Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

Directory of Open Access Journals (Sweden)

Cronin Michael

2008-06-01

Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

Inactivation of Listeria monocytogenes in milk by pulsed electric field.

Science.gov (United States)

Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

1998-09-01

Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

NARCIS (Netherlands)

Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

2013-01-01

The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

Science.gov (United States)

Lu, Chunye; Marjanovic, Olivera; Kiang, David

2017-01-01

ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

Synergistic effect of high pressure processing and Lactobacillus casei antimicrobial activity against pressure resistant Listeria monocytogenes.

Science.gov (United States)

Chung, Hyun-Jung; Yousef, Ahmed E

2010-09-30

The purpose of this study was to evaluate combinations of high pressure processing (HPP) and Lactobacillus casei antimicrobial activity against Listeria monocytogenes strains with variation in pressure resistance in culture and in a food model. In culture, combination of HPP (350 MPa, for 1-20 min) and Lb. casei cell extract (CE, 32 CEAU/ml) showed a significant synergistic bactericidal effect (P5 log(10)CFU/ml. Synergy between CE and HPP was most evident in the pressure-resistant strain, OSY-8578. Similar result was observed in meat products where high pressure (500 MPa for 1 min), and high-activity CE (100 CEAU/g) caused >5 log reduction in the viability of L. monocytogenes Scott A. The combination treatment resulted in the absence of peaks associated with cellular components in DSC thermogram suggesting that the presence of CE may have caused a considerable damage to cellular components during the high pressure treatment. Copyright 2010 Elsevier B.V. All rights reserved.

Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

Science.gov (United States)

Guenther, Susanne; Loessner, Martin J

2011-03-01

Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

Science.gov (United States)

Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

2016-02-02

The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

Directory of Open Access Journals (Sweden)

abazar pournajaf

2013-09-01

Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

Science.gov (United States)

Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-07-04

Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

Bacteriocin-like substances of Lactobacillus curvatus P99: characterization and application in biodegradable films for control of Listeria monocytogenes in cheese.

Science.gov (United States)

Marques, Juliana de Lima; Funck, Graciele Daiana; Dannenberg, Guilherme da Silva; Cruxen, Claudio Eduardo Dos Santos; Halal, Shanise Lisie Mello El; Dias, Alvaro Renato Guerra; Fiorentini, Ângela Maria; Silva, Wladimir Padilha da

2017-05-01

The aim of this study was to evaluate the effectiveness of a biodegradable film, with antimicrobial metabolites produced by Lactobacillus curvatus P99 incorporated, targeting the control of Listeria monocytogenes in sliced "Prato" cheese. Tests were performed to evaluate the spectrum of action of cell-free supernatant (CFS) of P99 against different microorganisms, as well as to detect the minimum inhibitory (MIC) and bactericidal (MBC) concentrations against L. monocytogenes Scott A. The detection of genes that encode for the production of bacteriocins and evaluation of their expression were performed. Antimicrobial films were prepared, followed by in vitro and in situ analysis. The MIC and MBC of CFS against L. monocytogenes Scott A was 15.6 μL/mL and 62.5 μL/mL, respectively. Lactobacillus curvatus P99 presented two genes coding for the bacteriocins, which were expressed. Films with added MBC showed activity against different indicator microorganisms and were able to control L. monocytogenes Scott A when used in sliced "Prato" cheese. Copyright © 2016 Elsevier Ltd. All rights reserved.

Control of Listeria monocytogenes in goat's milk and goat's jben by the bacteriocinogenic Enterococcus faecium F58 strain.

Science.gov (United States)

Achemchem, Fouad; Abrini, Jamal; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes

2006-10-01

The bacteriocinogenic Enterococcus faecium F58 strain, a natural goat's jben cheese isolate, lacks decarboxylase activity involved in most biogenic amine formation. It was also sensitive to 13 antibiotics assayed and free of virulence and vancomycin resistance genes. The F58 strain reached the stationary phase after 12 h of growth in sterile goat's milk, and the production of enterocin F-58 (Ent L50) was first detected after 48 h (400 AU/ml), thereafter remaining stable up to 5 days. The effectiveness of the F58 strain in controlling Listeria monocytogenes serovar 4b in reduced fat and whole goat's milk, and in goat's jben has been examined. Coculture experiments of F58-L. monocytogenes in both types of milk demonstrated that listeriae were not eliminated, although reductions by 1 to 4 log units were found. Nevertheless, when the F58 strain was previously inoculated in whole milk and left to grow for 12 h before contamination, the pathogen was completely eliminated after 130 h of coculture. Production of jben cheese contaminated with L. monocytogenes prior to packaging, using preparations of F58-producer strain, caused a significant decrease in the number of viable listeriae, which were undetectable after 1 week of cheese storage at 22 degrees C. Altogether, results from this study suggest that E. faecium F58 strain may be used as an adjunct culture in cheese to control contamination and growth of L. monocytogenes by in situ enterocin production, thus providing an additional hurdle to enhance control of this pathogen.

Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada

DEFF Research Database (Denmark)

Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.

2017-01-01

needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...

Influence of Organic Material and Biofilms on Disinfectant Efficacy Against Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hilda Nyati

2012-04-01

Full Text Available The effects of organic material and biofilm formation on the efficacy of Suma Tab D4 chlorine tablets and Suma Bac D10 quaternary ammonium compound (QAC against Listeria monocytogenes was determined in suspension and on stainless steel and polystyrene surfaces according to standard disinfectant test methodology. Exposure to 200 and 740 mg L-1 QAC and to 150 mg L-1 active chlorine resulted in a > 5.0 log10 CFU mL-1 and > 5.0 log10 CFU/coupon reduction of six L. monocytogenes strains within one minute, in suspension tests, and on stainless steel surfaces, respectively. Additionally, there was a reduction by as much as 5 log10 CFU/coupon or 5 log10 CFU/well of reference strains EGDe and Scott A biofilms within five minutes on stainless steel and polystyrene surfaces. Organic material, added as bovine serum albumin at 0.3% (w/v completely prevented the inactivation of L. monocytogenes in 150 mg L-1 chlorine, while reductions of only 0.6 +- 0.1 log10 CFU mL-1 were recorded in the presence of UHT milk at 3% (v/v. In contrast, reductions of 5 log10 CFU mL-1 were recorded within one minute on exposure to 740 mg L-1 QAC in the presence of 0.3% (w/v bovine serum albumin and within two minutes in the presence of 20 % (v/v UHT milk. Although Suma D4 chlorine tablets and Suma Bac D10 QAC are effective listericidal agents at recommended concentrations, Suma Tab D4 chlorine efficacy against L. monocytogenes is impaired by the presence of low concentrations of organic material, while Suma Bac D10 QAC maintains its listericidal activity in high organic loads.

Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

Science.gov (United States)

Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

2018-06-20

Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

Typing and Evaluation of the Genetic Relatedness of Listeria monocytogenes Strains Isolated from Food Samples by the Multiple-Locus Variable number Tandem Repeat Analysis (MLVA

Directory of Open Access Journals (Sweden)

Behrooz Sadeghi kalani

2014-12-01

Full Text Available Background and Aim:Listeria monocytogenes cause listeriosis and fatal infections in humans. The aim of this study was typing and evaluation of the genetic relatedness of L. monocytogenes strains from food samples using MLVA technique. Materials and Methods: 317 food samples were collected from 2009 to 2013 in Tehran,Iran. After final diagnosis of L. monocytogenes DNA was extracted to perform of MLVA technique, and also PCR products were analyzed by Gene Tools software. The number of tandem repeats was determined by using special equation for each selected locus. Also typing of strains was done. Results: 24 samples of 317 food samples were positive for L. monocytogenes using standard laboratory techniques. A total 13 different types were determined by MLVA technique that type 2 and type 3 were the most abundant types by 6 and 4 strains, respectively. Conclusions: The results of this study showed the presence of L. monocytogenes in dairy products and meat samples, therefore all people, especially pregnant women should observe health tips when using these products. The results of typing showed that L. monocytogenes strains from different sources can have the same origin. MLVA technique is easy with high accuracy and this method can be used in typing and evaluation of the genetic relatedness of L. monocytogenes for determination the source of contamination.

Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

Science.gov (United States)

Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

2015-02-06

Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

Influence of flow direction and flow rate on the initial adhesion of seven Listeria monocytogenes strains to fine polished stainless steel

DEFF Research Database (Denmark)

Skovager, Anne; Whitehead, Kathryn; Siegumfeldt, Henrik

2012-01-01

The effects of flow direction and shear stress on the adhesion of different strains of Listeria monocytogenes to fine polished stainless steel under liquid flow conditions were investigated. Furthermore, the relationship between cell surface properties and cell size and the initial adhesion rate...... (IAR) was studied. A method, including fluorescence microscopy and a flow perfusion system, was developed and used to examine the real-time initial cell adhesion of different L. monocytogenes species in situ to opaque surfaces under flow conditions. The results demonstrated that shear stress...... was the determining factor for the initial adhesion of L. monocytogenes under flow conditions. The flow direction in relation to the orientation of surface features (the scratches) could be disregarded. IARs were dependent on the shear stress and strain type. The strain EGDe, which had the lowest IAR, had the largest...

Effect of peracetic acid on biofilms formed by Listeria monocytogenes strains isolated from a Brazilian cheese processing plant

Directory of Open Access Journals (Sweden)

Sarah Hwa In Lee

2017-10-01

Full Text Available ABSTRACT This study aimed to investigate the effect of peracetic acid (PAA, 0.5% on adherent cells of three strains of Listeria monocytogenes strains belonging to serotypes 4b and 1/2b that had been previously isolated from the environment of a Brazilian cheese plant. The assays were conducted using polystyrene microplates and stainless steel coupons and the adhered cells were treated with PAA for 60, 120 and 180 s. On stainless steel, biofilms were partially inactivated by PAA after 60 s and almost 100% of the cells were damaged within 180 s using epifluorescence microscopy with LIVE/DEAD® staining. On polystyrene microplates, PAA decreased (P<0.05 biofilm biomass produced by the three L. monocytogenes isolates at 60 s, when compared with controls (no PAA treatment. However, PAA did not completely eliminate L. monocytogenes cells on polystyrene microplates (decreasing 1.8-2.5 log cycles after treatment with PAA for 180 s. The correct concentration and contact time of PAA is critical for eliminating biofilms formed by L. monocytogenes on stainless steel surfaces, although further studies are needed for defining efficient PAA treatments to remove adherent cells of this pathogen on plastic polymers.

Listeria monocytogenes strains encoding premature stop codons in inlA invade mice and guinea pig fetuses in orally dosed dams

DEFF Research Database (Denmark)

Holch, Anne; Ingmer, Hanne; Licht, Tine Rask

2013-01-01

potential of a group of food-processing persistent L. monocytogenes strains encoding a premature stop codon in inlA (encoding internalin A) by using two orally dosed models, pregnant mice and pregnant guinea pigs. A food-processing persistent strain of L. monocytogenes invaded placentas (n = 58; 10...... % positive) and fetuses (3 % positive) of pregnant mice (n = 9 animals per strain), similar to a genetically manipulated murinized strain, EGD-e InlAm* (n = 61; 3 and 2 %, respectively). In pregnant guinea pigs (n = 9 animals per bacterial strain), a maternofetal strain (from a human fetal clinical fatal...... case) was isolated from 34 % of placenta samples (n = 50), whereas both food-processing persistent strains were found in 5 % of placenta samples (n = 36 or 37). One of the food-processing persistent strains, N53-1, was found in up to 8 % of guinea pig fetal liver and brain samples, whereas...

Gene Transcription and Virulence Potential of Listeria monocytogenes Strains After Exposure to Acidic and NaCl Stress

DEFF Research Database (Denmark)

Olesen, Inger; Vogensen, Finn Kvist; Jespersen, Lene

2009-01-01

transcription were observed both after exposure to shock (six genes) and after long-term adaptation to stress (18 genes). In the shock experiments, a transient induction of clpC and clpE was seen for both strains, while transient induction of sigB, inlA, and inlB was observed for strain 4140 only; actA was only...... induced in EGD-e after NaCl shock. The longterm stress experiments were included to imitate the stress conditions encountered by L. monocytogenes when present in food products. Long-term adaptation of EGD-e to acidic stress induced transcription of iap and repressed flaA, while genes related to stress......Gene transcription and virulence potential of two strains of Listeria monocytogenes, EGD-e and 4140, were compared by quantitative real-time polymerase chain reaction and in a Caco-2 in vitro model after exposure to acidic (pH 5.5) and NaCl (4.5% w=v) stress. Strain-dependent differences in gene...

