples, by the dip inoculation method using distilled water as control. The population mean of L. monocytogenes after treatment with EO water and distilled water was reduced by 3.92 and 2.46 log CFU/ml respectively (p=0.00001. EO water and 6% acetic acid (vinegar were combined to improve the EO water effect on L. monocytogenes inoculated in lettuce; the effectiveness of this combination was examined. The results showed that there was a synergistic effect of both antimicrobial agents (population reduction by 5.49 log CFU/ml approximately on the viability of L. monocytogenes cells.

  2. Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

    DEFF Research Database (Denmark)

    Jiang, Lingli; Olesen, Inger; Andersen, Thomas;

    2010-01-01

    survival of L. monocytogenes serotypes 4b and 1=2a strains were higher than that of serotype 1=2c, suggesting that pathogenicity might be related to the viability in the gastrointestinal tract.The transcription levels of prfA and the general stress-related genes clpC, clpE, and clpP were upregulated...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

  3. Detection of antimicrobial sensitiveness of isolates of Listeria monocytogenes from food chain using Vitek 2 Compact Biomerieux

    Directory of Open Access Journals (Sweden)

    Jankuloski Dean

    2010-05-01

    Full Text Available Sensitivity of 26 Listeria monocytogenes isolates toward 18 antimicrobial substances used in veterinary and human medicine was examined using the automated VITEK 2 Compact system bioMerieux. The obtained results indicate that L. monocytogenes strains isolated from food and food processing environment had resistance to several or more antimicrobial substances that are commonly used in the treatment in animals and humans. Results showed resistance of all 26 (100% isolates toward Benzylpenicilin, Ampicilin/Sublactam, Oxacillin, Imipenem and Fosfomycine. Also 7 of the isolates (26.9% were resistant to Clindamiycin, 3 (11.5% to Quinupristion/Dalfopristin and 1 strain to Teicoplanin, Vancomycin, Tetracycline and Fusic acid, respectively.

  4. Listeria monocytogenes en comidas preparadas

    OpenAIRE

    Vila Brugalla, Montserrat

    2013-01-01

    Tradicionalmente Listeria monocytogenes no era considerado como un importante patógeno transmitido a través de los alimentos y, en consecuencia, no había recibido mucha atención por parte de la industria alimentaria. Los índices de listeriosis en la población humana siempre habían estado enormemente ensombrecidos por otras enfermedades transmitidas por los alimentos como la salmonelosis o la campilobacterosis, y la confirmación de brotes era poco frecuente. Sin embargo, los brotes de listerio...

  5. A five-gene stress survival islet (SSI-1) that contributes to the growth of Listeria monocytogenes in suboptimal conditions.

    Science.gov (United States)

    Ryan, S; Begley, M; Hill, C; Gahan, C G M

    2010-09-01

    The aim of this study was to examine the contribution of a five-gene islet (lmo0444 - lmo0448) to the growth of Listeria monocytogenes under suboptimal conditions. Bioinformatics and PCR analyses revealed that a five-gene islet is present in c. half of all L. monocytogenes strains examined (66 in total). A deletion mutant that lacks the entire c. 8·7-kb islet was created in L. monocytogenes strain LO28. This mutant was impaired in growth at low pH and at high salt concentrations and demonstrated a decreased ability to survive and grow in a model food system (frankfurters). Transcriptional analysis revealed that the islet is self-regulated in that the product of lmo0445 regulates the expression of the other four genes. A role of the alternative stress sigma factor SigB in regulating the islet was also uncovered. The five-gene islet (herein designated as SSI-1; stress survival islet 1) contributes to the growth of L. monocytogenes under suboptimal conditions. SSI-1 may contribute to the survival of certain strains of L. monocytogenes in food environments. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  6. Relativistic Scott correction in self-generated magnetic fields

    DEFF Research Database (Denmark)

    Erdös, Laszlo; Fournais, Søren; Solovej, Jan Philip

    2012-01-01

    We consider a large neutral molecule with total nuclear charge $Z$ in a model with self-generated classical magnetic field and where the kinetic energy of the electrons is treated relativistically. To ensure stability, we assume that $Z \\alpha .../3}$ and it is unchanged by including the self-generated magnetic field. We prove the first correction term to this energy, the so-called Scott correction of the form $S(\\alpha Z) Z^2$. The current paper extends the result of \\cite{SSS} on the Scott correction for relativistic molecules to include a self-generated...... constant. We are interested in the ground state energy in the simultaneous limit $Z \\rightarrow \\infty$, $\\alpha \\rightarrow 0$ such that $\\kappa=Z \\alpha$ is fixed. The leading term in the energy asymptotics is independent of $\\kappa$, it is given by the Thomas-Fermi energy of order $Z^{7...

  7. Adjusting the Scott-Knott cluster analyses for unbalanced designs

    Directory of Open Access Journals (Sweden)

    Thiago Vincenzi Conrado

    2016-12-01

    Full Text Available The Scott-Knott cluster analysis is an alternative approach to mean comparisons with high power and no subset overlapping. It is well suited for the statistical challenges in agronomy associated with testing new cultivars, crop treatments, or methods. The original Scott-Knott test was developed to be used under balanced designs; therefore, the loss of a single plot can significantly increase the rate of type I error. In order to avoid type I error inflation from missing plots, we propose an adjustment that maintains power similar to the original test while adding error protection. The proposed adjustment was validated from more than 40 million simulated experiments following the Monte Carlo method. The results indicate a minimal loss of power with a satisfactory type I error control, while keeping the features of the original procedure. A user-friendly SAS macro is provided for this analysis.

  8. Astronaut Scott Carpenter completes top egress training in white room

    Science.gov (United States)

    1962-01-01

    Project Mercury Astronaut M. Scott Carpenter, prime pilot of the Mercury-Atlas 7 (the nation's second manned orbital flight), completing top egress training in the white room at Cape Canaveral, Florida. The line he is holding is known as the 'man line' which attaches the survival kit to the astronaut. The bag is the survival kit he carries for contingency landings. Clearly visible around his neck is the bag containing the life vest.

  9. On pattern formation in the Gray-Scott model

    Institute of Scientific and Technical Information of China (English)

    Rui PENG; Ming-xin WANG

    2007-01-01

    In the paper, we investigate an elliptic system well-known as the Gray-Scott model and present some further results for positive solutions of this model. More precisely, we give the refined a priori estimates of positive solutions, and improve some previous results for the non-existence and existence of positive non-constant solutions as the parameters are varied, which imply some certain conditions where the pattern formation occurs or not.

  10. Cerebrovascular disease associated with Aarskog-Scott syndrome

    Energy Technology Data Exchange (ETDEWEB)

    DiLuna, Michael L.; Amankulor, Nduka M.; Gunel, Murat [Yale University School of Medicine, Department of Neurosurgery, New Haven, CT (United States); Johnson, Michele H. [Yale University School of Medicine, Department of Diagnostic Radiology, New Haven, CT (United States)

    2007-05-15

    Faciogenital dysplasia, also known as Aarskog-Scott syndrome (AAS), is an X-linked dominant congenital disorder characterized by multiple facial, musculoskeletal, dental, neurological and urogenital abnormalities, ocular manifestations, congenital heart defects, low IQ and behavioral problems. Here we describe an unusual presentation of dysplastic carotid artery, basilar artery malformation or occlusion and posterior circulation aneurysm in a 13-year-old male with AAS. (orig.)

  11. John Scott Haldane: The father of oxygen therapy

    Directory of Open Access Journals (Sweden)

    K C Sekhar

    2014-01-01

    Full Text Available John Scott Haldane was a versatile genius who solved several problems of great practical significance. His ability to look beyond the laboratory and investigate theory added crucial findings in the field of respiratory physiology. His work on high altitude physiology, diving physiology, oxygen therapy, and carbon monoxide poisoning led to a sea change in clinical medicine and improved safety and reduced mortality and morbidity in many high risk situations.

  12. Control of Listeria monocytogenes on cold-smoked salmon using chitosan-based antimicrobial coatings and films.

    Science.gov (United States)

    Jiang, Zheng; Neetoo, Hudaa; Chen, Haiqiang

    2011-01-01

    The relatively high incidence of Listeria monocytogenes in ready-to-eat (RTE) products such as cold-smoked salmon is of serious concern. The objective of this study was to evaluate the efficacy of chitosan-based edible coatings and films incorporating 3 generally recognized as safe (GRAS) antimicrobials, sodium lactate (SL), sodium diacetate (SD), and potassium sorbate (PS), against L. monocytogenes on cold-smoked salmon. Salmon samples were surface-inoculated with a 5-strain cocktail of Listeria monocytogenes to a final concentration of 4.4 log CFU/cm(2) and then either coated with chitosan solutions or wrapped with chitosan films with or without the 3 antimicrobials. The samples were then vacuum packaged and stored at 4 °C for 30 d. The chitosan coatings with or without the antimicrobials consistently showed higher efficacy against L. monocytogenes than chitosan films having the same compositions. The most effective film treatments, chitosan films containing 1.2% SL/0.25% SD or 2.4% SL, achieved ≥ 1.3 log reductions of L. monocytogenes during the 30 d of refrigerated storage, while the most effective coating treatments, chitosan coatings containing 1.2% SL/0.25% SD or 0.15% PS/0.125% SD, achieved ≥ 2.8 log reductions. Practical Application: This study shows that chitosan-based edible coatings and films hold promise and can potentially assist fishery industries in their efforts to control L. monocytogenes.

  13. Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

    Science.gov (United States)

    Ericson, Megan E.; Frank, Matthew W.

    2016-01-01

    Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

  14. Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes.

    Science.gov (United States)

    Yao, Jiangwei; Ericson, Megan E; Frank, Matthew W; Rock, Charles O

    2016-12-01

    Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Comparative Phenotypic and Genotypic Analysis of Swiss and Finnish Listeria monocytogenes Isolates with Respect to Benzalkonium Chloride Resistance.

    Science.gov (United States)

    Meier, Anja B; Guldimann, Claudia; Markkula, Annukka; Pöntinen, Anna; Korkeala, Hannu; Tasara, Taurai

    2017-01-01

    Reduced susceptibility of Listeria monocytogenes to benzalkonium chloride (BC), a quaternary ammonium compound widely used in food processing and hospital environments, is a growing public health and food safety concern. The minimal inhibitory concentration of BC on 392 L. monocytogenes strains from Switzerland (CH) and Finland (FIN) was determined. Within this strain collection, benzalkonium chloride resistance was observed in 12.3% (24/195) of Swiss and 10.6% (21/197) of Finnish strains. In both countries, the highest prevalence of BC-resistant strains (CH: 29.4%; FIN: 38.9%) was detected among serotype 1/2c strains. Based on PCR analysis, genes coding for the qacH efflux pump system were detected for most of the BC-resistant strains (CH: 62.5%; FIN: 52.4%). Some Swiss BC-resistant strains harbored genes coding for the bcrABC (16.7%) efflux pump system, while one Finnish BC-resistant strain harbored the emrE gene previously only described among BC-resistant L. monocytogenes strains from Canada. Interestingly, a subset of BC-resistant strains (CH: 5/24, 20.8%; FIN: 9/21, 42.8%) lacked genes for efflux pumps currently known to confer BC resistance in L. monocytogenes. BC resistance analysis in presence of reserpine showed that the resistance was completely or partially efflux pump dependent in 10 out of the 14 strains lacking the known BC resistance genes. Sequence types 155 and ST403 were over-representated among these strains suggesting that these strains might share similar but yet unknown mechanisms of BC resistance.

  16. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  17. Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

    Science.gov (United States)

    Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

    2017-09-01

    Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

  18. Bacteriophage predation promotes serovar diversification in Listeria monocytogenes.

    Science.gov (United States)

    Eugster, Marcel R; Morax, Laurent S; Hüls, Vanessa J; Huwiler, Simona G; Leclercq, Alexandre; Lecuit, Marc; Loessner, Martin J

    2015-07-01

    Listeria monocytogenes is a bacterial pathogen classified into distinct serovars (SVs) based on somatic and flagellar antigens. To correlate phenotype with genetic variation, we analyzed the wall teichoic acid (WTA) glycosylation genes of SV 1/2, 3 and 7 strains, which differ in decoration of the ribitol-phosphate backbone with N-acetylglucosamine (GlcNAc) and/or rhamnose. Inactivation of lmo1080 or the dTDP-l-rhamnose biosynthesis genes rmlACBD (lmo1081-1084) resulted in loss of rhamnose, whereas disruption of lmo1079 led to GlcNAc deficiency. We found that all SV 3 and 7 strains actually originate from a SV 1/2 background, as a result of small mutations in WTA rhamnosylation and/or GlcNAcylation genes. Genetic complementation of different SV 3 and 7 isolates using intact alleles fully restored a characteristic SV 1/2 WTA carbohydrate pattern, including antisera reactions and phage adsorption. Intriguingly, phage-resistant L. monocytogenes EGDe (SV 1/2a) isolates featured the same glycosylation gene mutations and were serotyped as SV 3 or 7 respectively. Again, genetic complementation restored both carbohydrate antigens and phage susceptibility. Taken together, our data demonstrate that L. monocytogenes SV 3 and 7 originate from point mutations in glycosylation genes, and we show that phage predation represents a major driving force for serovar diversification and evolution of L. monocytogenes.

  19. Contamination of cooked peeled shrimp (Pandalus borealis) by Listeria monocytogenes during processing at two processing plants.

    Science.gov (United States)

    Gudmundsdóttir, Sigrún; Gudbjörnsdóttir, Birna; Einarsson, Hjörleifur; Kristinsson, Karl G; Kristjansson, Már

    2006-06-01

    Listeria spp. and Listeria monocytogenes contamination was evaluated in cooked peeled shrimp (final or semifinal product, 82 samples) and the shrimp-processing environment (two plants, 613 samples) in eight surveys conducted from 1998 through 2001. Listeria was detected in 12.5% (78) of the 695 samples (11.2% of the samples were positive for L. monocytogenes), but none of the samples of final product contained Listeria. One hundred seventy-two L. monocytogenes isolates were characterized by pulsed-field gel electrophoresis. Cleavage with macrorestriction enzymes AscI and ApaI yielded 14 different pulsotypes in the plants; two types were dominant, one in each plant. Sixty-three of the 106 isolates in plant A and 43 of the 66 isolates in plant B were of the dominant types. Certain strains, mainly of serotypes 1/2c and 4b and pulsotypes 1A and 2H, were persistent for long periods in both plants. Adaptation of good hygienic practices in the processing plants, including strict rules concerning traffic of staff and equipment, and existing hygienic requirements appeared to be effective in preventing contamination between areas within plants and in the final product. The persistence of Listeria strains in these two processing plants indicates the importance of detecting the places in the processing environment (e.g., transporters, equipment, floors, and drains) where L. monocytogenes can survive so that cleaning and disinfection efforts can be directed to such niches.

  20. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

    Science.gov (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

    2015-10-23

    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes.

  1. Eradication of high viable loads of Listeria monocytogenes contaminating food-contact surfaces

    Directory of Open Access Journals (Sweden)

    Silvia ede Candia

    2015-07-01

    Full Text Available This study demonstrates the efficacy of cold gaseous ozone treatments at low concentrations in the eradication of high Listeria monocytogenes viable cell loads from glass, polypropylene, stainless steel and expanded polystyrene food-contact surfaces. Using a step by step approach, involving the selection of the most resistant strain-surface combinations, 11 Listeria spp. strains resulted inactivated by a continuous ozone flow at 1.07 mg m-3 after 24 or 48 h of cold incubation, depending on both strain and surface evaluated. Increasing the inoculum level to 9 log CFU coupon-1, the best inactivation rate was obtained after 48h of treatment at 3.21 mg m-3 ozone concentration when cells were deposited onto stainless steel and expanded polystyrene coupons, resulted the most resistant food-contact surfaces in the previous assays.The addition of naturally microbiologically contaminated meat extract to a high load of L. monocytogenes LMG 23775 cells, the most resistant strain out of the 11 assayed Listeria spp. strains, led to its complete inactivation after four days of treatment.To the best of our knowledge, this is the first report describing the survival of L. monocytogenes and the effect of ozone treatment under cold storage conditions on expanded polystyrene, a commonly-used material in food packaging. These results could be useful for reducing pathogen cross-contamination phenomena during cold food storage.

  2. Conservation and distribution of the benzalkonium chloride resistance cassette bcrABC in Listeria monocytogenes.

    Science.gov (United States)

    Dutta, Vikrant; Elhanafi, Driss; Kathariou, Sophia

    2013-10-01

    Analysis of a panel of 116 Listeria monocytogenes strains of diverse serotypes and sources (clinical, environment of food processing plants, and food) revealed that all but one of the 71 benzalkonium chloride-resistant (BC(r)) isolates harbored bcrABC, previously identified on a large plasmid (pLM80) of the 1998-1999 hot dog outbreak strain H7858. In contrast, bcrABC was not detected among BC-susceptible (BC(s)) isolates. The bcrABC sequences were highly conserved among strains of different serotypes, but variability was noted in sequences flanking bcrABC. The majority of the BC(r) isolates had either the pLM80-type of organization of the bcrABC region or appeared to harbor bcrABC on the chromosome, adjacent to novel sequences. Transcription of bcrABC was induced by BC (10 μg/ml) in strains of different serotypes and diverse bcrABC region organization. These findings reveal widespread dissemination of bcrABC across BC(r) L. monocytogenes strains regardless of serotype and source, while also suggesting possible mechanisms of bcrABC dissemination across L. monocytogenes genomes.

  3. Polyphasic characterization and genetic relatedness of low-virulence and virulent Listeria monocytogenes isolates

    Directory of Open Access Journals (Sweden)

    Roche Sylvie M

    2012-12-01

    Full Text Available Abstract Background Currently, food regulatory authorities consider all Listeria monocytogenes isolates as equally virulent. However, an increasing number of studies demonstrate extensive variations in virulence and pathogenicity of L. monocytogenes strains. Up to now, there is no comprehensive overview of the population genetic structure of L. monocytogenes taking into account virulence level. We have previously demonstrated that different low-virulence strains exhibit the same mutations in virulence genes suggesting that they could have common evolutionary pathways. New low-virulence strains were identified and assigned to phenotypic and genotypic Groups using cluster analysis. Pulsed-field gel electrophoresis, virulence gene sequencing and multi-locus sequence typing analyses were performed to study the genetic relatedness and the population structure between the studied low-virulence isolates and virulent strains. Results These methods showed that low-virulence strains are widely distributed in the two major lineages, but some are also clustered according to their genetic mutations. These analyses showed that low-virulence strains initially grouped according to their lineage, then to their serotypes and after which, they lost their virulence suggesting a relatively recent emergence. Conclusions Loss of virulence in lineage II strains was related to point mutation in a few virulence genes (prfA, inlA, inlB, plcA. These strains thus form a tightly clustered, monophyletic group with limited diversity. In contrast, low-virulence strains of lineage I were more dispersed among the virulence strains and the origin of their loss of virulence has not been identified yet, even if some strains exhibited different mutations in prfA or inlA.

  4. In vitro and in vivo invasiveness of different pulsed-field get electrophoresis types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Charlotte Nexmann; Nørrung, Birgit; Sommer, Helle Mølgaard

    2002-01-01

    The virulence of different pulsed-field gel electrophoresis (PFGE) types of Listeria monocytogenes was examined by monitoring their ability to invade Caco-2 cells. Strains belonging to seven different PFGE types originating from both foods and humans were included. No significant differences...... others is supported by this study showing that certain PFGE types of L. monocytogenes commonly found in food are less invasive than others to Caco-2 cells. In contrast to the differences in invasion, identical intracellular growth rates between the different PFGE types were observed. In vivo studies...... of the actual ability of the strains to invade the liver and spleen of cimetidine-treated rats following an oral dose of 109 L. monocytogenes cells were performed for isolates of PFGE types 1, 2, 5, and 15. After 2 days, equal amounts of bacteria were observed in the liver and spleen of the rats for any...

  5. Effect of peracetic acid on biofilms formed by Staphylococcus aureus and Listeria monocytogenes isolated from dairy plants.

    Science.gov (United States)

    Lee, S H I; Cappato, L P; Corassin, C H; Cruz, A G; Oliveira, C A F

    2016-03-01

    This research investigated the removal of adherent cells of 4 strains of Staphylococcus aureus and 1 Listeria monocytogenes strain (previously isolated from dairy plants) from polystyrene microtiter plates using peracetic acid (PAA, 0.5%) for 15, 30, 60, and 120 s, and the inactivation of biofilms formed by those strains on stainless steel coupons using the same treatment times. In the microtiter plates, PAA removed all S. aureus at 15 s compared with control (no PAA treatment). However, L. monocytogenes biofilm was not affected by any PAA treatment. On the stainless steel surface, epifluorescence microscopy using LIVE/DEAD staining (BacLight, Molecular Probes/Thermo Fisher Scientific, Eugene, OR) showed that all strains were damaged within 15 s, with almost 100% of cells inactivated after 30 s. Results of this trial indicate that, although PAA was able to inactivate both S. aureus and L. monocytogenes monospecies biofilms on stainless steel, it was only able to remove adherent cells of S. aureus from polystyrene microplates. The correct use of PAA is critical for eliminating biofilms formed by S. aureus strains found in dairy plants, although further studies are necessary to determine the optimal PAA treatment for removing biofilms of L. monocytogenes.

  6. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included......The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  7. Inhibition of Listeria monocytogenes and Salmonella by combinations of oriental mustard, malic acid, and EDTA.

    Science.gov (United States)

    Olaimat, Amin N; Holley, Richard A

    2014-04-01

    The antimicrobial activities of oriental mustard extract alone or combined with malic acid and EDTA were investigated against Salmonella spp. or Listeria monocytogenes at different temperatures. Five strain Salmonella or L. monocytogenes cocktails were separately inoculated in Brain Heart Infusion broth containing 0.5% (w/v) aqueous oriental mustard extract and incubated at 4 °C to 21 °C for 21 d. For inhibitor combination tests, Salmonella Typhimurium 02:8423 and L. monocytogenes 2-243 were individually inoculated in Mueller Hinton broth containing the mustard extract with either or both 0.2% (w/v) malic acid and 0.2% (w/v) EDTA and incubated at 10 °C or 21 °C for 10 to 14 d. Mustard extract inhibited growth of the L. monocytogenes cocktail at 4 °C up to 21 d (2.3 log10 CFU/mL inhibition) or at 10 °C for 7 d (2.4 log10 CFU/mL inhibition). Salmonella spp. viability was slightly, but significantly reduced by mustard extract at 4 °C by 21 d. Although hydrolysis of sinigrin in mustard extract by both pathogens was 2 to 6 times higher at 21 °C than at 4 °C to 10 °C, mustard was not inhibitory at 21 °C, perhaps because of the instability of its hydrolysis product (allyl isothiocyanate). At 21 °C, additive inhibitory effects of mustard extract with EDTA or malic acid led to undetectable levels of S. Typhimurium and L. monocytogenes by 7 d and 10 d, respectively. At 10 °C, S. Typhimurium was similarly susceptible, but combinations of antimicrobials were not more inhibitory to L. monocytogenes than the individual agents.

  8. Inactivation of Listeria monocytogenes on Frozen Red Raspberries by Using UV-C Light.

    Science.gov (United States)

    Liao, Yen-Te; Syamaladevi, Roopesh M; Zhang, Hongchao; Killinger, Karen; Sablani, Shyam

    2017-04-01

    In this study, the efficacy of UV-C treatment was determined on the reduction of foodborne pathogens on artificially contaminated frozen food surfaces. At first, the UV-C inactivation rates on 100 μl of the respective cocktails of Escherichia coli O157:H7, Salmonella , and Listeria monocytogenes covered underneath 0.5-cm-thick ice were examined. Simultaneously, the energy percentage of UV-C transmitted through the ice was determined. The experiments showed that more than 65% of the UV-C light energy passed through the ice and that UV-C susceptibility was in the descending order of E. coli O157:H7, Salmonella , and L. monocytogenes . L. monocytogenes , the most UV-C-resistant strain, was then selected to test on frozen raspberries. The UV-C inactivation kinetic data of L. monocytogenes were well described using the Weibull equation. During 720 s of UV-C exposure, with a total dose of 7.8 × 10(2) mJ/cm(2), a 1.5-log CFU/g reduction of L. monocytogenes population on the surface of frozen red raspberries was noted. No significant differences in total anthocyanins, total phenolics, and total antioxidant activity were observed between UV-C-treated and untreated frozen berries immediately after treatment. At the end of 9 months of storage at -35°C, UV-C-treated berries had statistically lower total phenolics, higher total anthocyanins, and similar total antioxidant activity compared with untreated berries. This study shows that UV-C light can be used to reduce the L. monocytogenes population on frozen raspberries.

  9. Antibiotic therapy for Listeria monocytogenes bacteremia.

    Science.gov (United States)

    Hung, C C; Chang, S C; Chen, Y C; Hsieh, W C; Luh, K T

    1995-01-01

    Listeria monocytogenes has been recognized as an important pathogen in immunocompromised patients, but it has been rarely reported in Taiwan. We reviewed 13 cases of L. monocytogenes bacteremia at National Taiwan University Hospital over a 12-year period. All of the patients had underlying diseases. Fever was the most common presenting symptom, and neurologic signs were found in 6 patients. Most of the patients received penicillin G, ampicillin or piperacillin with an aminoglycoside. Corticosteroids were used in 9 of 13 patients. The overall mortality directly due to L. monocytogenes bacteremia was 31%. However, patients treated with cephalosporins or oxacillin had higher mortality than those treated with penicillin G, ampicillin or piperacillin (p = 0.05). Given the increasing number of immunosuppressed patients in Taiwan, it is likely that more cases will be encountered. Physicians in Taiwan should be aware of L. monocytogenes bacteremia and its treatment.

  10. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased sequencing of L. monocytogenes isolates in combination with stress tolerance profiling, will enhance the ability to identify genetic elements

  11. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  12. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... understanding of L. monocytogenes prevalence in different types of cheeses and provided results that can be useful as input for quantitative microbiological risk assessment modelling....

  13. Listeria monocytogenes isolated from food samples from a Romanian black market show distinct virulence profiles.

    Science.gov (United States)

    Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin

    2015-09-16

    Listeria monocytogenes is a facultative intracellular foodborne pathogen responsible for listeriosis. In a recent study, in which we investigated neglected exogenous routes of transmission of foodborne pathogens into the European Union, we have isolated 15 L. monocytogenes strains in food products, which were imported from the Republic of Moldavia to Romania and illegally sold at a local market. The aim of this study was to characterize the subtype and virulence potential of these 15 L. monocytogenes strains. Multilocus sequence typing revealed that these L. monocytogenes strains belong to six different sequence types (ST2, ST8, ST9, ST20, ST121 and ST155). In addition, in vitro virulence assays using human intestinal epithelial Caco2 and macrophage-like THP1 cells showed a high strain variability regarding the invasion efficiency in Caco2 cells (0.98-2.78%) and the intracellular growth rate in both cell types. Both ST121 strains and the ST9 isolate were unable to invade Caco2 cells, and all ST155 strains showed no proliferation inside macrophages and revealed low cytotoxicity. Furthermore we performed sequence analysis of three main virulence factors: PrfA, internalin A (InlA) and listeriolysin O (LLO). The Romanian food isolates showed a high diversity in the InlA and LLO amino acid sequences, whereas the amino acid sequence of PrfA of all strains was identical. Overall, the amino acid sequences of PrfA, InlA and LLO were identical for strains belonging to the same ST. We detected in total 30 different amino acid substitutions, resulting in seven different InlA variants, two of which have not yet been described. The three strains, which were unable to invade Caco2 cells, harboured a premature stop codon resulting in truncated InlA. Furthermore, we detected four different amino acid substitutions in the LLO sequence, which are present in four variants. The number of LLO mutations correlates negatively with intracellular growth in Caco2 and THP1 cells and

  14. Probing the pan-genome of Listeria monocytogenes: new insights into intraspecific niche expansion and genomic diversification

    Directory of Open Access Journals (Sweden)

    Salzberg Steven L

    2010-09-01

    Full Text Available Abstract Background Bacterial pathogens often show significant intraspecific variations in ecological fitness, host preference and pathogenic potential to cause infectious disease. The species of Listeria monocytogenes, a facultative intracellular pathogen and the causative agent of human listeriosis, consists of at least three distinct genetic lineages. Two of these lineages predominantly cause human sporadic and epidemic infections, whereas the third lineage has never been implicated in human disease outbreaks despite its overall conservation of many known virulence factors. Results Here we compare the genomes of 26 L. monocytogenes strains representing the three lineages based on both in silico comparative genomic analysis and high-density, pan-genomic DNA array hybridizations. We uncover 86 genes and 8 small regulatory RNAs that likely make L. monocytogenes lineages differ in carbohydrate utilization and stress resistance during their residence in natural habitats and passage through the host gastrointestinal tract. We also identify 2,330 to 2,456 core genes that define this species along with an open pan-genome pool that contains more than 4,052 genes. Phylogenomic reconstructions based on 3,560 homologous groups allowed robust estimation of phylogenetic relatedness among L. monocytogenes strains. Conclusions Our pan-genome approach enables accurate co-analysis of DNA sequence and hybridization array data for both core gene estimation and phylogenomics. Application of our method to the pan-genome of L. monocytogenes sheds new insights into the intraspecific niche expansion and evolution of this important foodborne pathogen.

  15. Isolation of Listeria monocytogenes in a salami producing plant in Piedmont: use of pulsed field gel electrophoresis to trace contaminations

    Directory of Open Access Journals (Sweden)

    Annalisa Costa

    2013-06-01

    Full Text Available The ability of Listeria monocytogenes to survive in different environments and establish persistent contaminations is an important issue for food producers. This study aimed to assess the environmental contamination level in an Italian salami producing plant and to identify possible sources of contamination using pulsed field gel electrophoresis (PFGE on L. monocytogenes isolates obtained from environmental (n=54 and meat samples (n=9 collected over 9 months. Detection of L. monocytogenes was performed using the UNI EN ISO 11290-1 procedure and every isolate was characterised with PFGE, using AscI and ApaI restriction enzymes. The environmental detection frequencies were constant both in the first (22% and the second (27% visit, thus suggesting the presence of strains adapted to the processing plant. Equipments can represent a reservoir of L. monocytogenes from which it can spread into the whole producing plant. The reservoir was documented by PFGE results which showed several persistent strains. Moreover, PFGE proved the cross-contamination between surfaces and semiprocessed products like pastes, which furthermore have been contaminated by L. monocytogenes in 100% of samples in the first two visits and in 33% in the last visit. This study gave evidence that detection methods and PFGE characterisation can be effective tools to detect possible sources and routes of contamination.

  16. Inhibition of Listeria monocytogenes on Ready-to-Eat Meats Using Bacteriocin Mixtures Based on Mode-of-Action

    Directory of Open Access Journals (Sweden)

    Paul Priyesh Vijayakumar

    2017-03-01

    Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.

  17. Probing the pan-genome of Listeria monocytogenes: new insights into intraspecific niche expansion and genomic diversification.

    Science.gov (United States)

    Deng, Xiangyu; Phillippy, Adam M; Li, Zengxin; Salzberg, Steven L; Zhang, Wei

    2010-09-16

    Bacterial pathogens often show significant intraspecific variations in ecological fitness, host preference and pathogenic potential to cause infectious disease. The species of Listeria monocytogenes, a facultative intracellular pathogen and the causative agent of human listeriosis, consists of at least three distinct genetic lineages. Two of these lineages predominantly cause human sporadic and epidemic infections, whereas the third lineage has never been implicated in human disease outbreaks despite its overall conservation of many known virulence factors. Here we compare the genomes of 26 L. monocytogenes strains representing the three lineages based on both in silico comparative genomic analysis and high-density, pan-genomic DNA array hybridizations. We uncover 86 genes and 8 small regulatory RNAs that likely make L. monocytogenes lineages differ in carbohydrate utilization and stress resistance during their residence in natural habitats and passage through the host gastrointestinal tract. We also identify 2,330 to 2,456 core genes that define this species along with an open pan-genome pool that contains more than 4,052 genes. Phylogenomic reconstructions based on 3,560 homologous groups allowed robust estimation of phylogenetic relatedness among L. monocytogenes strains. Our pan-genome approach enables accurate co-analysis of DNA sequence and hybridization array data for both core gene estimation and phylogenomics. Application of our method to the pan-genome of L. monocytogenes sheds new insights into the intraspecific niche expansion and evolution of this important foodborne pathogen.

  18. Internalization of Listeria monocytogenes in Whole Avocado.

    Science.gov (United States)

    Chen, Yi; Evans, Peter; Hammack, Thomas S; Brown, Eric W; Macarisin, Dumitru

    2016-08-01

    In recent years, tree fruits have emerged as a new concern for Listeria monocytogenes contamination. The objective of the current study was to evaluate the potential internalization of L. monocytogenes from the surface of avocados into the edible portions of the fruit during certain postharvest practices simulated in a laboratory setting. One set of intact avocados was spot inoculated with L. monocytogenes on the stem scar, and the second set was hydrocooled in water contaminated with L. monocytogenes. Under these experimental conditions, L. monocytogenes internalized into the avocado pulp through the stem or stem scar after both spot inoculation and hydrocooling. In avocados spot inoculated with 50, 130, 500, and 1,300 CFU per fruit, bacteria were detected in the edible portion adjacent to the stem scar within 15 days postinoculation during storage at 4°C. In avocados hydrocooled in water containing L. monocytogenes at 10(6) and 10(8) CFU/ml, bacteria reached the bottom end of the fruit, and the populations in the edible portion adjacent to the stem scar reached up to 5.90 to 7.19 log CFU/g within 10 to 15 days during storage at 4°C. Dye mixed with inoculum was useful for guiding subsequent sampling, but dye penetration patterns were not always consistent with bacterial penetration.

  19. Listeria monocytogenes virulence factor Listeriolysin O favors bacterial growth in co-culture with the ciliate Tetrahymena pyriformis, causes protozoan encystment and promotes bacterial survival inside cysts

    Directory of Open Access Journals (Sweden)

    Ermolaeva Svetlana A

    2010-01-01

    Full Text Available Abstract Background The gram-positive pathogenic bacterium Listeria monocytogenes is widely spread in the nature. L. monocytogenes was reported to be isolated from soil, water, sewage and sludge. Listeriolysin O (LLO is a L. monocytogenes major virulence factor. In the course of infection in mammals, LLO is required for intracellular survival and apoptosis induction in lymphocytes. In this study, we explored the potential of LLO to promote interactions between L. monocytogenes and the ubiquitous inhabitant of natural ecosystems bacteriovorous free-living ciliate Tetrahymena pyriformis. Results Wild type L. monocytogenes reduced T. pyriformis trophozoite counts and stimulated encystment. The effects were observed starting from 48 h of co-incubation. On the day 14, trophozoites were eliminated from the co-culture while about 5 × 104 cells/ml remained in the axenic T. pyriformis culture. The deficient in the LLO-encoding hly gene L. monocytogenes strain failed to cause mortality among protozoa and to trigger protozoan encystment. Replenishment of the hly gene in the mutant strain restored toxicity towards protozoa and induction of protozoan encystment. The saprophytic non-haemolytic species L. innocua transformed with the LLO-expressing plasmid caused extensive mortality and encystment in ciliates. During the first week of co-incubation, LLO-producing L. monocytogenes demonstrated higher growth rates in association with T. pyriformis than the LLO-deficient isogenic strain. At latter stages of co-incubation bacterial counts were similar for both strains. T. pyriformis cysts infected with wild type L. monocytogenes caused listerial infection in guinea pigs upon ocular and oral inoculation. The infection was proved by bacterial plating from the internal organs. Conclusions The L. monocytogenes virulence factor LLO promotes bacterial survival and growth in the presence of bacteriovorous ciliate T. pyriformis. LLO is responsible for L. monocytogenes

  20. Postadaptational Resistance to Benzalkonium Chloride and Subsequent Physicochemical Modifications of Listeria monocytogenes

    Science.gov (United States)

    To, Monica S.; Favrin, Stacy; Romanova, Nadya; Griffiths, Mansel W.

    2002-01-01

    Many studies have demonstrated that bacteria, including Listeria monocytogenes, are capable of adapting to disinfectants used in industrial settings after prolonged exposure to sublethal concentrations. However, the consequent alterations of the cell surface due to sanitizer adaptation of this pathogen are not fully understood. Two resistant and four sensitive L. monocytogenes strains from different sources were progressively subcultured with increasing sublethal concentrations of a surfactant, benzalkonium chloride (BC). To evaluate the effects of acquired tolerance to BC, parent and adapted strains were compared by using several morphological and physiological tests. Sensitive strains showed at least a fivefold increase in the MIC, while the MIC doubled for resistant strains after the adaptation period. The hydrophobicities of cells of parent and adapted strains were similar. Serological testing indicated that antigen types 1 and 4 were both present on the cell surface of adapted cells. The data suggest that efflux pumps are the major mechanism of adaptation in sensitive strains and are less important in originally resistant isolates. A different, unknown mechanism was responsible for the original tolerance of resistant isolates. In an originally resistant strain, there was a slight shift in the fatty acid profile after adaptation, whereas sensitive strains had similar profiles. Electron micrographs revealed morphological differences after adaptation. The changes in cell surface antigens, efflux pump utilization, and fatty acid profiles suggest that different mechanisms are used by resistant and sensitive strains for adaptation to BC. PMID:12406712

  1. Induction and stability of oxidative stress adaptation in Listeria monocytogenes EGD (Bug600) and F1057 in sublethal concentrations of H2O2 and NaOH.

    Science.gov (United States)

    De Abrew Abeysundara, Piumi; Nannapaneni, Ramakrishna; Soni, Kamlesh A; Sharma, Chander S; Mahmoud, Barakat

    2016-12-05

    Food processing and food handling environments may contain residual levels of sanitizers or cleaners which may trigger oxidative stress adaptation in Listeria monocytogenes. The aim of this study was to determine the induction and stability of oxidative stress adaptation in L. monocytogenes EGD (Bug600) (serotype 1/2a) and F1057 (serotype 4b) at different concentrations and times of sublethal oxidative stress induced by H2O2 or sublethal alkali stress induced by NaOH at 37°C. Both L. monocytogenes Bug600 and F1057 strains showed significantly higher survival in lethal oxidative stress (1000ppm H2O2) after pre-exposure to 50ppm H2O2 for 30min compared to control cells (no pre-exposure to H2O2). When the cells were pre-exposed to sublethal alkali stress by NaOH, the oxidative stress adaptation was induced within 5min in L. monocytogenes. The survival of both L. monocytogenes strains was increased by 2 to 4.5 logs in lethal oxidative stress when the cells were pre-exposed to sublethal alkali stress at pH9 from 5 to 120min by NaOH compared to control cells (no pre-exposure to sublethal alkali pH). Two other alkali reagents tested (KOH and NH4OH) also induced oxidative stress adaptation in L. monocytogenes. For both L. monocytogenes strains, the oxidative stress adaptation induced by sublethal H2O2 was reversible in 30min and that induced by sublethal alkali stress was reversible within 60min at 37°C in the absence of such sublethal stress. These findings show that sublethal oxidative or alkali stress conditions can induce oxidative stress adaptation that may increase the risk of survival of L. monocytogenes cells in lethal oxidative stress.

  2. Comparative Genomic Analysis of Two Serotype 1/2b Listeria monocytogenes Isolates from Analogous Environmental Niches Demonstrates the Influence of Hypervariable Hotspots in Defining Pathogenesis

    Science.gov (United States)

    Casey, Aidan; Jordan, Kieran; Coffey, Aidan; Fox, Edward M.; McAuliffe, Olivia

    2016-01-01

    The vast majority of clinical human listeriosis cases are caused by serotype 1/2a, 1/2b, 1/2c, and 4b isolates of Listeria monocytogenes. The ability of L. monocytogenes to establish a systemic listeriosis infection within a host organism relies on a combination of genes that are involved in cell recognition, internalization, evasion of host defenses, and in vitro survival and growth. Recently, whole genome sequencing and comparative genomic analysis have proven to be powerful tools for the identification of these virulence-associated genes in L. monocytogenes. In this study, two serotype 1/2b strains of L. monocytogenes with analogous isolation sources, but differing infection abilities, were subjected to comparative genomic analysis. The results from this comparison highlight the importance of accessory genes (genes that are not part of the conserved core genome) in L. monocytogenes pathogenesis. In addition, a number of factors, which may account for the perceived inability of one of the strains to establish a systemic infection within its host, have been identified. These factors include the notable absence of the Listeria pathogenicity island 3 and the stress survival islet, of which the latter has been demonstrated to enhance the survival ability of L. monocytogenes during its passage through the host intestinal tract, leading to a higher infection rate. The findings from this research demonstrate the influence of hypervariable hotspots in defining the physiological characteristics of a L. monocytogenes strain and indicate that the emergence of a non-pathogenic isolate of L. monocytogenes may result from a cumulative loss of functionality rather than by a single isolated genetic event. PMID:28066772

  3. Differentiation of Listeria monocytogenes serovars by using artificial neural network analysis of Fourier-transformed infrared spectra.

    Science.gov (United States)

    Rebuffo-Scheer, Cecilia A; Schmitt, Jürgen; Scherer, Siegfried

    2007-02-01

    A classification system based on Fourier transform infrared (FTIR) spectroscopy combined with artificial neural network analysis was designed to differentiate 12 serovars of Listeria monocytogenes using a reference database of 106 well-defined strains. External validation was performed using a test set of another 166 L. monocytogenes strains. The O antigens (serogroup) of 164 strains (98.8%) could be identified correctly, and H antigens were correctly determined in 152 (91.6%) of the test strains. Importantly, 40 out of 41 potentially epidemic serovar 4b strains were unambiguously identified. FTIR analysis is superior to PCR-based systems for serovar differentiation and has potential for the rapid, simultaneous identification of both species and serovar of an unknown Listeria isolate by simply measuring a whole-cell infrared spectrum.

  4. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  5. Designing a home infusion therapy service at Scott and White.

    Science.gov (United States)

    Scheel, C; Sweeden, D

    1994-01-01

    A quality planning team at Scott and White used Juran planning techniques to design a coordinated, cost-effective method for providing home infusion therapy to patients. The team translated customer needs into important product and process features and then designed a home infusion program to meet those features. The program was implemented in late June and is expected to increase customer satisfaction, contain costs, and provide improved coordination of care by all providers. Quantitative results are being tracked. Based on this team's apparent success, two other planning teams have been formed and are nearing completion.

  6. APOLLO 15: Commander Scott on those who gave all

    Science.gov (United States)

    1974-01-01

    APOLLO 15: A demonstration of a classic experiment. From the film documentary 'APOLLO 15: 'The mountains of the Moon'', part of a documentary series on the APOLLO missions made in the early '70's and narrated by Burgess Meredith. APOLO 15: Fourth manned lunar landing with David R. Scott, Alfred M. Worden, and James B. Irwin. Landed at Hadley rilleon July 30, 1971;performed EVA with Lunar Roving Vehicle; deployed experiments. P& F Subsattelite spring-launched from SM in lunar orbit. Mission Duration 295 hrs 11 min 53sec

  7. Biofilm formation of Listeria monocytogenes serotype 1/2a strains and the diversity in correlated genes%单增李斯特菌1/2a血清型菌株生物膜形成能力及相关基因差异研究

    Institute of Scientific and Technical Information of China (English)

    叶正兴; 王艳; 李培京; 刘凯; 叶长芸

    2013-01-01

    目的 检测5株1/2a血清型单增李斯特菌生物膜形成能力并分析其单增李斯特菌生物膜形成相关基因的携带情况,为进一步探究单增李斯特菌生物膜形成影响因素及致病机制提供线索.方法 依据96孔微孔板结晶紫染色方法对5株单增李斯特菌进行了生物膜形成能力检测,并用扫描电镜观察生物膜形成情况.使用聚合酶链反应(PCR)技术对5株菌进行了生物膜形成相关的12对基因(sigB,prfA,yneA,hpt,relA,flaA,recA,agrA,luxS,degU,motB,bapL)全长的扩增及测序分析,通过与GeneBank中已公布的单增标准菌株EGD-e序列比对确定基因变异情况.结果 5株1/2a血清型单增李斯特菌形成生物膜的能力有所不同,结晶紫染色观察结果与扫描电镜观察结果较为一致.11种生物膜相关基因在5株单增李斯特菌中的检测结果全阳性,测序结果发现部分基因出现突变位点(多为同义突变,部分为非同义突变).bapL基因在生物膜形成能力较低两株菌中为阳性,而在生物膜形成能力较高的两株菌中为阴性.结论 不同的1/2a血清型单增李斯特菌间生物膜形成能力有所差异,5株1/2a血清型单增李斯特菌bapL基因携带与其生物膜形成能力并不一致,11株生物膜相关基因中出现多处碱基位点及氨基酸变化等同义突变与非同义突变.%To investigate biofilm formation in 5 Listeria monocytogenes serotype l/2a strains and the related gene diversity, a classical 96-cell microtitre plate biofilm production assay using crystal violet staining was employed in this study and scanning electron microscope (SKM) was also used to visualize the formation of biofilm. PCR method was performed to amplify the 12 genes based on full-length primers, and PCR products were sequenced and compared with the reference strain EGD-e from GenBank. Among these 12 genes, 11 were positive in the 5 strains with some bases replacement at some locus of the genes (most of

  8. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  9. Differential internalin A levels in biofilms of Listeria monocytogenes grown on different surfaces and nutrient conditions.