Listeria monocytogenes Strains Underrepresented during Selective Enrichment with an ISO Method Might Dominate during Passage through Simulated Gastric Fluid and In Vitro Infection of Caco-2 Cells

Science.gov (United States)

Zilelidou, Evangelia; Karmiri, Christina-Vasiliki; Zoumpopoulou, Georgia; Mavrogonatou, Eleni; Kletsas, Dimitris; Tsakalidou, Effie; Papadimitriou, Konstantinos; Drosinos, Eleftherios

2016-01-01

ABSTRACT Various Listeria monocytogenes strains may contaminate a single food product, potentially resulting in simultaneous exposure of consumers to multiple strains. However, due to bias in strain recovery, L. monocytogenes strains isolated from foods by selective enrichment (SE) might not always represent those that can better survive the immune system of a patient. We investigated the effect of cocultivation in tryptic soy broth with 0.6% yeast extract (TSB-Y) at 10°C for 8 days on (i) the detection of L. monocytogenes strains during SE with the ISO 11290-1:1996/Amd 1:2004 protocol and (ii) the in vitro virulence of strains toward the Caco-2 human colon epithelial cancer cell line following exposure to simulated gastric fluid (SGF; pH 2.0)-HCl (37°C). We determined whether the strains which were favored by SE would be effective competitors under the conditions of challenges related to gastrointestinal passage of the pathogen. Interstrain competition of L. monocytogenes in TSB-Y determined the relative population of each strain at the beginning of SE. This in turn impacted the outcome of SE (i.e., favoring survival of competitors with better fitness) and the levels exposed subsequently to SGF. However, strong growth competitors could be outcompeted after SGF exposure and infection of Caco-2 cells by strains outgrown in TSB-Y and underdetected (or even missed) during enrichment. Our data demonstrate a preferential selection of certain L. monocytogenes strains during enrichments, often not reflecting a selective advantage of strains during infection. These findings highlight a noteworthy scenario associated with the difficulty of matching the source of infection (food) with the L. monocytogenes isolate appearing to be the causative agent during listeriosis outbreak investigations. IMPORTANCE This report is relevant to understanding the processes involved in selection and prevalence of certain L. monocytogenes strains in different environments (i.e., foods or

Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction.

Science.gov (United States)

Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza

2016-01-01

This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

Directory of Open Access Journals (Sweden)

Hurtado Ana

2009-01-01

Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

One group of genetically similar Listeria monocytogenes strains frequently dominates and persists in several fish slaughter- and smokehouses

DEFF Research Database (Denmark)

Wulff, Gitte; Gram, Lone; Ahrens, Peter

2006-01-01

Contamination of foods with the human pathogen Listeria monocytogenes may occur during processing, and the purpose of this study was to determine whether genetically similar strains colonize different processing plants or whether specific persistent strains are unique to each processing plant. We...... smokehouses and two slaughterhouses and was predominant in three of these plants. A subset of 35 strains was also analyzed by amplified fragment length polymorphism typing, which confirmed the genetic similarity of the groups. Moreover, strains of the dominant RAPD type were indistinguishable from strains...

Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

Abazar Pournajaf

Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

Stress Survival Islet 2, Predominantly Present in Listeria monocytogenes Strains of Sequence Type 121, Is Involved in the Alkaline and Oxidative Stress Responses.

Science.gov (United States)

Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin

2017-08-15

The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation

The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

Science.gov (United States)

Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

2018-06-13

The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

Population Genetic Structure of Listeria monocytogenes Strains Isolated From the Pig and Pork Production Chain in France

Directory of Open Access Journals (Sweden)

Benjamin Félix

2018-04-01

Full Text Available Listeria monocytogenes is an ubiquitous pathogenic bacterium, transmissible to humans through the consumption of contaminated food. The pork production sector has been hit hard by a series of L. monocytogenes-related food poisoning outbreaks in France. An overview of the diversity of strains circulating at all levels of the pork production chain, from pig farming (PF to finished food products (FFP, is needed to identify the contamination routes and improve food safety. Until now, no typing data has been available on strains isolated across the entire pig and pork production chain. Here, we analyzed the population genetic structure of 687 L. monocytogenes strains isolated over the last 20 years in virtually all the French départements from three compartments of this production sector: PF, the food processing environment (FPE, and FFP. The genetic structure was described based on Multilocus sequence typing (MLST clonal complexes (CCs. The CCs were obtained by mapping the PFGE profiles of the strains. The distribution of CCs was compared firstly between the three compartments and then with CCs obtained from 1106 strains isolated from other food production sectors in France. The predominant CCs of pig and pork strains were not equally distributed among the three compartments: the CC37, CC59, and CC77 strains, rarely found in FPE and FFP, were prevalent in PF. The two most prevalent CCs in the FPE and FFP compartments, CC9 and CC121, were rarely or never detected in PF. No CC was exclusively associated with the pork sector. Three CCs (CC5, CC6, and CC2 were considered ubiquitous, because they were observed in comparable proportions in all food production sectors. The two most prevalent CCs in all sectors were CC9 and CC121, but their distribution was disparate. CC9 was associated with meat products and food products combining several food categories, whereas CC121 was not associated with any given sector. Based on these results, CC121 is likely able