    Science.gov (United States)

    Gilmartin, Niamh; Gião, Maria S; Keevil, Charles W; O'Kennedy, Richard

    2016-02-16

    Listeria monoctyogenes is a foodborne pathogen containing the surface protein, internalin A (InlA). The expression of this protein permits the invasion of L. monocytogenes into intestinal epithelial cells expressing the receptor E-cadherin, thus crossing the intestinal barrier and resulting in listerosis. The main aim of this work was to investigate InlA levels in different L. monocytogenes strains in both planktonic and sessile states using an anti-InlA antibody. Biofilms were grown in high and low nutrient environments on glass, stainless steel and polytetrafluoroethylene (PTFE). This study demonstrated that InlA levels varied greatly between strains and serotypes of L. monocytogenes. However, the serotypes 1/2a, 1/2b and 4b, associated with the largest number of outbreaks of listerosis consistently showed the highest InlA levels, regardless of nutrient content or planktonic or sessile state. Differences in InlA levels were also observed in biofilms grown on different surfaces such as glass, stainless steel and PTFE, with a significant reduction in InlA levels observed in biofilms on PTFE. Interestingly, although a large number of the total cells observed in biofilms formed in tap-water were non-cultivable, the virulence factor, InlA, was expressed at levels between 78 and 85%, thus indicating that these cells may still be virulent. A greater understanding of the factors that affect the levels of InlA on the surface of L. monocytogenes, is essential in the appreciation of the role of InlA in the persistence of biofilms containing L. monocytogenes and their potential to cause food borne disease.

  10. Virulence Phenotyping and Molecular Characterization of a Low-pathogenicity Isolate of Listeria monocytogenes from Cow's Milk

    Institute of Scientific and Technical Information of China (English)

    Ling-Li JIANG; Jing-Jing XU; Ning CHEN; Jiang-Bing SHUAI; Wei-Huan FANG

    2006-01-01

    A low-pathogenicity isolate of Listeria monocytogenes from cow's milk, as screened in mouse and chicken embryonated egg models, was examined for virulence-related phenotypic traits. Corresponding virulence genes (iap, prfA, plcA, hly, mpl, actA, plcB, InlA and InlB) were compared with L. monocytogenes reference strains 10403S and EGD to elucidate the possible molecular mechanisms of low virulence. Although L. monocytogenes H4 exhibited similar patterns to strain 10403S in terms of hemolytic activity, in vitro growth and invasiveness and even had higher adhesiveness, faster intracellular growth and higher phospholipase activity in vitro, it was substantially less virulent than the strain 10403S in mouse and chicken embryo models (50% lethal dose: 108.14 vs. 105.49 and 106.73 VS. 101.9, respectively). The genes prfA, plcA and mpl were homologous among L. monocytogenes strains H4, 10403S and EGD (>98%). Genes iap, hly, plcB,InlA and InlB of L. monocytogenes 10403S had higher homology to those of strain EGD (>98%) than isolate H4. The homology of the gene hly between strain 10403S and isolate H4 was 96.9% at the nucleotide level,but 98.7% at the amino acid level. The actA gene of isolate H4 had deletions of 105 nucleotides corresponding to 35 amino acid deletions falling within the proline-rich region. Taken together, this study presents some clues as to reduced virulence to mice and chicken embryos of the isolate H4 probably as a result of deletion mutations of actA.

  11. Dynamic kinetic analysis of growth of Listeria monocytogenes in a simulated comminuted, non-cured cooked pork product

    Science.gov (United States)

    The objective of this study was to directly construct a tertiary growth model for Listeria monocytogenes in cooked pork and simultaneously determine the kinetic parameters using a combination of dynamic and isothermal growth curves. Growth studies were conducted using a cocktail of 5 strains of L. ...

  12. The role of Listeria monocytogenes cell wall surface anchor protein LapB in virulence, adherence, and intracellular replication

    Science.gov (United States)

    Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...

  13. Genome Sequence of Listeria monocytogenes Plasmid pLM-C-273 Carrying Genes Related to Stress Resistance.

    Science.gov (United States)

    Liang, Lindsay; Gnaneshan, Saravanamuttu; Garduño, Rafael A; Mallo, Gustavo V

    2016-10-13

    Mobile genetic elements in bacteria, such as plasmids, act as important vectors for the transfer of antibiotic resistance, virulence, and metal resistance genes. Here, we report the genome sequence of a new plasmid pLM-C-273, identified in a Listeria monocytogenes strain isolated from a clinical sample in Ontario, Canada.

  14. Genome Sequence of Listeria monocytogenes Plasmid pLM-C-273 Carrying Genes Related to Stress Resistance

    Science.gov (United States)

    Liang, Lindsay; Gnaneshan, Saravanamuttu; Garduño, Rafael A.

    2016-01-01

    Mobile genetic elements in bacteria, such as plasmids, act as important vectors for the transfer of antibiotic resistance, virulence, and metal resistance genes. Here, we report the genome sequence of a new plasmid pLM-C-273, identified in a Listeria monocytogenes strain isolated from a clinical sample in Ontario, Canada. PMID:27738039

  15. Diverse genomic location and sequence content of a Listeria monocytogenes chromosomal island harboring heavy metal resistance and other genes

    Science.gov (United States)

    Listeria monocytogenes remains a major foodborne pathogen with three serotype 4b clonal groups (ECI, ECII, ECIa) repeatedly implicated in human listeriosis. For reasons that are unknown, many of these strains are also resistant to heavy metals, i.e. cadmium and arsenic. The acquisition and fitness i...

  16. Mixed species biofilms of Listeria monocytogenes and Lactobacillus plantarum show enhanced resistance to benzalkonium chloride and peracetic acid

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2011-01-01

    We investigated the formation of single and mixed species biofilms of Listeria monocytogenes strains EGD-e and LR-991, with Lactobacillus plantarum WCFS1 as secondary species, and their resistance to the disinfectants benzalkonium chloride and peracetic acid. Modulation of growth, biofilm formation,

  17. BEHAVIOR OF ESCHERICHIA COLI O157:H7, LISTERIA MONOCYTOGENES, AND SALMONELLA TYPHIMURIUM IN TEEWURST, A RAW SPREADABLE SAUSAGE

    Science.gov (United States)

    The fate of Listeria monocytogenes, Salmonella Typhimurium, or Escherichia coli O157:H7 were separately monitored both in and on teewurst, a traditional raw and spreadable sausage of Germanic origin. Multi-strain cocktails of each pathogen (ca. 5.0 log CFU/g) were used to separately inoculate teewur...

  18. The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne

    conditions in a resD mutant strain compared to the wild type. The majority of these were involved in motility and chemotaxis and in carbohydrate uptake such as mannose and cellobiose specific PTS uptake systems. The role of ResD for metabolism in L. monocytogenes was also studied by northern blot analysis...

  19. Initial adhesion of Listeria monocytogenes to solid surfaces under liquid flow

    DEFF Research Database (Denmark)

    Szlavik, Julie; Soares Paiva, Dionísio; Mørk, Nils;

    2012-01-01

    strains of L. monocytogenes was investigated under liquid flow at two levels of shear stress on six different surfaces using a flow chamber set-up with microscopy measurements. The surfaces tested were glass and PVC, and glass coated with beef extract, casein, and homogenised and unhomogenised milk....... In addition, the effect of prior environmental stress (5% NaCl, low nutrient availability) on initial adhesion was investigated. The hydrophobicity of the investigated surfaces was determined by contact angle measurements and the surface properties of the investigated L. monocytogenes strains were determined.......001) was observed but not of interactions between surface-shear stress. No correlation between surface hydrophobicity and IAR was observed. Addition of 5% NaCl during propagation resulted in a decrease in IAR whilst propagation in low nutrient media caused an increase indicating a general change in surface...

  20. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  1. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  2. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

    Science.gov (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

    2014-09-01

    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans.

  3. Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.

    Science.gov (United States)

    Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y

    2009-09-01

    The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

  4. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

    Science.gov (United States)

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-06-30

    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination.IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

  5. Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

    Science.gov (United States)

    Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

    2016-11-16

    . Both shotgun and 16S rRNA data supported the presence of three slightly variable genomes of L. monocytogenes. Moreover, the draft assembly of a consensus genome of L. monocytogenes from shotgun metagenomic data demonstrated the potential utility of this approach to expedite trace-back of outbreak-associated strains, although further validation will be needed to confirm this utility.

  6. Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

    Directory of Open Access Journals (Sweden)

    Wanessa Altimiras Costa

    2009-12-01

    Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

  7. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  8. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    OpenAIRE

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  9. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    OpenAIRE

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  10. Putative Cross-Contamination Routes of Listeria monocytogenes in a Meat Processing Facility in Romania.

    Science.gov (United States)

    Bolocan, Andrei Sorin; Oniciuc, Elena Alexandra; Alvarez-Ordóñez, Avelino; Wagner, Martin; Rychli, Kathrin; Jordan, Kieran; Nicolau, Anca Ioana

    2015-09-01

    Putative routes of Listeria monocytogenes contamination, based on the workflow of the employees, were studied in a meat processing facility by investigating 226 samples collected from food contact surfaces, non-food contact surfaces, raw materials, and ready-to-eat meat products on four occasions over a 1-year period. In total, 19.7% of non-food contact surfaces, 22.9% of food contact surfaces, 45% of raw materials, and 20% of ready-to-eat meat products were positive for L. monocytogenes (analyzed by the International Organization for Standardization standard method ISO 11290). Pulsed-field gel electrophoresis (PFGE) profiles were determined for a representative subset of these isolates, and 11 distinct pulsotypes were identified, two of which were frequently isolated (T4 and T8) and considered persistent. Strains from the various pulsotypes were screened for the presence of bcrABC and qacH, the genes responsible for tolerance responses to quaternary ammonium compounds. Two strains harbored bcrABC, and these strains had a higher benzalkonium chloride tolerance; however, they were not considered persistent strains. The frequently isolated PFGE pulsotype T8 strains were highly adhesive to abiotic surfaces at 10 and 20°C; however, the pulsotype T6 strain, which was isolated only at the last sampling time, had the highest adhesion ability, and the pulsotype T4 strain (the second most persistent pulsotype) had only modest adhesion. Four putative cross-contamination routes were confirmed by mapping the persistent and other isolates. This information could allow a food safety manager to adjust the work flow to improve the hygienic conditions in a meat processing facility. This study revealed the prevalence and persistence of L. monocytogenes strains in a meat processing facility and established the importance of developing strategies to avoid cross-contamination, recalls, and outbreaks of listeriosis.

  11. Effect of selected generally recognized as safe preservative sprays on growth of Listeria monocytogenes on chicken luncheon meat.

    Science.gov (United States)

    Islam, Mahbub; Chen, Jinru; Doyle, Michael P; Chinnan, Manjeet

    2002-05-01

    The ability of selected generally recognized as safe (GRAS) chemical preservatives to reduce populations or inhibit growth of Listeria monocytogenes on chicken luncheon meat was evaluated. Slices of luncheon meat were treated by evenly spraying onto their surfaces 0.2 ml of a solution of one of four preservatives (sodium benzoate, sodium propionate, potassium sorbate, and sodium diacetate) at one of three different concentrations (15, 20, or 25% [wt/vol]). Each slice was then surface inoculated with a five-strain mixture of 10(5) CFU of L. monocytogenes per ml, held at 4, 13, or 22 degrees C, and assayed for L. monocytogenes immediately after inoculation and at 3, 7, 10, and 14 days of storage. Initial reductions of L. monocytogenes populations ranged from 0.78 to 1.32 log10 CFU g(-1) at day 0 for sodium benzoate- or sodium diacetate-treated meat, whereas reductions for the sodium propionate or potassium sorbate treatments were only 0.14 to 0.36 log10 CFU g(-1). After 14 days of storage at 4 degrees C, L. monocytogenes populations on all treated slices were 1.5 to 3 log10 CFU g(-1) less than on the untreated slices. At 13 degrees C and after 14 days of storage, L. monocytogenes populations were 3.5 and 5.2 log10 CFU g(-1) less on luncheon meat slices treated with 25% sodium benzoate or 25% sodium diacetate, respectively, and ca. 2 log10 CFU g(-1) less when treated with 25% sodium propionate or 25% potassium sorbate than on untreated control slices. Only sodium diacetate was highly inhibitory to L. monocytogenes on meat slices held at 22 degrees C for 7 days or longer. Untreated luncheon meat held at 22 degrees C was visibly spoiled within 10 days, whereas there was no evidence of visible spoilage on any treated luncheon meat at 14 days of storage.

  12. Acidified sodium chlorite treatment for inhibition of Listeria monocytogenes growth on the surface of cooked roast beef.

    Science.gov (United States)

    Beverly, Richelle L; Janes, Marlene E; Oliver, Grady

    2006-02-01

    The effects of acidified sodium chlorite (ASC) against Listeria monocytogenes on the surface of cooked roast beef were investigated. L. monocytogenes, strain V7, serotype 1/2a, was inoculated at numbers of 6.0 log CFU/g onto 5-g cubes of cooked regular or spicy roast beef. The samples were allowed to air dry for 1 h. The cooked roast beef samples were dipped into ASC or sprayed with ASC solutions of 250, 500, 750, or 1,000 ppm, then placed in bags with or without a vacuum and refrigerated at 4 degrees C. L. monocytogenes counts were determined after 0, 7, 14, 21, and 28 days of storage by spread plating roast beef samples onto Oxford agar plates that were incubated at 37 degrees C for 48 h. At day 28, the number of L. monocytogenes on the > or = 500 ppm ASC-treated spicy roast beef samples had count reductions that were >4.0 log CFU/g, whereas the same concentrations of ASC-treated regular roast beef samples had approximately a 2.5 log CFU/g reduction in L. monocytogenes counts when compared with the untreated samples. No significant differences (P > 0.05) were observed in L. monocytogenes counts between the vacuum- or nonvacuum-packaged ASC-treated cooked roast beef samples. Sensory evaluation showed no significant differences (P > 0.05) between ASC-treated and untreated roast beef. ASC can be used as a processing aid in the form of a dip or spray treatment to control L. monocytogenes on the surface of cooked roast beef.

  13. The overgrowth of Listeria monocytogenes by other Listeria spp. in food samples undergoing enrichment cultivation has a nutritional basis.

    Science.gov (United States)

    Besse, Nathalie Gnanou; Barre, Lena; Buhariwalla, Colin; Vignaud, Marie Léone; Khamissi, Elissa; Decourseulles, Emilie; Nirsimloo, Marjorie; Chelly, Minyar; Kalmokoff, Martin

    2010-01-01

    The isolation of Listeria monocytogenes from food is carried out using a double enrichment. In cases where multiple Listeria species are present within the original sample, L. monocytogenes can be overgrown during enrichment by other species of listeria present in the original sample. From a practical perspective, this can result in a false negative or complicate the ability of public health investigators to match food and clinical isolates. We have further investigated this phenomenon by analysing the growth kinetics of single species and pairs of different species over the ISO 11290-1 enrichment process. The overgrowth of a strain of L. monocytogenes by a strain of Listeria innocua resulted primarily from interactions which occurred in late exponential phase, where it was observed that growth of both strains stopped when the dominant strain reached stationary phase. In a second mixed culture, the dominant L. monocytogenes strain suppressed the exponential growth rate of the second Listeria welshimeri strain. Both findings suggest that the overgrowth could partially be explained in terms of a nutritional competition. Multi-factor analysis of Fraser broth constituents and growth temperatures using both stressed and non-stressed inoculants failed to identify any single factor in the ISO 11290-1 methodology which would contribute to the overgrowth phenomenon in our model system. Furthermore, species was not a significant factor in observed differences in growth parameters among a wider array of strains which had been stressed or not stressed prior to grown in Fraser broths, even though some strains had significantly faster growth rates than others. Limiting diffusion in Fraser broth through the addition of agar significantly reduced the extent of the overgrowth in experiments using mixtures of strains originally isolated from foods where overgrowth had been previously observed. Taken together, these findings support that the overgrowth phenomenon in most instances

  14. Estudio mediante PCR múltiple de serotipos de Listeria monocytogenes aislados en Argentina Study by multiplex PCR of Listeria monocytogenes serotypes isolated in Argentine

    Directory of Open Access Journals (Sweden)

    R. Callejo

    2008-06-01

    Full Text Available Se comparó una PCR múltiple recientemente validada para la caracterización de serotipos de Listeria monocytogenes con el método tradicional de serotipificación. Se estudiaron 342 aislamientos de origen humano, alimentario, veterinario y ambiental obtenidos durante el período 1992-2005. La concordancia entre ambos métodos para los serotipos 1/2a, 1/2b y 1/2c fue del 100%, y para el serotipo 4b fue del 98%. La serotipificación constituye una herramienta importante como primer nivel de diferenciación de cepas de L. monocytogenes para llevar a cabo la vigilancia epidemiológica y, sobre todo, el estudio de brotes. La PCR múltiple es una técnica alternativa rápida, de bajo costo y fácilmente adaptable en laboratorios de bacteriología clínica y bromatología.A multiplex PCR assay, recently validated to characterize the serotypes of Listeria monocytogenes was evaluated in comparison to conventional serotyping. Three hundred forty two L. monocytogenes strains isolated from human, food, animal and environmental sources during the 1992-2005 period were assayed. The concordance between the two methods for serotypes 1/2a, 1/2b and 1/2c was 100%, whereas for serotype 4b it was 98%. Serotyping is a useful tool for first line strain differentiation during epidemiological surveillance and outbreaks. The multiplex PCR assay offers a fast and low-cost alternative, which is easily adaptable to clinical bacteriology and bromatology laboratories.

  15. Fate of viable but non-culturable Listeria monocytogenes in pig manure microcosms

    Directory of Open Access Journals (Sweden)

    Jeremy eDesneux

    2016-03-01

    Full Text Available The fate of two strains of L. monocytogenes and their ability to become viable but non-culturable (VBNC was investigated in microcosms containing piggery effluents (two raw manures and two biologically treated manures stored for two months at 8°C and 20°C. Levels of L. monocytogenes were estimated using the culture method, qPCR, and propidium monoazide treatment combined with qPCR (qPCRPMA. The chemical composition and the microbial community structure of the manures were also analysed. The strains showed similar decline rates and persisted up to 63 days. At day zero, the percentage of VBNC cells among viable cells was higher in raw manures (81.5-94.8% than in treated manures (67.8-79.2%. The changes in their proportion over time depended on the temperature and on the type of effluent: the biggest increase was observed in treated manures at 20°C and the smallest increase in raw manures at 8°C. The chemical parameters had no influence on the behaviour of the strains, but decrease of the persistence of viable cells was associated with an increase in the microbial richness of the manures. This study demonstrated that storing manure altered the culturability of L. monocytogenes, which rapidly entered the VBNC state, and underlines the importance of including VBNC cells when estimating the persistence of the pathogens in farm effluents.

  16. Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

    2013-04-01

    Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

  17. Staphylococcus aureus but not Listeria monocytogenes adapt to triclosan and adaptation correlates with increased fabI expression and agr deficiency

    DEFF Research Database (Denmark)

    Nielsen, Lene Nørby; Larsen, Marianne Halberg; Skovgaard, Sissel

    2013-01-01

    Background. The ability of pathogens to adapt to the widely used biocide, triclosan, varies substantially. The purpose of the study was to examine bacterial adaptation over an extended period of time to low increments of triclosan concentrations. Focus was two human pathogens, S. aureus and L....... monocytogenes that previously have displayed inherent high and low adaptability, respectively. Results. Three strains of L. monocytogenes and two strains of S. aureus including the community-acquired USA300 were exposed to increasing, sub-lethal concentrations of triclosan in triclosan-containing agar gradients....... Following 25 days of exposure on agar plates to sub-lethal concentrations of triclosan with a twofold concentration increase every second day, minimum inhibitory concentration (MIC) for S. aureus increased from 0.125 (8325-4) and 0.0625 (USA 300) mg/L to 4 mg/L. The MIC of all three L. monocytogenes strains...

  18. Phenotypic, Proteomic, and Genomic Characterization of a Putative ABC-Transporter Permease Involved in Listeria monocytogenes Biofilm Formation

    DEFF Research Database (Denmark)

    Zhu, Xinna; Liu, Weibing; Lametsch, René

    2011-01-01

    enhanced ability for biofilm formation as the LM-49 strain using a crystal violet staining assay. DNA microarrays and two-dimensional gel electrophoresis revealed 49 and 11 differentially expressed (twofold or more) genes or proteins in Δ1771, respectively. The transcriptomics study indicated that lm......The foodborne pathogen Listeria monocytogenes is able to form biofilms in food processing environments. Previously, we have reported that an lm.G_1771 gene (encoding a putative ABC-transporter permease) was involved in negative regulation of L. monocytogenes biofilm formation using LM-49, a biofilm......-enhanced mutant isolated on Tn917 mutagenesis (AEM 2008 p.7675–7683). Here, the possible action of this ABC-transporter permease in L. monocytogenes biofilm formation was characterized by phenotypic, proteomic, and genomic analyses using an lm.G_1771 gene deletant (Δ1771). The Δ1771 mutant exhibited the same...

  19. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-01-01

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono......- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased...... during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus...

  20. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    -related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...... of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p tolerance relative to those harboring a premature stop...

  1. Evaluation of the transfer of Listeria monocytogenes from stainless steel and high-density polyethylene to Bologna and American cheese.

    Science.gov (United States)

    Rodríguez, Andrés; McLandsborough, Lynne A

    2007-03-01

    The objective of this study was to determine the factors involved in the transfer of Listeria monocytogenes from surfaces to foods. We evaluated the influence of surface type (stainless steel and high-density polyethylene), inoculation method (biofilm growth and attached cells), hydration level (visibly dry and wet), and food type (bologna and American cheese). Each experiment included all 16 combinations and was repeated 11 times. A four-strain cocktail of L. monocytogenes was used to inoculate stainless steel and high-density polyethylene either as growing biofilms or attached cells. Slides were placed on a universal testing machine and brought into contact with food at a constant pressure (45 kPa) and time (30 s). Food slices were blended, the number of transferred cells was determined by plating, and the efficiency of transfer (EOT) was calculated. The results strongly suggest that stainless steel surfaces transferred more L. monocytogenes to foods than did polyethylene (P = 0.05). Independent of the surface, biofilms tended to transfer more L. monocytogenes to foods (EOT = 0.57) than did attached cells (EOT = 0.16). Among foods, L. monocytogenes was transferred to bologna more easily than to cheese (P 0.05). We hypothesize that drying weakens cell-to-cell interactions in biofilms and cell-to-surface interactions of biofilms and thus allows increased transfer of cells to food products.

  2. Survival of Listeria monocytogenes during Production and ripening of traditional Turkish Savak tulum cheese and in synthetic gastric fluid.

    Science.gov (United States)

    Dikici, Abdullah; Calicioglu, Mehmet

    2013-10-01

    This study investigated the survival and acid tolerance of Listeria monocytogenes during the 2-day processing stage and 90-day ripening of Savak tulum cheese, a traditional cheese in Turkey. Experimental Savak tulum cheese was produced from raw sheep's milk that was inoculated with a L. monocytogenes mixture consisting of five strains (average 7.0 log CFU/ml) and was ripened at 6°C for 90 days. Microbiological and chemical analyses and acid exposure experiments in synthetic gastric fluid (SGF) (pH 1.5 to 2.5) were carried out on days 1 and 2 during processing and on days 0, 15, 30, 45, 60, and 90 during ripening. The numbers of L. monocytogenes did not decrease during processing, but a total of 4.1 log CFU/g reduction was observed during ripening. Throughout the ripening period, L. monocytogenes cells survived direct 90-min exposures of the cheese samples to SGF. These results suggest that, although the pathogen numbers decreased in Savak tulum cheese ripened at 6°C for 90 days, a sublethal environment may have occurred in the cheese during the production stage, activating the acid-tolerance mechanisms of the pathogen and allowing L. monocytogenes to maintain its viability in the SGF for 90 min.

  3. Survival and Metabolic Activity of Listeria monocytogenes on Ready-to-Eat Roast Beef Stored at 4 °C.

    Science.gov (United States)

    Broady, Johnathan W; Han, Dong; Yuan, Jing; Liao, Chao; Bratcher, Christy L; Lilies, Mark R; Schwartz, Elizabeth H; Wang, Luxin

    2016-07-01

    Three brands of commercial roast beef were purchased and artificially inoculated with a 5-strain Listeria monocytogenes cocktail at 2 inoculation levels (approximately 3 and 6 Log CFU/g). Although all 3 brands contained sodium diacetate and sodium lactate, inoculated Listeria cocktail survived for 16 d in all 3 brands; significant increases in L. monocytogenes numbers were seen on inoculated Brand B roast beef on days 12 and 16. Numbers of L. monocytogenes increased to 4.14 Log CFU/g for the 3 Log CFU/g inoculation level and increased to 7.99 Log CFU/g for the 6 Log CFU/g inoculation level by day 16, with the pH values being 5.4 and 5.8 respectively. To measure the cell viability in potential biofilms formed, an Alamar blue assay was conducted. Brand B meat homogenate had the highest metabolic activities (P monocytogenes in ready-to-eat roast beef. Native microflora (both diversity and abundance), together with product formula, pH, antimicrobial concentrations, and storage conditions may all impact the survival and growth of L. monocytogenes. © 2016 Institute of Food Technologists®

  4. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  5. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  6. Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

    Directory of Open Access Journals (Sweden)

    Anna Mureddu

    2014-02-01

    Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

  7. Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants

    Science.gov (United States)

    Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca

    2014-01-01

    Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants. PMID:27800316

  8. Ruminant rhombencephalitis-associated Listeria monocytogenes alleles linked to a multilocus variable-number tandem-repeat analysis complex.

    Science.gov (United States)

    Balandyté, Lina; Brodard, Isabelle; Frey, Joachim; Oevermann, Anna; Abril, Carlos

    2011-12-01

    Listeria monocytogenes is among the most important food-borne pathogens and is well adapted to persist in the environment. To gain insight into the genetic relatedness and potential virulence of L. monocytogenes strains causing central nervous system (CNS) infections, we used multilocus variable-number tandem-repeat analysis (MLVA) to subtype 183 L. monocytogenes isolates, most from ruminant rhombencephalitis and some from human patients, food, and the environment. Allelic-profile-based comparisons grouped L. monocytogenes strains mainly into three clonal complexes and linked single-locus variants (SLVs). Clonal complex A essentially consisted of isolates from human and ruminant brain samples. All but one rhombencephalitis isolate from cattle were located in clonal complex A. In contrast, food and environmental isolates mainly clustered into clonal complex C, and none was classified as clonal complex A. Isolates of the two main clonal complexes (A and C) obtained by MLVA were analyzed by PCR for the presence of 11 virulence-associated genes (prfA, actA, inlA, inlB, inlC, inlD, inlE, inlF, inlG, inlJ, and inlC2H). Virulence gene analysis revealed significant differences in the actA, inlF, inlG, and inlJ allelic profiles between clinical isolates (complex A) and nonclinical isolates (complex C). The association of particular alleles of actA, inlF, and newly described alleles of inlJ with isolates from CNS infections (particularly rhombencephalitis) suggests that these virulence genes participate in neurovirulence of L. monocytogenes. The overall absence of inlG in clinical complex A and its presence in complex C isolates suggests that the InlG protein is more relevant for the survival of L. monocytogenes in the environment.

  9. Behavior of Listeria monocytogenes and Staphylococcus aureus in yogurt fermented with a bacteriocin-producing thermophilic starter.

    Science.gov (United States)

    Benkerroum, Noreddine; Oubel, Hafida; Mimoun, Lamiae Ben

    2002-05-01

    Streptococcus salivarius subsp. thermophilus B producing a bacteriocin active against Listeria monocytogenes ATCC 7644 and Staphylococcus aureus SAD 30 was isolated from bakery yeast. The bacteriocin was partially purified by an adsorption/desorption technique, and its spectrum of action was compared to that of a neutralized cell-free supernatant (CFS). Although the CFS inhibited a number of gram-positive and -negative bacteria of health and spoilage significance, the spectrum of action of the partially purified bacteriocin was limited to gram-positive bacteria. L. monocytogenes was the most sensitive to both preparations. The bacteriocin-producing streptococcal strain was used in combination with a Bac- Lactobacillus delbrueckii subsp. bulgaricus CY strain isolated from commercial yogurt to assess the effectiveness of the resulting thermophilic starter in controlling L. monocytogenes and S. aureus in yogurt during fermentation and storage at refrigeration (ca. 7 degrees C) or abuse (ca. 22 degrees C) temperature. Yogurt samples were contaminated with L. monocytogenes or S. aureus to the approximate levels of 10(3) and 10(6) CFU/ml of milk, respectively. The results showed that in situ bacteriocin production was more active against L. monocytogenes than against S. aureus in vitro and in contaminated samples. While L. monocytogenes leveled off below the detectable limit in a 1-ml sample of yogurt within 24 h of processing, S. aureus survived in Bac+ and Bac- samples during 10 days of storage at room temperature (ca. 22 degrees C). Use of a Bac+ starter resulted in a 5-day extension of the shelf life.

  10. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material.

    Science.gov (United States)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne; Gram, Lone

    2010-06-15

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L. monocytogenes in food processing environments and the purpose of the present study was to determine ability of L. monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative humidities (RHs) during desiccation decreased significantly (pDesiccation in physiological peptone saline (PPS) reduced survivors by 3-5 log units whereas bacterial cells suspended in bacteriological growth substrates (tryptone soy broth with 1% glucose, TSB-glu) or PPS with 5% NaCl only were reduced by 1-3 log units. At RHs of 2, 43 and 75%, surfaces were visibly dry after 1, 3 and 5days of incubation, respectively. The lowest RH resulted in the most significant loss of viability, however, 10(3)-10(4)CFU/cm(2) remained viable regardless of the desiccation treatment (i.e., presence of TSB-glu and/or salt). At 75% RH, the bacterial counts remained almost constant when desiccated in TSB-glu. When bacteria were grown and desiccated (15 degrees C, 43% RH) in salmon or smoked salmon juice, survivors decreased slowly resulting in low numbers (10(2)-10(3)CFU/cm(2)) from all eight strains remaining viable after 3months. Whilst conditions during desiccation had a pronounced influence on inactivation kinetics and the number of survivors, persistent L. monocytogenes were not more tolerant to desiccation than presumed non-persistent isolates. Our study shows that the ability to survive for months during desiccated conditions may be a factor explaining the ability of L. monocytogenes to persist in food processing environments. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Listeria monocytogenes survival in refrigerator dill pickles.

    Science.gov (United States)

    Kim, Jin Kyung; D'Sa, Elaine M; Harrison, Mark A; Harrison, Judy A; Andress, Elizabeth L

    2005-11-01

    Listeria monocytogenes can survive and grow in refrigerated foods with pH values of approximately 4.0 to 5.0 and salt concentrations of 3 to 4%. Home-fermented refrigerator dill pickles fit this description. Contamination of this product with L. monocytogenes could cause serious problems because these items are not heated prior to consumption. L. monocytogenes survival and growth patterns were investigated in refrigerator dill pickles at 1.3, 3.8, and 7.6% salt concentrations. Pickling cucumbers were dipped into an inoculum of L. monocytogenes, brine mixtures were added, and cucumbers were held at room temperature for 1 week and then refrigerated for up to 3 months. The pH, NaCl percentage, titratable acidity percentage, and total populations of Listeria and aerobic, psychrotrophic, and lactic acid bacteria were measured at the addition of brine, after 2, 4, and 7 days of storage at room temperature, and then weekly during refrigerated storage. The initial Listeria population was 5.4 to 5.6 log CFU/cm2 on cucumber surfaces and 3.9 to 4.6 log CFU/g internally. There was an approximate 0.3- to 1-log increase during room temperature fermentation followed by a population decline during refrigerator storage, with a greater decrease in the brines with the highest NaCl concentration. Up to 49 days, the internal tissue of pickles with 1.3, 3.8, or 7.6% salt concentrations were presumptively positive for L. monocytogenes by the enrichment method, and at 91 days the surfaces of such pickles were still positive for L. monocytogenes. Populations of total aerobes and lactic acid bacteria increased during room temperature storage and decreased gradually during refrigerated storage.

  12. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  13. Oral immunization with recombinant listeria monocytogenes controls virus load after vaginal challenge with feline immunodeficiency virus.

    Science.gov (United States)

    Stevens, Rosemary; Howard, Kristina E; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A

    2004-08-01

    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and delivers an FIV Env-expressing DNA vaccine (LMgag/pND14-Lc-env). Control cats were either sham immunized or immunized with wild-type L. monocytogenes (LM-wt). At 1 year after vaginal challenge, provirus could not be detected in any of the nine tissues evaluated from cats immunized with the recombinant bacteria but was detected in at least one tissue in 8 of 10 control animals. Virus was isolated from bone marrow of four of five LMgag/pND14-Lc-env-immunized cats by use of a stringent coculture system but required CD8(+) T-cell depletion, indicating CD8(+) T-cell suppression of virus replication. Control animals had an inverted CD4:CD8 ratio in mesenteric lymph node and were depleted of both CD4(+) and CD8(+) intestinal epithelial T cells, while LMgag/pND14-Lc-env-immunized animals showed no such abnormalities. Vaginal FIV-specific immunoglobulin A was present at high titer in three LMgag/pND14-Lc-env-immunized cats before challenge and in all five at 1 year postchallenge. This study demonstrates that recombinant L. monocytogenes conferred some control of viral load after vaginal challenge with FIV.

  14. W. Richard Scott, Institutions and Organizations: Ideas, Interests, and Identities

    DEFF Research Database (Denmark)

    Jakobsen, Michael

    2014-01-01

    Book review of: W. Richard Scott: Institutions and Organizations: Ideas, Interests, and Identities. 4th edition. Thousand Oaks, CA: SAGE Publications, 2014. xiii, 345 pp.......Book review of: W. Richard Scott: Institutions and Organizations: Ideas, Interests, and Identities. 4th edition. Thousand Oaks, CA: SAGE Publications, 2014. xiii, 345 pp....

  15. To Flame With a Wild Life: Florida Scott-Maxwell's Experience of Old Age.

    Science.gov (United States)

    Berman, Harry J.

    1986-01-01

    Analyzes an intimate journal, Florida Scott-Maxwell's "The Measure of My Days". Scott-Maxwell's journal contains suggestive ideas about the experience of aging among the old-old, about the theoretical issue of late life individuation, and about successful aging. (Author/ABB)

  16. Executive dysfunctions as part of the behavioural phenotype of Aarskog-Scott syndrome

    NARCIS (Netherlands)

    Egger, J.I.M.; Verhoeven, W.M.A.; Janssen, G.T.L.; Aken, L. van; Hoogeboom, A.J.M.

    2012-01-01

    Introduction Aarskog syndrome (AAS) also called Aarskog-Scott syndrome faciodigitogenital syndrome or faciogenital dysplasia is a genetically heterogeneous developmental disorder, first described in 1970 by the Norwegian pediatrician Dagfin Aarskog and further delineated by Scott in 1971. It is a pr

  17. The Great Kanto earthquake and F. Scott Fitzgerald

    Science.gov (United States)

    Kawakatsu, Hitoshi; Bina, Craig R.

    How many recall the following striking sentence from The Great Gatsby by F. Scott Fitzgerald, which appears on the second page of the novel, where Fitzgerald first introduces Gatsby? “If personality is an unbroken series of successful gestures, then there was something gorgeous about him, some heightened sensitivity to the promises of life, as if he were related to one of those intricate machines that register earthquakes ten thousand miles away.”This line may have failed to focus our attention when we first read the book in our younger days. Now, however, as a Japanese seismologist and an American geophysicist (and student of Japanese culture), we would be greatly remiss for failing to take greater note of this statement. Indeed, as The Great Gatsby was published in 1925, it occurred to us that the earthquake Fitzgerald might have been thinking of was the Great Kanto earthquake, which occurred on September 1, 1923 and devastated the Tokyo metropolitan area.

  18. Bacteriocin production by Lactobacillus plantarum AMA-K isolated from Amasi, a Zimbabwean fermented milk product and study of the adsorption of bacteriocin AMA-K to Listeria sp. Otimização da produção de bacteriocina por Lactobacillus plantarum AMA-K isolado de Amasi, um produto lácteo fermentado de Zimbabwe, e estudo da adsorção da bacteriocina AMA-K à Listeria innocua, Listeria monocytogenes e Listeria ivanovii subsp. ivanovii

    Directory of Open Access Journals (Sweden)

    Svetoslav D. Todorov

    2008-03-01

    Full Text Available Bacteriocin AMA-K produced by Lactobacillus plantarum AMA-K inhibits the growth of Enterococcus spp., Escherichia coli, Klebsiella pneumoniae and Listeria spp. Growth of strain AMA-K in BHI, M17, soy milk and molasses was similar to growth in MRS. The effect of organic nitrogen sources, carbohydrates, glycerol, K2HPO4 and KH2PO4, MgSO4, MnSO4, tri-ammonium citrate, Tween 80, vitamins and initial pH on bacteriocin AMA-K was determined. The mode of action of bacteriocin AMA-K was studied. The effect of bacteriocin AMA-K to actively growing Listeria innocua LMG13568, L. ivanovii subsp. ivanovii ATCC19119 and L. monocytogenes ScottA was determined. Adsorption of bacteriocin AMA-K to target cells at different temperatures, pH and in presence of Tween 20, Tween 80, ascorbic acid, potassium sorbate, sodium nitrate and sodium chloride were studied. Bacteriocin AMA-K shares high homology to pediocin PA-1.A bacteriocina AMA-K produzida por Lactobacillus plantarum AMA-K inibe a multiplicação de Enterococcus spp, Escherichia coli, Klebsiella pneumoniae e Listeria spp. A multiplicação da cepa AMA-K em BHI, leite de soja e melaço foi semelhante à multiplicação em MRS. O efeito de fontes de nitrogênio orgânico, carboidratos, glicerol, K2HPO4 e KH2PO4, MgSO4, MnSO4, citrato de triamônio, Tween 80, vitaminas e pH inicial sobre a bacteriocina AMA-K foi determinada. O modo de ação da bacteriocina AMA-K foi estudado. O efeito da bacteriocina AMA-K sobre Listeria innocua LMG13568, Listeria ivanovii subsp.ivanovii ATCC19119 e Listeria monocytogenes Scott A foi determinado. A adsorção da bacteriocina AMA-K às células-alvo em diferentes temperaturas, pH e na presença de Tween 20, Tween 80, ácido ascórbico, sorbato de potássio, nitrato de sódio a cloreto de sódio foi avaliada. A bacteriocina AMA-K apresenta grande homologia a pediocina PA-1.

  19. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism.

  20. Geographical and longitudinal analysis of Listeria monocytogenes genetic diversity reveals its correlation with virulence and unique evolution.

    Science.gov (United States)

    Yin, Yuelan; Tan, Weijun; Wang, Guoliang; Kong, Suwei; Zhou, Xiaohui; Zhao, Dan; Jia, Yanyan; Pan, Zhiming; Jiao, Xin'an

    2015-06-01

    Listeria monocytogenes is one of the most important foodborne pathogens causing severe diseases with a mortality rate of 24%. However, the genetic diversity and evolution of L. monocytogenes, particularly at the worldwide level, are poorly defined. In this study, we performed multilocus sequence typing (MLST) and multi virulence locus sequence typing (MVLST) for 86 L. monocytogenes strains derived from 8 countries from 1926 to 2012 in order to better understand the molecular evolution and genetic characteristics of this pathogen. A total of 13 clonal complexes (CCs) were detected, of which CC1, CC2, CC3, CC7, CC9, CC4 are the most prevalent. Notably, polymorphism of housekeeping genes of isolates belong to CC1 (STs = 47) increased more rapidly over the time. MLST-based phylogenetic analysis showed that serotype 1/2b and 4b strains had an "interval-type" evolution pattern, while serotype 1/2a and 1/2c strains had a "progressive-type" evolution pattern. Furthermore, strains from temporally and geographically unrelated outbreaks in different countries were clustered in the same subgroup of phylogenetic tree, indicating that that L. monocytogenes developed highly similar virulence genes and genetic characteristics to adaptation in a special ecological niche. Interestingly, there was a high correlation between the population structure of MVLST and MLST among the isolates of cluster IA corresponding to CC1, CC2, CC4 and CC6 that had the highest potential to cause listeriosis outbreaks, strengthening that surveillance of these CCs is important for prevention of listeriosis. The present study offers insights into the internal relationships between the population structure, distribution and pathogenicity of L. monocytogenes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

    Science.gov (United States)

    Eskhan, Asma Omar

    Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

  2. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    . monocytogenes strains. Despite this great step forward, there is not a single marker available to test the virulence of field isolates of this species. In the future, the combination of different molecular markers will probably allow the screening of food contamination by only the virulent clones of L. monocytogenes, thus improving the prevention of foodborne human listeriosis.

  3. Role of lactic acid bacteria as a biosanitizer to prevent attachment of Listeria monocytogenes F6900 on deli slicer contact surfaces.

    Science.gov (United States)

    Ndahetuye, Jean Baptiste; Koo, Ok Kyung; O'Bryan, Corliss A; Ricke, Steven C; Crandall, Philip G

    2012-08-01

    The study was conducted to evaluate the attachment of three lactic acid bacteria (LAB) strains and their combination in a cocktail, to stainless steel coupons from a deli slicer, and their ability to inhibit the attachment of Listeria monocytogenes. In a previous study, three LAB strains, Pediococcus acidilactici, Lactobacillus amylovorus, and Lactobacillus animalis, were isolated from ready-to-eat meat and exhibited antilisterial effect. In the study reported here, hydrophobicity tests were determined according to the method of microbial adhesion to solvent. The attachment of the cells was evaluated on stainless steel coupons from deli slicers. Extracellular carbohydrates were determined with a colorimetric method. Based on these tests, L. animalis exhibited the greatest hydrophobicity (26.3%), and its adherence increased sharply from 24 to 72 h, whereas L. amylovorus yielded the lowest hydrophobicity (3.86%) and was weakly adherent. Although P. acidilactici had moderate hydrophobicity (10.1%), it adhered strongly. The attached LAB strains produced significantly (P < 0.05) higher total carbohydrates than their planktonic counterparts did, which is an important characteristic for attachment. Three conditions were simulated to evaluate the ability of the LAB cocktail (10(8) CFU/ml) to competitively exclude L. monocytogenes (10(3) CFU/ml) on the surface of the coupons. The coupons were pretreated with the LAB cocktail for 24 h prior to the addition of L. monocytogenes, simultaneously treated with the LAB cocktail and L. monocytogenes, or pretreated with L. monocytogenes 24 h prior to the addition of the LAB cocktail. The LAB cocktail was able to reduce the attachment L. monocytogenes significantly (P < 0.05). The LAB cocktail indicated potential attachment on stainless steel and bacteriostatic activity toward L. monocytogenes attached on stainless steel, which indicates a possible role for LAB as a biosanitizer in the food industry.

  4. The Correlation between NaCl Adaptation and Heat Sensitivity of Listeria monocytogenes, a Foodborne Pathogen through Fresh and Processed Meat.

    Science.gov (United States)

    Lee, Jeeyeon; Ha, Jimyeong; Kim, Sejeong; Lee, Soomin; Lee, Heeyoung; Yoon, Yohan; Choi, Kyoung-Hee

    2016-01-01

    This study examined the relationship between NaCl sensitivity and stress response of Listeria monocytogenes. Nine strains of L. monocytogenes (NCCP10805, NCCP10806, NCCP10807, NCCP10808, NCCP10809, NCCP10810, NCCP10811, NCCP10920 and NCCP 10943) were exposed to 0%, 1%, 2% and 4% NaCl, and then incubated at 60℃ for 60 min to select strains that were heat-sensitized (HS) and non-sensitized (NS) by NaCl exposure. After heat challenge, L. monocytogenes strains were categorized as HS (NCCP 10805, NCCP10806, NCCP10807, NCCP10810, NCCP10811 and NCCP10920) or NS (NCCP10808, NCCP10809 and NCCP10943). Total mRNA was extracted from a HS strain (NCCP10811) and two NS strains (NCCP10808 and NCCP10809), and then cDNA was prepared to analyze the expression of genes (inlA, inlB, opuC, betL, gbuB, osmC and ctc) that may be altered in response to NaCl stress, by qRT-PCR. The expression levels of two invasion-related genes (inlA and inlB) and two stress response genes (opuC and ctc) were increased (p<0.05) in NS strains after NaCl exposure in an NaCl concentration-dependent manner. However, only betL expression was increased (p<0.05) in the HS strains. These results indicate that the effect of NaCl on heat sensitization of L. monocytogenes is strain dependent and that opuC and ctc may prevent NS L. monocytogenes strains from being heat sensitized by NaCl. Moreover, NaCl also increases the expression of invasion-related genes (inlA and inlB).

  5. Elimination of Listeria monocytogenes from vacuum-packed dry-cured ham by E-beam radiation.

    Science.gov (United States)

    Hoz, L; Cambero, M I; Cabeza, M C; Herrero, A M; Ordónez, J A

    2008-10-01

    The inactivation kinetics for Listeria monocytogenes Scott A (CIP 103575, serotype 4b) and Listeria innocua (NTC 11288) after E-beam radiation were studied in vacuum-packed ready-to-eat dry-cured ham to optimize the sanitation treatment of this product. A treatment of 1.12 kGy was calculated to reach the food safety objective according to the U.S. Department of Agriculture criterion. No irradiation treatment is necessary to meet the European Union microbiological criterion for this bacterium. No changes (at doses Dry-cured hams treated with 1 and 2 kGy had negligible sensory modifications (appearance, odor, and flavor). However, the application of 3 and 4 kGy resulted in an increase in the intensity of off-odors and off-flavors. Despite these effects, all irradiated vacuum-packed dry-cured hams treated at < or =4 kGy were deemed acceptable for trading.

  6. Diversity and persistence of Listeria monocytogenes within the Gorgonzola PDO production chain and comparison with clinical isolates from the same area.

    Science.gov (United States)

    Filipello, Virginia; Gallina, Silvia; Amato, Ettore; Losio, Marina Nadia; Pontello, Mirella; Decastelli, Lucia; Lomonaco, Sara

    2017-03-20

    Listeria monocytogenes causes invasive syndromes with high fatality rates in specific population groups. Cheeses have been commonly implicated in outbreaks worldwide. Gorgonzola is a cheese only produced in Northwestern Italy (it is the third Italian cheese in terms of production and export) and L. monocytogenes is frequently isolated from the production chain. The aims of this study were to assess the distribution of L. monocytogenes Virulence Types (VTs) in isolates collected in Gorgonzola processing plants and to determine the presence of Epidemic Clones (ECs). Fifty-Six L. monocytogenes strains collected between 2004 and 2016 from cheese and environmental samples were subtyped with Multi-Virulence-Locus Sequence Typing (MVLST) and compared to previously typed strains. Most isolates (n=50) belonged to two new VTs (VT113 and VT114). The remaining isolates belonged to previously identified VTs: VT14-ECVIII (milk chocolate outbreak, 1994, USA) and VT80 (ricotta salata outbreak, 2012, USA). VT14, VT80 and VT113 were shared with isolates from apparently sporadic human cases in the same geographical area and temporal period (Piedmont and Lombardy, 2005-2016). The overall L. monocytogenes population appears to be homogeneous and may be characteristic of Gorgonzola production. Nevertheless, the detection in cheese and environmental samples of VTs observed in clinical isolates or outbreak related strains (VT80, VT14) contributed to better describe the current scenario and pointed out the need for increased surveillance.

  7. Heavy-Metal and Benzalkonium Chloride Resistance of Listeria monocytogenes Isolates from the Environment of Turkey-Processing Plants▿ †

    Science.gov (United States)

    Mullapudi, S.; Siletzky, R. M.; Kathariou, S.

    2008-01-01

    The resistance of Listeria monocytogenes to cadmium and arsenic has been used extensively for strain subtyping. However, limited information is available on the prevalence of such resistance among isolates from the environment of food-processing plants. In addition, it is not known whether the resistance of such isolates to heavy metals may correlate with resistance to quaternary ammonium compounds extensively used as disinfectants in the food-processing industry. In this study, we characterized 192 L. monocytogenes isolates (123 putative strains) from the environment of turkey-processing plants in the United States for resistance to cadmium and arsenic and to the quaternary ammonium disinfectant benzalkonium chloride (BC). Resistance to cadmium was significantly more prevalent among strains of serotypes 1/2a (or 3a) and 1/2b (or 3b) (83% and 74%, respectively) than among strains of the serotype 4b complex (19%). Resistance to BC was encountered among 60% and 51% of the serotype 1/2a (or 3a) and 1/2b (or 3b) strains, respectively, and among 7% of the strains of the serotype 4b complex. All BC-resistant strains were also resistant to cadmium, although the reverse was not always the case. In contrast, no correlation was found between BC resistance and resistance to arsenic, which overall was low (6%). Our findings suggest that the processing environment of turkey-processing plants may constitute a reservoir for L. monocytogenes harboring resistance to cadmium and to BC and raise the possibility of common genetic elements or mechanisms mediating resistance to quaternary ammonium disinfectants and to cadmium in L. monocytogenes. PMID:18192428

  8. Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

    Science.gov (United States)

    Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

    2012-01-01

    The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

  9. Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

    Science.gov (United States)

    Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

    2012-08-01

    Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

  10. Thermal inactivation of Listeria monocytogenes and Salmonella spp. in sous-vide processed marinated chicken breast.

    Science.gov (United States)

    Karyotis, Dimitrios; Skandamis, Panagiotis N; Juneja, Vijay K

    2017-10-01

    The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60°C in 1h, and then held for predetermined times. The surviving Salmonella and L. monocytogenes cells were enumerated by surface plating on XLD agar and Palcam agar, respectively. D-values, determined by linear regression, of Salmonella in chicken breast ranged from 47.65min at 55°C to 7.48min at 60°C; the values for L. monocytogenes ranged from 54.81min at 55°C to 10.39min at 60°C. Marination rendered the pathogen more sensitive to the lethal effect of heat. The results of this study will assist the food industry in ensuring microbiological safety of sous-vide processed marinated chicken breasts. Published by Elsevier Ltd.

  11. Antimicrobial activity of reuterin produced by Lactobacillus reuteri on Listeria monocytogenes in cold-smoked salmon.

    Science.gov (United States)

    Montiel, R; Martín-Cabrejas, I; Langa, S; El Aouad, N; Arqués, J L; Reyes, F; Medina, M

    2014-12-01

    Lactobacillus reuteri INIA P579 was used for the production and purification of reuterin. The purity of reuterin was assessed by high resolution electrospray ionization mass spectrometry (HRESIMS) and nuclear magnetic resonance (NMR) spectroscopy. After purification, reuterin concentration obtained was 1.3 M. The inhibitory activity using Escherichia coli K12 as indicator strain was estimated to be 510 AU/ml. Survival curves in tryptic soy broth revealed that reuterin required to inhibit the growth of three Listeria monocytogenes strains was in the range of 2-4 AU/ml. Purified reuterin (10 AU/g) significantly reduced the growth of L. monocytogenes in cold-smoked salmon kept under moderate or strong temperature abuse conditions. After 15 d at 8 °C, cold-smoked salmon with added reuterin exhibited L. monocytogenes counts 2.0 log CFU/g lower than control smoked salmon with no reuterin added. At 30 °C, reuterin also controlled the growth of the pathogen, with counts 1.4 and 0.9 log CFU/g lower than those observed in control smoked salmon after 24 and 48 h, respectively. The addition of purified reuterin might be used as a hurdle technology to improve the safety and extend the shelf-life of lightly preserved seafood products such as cold-smoked salmon.

  12. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  13. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

    Science.gov (United States)

    Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

    2015-12-03

    Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  14. The surface protein Lmo1941 with LysM domain influences cell wall structure and susceptibility of Listeria monocytogenes to cephalosporins.

    Science.gov (United States)

    Krawczyk-Balska, Agata; Korsak, Dorota; Popowska, Magdalena

    2014-08-01

    Listeria monocytogenes is a Gram-positive bacterium causing rare but dangerous cases of disease in humans and animals. The β-lactams penicillin G and ampicillin are the antibiotics of choice in the treatment of listeriosis. Recently, lmo1941, encoding a surface protein of L. monocytogenes with unknown function, was identified as a gene transcriptionally upregulated under penicillin G pressure. In this study, the effect of lmo1941 knockout on the susceptibility of L. monocytogenes to β-lactams was examined. Deletion mutant in lmo1941 was constructed and subjected to studies, which revealed that the deletion of lmo1941 had no effect on susceptibility and tolerance to penicillin G and ampicillin but resulted, however, in increased susceptibility of L. monocytogenes to several cephalosporins. Subsequently, the potential effect of lmo1941 mutation on the cell wall of L. monocytogenes was investigated. The analysis revealed quantitative changes in the muropeptide profile of peptidoglycan and a decrease in density of the high-density zone of cell wall of the mutant strain. Both these changes were observed in cells taken from the stationary phase. These results indicate that the surface protein Lmo1941 affects peptidoglycan composition and cell wall structure of L. monocytogenes in the stationary phase of growth. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  15. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP for Rapid Detection and Differentiation of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2015-12-01

    Full Text Available Here, a novel model of loop-mediated isothermal amplification (LAMP, termed multiple inner primers-LAMP (MIP-LAMP, was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD, or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  16. Benzalkonium chloride and heavy-metal tolerance in Listeria monocytogenes from retail foods.

    Science.gov (United States)

    Xu, Dongyang; Li, Yanli; Zahid, M Shamim Hasan; Yamasaki, Shinji; Shi, Lei; Li, Jian-rong; Yan, He

    2014-11-03

    Phenotypic and genotypic tolerance in 71 Listeria monocytogenes isolates from different varieties of foods to benzalkonium chloride (BC) and cadmium were investigated by susceptibility test and molecular methods. To investigate the role of efflux pumps in BC tolerance, reserpine, an efflux pump inhibitor, was added to the BC tolerant strains. Tolerance to BC and cadmium were 26.8% (19/71) and 49.3% (35/71) respectively. Strains with BC tolerance were significantly more frequent among those of serotype 4b (100%, 6/6) than among those of serotype 1/2a (or 3a) (13.5%, 5/37), which represent the predominant number of strains (52.1%, 37/71). Tolerance to cadmium was encountered among 62.2% (23/37) and 50.0% (3/6) of the serotype 1/2a (or 3a) and 4b strains, respectively, and among 19.0% (4/21) of the strains of the serotype 1/2c. All of the 10 (14.1%) isolates found to be BC and cadmium co-tolerance were isolated from raw meat or quick-frozen food made of wheat flour and rice. Five multi-drug resistant strains were tolerant to cadmium as well. Among 71 isolates examined, one contained qacA and three contained qacEΔ1-sul. To the best of our knowledge, this is the first detection of qacA and qacEΔ1-sul in L. monocytogenes, an indication of the possible horizontal transfer of the two genes. Addition of reserpine to the tolerant strains resulted in the loss of tolerance among seven out of 19 BC strains, suggesting a certain role the efflux pump played in mediating BC tolerance. Of the three distinct cadA types known to date in L. monocytogenes, the cadA1 and cadA2 genes were detected among 24 (33.8%) and three (4.2%) isolates respectively. The presence of cadA1 and cadA2 largely corresponded to the susceptibility phenotype. A subset (9/35 [25.7%]) of the cadmium-tolerant isolates lacked the known cadmium resistance determinants. These findings suggest that food products could act as a reservoir for L. monocytogenes harboring tolerance to BC and cadmium and will further

  17. Susceptibility of Listeria monocytogenes isolated from food in Italy to antibiotics.

    Science.gov (United States)

    Aureli, Paolo; Ferrini, Anna Maria; Mannoni, Veruscka; Hodzic, Snjezana; Wedell-Weergaard, Christina; Oliva, Brunello

    2003-06-25

    The susceptibility of 148 strains of Listeria monocytogenes isolated from food to antibiotics currently used in veterinary and human therapy was determined by standard agar dilution and disk diffusion methods. The antibiotics included amikacin, amoxicillin, cefazolin, chloramphenicol, erythromycin, flumequine, fosfomycin, gentamicin, kanamycin, lincomycin, oxytetracycline, rifampicin, spiramycin, streptomycin, tetracycline, tobramycin and vancomycin. Soussy's breakpoints and MIC(50)-MIC(90) values were used to classify the strains into sensitive, moderately sensitive and resistant groups. This work is part of a wider surveillance program on listeriosis started in Italy in 1995.

  18. Bacteriocin production and resistance to drugs are advantageous features for Lactobacillus acidophilus La-14, a potential probiotic strain.

    Science.gov (United States)

    Todorov, Svetoslav Dimitrov; Furtado, Danielle Nader; Saad, Susana Marta Isay; Gombossy de Melo Franco, Bernadette Dora

    2011-10-01

    L. acidophilus La-14 produces bacteriocin active against L. monocytogenes ScottA (1600 AU/ml) in MRS broth at 30°C or 37°C. The bacteriocin proved inhibitory to different serological types of Listeria spp. Antimicrobial activity was completely lost after treatment of the cell-free supernatant with proteolytic enzymes. Addition of bacteriocin produced by L. acidophilus La-14 to a 3 h-old culture of L. monocytogenes ScottA repressed cell growth in the following 8h. Treatment of stationary phase cells of L. monocytogenes ScottA (107-108 CFU/ml) by the bacteriocin resulted in growth inhibition. Growth of L. acidophilus La-14 was not inhibited by commercial drugs from different generic groups, including nonsteroidal anti-inflammatory drugs (NSAID) containing diclofenac potassium or ibuprofen arginine. Only one non-antibiotic drug tested, Atlansil (an antiarrhythmic agent), had an inhibitory effect on L. acidophilus La-14 with MIC of 2.5 mg/ml. L. acidophilus La-14 was not affected by drugs containing sodium or potassium diclofenac. L. acidophilus La-14 shows a good resistance to several drugs and may be applied in combination for therapeutic use.

  19. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  20. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  1. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  2. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  3. Effect of mayonnaise pH and storage temperature on the behavior of Listeria monocytogenes in ham salad and potato salad.

    Science.gov (United States)

    Hwang, Cheng-An

    2005-08-01

    This study examined and modeled the behavior of Listeria monocytogenes in ham salad and potato salad as affected by the pH of mayonnaise and storage temperature. An eight-strain cocktail of L. monocytogenes was inoculated on the surface of diced cooked ham or potato. The inoculated ham or potato was then mixed with regular mayonnaise (pH 3.8) or mayonnaise that was adjusted with NaOH to pH 4.2 or 4.6. The cell counts of L. monocytogenes in the salads during storage at 4, 8, or 12 degrees C were enumerated and used to model the behavior of L. monocytogenes in ham salad or potato salad. At each of the storage temperatures, L. monocytogenes was able to grow in ham salad, whereas L. monocytogenes was inactivated in potato salad. The growth rate (log CFU per hour) in ham salad or the inactivation rate (log CFU per hour) in potato salad increased as the storage temperature increased. The duration before growth in ham salad or inactivation in potato salad increased as storage temperature decreased. The mayonnaise pH showed no consistent effect on the growth rate or inactivation rate and duration before growth or inactivation occurred. Mathematical equations that described the growth rate or inactivation rate of L. monocytogenes in both salads as a function of mayonnaise pH and storage temperature were generated and shown to be satisfactory in describing the growth rate or inactivation rate of L. monocytogenes in the ham salad or potato salad.

  4. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    Science.gov (United States)

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    Summary To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or induced to lyse by treatment with ampicillin stimulated pyroptosis. Pyroptosis was independent of the Nlrp3 and Nlrc4 receptors, but dependent on ASC and AIM2. Importantly, wild type L. monocytogenes were also found to lyse, albeit at low levels, and trigger AIM2-dependent pyroptosis. Since AIM2 is activated by DNA, these data suggested that pyroptosis is triggered by bacterial DNA released during lysis. PMID:20417169

  5. Genome-wide analyses reveal lineage specific contributions of positive selection and recombination to the evolution of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sun Qi

    2008-08-01

    Full Text Available Abstract Background The genus Listeria includes two closely related pathogenic and non-pathogenic species, L. monocytogenes and L. innocua. L. monocytogenes is an opportunistic human foodborne and animal pathogen that includes two common lineages. While lineage I is more commonly found among human listeriosis cases, lineage II appears to be overrepresented among isolates from foods and environmental sources. This study used the genome sequences for one L. innocua strain and four L. monocytogenes strains representing lineages I and II, to characterize the contributions of positive selection and recombination to the evolution of the L. innocua/L. monocytogenes core genome. Results Among the 2267 genes in the L. monocytogenes/L. innocua core genome, 1097 genes showed evidence for recombination and 36 genes showed evidence for positive selection. Positive selection was strongly associated with recombination. Specifically, 29 of the 36 genes under positive selection also showed evidence for recombination. Recombination was more common among isolates in lineage II than lineage I; this trend was confirmed by sequencing five genes in a larger isolate set. Positive selection was more abundant in the ancestral branch of lineage II (20 genes as compared to the ancestral branch of lineage I (9 genes. Additional genes under positive selection were identified in the branch separating the two species; for this branch, genes in the role category "Cell wall and membrane biogenesis" were significantly more likely to have evidence for positive selection. Positive selection of three genes was confirmed in a larger isolate set, which also revealed occurrence of multiple premature stop codons in one positively selected gene involved in flagellar motility (flaR. Conclusion While recombination and positive selection both contribute to evolution of L. monocytogenes, the relative contributions of these evolutionary forces seem to differ by L. monocytogenes lineages and

  6. Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland

    Directory of Open Access Journals (Sweden)

    Dara eLeong

    2014-08-01

    Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.

  7. Antimicrobial activity of the Nisin Z producer Lactococcus lactis subsp. lactis Lc08 against Listeria monocytogenes in skim milk

    Directory of Open Access Journals (Sweden)

    L.M. Perin

    2013-10-01

    Full Text Available The presented study aimed to verify the effect of different pH values, enzyme solutions and heat treatments on the antimicrobial activity of the bacteriocinogenic strain Lactococcus lactis subsp. lactis Lc08 and to test their antimicrobial activity against Listeria monocytogenes in reconstituted skim milk at refrigeration temperatures. This strain was previously described as a nisin Z producer and capable of inhibiting L. monocytogenes growth in in vitro tests. The antimicrobial activity of the bacteriocin cell-free supernatant of Lc08 was sensitive to enzyme treatments (except papain. The pH values and heating (65ºC for 30min, 75ºC for 15s had no apparent effect on the antimicrobial activity of the bacteriocin produced by Lc08. Only treatment at autoclave conditions result in loss of their antimicrobial activity. Lc08 presented antimicrobial activity against L. monocytogenes in the milk system after 12h at 25ºC. No effect was found at 7ºC. The results show the application viability of the Lc08 in food systems as a biopreservative against L. monocytogenes.

  8. Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland.

    Science.gov (United States)

    Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran

    2014-01-01

    Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.

  9. Potential Impact of the Resistance to Quaternary Ammonium Disinfectants on the Persistence of Listeria monocytogenes in Food Processing Environments

    Science.gov (United States)

    Martínez-Suárez, Joaquín V.; Ortiz, Sagrario; López-Alonso, Victoria

    2016-01-01

    The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations. PMID:27199964

  10. VIDAS Listeria monocytogenes II (LMO2).

    Science.gov (United States)

    Johnson, Ronald; Mills, John

    2013-01-01

    This AOAC GovVal study compared the VIDAS Listeria monocytogenes II (LMO2) to the Health Products and Food Branch MFHPB-30 reference method for detection of L. monocytogenes in ready-to-eat (RTE) meats. The VIDAS LMO2 test is an automated enzyme-linked fluorescent immunoassay for the detection of L. monocytogenes in foods. The LMO2 test, following the enrichment procedure from the MFLP-33 method, also included use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LMO2 presumptive results. In previous AOAC validation studies comparing the VIDAS LMO2 method to the U.S. Food and Drug Administration Bacteriological Analytical Manual and U.S. Department of Agriculture-Food Safety and Inspection Service reference methods, LMO2 was approved as AOAC Official Method 2004.02 for the detection of L. monocytogenes in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry. The GovVal comparative study included 20 replicate test portions, each at two contamination levels for each matrix, where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. Chi-square analysis of the comparative data in this study indicates no statistical differences between the VIDAS LMO2 and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LMO2 results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data demonstrate that the VIDAS LMO2 method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of L. monocytogenes in RTE meats, including liver paté, hot dogs, raw fermented sausage, sliced deli turkey, and sliced deli ham.

  11. Oxygen restriction increases the infective potential of Listeria monocytogenes in vitro in Caco-2 cells and in vivo in guinea pigs

    Directory of Open Access Journals (Sweden)

    Licht Tine

    2007-06-01

    Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.

  12. Development of a Listeria monocytogenes EGDe partial proteome reference map and comparison with the protein profiles of food isolates.

    Science.gov (United States)

    Ramnath, Manilduth; Rechinger, K Björn; Jänsch, Lothar; Hastings, John W; Knøchel, Susanne; Gravesen, Anne

    2003-06-01

    A partially annotated proteome reference map of the food pathogen Listeria monocytogenes was developed for exponentially growing cells under standardized, optimal conditions by using the sequenced strain EGDe (serotype 1/2a) as a model organism. The map was developed by using a reproducible total protein extraction and two-dimensional (2-D) polyacrylamide gel electrophoresis analysis procedure, and it contained 33 identified proteins representing the four main protein functional classes. In order to facilitate analysis of membrane proteins, a protein compartmentalization procedure was assessed. The method used provided partial fractionation of membrane and cytosolic proteins. The total protein 2-D profiles of three serotype 1/2a strains and one serotype 1/2b strain isolated from food were compared to the L. monocytogenes EGDe proteome. An average of 13% of the major protein spots in the food strain proteomes were not matched in the strain EGDe proteome. The variation was greater for the less intense spots, and on average 28% of these spots were not matched. Two of the proteins identified in L. monocytogenes EGDe were missing in one or more of the food isolates. These two proteins were proteins involved in the main glycolytic pathway and in metabolism of coenzymes and prosthetic groups. The two corresponding genes were found by PCR amplification to be present in the four food isolates. Our results show that the L. monocytogenes EGDe reference map is a valuable starting point for analyses of strains having various origins and could be useful for analyzing the proteomes of different isolates of this pathogen.

  13. Host range and in vitro lysis of Listeria monocytogenes seafood isolates by bacteriophages.

    Science.gov (United States)

    Arachchi, Geevika J Ganegama; Cruz, Cristina D; Dias-Wanigasekera, Beatrice M; McIntyre, Lynn; Billington, Craig; Hudson, Andrew; Flint, Steve H; Mutukumira, Anthony N

    2014-12-01

    Listeria-infecting bacteriophages (listeriaphages) can be used to control Listeria monocytogenes in the food industry. However, the sensitivity of many of seafood-borne Listeria strains to phages has not been reported. This research investigated the host ranges of three listeriaphages (FWLLm1, FWLLm3 and FWLLm5) by the formation of lytic zones and plaques on host lawns and in vitro lysis kinetics of listeriaphage FWLLm3. The study also predicted the phage titres required to lyse host cells. The host ranges of the phages were determined using 50 L. monocytogenes strains, of which 48 were isolated from the seafood industry and two from clinical cases. Of the 50 strains, 36 were tested at 25 and 30 ℃ and the remainder (14) at 15 and 25 ℃. Based on the formation of either discrete plaques or lytic zones (host kill zones), the host ranges of FWLLm1, FWLLm3 and FWLLm5 were about 87%, 81% and 87%, respectively, at 25 ℃. Six L. monocytogenes strains from the seafood environment were insensitive to all three phages, while the other seafood strains (42) were phage-sensitive. The adsorption rate constant (k value) of listeriaphage FWLLm3 was between 1.2 × 10(-9) and 1.6 × 10(-9 )ml/min across four host strains in tryptic soy broth at 25 ℃. The cultures (at 3-4 log colony-forming unit (CFU/ml) were completely lysed ( 8.7 log phage-forming units (PFU/ml) for 30 min. Re-growth of phage-infected cultures was not detected after 24 h. The effective empirical phage titre was similar to the calculated titre using a kinetic model. Results indicate the potential use of the three phages for controlling L. monocytogenes strains in seafood processing environments. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  14. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride.

    Science.gov (United States)

    Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia

    2015-06-01

    In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment.

  15. Inhibition of Listeria monocytogenes by Buffered Dry Vinegar in Reduced-Sodium Ready-to-Eat Uncured Turkey Stored at 4°C.

    Science.gov (United States)

    Badvela, Mani K; Dickson, James S; Sebranek, Joseph G; Schroeder, William D

    2016-08-01

    A reduced-sodium ready-to-eat (RTE) uncured turkey was manufactured with buffered dry vinegar treatments to validate the inhibition of Listeria monocytogenes and spoilage microflora and to determine the effects on sensory and quality attributes. Samples were stored at 4°C for 12 weeks, and the study was independently replicated three times. Two different five-strain inocula of L. monocytogenes obtained from different sources were used for evaluating the efficacy of the buffered dry vinegar treatments. The results showed that 0.6 and 0.8% buffered dry vinegar with a sodium base (BDV-SB) and buffered dry vinegar with a potassium base (BDV-PB) at 0.7 and 0.9% controlled L. monocytogenes for 12 weeks. The untreated control product containing no buffered dry vinegar showed >1 log increase in L. monocytogenes populations counts at the end of 2 weeks. Statistical analysis confirmed that the dry vinegar treatments inhibited (P > 0.05) the growth of L. monocytogenes compared with the untreated control. No significant differences (P > 0.05) were seen in the inhibition of L. monocytogenes between the two different five-strain inocula. Instrumental color results showed no significant differences between the treatments. Purge loss results showed no significant differences between the dry vinegar treatments, but significant differences were seen between the untreated control and dry vinegar treatments at a few testing intervals. The overall results indicated that the dry vinegar ingredients (6.66 to 8.83 mM acetic acid in the finished product) were effective in inhibiting L. monocytogenes obtained from multiple sources in reduced-sodium RTE uncured turkey stored at 4°C without adversely impacting the quality attributes.

  16. Combined effects of NaCl, NaOH, and biocides (monolaurin or lauric acid) on inactivation of Listeria monocytogenes and Pseudomonas spp.

    Science.gov (United States)

    Vasseur, C; Rigaud, N; Hébraud, M; Labadie, J

    2001-09-01

    This study highlighted combinations of chemical stresses that could decrease or eliminate Listeria monocytogenes and Pseudomonas spp. surviving in food processing plants. Strains of L. monocytogenes, Pseudomonas fragi, and Pseudomonas fluorescens isolated from processing environments (meat and milk) were grown at 20 degrees C up to the early stationary phase. The strains were then subjected to 30 min of physicochemical treatments. These treatments included individual or combined acid (acetic acid), alkaline (NaOH), osmotic (NaCl), and biocides (fatty acids) challenges. Survival of the strains was studied after individual or combined acid (acetic acid), alkaline (NaOH), osmotic (NaCl), and biocides (monolaurin, lauric acid) challenges. Individual pH shocks had lower efficiencies than those used in combinations with other parameters. The treatment pH 5.4 followed by pH 10.5 had a low efficiency against L. monocytogenes. The opposite combination, pH 10.5 followed by pH 5.4, led to a 3-log reduction of the L. monocytogenes population. Pseudomonas spp. strains were much more sensitive than L. monocytogenes, and population reductions of 5 and 8 log (total destruction), respectively, were observed after the same treatments. As for L. monocytogenes, the combination pH 10.5 followed by pH 5.4 is more deleterious than the opposite. Whatever the bacterial species, the most efficient treatments were combinations of alkaline, osmotic, and biocide shocks. For instance, the combination pH 10.5 and 10% NaCl plus biocides showed reductions of 5 to 8 log for both bacteria. The origins of the observed lethal effects are discussed.

  17. Aurora 7 the Mercury space flight of M. Scott Carpenter

    CERN Document Server

    Burgess, Colin

    2016-01-01

    TO A NATION enthralled by the heroic exploits of the Mercury astronauts, the launch of Lt. Cmdr. Scott Carpenter on NASA’s second orbital space flight was a renewed cause for pride, jubilation and celebration. Within hours, that excitement had given way to stunned disbelief and anxiety as shaken broadcasters began preparing the American public for the very real possibility that an American astronaut and his spacecraft may have been lost at sea. In fact, it had been a very close call. Completely out of fuel and forced to manually guide Aurora 7 through the frightening inferno of re-entry, Carpenter brought the Mercury spacecraft down to a safe splashdown in the ocean. In doing so, he controversially overshot the intended landing zone. Despite his efforts, Carpenter’s performance on the MA-7 mission was later derided by powerful figures within NASA. He would never fly into space again. Taking temporary leave of NASA, Carpenter participated in the U.S. Navy’s pioneering Sealab program. For a record 30 days...

  18. Aarskog-Scott syndrome: phenotypic and genetic heterogeneity

    Directory of Open Access Journals (Sweden)

    Ignacio Briceno

    2016-03-01

    Full Text Available Aarskog-Scott syndrome (AAS is a rare developmental disorder which primarily affects males and has a relative prevalence of 1 in 25,000 in the general population. AAS patients usually present with developmental complications including short stature and facial, skeletal and urogenital anomalies. The spectrum of genotype-phenotype correlations in AAS is unclear and mutations of the FGD1 gene on the proximal short arm of chromosome X account for only 20% of the incidence of the disorder. Failure to identify pathogenic variants in patients referred for FGD1 screening suggests heterogeneity underlying pathophysiology of the condition. Furthermore, overlapping features of AAS with several other developmental disorders increase the complexity of diagnosis. Cytoskeletal signaling may be involved in the pathophysiology of AAS. The FGD1 protein family has a role in activation of CDC42 (Cell Division Control protein 42 homolog which has a core function in remodeling of extracellular matrix and the transcriptional activation of many modulators of development. Therefore, mutations in components in the EGFR1 (Epidermal Growth Factor Receptor 1 signaling pathway, to which CDC42 belongs, may contribute to pathophysiology. Parallel sequencing strategies (so-called next generation sequencing or high throughput sequencing enables simultaneous production of millions of sequencing reads that enormously facilitate cost-effective identification of cryptic mutations in heterogeneous monogenic disorders. Here we review the source of phenotypic and genetic heterogeneity in the context of AAS and discuss the applicability of next generation sequencing for identification of novel mutations underlying AAS.

  19. Professor John Scott, folate and neural tube defects.

    Science.gov (United States)

    Hoffbrand, A Victor

    2014-02-01

    John Scott (1940-2013) was born in Dublin where he was to spend the rest of his career, both as an undergraduate and subsequently Professor of Biochemistry and Nutrition at Trinity College. His research with the talented group of scientists and clinicians that he led has had a substantial impact on our understanding of folate metabolism, mechanisms of its catabolism and deficiency. His research established the leading theory of folate involvement with vitamin B12 in the pathogenesis of vitamin B12 neuropathy. He helped to establish the normal daily intake of folate and the increased requirements needed either in food or as a supplement before and during pregnancy to prevent neural tube defects. He also suggested a dietary supplement of vitamin B12 before and during pregnancy to reduce the risk of neural tube defects. It would be an appropriate epitaph if fortification of food with folic acid became mandatory in the UK and Ireland, as it is in over 70 other countries. © 2013 John Wiley & Sons Ltd.

  20. 单增李斯特菌鉴定方法比较研究%COMPARATIVE EVALUATION ON THREE METHODS OF IDENTIFICATION OF LISTERIA MONOCYTOGENES

    Institute of Scientific and Technical Information of China (English)

    李秀娟; 徐保红; 高伟利; 李波; 宋红梅; 张仁伟

    2011-01-01

    [Objective] To evaluate the methods on identification of the Listeria monocytogenes. [Methods] 17 strains of Listeria monocytogenes were identified with API assay and 16S rRNA gene sequence analysis, pyrosequencing assay. [Re-sylts] Three methods all can identify 17 strains of Iisteria monocytogenes. [Conclusion] The pyrosequencing technology provides a specific, rapid, and real-time method for detection of Iisteria monocytogenes. It is helpful for the rapid and high-flux identification of Iisteria monocytogenes.%[目的]对单增李斯特菌鉴定方法进行研究.[方法]分别用API检测方法、16S rRNA序列分析法和焦磷酸测序法对17株单核细胞增生李斯特菌进行检测.[结果]3种方法均能准确鉴定单增李斯特菌.[结论]焦磷酸测序方法检测单增李斯特菌特异性强、经济、操作简便、检测快速,为单增李斯特菌的快速、高通量检测提供了一种新的手段.

  1. Evaluation of applied biosystems MicroSeq real-time PCR system for detection of Listeria monocytogenes in food. Performance Tested Method 011002.

    Science.gov (United States)

    Tebbs, Robert S; Balachandran, Priya; Wong, Lily Y; Zoder, Patrick; Furtado, Manohar R; Petrauskene, Olga V; Cao, Yanxiang

    2011-01-01

    Increasingly, more food companies are relying on molecular methods, such as PCR, for pathogen detection due to their improved simplicity, sensitivity, and rapid time to results. This report describes the validation of a new Real-Time PCR method to detect Listeria monocytogenes in nine different food matrixes. The complete system consists of the MicroSEQ L. monocytogenes Detection Kit, sample preparation, the Applied Biosystems 7500 Fast Real-Time PCR instrument, and RapidFinder Express software. Two sample preparation methods were validated: the PrepSEQ Nucleic Acid extraction kit and the PrepSEQ Rapid Spin sample preparation kit. The test method was compared to the ISO 11290-1 reference method using an unpaired-study design to detect L. monocytogenes in roast beef, cured bacon, lox (smoked salmon), lettuce, whole cow's milk, dry infant formula, ice cream, salad dressing, and mayonnaise. The MicroSEQ L. monocytogenes Detection Kit and the ISO 11290-1 reference method showed equivalent detection based on Chi-square analysis for all food matrixes when the samples were prepared using either of the two sample preparation methods. An independent validation confirmed these findings on smoked salmon and whole cow's milk. The MicroSEQ kit detected all 50 L. monocytogenes strains tested, and none of the 30 nontargeted bacteria strains.

  2. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  3. Inactivation of Escherichia coli, Listeria monocytogenes and Yersinia enterocolitica in fermented sausages during maturation/storage.

    Science.gov (United States)

    Lindqvist, Roland; Lindblad, Mats

    2009-01-31

    The purpose of this study was to evaluate maturation and storage conditions as a way to increase the safety of non-heat treated fermented sausages. The specific objectives were to investigate the effects of storage time and temperature on the levels of Escherichia coli, Listeria monocytogenes and Yersinia enterocolitica in fermented sausages and in broth, and to validate how well the broth experiments and some published models can predict inactivation in sausage. One strain each of E. coli, L. monocytogenes and Y. enterocolitica with induced acid tolerance was inoculated into sausage batters representing a typical Swedish recipe for cold-smoked sausages. The sausages were fermented at 27 degrees C for 39 or 48 h and then stored at different temperatures (8, 15, or 20-22 degrees C) for up to 44 days. The levels of the experimental strains, lactic acid bacteria, and pH, a(w), and lactic acid was measured during the maturation/storage period. Inactivation in BHI broths adjusted to pH 4.4 or 4.6, water activity of 0.93, and with 1, 1.3 or 2% lactic acid added was also studied. For all strains inactivation rates increased with temperature in both broths and sausages. At 8 degrees C the storage time required for a one-log reduction in sausage ranged from 21 days for E. coli, >16 days for L. monocytogenes, to 18 days for Y. enterocolitica. At temperatures of 20 degrees C or more, the storage time needed for a one log reduction was shorter: between 7 to 11 days for E. coli, 4 to 7 days for L. monocytogenes, and 1 to 4 days for Y. enterocolitica. A published model based on temperature only yielded a good prediction of E. coli inactivation in sausage. A linear model based on the rate estimated in broth yielded a fair prediction of L. monocytogenes inactivation. The performance of other inactivation models validated was unsatisfactory. Significant E. coli growth which occurred in batters without salt during initial phases of fermentation resulted in a subsequent increased

  4. Survival of Listeria monocytogenes in low acid italian sausage produced under brazilian conditions Sobrevivência de Listeria monocytogenes em salame tipo italiano de baixa acidez, produzido sob condições brasileiras de fabricação

    Directory of Open Access Journals (Sweden)

    Roberto Degenhardt

    2007-06-01

    Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil

  5. Atividade antimicrobiana de bactérias lácticas de embutidos curados frente a Listeria monocytogenes Antimicrobial activity of lactic acid bacteria isolated from Brazilian dry fermented sausages against Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    C.S. Prado

    2000-08-01

    Full Text Available Cepas de bactérias lácticas recuperadas de 336 colônias isoladas e selecionadas foram submetidas ao teste de atividade antimicrobiana direta, que identificou as produtoras de substâncias antimicrobianas capazes de inibir in vitro o desenvolvimento de duas cepas indicadoras de Listeria monocytogenes. As 108 cepas que inibiram diretamente pelo menos uma das cepas indicadoras receberam a denominação DTEI e foram selecionadas para o teste de atividade antimicrobiana indireta contra as mesmas cepas de L. monocytogenes, assim como frente a outras cepas de bactérias lácticas de origens diversas. Essa atividade inibidora indireta foi avaliada por meio de sobrenadantes isentos de células, esterilizados por meio de microfiltração, eliminando-se os principais compostos responsáveis por ela, como por exemplo os ácidos orgânicos e o peróxido de hidrogênio, mediante o ajuste do pH e a liofilização dos sobrenadantes. Oito cepas de bactérias lácticas apresentaram atividade antimicrobiana indireta frente a pelo menos um dos microrganismos indicadores utilizados, sugerindo terem produzido substâncias semelhantes a bacteriocinas. Três destas cepas foram caracterizadas e identificadas como pertencentes ao gênero Lactobacillus sp.The direct antimicrobial activity of 336 samples of lactic acid bacteria, isolated from Brazilian dry fermented sausages, was evaluated in vitro against two strains of Listeria monocytogenes, using agar diffusion assay. A total of 108 strains of lactic acid bacteria showed direct inhibitory activity against at least one of the two strains of Listeria monocytogenes, probably due to production of organic acids, hydrogen peroxide, and oxygen metabolites, in addition to other substances. These 108 strains were further tested for indirect antimicrobial activity against the same strains of Listeria monocytogenes, as well as against other strains of lactic acid bacteria. Indirect antimicrobial activity was evaluated using

  6. Nisin resistance of Listeria monocytogenes is increased by exposure to salt stress and is mediated via LiaR.

    Science.gov (United States)

    Bergholz, Teresa M; Tang, Silin; Wiedmann, Martin; Boor, Kathryn J

    2013-09-01

    Growth of Listeria monocytogenes on refrigerated, ready-to-eat food is a significant food safety concern. Natural antimicrobials, such as nisin, can be used to control this pathogen on food, but little is known about how other food-related stresses may impact how the pathogen responds to these compounds. Prior work demonstrated that exposure of L. monocytogenes to salt stress at 7°C led to increased expression of genes involved in nisin resistance, including the response regulator liaR. We hypothesized that exposure to salt stress would increase subsequent resistance to nisin and that LiaR would contribute to increased nisin resistance. Isogenic deletion mutations in liaR were constructed in 7 strains of L. monocytogenes, and strains were exposed to 6% NaCl in brain heart infusion broth and then tested for resistance to nisin (2 mg/ml Nisaplin) at 7°C. For the wild-type strains, exposure to salt significantly increased subsequent nisin resistance (P nisin resistance of wild-type strains, ΔliaR strains were significantly more sensitive to nisin (P nisin. Transcript levels of LiaR-regulated genes were induced by salt stress, and lmo1746 and telA were found to contribute to LiaR-mediated salt-induced nisin resistance. These data suggest that environmental stresses similar to those on foods can influence the resistance of L. monocytogenes to antimicrobials such as nisin, and potential cross-protective effects should be considered when selecting and applying control measures for this pathogen on ready-to-eat foods.

  7. Reliable and Rapid Identification of Listeria monocytogenes and Listeria Species by Artificial Neural Network-Based Fourier Transform Infrared Spectroscopy†

    Science.gov (United States)

    Rebuffo, Cecilia A.; Schmitt, Jürgen; Wenning, Mareike; von Stetten, Felix; Scherer, Siegfried

    2006-01-01

    Differentiation of the species within the genus Listeria is important for the food industry but only a few reliable methods are available so far. While a number of studies have used Fourier transform infrared (FTIR) spectroscopy to identify bacteria, the extraction of complex pattern information from the infrared spectra remains difficult. Here, we apply artificial neural network technology (ANN), which is an advanced multivariate data-processing method of pattern analysis, to identify Listeria infrared spectra at the species level. A hierarchical classification system based on ANN analysis for Listeria FTIR spectra was created, based on a comprehensive reference spectral database including 243 well-defined reference strains of Listeria monocytogenes, L. innocua, L. ivanovii, L. seeligeri, and L. welshimeri. In parallel, a univariate FTIR identification model was developed. To evaluate the potentials of these models, a set of 277 isolates of diverse geographical origins, but not included in the reference database, were assembled and used as an independent external validation for species discrimination. Univariate FTIR analysis allowed the correct identification of 85.2% of all strains and of 93% of the L. monocytogenes strains. ANN-based analysis enhanced differentiation success to 96% for all Listeria species, including a success rate of 99.2% for correct L. monocytogenes identification. The identity of the 277-strain test set was also determined with the standard phenotypical API Listeria system. This kit was able to identify 88% of the test isolates and 93% of L. monocytogenes strains. These results demonstrate the high reliability and strong potential of ANN-based FTIR spectrum analysis for identification of the five Listeria species under investigation. Starting from a pure culture, this technique allows the cost-efficient and rapid identification of Listeria species within 25 h and is suitable for use in a routine food microbiological laboratory. PMID

  8. Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model

    Directory of Open Access Journals (Sweden)

    Hill Colin

    2010-12-01

    Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced

  9. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes Internalin A for enhanced infectivity in the murine oral infection model

    LENUS (Irish Health Repository)

    Monk, Ian R

    2010-12-13

    Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human

  10. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-18

    Aug 18, 2008 ... 2Department of Food Technology, University of Ibadan, Ibadan, Nigeria. Accepted 10 July ... current therapy of choice for all forms of listeriosis is a combination of .... conditions that affect biofilm formation of various sur- faces.

  11. Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE.

    Science.gov (United States)

    Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne

    2013-08-16

    Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

  12. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

    Science.gov (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

    2014-01-01

    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  13. Astronaut Scott Carpenter on recovery ship U.S.S. Intrepid after MA-7 flight

    Science.gov (United States)

    1962-01-01

    Astronaut M. Scott Carpenter, prime pilot for the Mercury-Atlas 7 (MA-7) mission, arrives aboard the prime recovery ship, U.S.S. Intrepid, during recovery operations following his earth-orbital mission.

  14. Astronaut Scott Carpenter being recovered from Ocean after MA-7 flight

    Science.gov (United States)

    1962-01-01

    Astronaut M. Scott Carpenter, prime pilot for the Mercury-Atlas 7 (MA-7) mission, is seen being recovered from Atlantic Ocean after MA-7 flight. A diver helps Carpenter into a life raft while the capsule floats nearby.

  15. Eesti tervishoid on tõesti hea. Aitäh, USA! / Scott Abel

    Index Scriptorium Estoniae

    Abel, Scott

    2010-01-01

    Ameeriklane Scott Abel kirjutab, et president Barack Obama tervishoiureform mõjutab arstiabi ka Eestis. Vastukaja artiklile: Turay, Abdul. Kindla individualismi traditsioon // Postimees (2010) 30. märts, lk. 12

  16. A saúde como campo de pesquisa antropológica: entrevista com Parry Scott

    National Research Council Canada - National Science Library

    Soraya Fleischer; Marion Quadros; Pedro Nascimento

    2015-01-01

      Entrevista com Russel Parry Scott, Professor Titular do Departamento de Antropologia e Museologia da UFPE, realizada em 2012, em seu apartamento no Recife pelos amigos, colegas e professores Marion Teodósio de Quadros (UFPE...

  17. Eesti tervishoid on tõesti hea. Aitäh, USA! / Scott Abel

    Index Scriptorium Estoniae

    Abel, Scott

    2010-01-01

    Ameeriklane Scott Abel kirjutab, et president Barack Obama tervishoiureform mõjutab arstiabi ka Eestis. Vastukaja artiklile: Turay, Abdul. Kindla individualismi traditsioon // Postimees (2010) 30. märts, lk. 12

  18. Scott's Lake Site/Santee Indian Mound/Fort Watson Human Remains

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a generic dataset collected on human remains and funerary objects during Scott's Lake Site Excavation. Excavated by Dr. Leland G. Ferguson of SCIAA in 1973,...

  19. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  20. An Overview of Justice in Sir Walter Scott Waverley Novels: The Heart of Mid-Lothian

    Directory of Open Access Journals (Sweden)

    Enrique García Díaz

    2014-12-01

    Full Text Available Although Sir Walter Scott is a well-known writer most of his readers know that he became an advocate in 1792, when he was admitted to the bar. Since then Scott and other advocates walked the floor at Parliament House (home of the Faculty of Advocates and the Court of Session waiting to be hired. Scott’s own experiences as a fledgling advocate are echoed in those of Alain Fairford in his novel Redgauntlet (Scott 1824, which provides a vivid picture of Parliament House in the eighteenth century. During his life, Scott combined extensive writing and editing issues with his daily work as Clerk of Session and Sheriff-Depute of Selkirkshire. Walter Scott was not unaware of Justice and Law and The Heart of Mid-Lothian is the novel in which he introduces to the reader the Scottish Legal System during the eighteenth century. However, there are few more examples that I will explain. Aunque Sir Walter Scott es un conocido escritor, la mayoría de sus lectores saben que en 1792 se hizo abogado, cuando fue admitido en el colegio de abogados. Desde entonces Scott y otros abogados rondaron el Parlamento con la esperanza de ser contratados. Las propias experiencias de Scott como un abogado novel se reflejan en las de Alain Fairford en su novela Redgauntlet (Scott 1824, lo que ofrece una vívida imagen del Parlamento (sede de la facultad de Derecho y Tribunal Supremo en el siglo XVIII. Durante su vida, Scott compaginó una profusa actividad como escritor y editor con su trabajo diario como juez en Selkirk. Walter Scott conocía la justicia y el derecho y El corazón de Mid-Lothian es la novela en la presenta al lector el régimen jurídico de Escocia durante el siglo XVIII. Sin embargo, se explicarán algunos otros ejemplos. DOWNLOAD THIS PAPER FROM SSRN: http://ssrn.com/abstract=2543538

  1. Impact of environmental factors on the culturability and viability of Listeria monocytogenes under conditions encountered in food processing plants.

    Science.gov (United States)

    Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier

    2017-03-06

    The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Investidura com a doctor honoris causa de l'Excm. Sr. Hugh Scott Fogler

    OpenAIRE

    Diversos autors

    2016-01-01

    Investidura com a doctor honoris causa del senyor Hugh Scott Fogler. Sessió acadèmica extraordinària, 15 d'abril de 2016. Elogi del candidat a càrrec del doctor Azael Fabregat Llagostera. Discurs d’investidura pronunciat pel senyor Hugh Scott Fogler. Paraules de benvinguda pronunciades pel doctor Josep Anton Ferré Vidal, Rector Magfc. de la Universitat.

  3. HISTOPATHOLOGICAL CHANGES IN THE LIVER OF MICE CHALLENGED WITH Listeria monocytogenes IN SIX ZONES OF NIGERIA

    Directory of Open Access Journals (Sweden)

    Enurah L U

    2013-11-01

    Full Text Available Fifty four strains of Listeria monocytogenes were isolated from fresh raw milk and abattoir effluent. Uniform distribution pattern of the isolates in the six zones of Nigeria viz Southwest, Southeast, Southsouth, Norhwest, Northeast and Northcentral is evidence that food contamination with this organism may be a source of foodborne outbreak s in Nigeria. Present study investigated the pathogenic nature of the strains. The pathogenic strains were isolated by culturing on 7% Sheep Blood Agar for evidence of haemolysis and were used to challenge thr ee out of four groups of laboratory bred mice for pathogenicity test. The Group 1 mice were given 1ml of sterile distilled water orally and served as control, groups 2, 3 and 4 with 1.6 x 10 5cfu/ml orally, subcutaneously and intraperitoneally respectively. Experimental animals were successfully observed up to six days for clinical signs and possible mortality. All the infected mice that died were subjected to post - mortem examination which showed change with liver abscess with congested gall bladder containing purulent bile. Histopathology sections of the liver showed hepatocyte necrosis with infiltration of degenerative neutrophils, lymphocytes and few plasma cells compared to control. The study confirmed the presence of pathogenic strains of L.monocytogenes in all zones of Nigeria and their presence in the food may pose serious health hazards

  4. Heat resistance of Listeria monocytogenes in vacuum packaged pasteurized fish fillets.

    Science.gov (United States)

    Ben Embarek, P K; Huss, H H

    1993-11-01

    The heat resistance of two strains of Listeria monocytogenes in sous-vide cooked fillets of cod and salmon was investigated. Fish sticks of 5 g were inoculated, vacuum-packed and heated at different combinations of time and temperature (58-80 degrees C). Time-temperature combinations allowing survival and time-temperature combinations at which the bacteria were destroyed, were used to determine D- and z-values. D-values were in the range of what has been published for other food products. D60-values were between 1.95 and 4.48 min depending on the strain and the fish. Both strains were one-four-times more heat resistant in salmon than in cod, showing the importance of the heating menstruum. This difference may be due to the higher fat content in salmon as compared to cod. Z-values were calculated to be 5.65 and 6.4 degrees C, respectively, for the two strains. The suitability of methods for heat resistance experiments and the survival of L. monocytogenes in sous-vide cooked fish fillets are discussed.

  5. An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

    Directory of Open Access Journals (Sweden)

    Laura Bifulco

    2013-01-01

    Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  6. The majority of genotypes of the virulence gene inlA are intact among natural watershed isolates of Listeria monocytogenes from the central california coast

    Science.gov (United States)

    Internalin A is an essential virulence gene involved in the uptake of the foodborne pathogen Listeria monocytogenes into host cells. It is intact in clinical strains and often truncated due to Premature Stop Codons (PMSCs) in isolates from processed foods and processing facilities. The genotypes fou...

  7. Application of bacteriocinogenic Enterococcus mundtii CRL35 and Enterococcus faecium ST88Ch in the control of Listeria monocytogenes in fresh Minas cheese.

    Science.gov (United States)

    Vera Pingitore, Esteban; Todorov, Svetoslav Dimitrov; Sesma, Fernando; Franco, Bernadette Dora Gombossy de Melo

    2012-10-01

    Several strains of Enterococcus spp. are capable of producing bacteriocins with antimicrobial activity against important bacterial pathogens in dairy products. In this study, the bacteriocins produced by two Enterococcus strains (Enterococcus mundtii CRL35 and Enterococcus faecium ST88Ch), isolated from cheeses, were characterized and tested for their capability to control growth of Listeria monocytogenes 426 in experimentally contaminated fresh Minas cheese during refrigerated storage. Both strains were active against a variety of pathogenic and non-pathogenic microorganisms and bacteriocin absorption to various L. monocytogenes, Enterococcus faecalis ATCC 19443 and Lactobacillus sakei ATCC 15521 varied according to the strain and the testing conditions (pH, temperature, presence of salts and surfactants). Growth of L. monocytogenes 426 was inhibited in cheeses containing E. mundtii CRL35 up to 12 days at 8 °C, evidencing a bacteriostatic effect. E. faecium ST88Ch was less effective, as the bacteriostatic affect occurred only after 6 days at 8 °C. In cheeses containing nisin (12.5 mg/kg), less than one log reduction was observed. This research underlines the potential application of E. mundtii CRL35 in the control of L. monocytogenes in Minas cheese.

  8. Rapid identification and classification of Listeria spp. and serotype assignment of Listeria monocytogenes using fourier transform-infrared spectroscopy and artificial neural network analysis

    Science.gov (United States)

    The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...

  9. Use of a genetically enhanced, pediocin-producing starter culture, Lactococcus lactis subsp. lactis MM217, to control Listeria monocytogenes in cheddar cheese

    NARCIS (Netherlands)

    Buyong, N; Kok, J; Luchansky, JB

    1998-01-01

    Cheddar cheese was prepared with Lactococcus lactis subsp, lactis MM217, a starter culture which contains pMC117 coding for pediocin PA-1, About 75 liters of pasteurized milk (containing ca, 3.6% fat) was inoculated with strain MM217 (ca, 10(6) CFU per ml) and a mixture of three Listeria monocytogen

  10. Colovesical fistula presenting as Listeria monocytogenes bacteraemia.

    Science.gov (United States)

    Hobbs, Mark

    2015-03-31

    We present a case of colovesical fistula presenting with a clinical syndrome of urosepsis subsequently demonstrated to be due to Listeria monocytogenes bacteraemia. The patient had a history of previous rectal cancer with a low anterior resection and a covering ileostomy that had been reversed 6 months prior to this presentation. L. monocytogenes was also isolated among mixed enteric organisms on urine culture. There were no symptoms or signs of acute gastrointestinal listeriosis or meningoencephalitis. This unusual scenario prompted concern regarding the possibility of communication between bowel and bladder, which was subsequently confirmed with CT and a contrast enema. The patient recovered well with intravenous amoxicillin and to date has declined surgical management of his colovesical fistula. This case illustrates the importance of considering bowel pathology when enteric organisms such as Listeria are isolated from unusual sites.

  11. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech

    2013-01-01

    The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...... bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP...

  12. Microbiological challenge testing for Listeria monocytogenes in ready-to-eat food: a practical approach

    Directory of Open Access Journals (Sweden)

    Carlo Spanu

    2014-12-01

    Full Text Available Food business operators (FBOs are the primary responsible for the safety of food they place on the market. The definition and validation of the product’s shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE food that supports the growth of Listeria monocytogenes. Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.

  13. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter

    2012-01-31

    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  14. Structural characterisation of the fatty acid biosynthesis enzyme FabF from the pathogen Listeria monocytogenes

    Science.gov (United States)

    Soares da Costa, Tatiana P.; Nanson, Jeffrey D.; Forwood, Jade K.

    2017-01-01

    Development of new antimicrobial agents is required against the causative agent for listeriosis, Listeria monocytogenes, as the number of drug resistant strains continues to increase. A promising target is the β-ketoacyl-acyl carrier protein synthase FabF, which participates in the catalysis of fatty acid synthesis and elongation, and is required for the production of phospholipid membranes, lipoproteins, and lipopolysaccharides. In this study, we report the 1.35 Å crystal structure of FabF from L. monocytogenes, providing an excellent platform for the rational design of novel inhibitors. By comparing the structure of L. monocytogenes FabF with other published bacterial FabF structures in complex with known inhibitors and substrates, we highlight conformational changes within the active site, which will need to be accounted for during drug design and virtual screening studies. This high-resolution structure of FabF represents an important step in the development of new classes of antimicrobial agents targeting FabF for the treatment of listeriosis. PMID:28045020

  15. Microbiological Challenge Testing for Listeria Monocytogenes in Ready-to-Eat Food: A Practical Approach

    Science.gov (United States)

    Scarano, Christian; Ibba, Michela; Pala, Carlo; Spanu, Vincenzo; De Santis, Enrico Pietro Luigi

    2014-01-01

    Food business operators (FBOs) are the primary responsible for the safety of food they place on the market. The definition and validation of the product’s shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE) food that supports the growth of Listeria monocytogenes. Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food. PMID:27800369

  16. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Paul D Cotter

    Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

  17. Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.

    Science.gov (United States)

    Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A

    2016-01-01

    The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (ppH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

  18. The Never Ending Gale: its Role in Captain Robert F. Scott and his Companions' Deaths

    CERN Document Server

    Sienicki, Krzysztof

    2011-01-01

    Polar historians and enthusiasts are aware that toward the end of March 1912, Captain Robert F. Scott reported in his journal a meteorological event, which was extraordinary as far as its length and strength was concerned. This event was the gale which according to Captain Scott, lasted nine/ten days. Were the laws of physics suspended at the end of March 1912 in the Antarctic? I have shown that the near surface winds in the Antarctic are self-organized critically and that the winds over the continent form an ergodic system. I have presented an analysis of wind events in the proximity of Captain Scott's camp and at Ross Island. By comparing wind events at these locations, and performing an analysis of a gale's wind duration and strength at One Ton Dep\\^ot, I concluded that Captain Scott's wind record was highly inaccurate. I concluded that the nine/ten day gale described by Captain Scott, that lasted from March 21 to 29, did not take place. This result combined with my previous analysis of Captain Scott's tem...

  19. Antibiotic resistances in Listeria monocytogenes and Salmonella enterica isolated from foods with animal origin Resistencias a antibióticos en Listeria monocytogenes y Salmonella enterica aislados de alimentos de origen animal

    OpenAIRE

    Baltasar Balsalobre Hernández; Joaquín Hernández-Godoy

    2004-01-01

    Extensive use of antibiotics in both human and animal health and in cattle production has generated resistant microorganisms to common antibiotics. Resistances spread caused by human and animal therapeutic is well known, but we know poorly frecuency of resistant bacteria in foods with animal origin and destinated to human consumers. In this paper, sensitivity to nineteen antibiotics was investigated in Listeria monocytogenes and Salmonella enterica strains isolated from foods with animal orig...

  20. Comparative Genomics of the Listeria monocytogenes ST204 Subgroup

    Science.gov (United States)

    Fox, Edward M.; Allnutt, Theodore; Bradbury, Mark I.; Fanning, Séamus; Chandry, P. Scott

    2016-01-01

    The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates. PMID:28066377

  1. Comparative Genomics of the Listeria monocytogenes ST204 Subgroup.

    Science.gov (United States)

    Fox, Edward M; Allnutt, Theodore; Bradbury, Mark I; Fanning, Séamus; Chandry, P Scott

    2016-01-01

    The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates.

  2. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  3. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  4. Deciphering the intracellular metabolism of Listeria monocytogenes by mutant screening and modelling

    Directory of Open Access Journals (Sweden)

    Dandekar Thomas

    2010-10-01

    Full Text Available Abstract Background The human pathogen Listeria monocytogenes resides and proliferates within the cytoplasm of epithelial cells. While the virulence factors essentially contributing to this step of the infection cycle are well characterized, the set of listerial genes contributing to intracellular replication remains to be defined on a genome-wide level. Results A comprehensive library of L. monocytogenes strain EGD knockout mutants was constructed upon insertion-duplication mutagenesis, and 1491 mutants were tested for their phenotypes in rich medium and in a Caco-2 cell culture assay. Following sequencing of the plasmid insertion site, 141 different genes required for invasion of and replication in Caco-2 cells were identified. Ten in-frame deletion mutants were constructed that confirmed the data. The genes with known functions are mainly involved in cellular processes including transport, in the intermediary metabolism of sugars, nucleotides and lipids, and in information pathways such as regulatory functions. No function could be ascribed to 18 genes, and a counterpart of eight genes is missing in the apathogenic species L. innocua. Mice infection studies revealed the in vivo requirement of IspE (Lmo0190 involved in mevalonate synthesis, and of the novel ABC transporter Lmo0135-0137 associated with cysteine transport. Based on the data of this genome-scale screening, an extreme pathway and elementary mode analysis was applied that demonstrates the critical role of glycerol and purine metabolism, of fucose utilization, and of the synthesis of glutathione, aspartate semialdehyde, serine and branched chain amino acids during intracellular replication of L. monocytogenes. Conclusion The combination of a genetic screening and a modelling approach revealed that a series of transporters help L. monocytogenes to overcome a putative lack of nutrients within cells, and that a high metabolic flexibility contributes to the intracellular replication of

  5. Nanovesicle encapsulation of antimicrobial peptide P34: physicochemical characterization and mode of action on Listeria monocytogenes

    Science.gov (United States)

    da Silva Malheiros, Patrícia; Sant'Anna, Voltaire; Micheletto, Yasmine Miguel Serafini; da Silveira, Nadya Pesce; Brandelli, Adriano

    2011-08-01

    Antimicrobial peptide P34, a substance showing antibacterial activity against pathogenic and food spoilage bacteria, was encapsulated in liposomes prepared from partially purified soybean phosphatidylcholine, and their physicochemical characteristics were evaluated. The antimicrobial activity was estimated by agar diffusion assay using Listeria monocytogenes ATCC 7644 as indicator strain. A concentration of 3,200 AU/mL of P34 was encapsulated in nanovesicles and stocked at 4 °C. No significant difference ( p > 0.05) in the biological activity of free and encapsulated P34 was observed through 24 days. Size and PDI of liposomes, investigated by light scattering analysis, were on average 150 nm and 0.22 respectively. Zeta potential was -27.42 mV. There was no significant change ( p > 0.05) in the physicochemical properties of liposomes during the time of evaluation. The liposomes presented closed spherical morphology as visualized by transmission electron microscopy (TEM). The mode of action of liposome-encapsulated P34 under L. monocytogenes cells was investigated by TEM. Liposomes appeared to adhere but not fuse with the bacterial cell wall, suggesting that the antimicrobial is released from nanovesicles to act against the microorganism. The effect of free and encapsulated P34 was tested against L. monocytogenes, showing that free bacteriocin inhibited the pathogen more quickly than the encapsulated P34. Liposomes prepared with low-cost lipid showed high encapsulation efficiency for a new antimicrobial peptide and were stable during storage. The mode of action against the pathogen L. monocytogenes was characterized.

  6. Impact of Nutrient Restriction on the Structure of Listeria monocytogenes Biofilm Grown in a Microfluidic System

    Directory of Open Access Journals (Sweden)

    Tamazight Cherifi

    2017-05-01

    Full Text Available Biofilm formation by the pathogen Listeria monocytogenes is a major concern in food industries. The aim of this work was to elucidate the effect of nutrient limitation on both biofilm architecture and on the viability of the bacteria in microfluidic growth conditions. Biofilm formation by two L. monocytogenes strains was performed in a rich medium (BHI and in a 10-fold diluted BHI (BHI/10 at 30°C for 24 h by using both static conditions and the microfluidic system Bioflux. In dynamic conditions, biofilms grown in rich and poor medium showed significant differences as well in structure and in the resulting biovolume. In BHI/10, biofilm was organized in a knitted network where cells formed long chains, whereas in the rich medium, the observed structure was homogeneous cellular multilayers. Biofilm biovolume production in BHI/10 was significantly higher than in BHI in these dynamic conditions. Interestingly, biovolume of dead cells in biofilms formed under limited nutrient conditions (BHI/10 was significantly higher than in biofilms formed in the BHI medium. In the other hand, in static conditions, biofilm is organized in a multilayer cells and dispersed cells in a rich medium BHI and poor medium BHI/10 respectively. There was significantly more biomass in the rich medium compared to BHI/10 but no difference was noted in the dead/damaged subpopulation showing how L. monocytogenes biofilm could be affected by the growth conditions. This work demonstrated that nutrient concentration affects biofilm structure and the proportion of dead cells in biofilms under microfluidic condition. Our study also showed that limited nutrients play an important role in the structural stability of L. monocytogenes biofilm by enhancing cell death and liberating extracellular DNA.

  7. Control of Listeria monocytogenes on frankfurters by dipping in hops beta acids solutions.

    Science.gov (United States)

    Shen, Cangliang; Geornaras, Ifigenia; Kendall, Patricia A; Sofos, John N

    2009-04-01

    Hops beta acids (HBA) are parts of hops flowers used in beer brewing and have shown antilisterial activity in bacteriological broth. The U.S. Department of Agriculture, Food Safety and Inspection Service has approved HBA for use to control Listeria monocytogenes on ready-to-eat meat products. This study evaluated the effects of HBA as dipping solutions to control L. monocytogenes during storage of frankfurters. Frankfurters (two replicates and three samples each) were inoculated (1.9 +/- 0.1 log CFU/cm2) with L. monocytogenes (10-strain mixture), dipped (2 min, 25 +/- 2 degrees C) in HBA solutions (0.03, 0.06, and 0.10%) or distilled water, and then vacuum packaged and stored at 4 or 10 degrees C for up to 90 and 48 days, respectively. Samples were periodically analyzed for microbial survival and growth on tryptic soy agar plus 0.6% yeast extract and PALCAM agar. Dipping in HBA solutions caused immediate L. monocytogenes reductions (P < 0.05) of 1.3 to 1.6 log CFU/cm2, whereas distilled water reduced counts by 1.0 log CFU/cm2. Pathogen growth was completely suppressed (P < 0.05) for 30 to 50 (4 degrees C) or 20 to 28 (10 degrees C) days on frankfurters dipped in HBA solutions, with antilisterial effects increasing with higher concentrations (0.03 to 0.10%). Fitting the data with the Baranyi model confirmed that the lag-phase duration of the pathogen was extended, and the growth rate was decreased on samples dipped in HBA solutions. Therefore, HBA may be considered for use to improve the microbial safety of ready-to-eat meat products, provided that future studies show no adverse effects on sensory qualities and that their use is economically feasible.

  8. Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

    2015-08-01

    In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil.

  9. Retardation of Listeria monocytogenes growth in mozzarella cheese using antimicrobial sachets containing rosemary oil and thyme oil.

    Science.gov (United States)

    Han, Jung H; Patel, Dhaval; Kim, Jung Eun; Min, Sea C

    2014-11-01

    An antimicrobial sachet containing microcellular foam starch (MFS) with embedded rosemary oil and thyme oil was developed to reduce bacterial growth in shredded mozzarella cheese. The efficacy of the volatiles of oils at various concentrations in reducing Listeria monocytogenes as well as the release of the oils from the MFS have been also determined in this study. The cheese, inoculated with a cocktail of 5 strains of L. monocytogenes (approximately 3 log CFU/g), was packaged in a Nylon/EVOH/PE bag. A paper sachet containing MFS embedded with rosemary oil and thyme oil, separately or together, was inserted into the bag. Rosemary and thyme oil volatiles released from the sachet restricted the growth of L. monocytogenes, resulting in a 2.5 log CFU/g reduction on day 9 at 10 °C. The volatile oils also showed inhibitory effects on the growth of lactic acid bacteria (LAB) and total aerobic bacteria (TAB). After 15 d at 10 °C, the numbers of LAB and TAB in the samples containing the sachet with both oils experienced a 1.2 and 1.4 log CFU/g reduction, respectively, compared to untreated samples. Nonetheless, the sachet treatment produced a distinct odor, unfavorably received by the panelists. The results suggest the potential for application of the sachet system for the reduction of growth of L. monocytogenes, LAB, and TAB in food products.

  10. Control of Relative Air Humidity as a Potential Means to Improve Hygiene on Surfaces: A Preliminary Approach with Listeria monocytogenes.

    Science.gov (United States)

    Zoz, Fiona; Iaconelli, Cyril; Lang, Emilie; Iddir, Hayet; Guyot, Stéphane; Grandvalet, Cosette; Gervais, Patrick; Beney, Laurent

    2016-01-01

    Relative air humidity fluctuations could potentially affect the development and persistence of pathogenic microorganisms in their environments. This study aimed to characterize the impact of relative air humidity (RH) variations on the survival of Listeria monocytogenes, a bacterium persisting on food processing plant surfaces. To assess conditions leading to the lowest survival rate, four strains of L. monocytogenes (EGDe, CCL500, CCL128, and LO28) were exposed to different RH conditions (75%, 68%, 43% and 11%) with different drying kinetics and then rehydrated either progressively or instantaneously. The main factors that affected the survival of L. monocytogenes were RH level and rehydration kinetics. Lowest survival rates between 1% and 0.001% were obtained after 3 hours of treatment under optimal conditions (68% RH and instantaneous rehydration). The survival rate was decreased under 0.001% after prolonged exposure (16h) of cells under optimal conditions. Application of two successive dehydration and rehydration cycles led to an additional decrease in survival rate. This preliminary study, performed in model conditions with L. monocytogenes, showed that controlled ambient RH fluctuations could offer new possibilities to control foodborne pathogens in food processing environments and improve food safety.

  11. Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

    Directory of Open Access Journals (Sweden)

    Ivy Reid A

    2008-11-01

    Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

  12. Identification of a ferritin-like protein of Listeria monocytogenes as a mediator of β-lactam tolerance and innate resistance to cephalosporins

    Directory of Open Access Journals (Sweden)

    Krawczyk-Balska Agata

    2012-11-01

    Full Text Available Abstract Background The food-borne pathogen Listeria monocytogenes is the causative agent of listeriosis. The β-lactam antibiotics penicillin G and ampicillin are the current drugs of choice for the treatment of listerial infections. While isolates of L. monocytogenes are susceptible to these antibiotics, their action is only bacteriostatic and consequently, this bacterium is regarded as tolerant to β-lactams. In addition, L. monocytogenes has a high level of innate resistance to the cephalosporin family of β-lactams frequently used to treat sepsis of unknown etiology. Given the high mortality rate of listeriosis despite rational antibiotic therapy, it is important to identify genes that play a role in the susceptibility and tolerance of L. monocytogenes to β-lactams. Results The hly-based promoter trap system was applied to identify penicillin G-inducible genes of L. monocytogenes. The results of reporter system studies, verified by transcriptional analysis, identified ten penicillin G-inducible genes. The contribution of three of these genes, encoding a ferritin-like protein (fri, a two-component phosphate-response regulator (phoP and an AraC/XylS family transcriptional regulator (axyR, to the susceptibility and tolerance of L. monocytogenes to β-lactams was examined by analysis of nonpolar deletion mutants. The absence of PhoP or AxyR resulted in more rapid growth of the strains in the presence of sublethal concentration of β-lactams, but had no effect on the MIC values or the ability to survive a lethal dose of these antibiotics. However, the Δfri strain showed impaired growth in the presence of sublethal concentrations of penicillin G and ampicillin and a significantly reduced ability to survive lethal concentrations of these β-lactams. A lack of Fri also caused a 2-fold increase in the sensitivity of L. monocytogenes to cefalotin and cephradine. Conclusions The present study has identified Fri as an important mediator of

  13. Hyperinvasiveness and increased intercellular spread of Listeria monocytogenes sequence type 1 are independent of listeriolysin S, internalin F and internalin J1.

    Science.gov (United States)

    Rupp, Sebastian; Bärtschi, Michelle; Frey, Joachim; Oevermann, Anna

    2017-07-01

    Listeria monocytogenes is a genetically heterogeneous species, which is divided into evolutionary lineages and clonal complexes (CCs). Not all L. monocytogenes isolates are equally likely to cause disease, with CC1, and in particular sequence type (ST) 1, being the most prevalent complex in human and ruminant infections and more specifically in neurolisteriosis. While the major factors that determine neurotropism are unknown, the L. monocytogenes CC1 strains harbour listeriolysin S (lls) and particular alleles of internalin (inl) F and inlJ, which are not present in CCs commonly isolated from food and the environment. The aim of this study was to analyse the role of these factors in cellular infection. A ST1 field strain (JF5203) from CC1 isolated from a bovine rhombencephalitis case was used to create deletion mutants. These were tested alongside the parental strain and EGD-e (CC9), in different culture models representing L. monocytogenes targets (neurons, microglia, placenta, intestine and macrophages). The phenotype was assessed by quantification of c.f.u. from cell lysates and immunofluorescence analysis. Compared to EGD-e, the ST1 strain JF5203 was hyperinvasive and exhibited increased intercellular spread. However, deletion of llsB, inlF or inlJ1, had no significant effect on infection or growth in the culture models tested. Our results underline the importance of using relevant clinical strains when investigating L. monocytogenes virulence. We show that despite the association with CC1, llsB, inlF and inlJ1 are not involved in the hyperinvasiveness and efficient intercellular spread of ST1 in various cell types.

  14. 78 FR 23901 - Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-04-23

    ... Food Safety and Inspection Service Interagency Risk Assessment--Listeria monocytogenes in Retail... risk assessment (QRA), ``Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens... and on the FSIS Web site at http://www.fsis.usda.gov/PDF/Listeria-Transcript_062309.pdf ). II....

  15. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  16. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  17. Application Progress of Recombinant Attenuated Listeria monocytogenes in Tumor Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    Yin Xiaojiao; Bai Lin; Yang Xu

    2015-01-01

    Much progress of application of bacterial vaccine in treatment and prevention of tumor was acquired,which showed broad prospect in clinical study of animals and humans. Listeria monocytogenes( L. monocytogenes) was considered much important by virtue of its special characteristic of biology and immunology.L. monocytogenes was ingested by professional or part-time phagocytes,survived and proliferated in the phagocytes under synergism of toxic factor secreted by itself,meanwhile,the cellular and humoral immune response was induced. Antigenic gene of specific tumor was loaded in the attenuated L. monocytogenes,which can enhance immune response of host cells. Effective cell targeted to enter tumor tissue and acted on tumor cells to induce apoptosis of tumor cells. Tumor degenerated not easy to reappear. Therefore,recombinant attenuated L. monocytogenes was a safe and effective anti-cancer vaccine vector. Now the work of researchers mainly focuses on solving practical problem in clinical application. Biological characteristics of L. monocytogenes,feasibility and superiority of L. monocytogenes as targeted vaccine vector,problem and prospect of L. monocytogenes in clinical application of anti-tumor were reviewed in this paper.

  18. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health concer

  19. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  20. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  1. Listeria monocytogenes efficiently invades Caco-2 cells after low-temperature storage in broth and on deli meat.

    Science.gov (United States)

    Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne

    2010-09-01

    The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p 0.05) in invasiveness after 7 days at 10 degrees C in BHI broth or on sausage, whereas a slight increase (p < 0.05) was observed after incubation on ham for 2 and 4 weeks compared to that in BHI broth. Most importantly, our results show that L. monocytogenes efficiently invade Caco-2 cells even after 4 weeks of storage at chilled temperature. This is highly relevant for safety assessment of this organism in food as these conditions reflect storage of ready-to-eat food products in domestic refrigerators.

  2. Rapid differentiation of Listeria monocytogenes epidemic clones III and IV and their intact compared with heat-killed populations using Fourier transform infrared spectroscopy and chemometrics.

    Science.gov (United States)

    Nyarko, Esmond B; Puzey, Kenneth A; Donnelly, Catherine W

    2014-06-01

    The objectives of this study were to determine if Fourier transform infrared (FT-IR) spectroscopy and multivariate statistical analysis (chemometrics) could be used to rapidly differentiate epidemic clones (ECs) of Listeria monocytogenes, as well as their intact compared with heat-killed populations. FT-IR spectra were collected from dried thin smears on infrared slides prepared from aliquots of 10 μL of each L. monocytogenes ECs (ECIII: J1-101 and R2-499; ECIV: J1-129 and J1-220), and also from intact and heat-killed cell populations of each EC strain using 250 scans at a resolution of 4 cm(-1) in the mid-infrared region in a reflectance mode. Chemometric analysis of spectra involved the application of the multivariate discriminant method for canonical variate analysis (CVA) and linear discriminant analysis (LDA). CVA of the spectra in the wavelength region 4000 to 600 cm(-1) separated the EC strains while LDA resulted in a 100% accurate classification of all spectra in the data set. Further, CVA separated intact and heat-killed cells of each EC strain and there was 100% accuracy in the classification of all spectra when LDA was applied. FT-IR spectral wavenumbers 1650 to 1390 cm(-1) were used to separate heat-killed and intact populations of L. monocytogenes. The FT-IR spectroscopy method allowed discrimination between strains that belong to the same EC. FT-IR is a highly discriminatory and reproducible method that can be used for the rapid subtyping of L. monocytogenes, as well as for the detection of live compared with dead populations of the organism. Fourier transform infrared (FT-IR) spectroscopy and multivariate statistical analysis can be used for L. monocytogenes source tracking and for clinical case isolate comparison during epidemiological investigations since the method is capable of differentiating epidemic clones and it uses a library of well-characterized strains. The FT-IR method is potentially less expensive and more rapid compared to genetic

  3. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Directory of Open Access Journals (Sweden)

    Shi Wu

    Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  4. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  5. Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Gram, Lone

    2012-01-01

    Listeria monocytogenes is a food-borne pathogen that can persist for years in food processing plants. It has been hypothesized that this could be due to the development of tolerance or resistance to the disinfectants used. The purpose of the present study was to determine whether biocide resistance...... of tolerance, the populations adapted to Triquart SUPER were still sensitive to killing with this disinfectant at 0.0125%, which is much lower than in-use concentrations (1–5%). Our data are in agreement with the fact that finding strains with high acquired resistance to disinfectants is rare...

  6. Resistance to Biocides in Listeria monocytogenes Collected in Meat-Processing Environments

    Science.gov (United States)

    Conficoni, Daniele; Losasso, Carmen; Cortini, Enzo; Di Cesare, Andrea; Cibin, Veronica; Giaccone, Valerio; Corno, Gianluca; Ricci, Antonia

    2016-01-01

    The emergence of microorganisms exerting resistance to biocides is a challenge to meat-processing environments. Bacteria can be intrinsically resistant to biocides but resistance can also be acquired by adaptation to their sub-lethal concentrations. Moreover, the presence of biocide resistance determinants, which is closely linked to antibiotic resistance determinants, could lead to co-selection during disinfection practices along the food chain, and select cross-resistant foodborne pathogens. The purpose of this work was to test the resistance of wild strains of Listeria monocytogenes, isolated from pork meat processing plants, toward benzalkonium chloride (BC), used as proxy of quaternary ammonium compounds. Furthermore, the expression of two non-specific efflux pumps genes (lde and mdrL) under biocide exposure was evaluated. L. monocytogenes were isolated from five processing plants located in the Veneto region (northeast of Italy) before and after cleaning and disinfection (C&D) procedures. A total of 45 strains were collected: 36 strains before and nine after the C&D procedures. Collected strains were typed according to MLST and ERIC profiles. Strains sampled in the same site, isolated before, and after the C&D procedures and displaying the same MLST and ERIC profiles were tested for their sensitivity to different concentrations of BC, in a time course assay. The expression of non-specific efflux pumps was evaluated at each time point by qPCR using tufA gene as housekeeping. A differential expression of the two investigated genes was observed: lde was found to be more expressed by the strains isolated before C&D procedures while its expression was dose-dependent in the case of the post C&D procedures strain. On the contrary, the expression of mdrL was inhibited under low biocidal stress (10 ppm BC) and enhanced in the presence of high stress (100 ppm BC). These findings suggests a possible role for C&D procedures to select L. monocytogenes persisters, pointing

  7. Resistance to biocides in Listeria monocytogenes collected in meat-processing environments

    Directory of Open Access Journals (Sweden)

    Daniele Conficoni

    2016-10-01

    Full Text Available The emergence of microorganisms exerting resistance to biocides is a challenge to meat-processing environments. Bacteria can be intrinsically resistant to biocides but resistance can also be acquired by adaptation to their sub-lethal concentrations. Moreover the presence of biocide resistance determinants, which is closely linked to antibiotic resistance determinants, could lead to co-selection during disinfection practices along the food chain and select cross-resistant foodborne pathogens. The purpose of this work was to test the resistance of wild strains of Listeria monocytogenes, isolated from pork meat processing plants, towards benzalkonium chloride (BC, used as proxy of quaternary ammonium compounds. Furthermore, the expression of two non-specific efflux pumps genes (lde and mdrL under biocide exposure was evaluated. Listeria monocytogenes were isolated from five processing plants located in the Veneto region (northeast of Italy before and after cleaning and disinfection (C&D procedures. A total of 45 strains were collected: 36 strains before and 9 after the C&D procedures. Collected strains were typed according to MLST and ERIC profiles. Strains sampled in the same site, isolated before and after the C&D procedures and displaying the same MLST and ERIC profiles were tested for their sensitivity to different concentrations of BC, in a time course assay. The expression of non-specific efflux pumps was evaluated at each time point by qPCR using tufA gene as housekeeping. A differential expression of the two investigated genes was observed: lde was found to be more expressed by the strains isolated before C&D procedures while its expression was dose-dependent in the case of the post C&D procedures strain. On the contrary, the expression of mdrL was inhibited under low biocidal stress (10 ppm BC and enhanced in the presence of high stress (100 ppm BC. These findings suggests a possible role for C&D procedures to select Listeria monocytogenes

  8. Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources.

    Directory of Open Access Journals (Sweden)

    Swapnil P Doijad

    Full Text Available A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26% strains as weak, 27 (27.55% strains as moderate, and 9 (9.18% strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015 was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids.

  9. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-01-01

    - and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased...... EGD-e. The two bacterial strains were grown in mono- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional...... during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus...

  10. A multiple-locus variable-number tandem repeat analysis (MLVA) of Listeria monocytogenes isolated from Norwegian salmon-processing factories and from listeriosis patients.

    Science.gov (United States)

    Lunestad, B T; Truong, T T T; Lindstedt, B-A

    2013-10-01

    The objective of this study was to characterize Listeria monocytogenes isolated from farmed Atlantic salmon (Salmo salar) and the processing environment in three different Norwegian factories, and compare these to clinical isolates by multiple-locus variable-number tandem repeat analysis (MLVA). The 65 L. monocytogenes isolates obtained gave 15 distinct MLVA profiles. There was great heterogeneity in the distribution of MLVA profiles in factories and within each factory. Nine of the 15 MLVA profiles found in the fish-associated isolates were found to match human profiles. The MLVA profile 07-07-09-10-06 was the most common strain in Norwegian listeriosis patients. L. monocytogenes with this profile has previously been associated with at least two known listeriosis outbreaks in Norway, neither determined to be due to fish consumption. However, since this profile was also found in fish and in the processing environment, fish should be considered as a possible food vehicle during sporadic cases and outbreaks of listeriosis.

  11. The Agr communication system provides a benefit to the populations of Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Piveteau, Pascal

    2014-01-01

    In this study, we investigated whether the Agr communication system of the pathogenic bacterium Listeria monocytogenes was involved in adaptation and competitiveness in soil. Alteration of the ability to communicate, either by deletion of the gene coding the response regulator AgrA (response-negative mutant) or the signal pro-peptide AgrD (signal-negative mutant), did not affect population dynamics in soil that had been sterilized but survival was altered in biotic soil suggesting that the Agr system of L. monocytogenes was involved to face the complex soil biotic environment. This was confirmed by a set of co-incubation experiments. The fitness of the response-negative mutant was lower either in the presence or absence of the parental strain but the fitness of the signal-negative mutant depended on the strain with which it was co-incubated. The survival of the signal-negative mutant was higher when co-cultured with the parental strain than when co-cultured with the response-negative mutant. These results showed that the ability to respond to Agr communication provided a benefit to listerial cells to compete. These results might also indicate that in soil, the Agr system controls private goods rather than public goods.

  12. Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria.

    Science.gov (United States)

    Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto

    2016-01-01

    The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

  13. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  14. BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Lea

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  15. IL-17A-producing resident memory γδ T cells orchestrate the innate immune response to secondary oral Listeria monocytogenes infection.

    Science.gov (United States)

    Romagnoli, Pablo A; Sheridan, Brian S; Pham, Quynh-Mai; Lefrançois, Leo; Khanna, Kamal M

    2016-07-26

    Memory γδ T cells are important for the clearance of Listeria monocytogenes infection in the intestinal mucosa. However, the mechanisms by which memory γδ T cells provide protection against secondary oral infection are poorly understood. Here we used a recombinant strain of L. monocytogenes that efficiently invades the intestinal epithelium to show that Vγ4(+) memory γδ T cells represent a resident memory (Trm) population in the mesenteric lymph nodes (MLNs). The γδ Trm exhibited a remarkably static pattern of migration that radically changed following secondary oral L. monocytogenes infection. The γδ Trms produced IL-17A early after rechallenge and formed organized clusters with myeloid cells surrounding L. monocytogenes replication foci only after a secondary oral infection. Antibody blocking studies showed that in addition to IL-17A, the chemokine receptor C-X-C chemokine receptor 3 (CXCR3) is also important to enable the local redistribution of γδ Trm cells and myeloid cells specifically near the sites of L. monocytogenes replication within the MLN to restrict bacterial growth and spread. Our findings support a role for γδ Trms in orchestrating protective immune responses against intestinal pathogens.

  16. Package systems and storage times serve as postlethality controls for Listeria monocytogenes on whole-muscle beef jerky and pork and beef smoked sausage sticks.

    Science.gov (United States)

    Lobaton-Sulabo, April Shayne S; Axman, Tyler J; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Uppal, Kamaldeep K; Barry, Bruce; Higgins, James J

    2011-02-01

    To validate how packaging and storage reduces Listeria monocytogenes on whole-muscle beef jerky and smoked pork and beef sausage sticks, four packaging systems (heat sealed [HS] without vacuum, heat sealed with oxygen scavenger, nitrogen flushed with oxygen scavenger [NFOS], and vacuum) and four ambient temperature storage times were evaluated. Commercially available whole-muscle beef jerky and smoked pork and beef sausage sticks were inoculated with a five-strain L. monocytogenes cocktail, packaged, and then stored at 25.5 °C until enumerated for L. monocytogenes at 0, 24, 48, and 72 h and 30 days after packaging. The interaction of packaging and storage time affected L. monocytogenes reduction on jerky, but not on sausage sticks. A >2-log CFU/cm(2) reduction was achieved on sausage sticks after 24 h of storage, regardless of package type, while jerky had 2 log CFU/cm(2), except for NFOS (1.22-log CFU/cm(2) reduction). Processors could package beef jerky in HS packages with oxygen scavenger or vacuum in conjunction with a 24-h holding time as an antimicrobial process to ensure a >1-log CFU/cm(2) L. monocytogenes reduction or use a 48-h holding time for HS- or NFOS-packaged beef jerky. A >3-log CFU/cm(2) mean reduction was observed for all beef jerky and sausage stick packaging systems after 30 days of 25.5 °C storage.

  17. Prevalence of Listeria monocytogenes in Idiazabal cheese Prevalencia de Listeria monocytogenes en queso Idiazabal

    Directory of Open Access Journals (Sweden)

    E. Arrese

    2012-12-01

    Full Text Available Introduction: Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. Objective: To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. Methodology: A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. Results and conclusion: All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.Introducción: Listeria monocytogenes se ha asociado a quesos elaborados a partir de leche cruda, lo que supone un importante riesgo de salud pública debido a la listeriosis. Objetivo: Estudiar la prevalencia y los niveles de L. monocytogenes en quesos Idiazabal semi-curados de distintos productores del País Vasco, a nivel de consumidor. Metodología: Se analizaron 51 muestras de queso Idiazabal procedentes de 10 establecimientos de venta al público; el muestreo fue aleatorio y estratificado. Los análisis se hicieron según el método de detección y de enumeración del procedimiento estandarizado ISO 11290-1. Resultados y conclusión: Todas las muestras dieron negativo para L. monocytogenes. Sin embargo, el 9,8% dio positivo para Listeria spp., distinta de L. monocytogenes. Las muestras positivas procedían de dos marcas, dos eran quesos naturales y tres ahumados. La presencia de Listeria spss. sugiere que el procesado del queso y la higiene durante el ordeño o durante la fabricación podr

  18. Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

    Science.gov (United States)

    Jahan, M; Holley, R A

    2016-04-01

    Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

  19. InlA Promotes Dissemination of Listeria monocytogenes to the Mesenteric Lymph Nodes during Food Borne Infection of Mice

    Science.gov (United States)

    Bou Ghanem, Elsa N.; Jones, Grant S.; Myers-Morales, Tanya; Patil, Pooja D.; Hidayatullah, Achmad N.; D'Orazio, Sarah E. F.

    2012-01-01

    Intestinal Listeria monocytogenes infection is not efficient in mice and this has been attributed to a low affinity interaction between the bacterial surface protein InlA and E-cadherin on murine intestinal epithelial cells. Previous studies using either transgenic mice expressing human E-cadherin or mouse-adapted L. monocytogenes expressing a modified InlA protein (InlAm) with high affinity for murine E-cadherin showed increased efficiency of intragastric infection. However, the large inocula used in these studies disseminated to the spleen and liver rapidly, resulting in a lethal systemic infection that made it difficult to define the natural course of intestinal infection. We describe here a novel mouse model of oral listeriosis that closely mimics all phases of human disease: (1) ingestion of contaminated food, (2) a distinct period of time during which L. monocytogenes colonize only the intestines, (3) varying degrees of systemic spread in susceptible vs. resistant mice, and (4) late stage spread to the brain. Using this natural feeding model, we showed that the type of food, the time of day when feeding occurred, and mouse gender each affected susceptibility to L. monocytogenes infection. Co-infection studies using L. monocytogenes strains that expressed either a high affinity ligand for E-cadherin (InlAm), a low affinity ligand (wild type InlA from Lm EGDe), or no InlA (ΔinlA) showed that InlA was not required to establish intestinal infection in mice. However, expression of InlAm significantly increased bacterial persistence in the underlying lamina propria and greatly enhanced dissemination to the mesenteric lymph nodes. Thus, these studies revealed a previously uncharacterized role for InlA in facilitating systemic spread via the lymphatic system after invasion of the gut mucosa. PMID:23166492

  20. Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes.

    Science.gov (United States)

    Schirmer, B C T; Heir, E; Møretr