Population Genetic Structure of Listeria monocytogenes Strains Isolated From the Pig and Pork Production Chain in France

Science.gov (United States)

Félix, Benjamin; Feurer, Carole; Maillet, Aurelien; Guillier, Laurent; Boscher, Evelyne; Kerouanton, Annaëlle; Denis, Martine; Roussel, Sophie

2018-01-01

Listeria monocytogenes is an ubiquitous pathogenic bacterium, transmissible to humans through the consumption of contaminated food. The pork production sector has been hit hard by a series of L. monocytogenes-related food poisoning outbreaks in France. An overview of the diversity of strains circulating at all levels of the pork production chain, from pig farming (PF) to finished food products (FFP), is needed to identify the contamination routes and improve food safety. Until now, no typing data has been available on strains isolated across the entire pig and pork production chain. Here, we analyzed the population genetic structure of 687 L. monocytogenes strains isolated over the last 20 years in virtually all the French départements from three compartments of this production sector: PF, the food processing environment (FPE), and FFP. The genetic structure was described based on Multilocus sequence typing (MLST) clonal complexes (CCs). The CCs were obtained by mapping the PFGE profiles of the strains. The distribution of CCs was compared firstly between the three compartments and then with CCs obtained from 1106 strains isolated from other food production sectors in France. The predominant CCs of pig and pork strains were not equally distributed among the three compartments: the CC37, CC59, and CC77 strains, rarely found in FPE and FFP, were prevalent in PF. The two most prevalent CCs in the FPE and FFP compartments, CC9 and CC121, were rarely or never detected in PF. No CC was exclusively associated with the pork sector. Three CCs (CC5, CC6, and CC2) were considered ubiquitous, because they were observed in comparable proportions in all food production sectors. The two most prevalent CCs in all sectors were CC9 and CC121, but their distribution was disparate. CC9 was associated with meat products and food products combining several food categories, whereas CC121 was not associated with any given sector. Based on these results, CC121 is likely able to colonize a

ANTILISTERIAL ACTYVITY OF LACTIC ACID BACTERIA ISOLATED FROM GILTHEAD BREAMS AND SEA BASSES FILLETS PACKAGED MAP AGAINST PRIMITIVE STRAINS OF LISTERIA MONOCYTOGENES

Directory of Open Access Journals (Sweden)

M. Barile

2011-04-01

Full Text Available Listeria monocytogenes is the causative agent of listeriosis typically caused by ready-to-eat processed food that have a refrigerated shelf-life, but lightly preserved fish products also belong to a high-risk category. Aim of the work was to evaluate antimicrobial activity linked bacteriocin-producing of LAB isolated from gilthead breams and sea basses fillets packaged in modified atmospheres. Fifty-five LAB strains were screened against 21 strains of Listeria monocytogenes, 1 Listeria innocua held in the culture collection of Department of Zootechnical Sciences and Food Ispection (SIA and submitted to antagonistic activity using the spot on lawn and the agar well diffusion assay. Lactococcus lactis sub. lactis Sa31 was able to produce bacteriocin in agar and different broth medium. The bacteriocin man31 showed sensitivity to trypsin, pronase E and papain, inactivation at temperatures ≥ 100°C, bactericidal mode of action and antilisterial act, rapidly. The bacteriocin man31 caused a reduction of L. monocytogenes ½ c growth about log10 > 3 UFC/ml, when was applied on indicator strain at 20,480 AU/ml concentration, in vitro.

Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

DEFF Research Database (Denmark)

Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

2009-01-01

Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....

Biocontrol of Listeria monocytogenes in a meat model using a combination of a bacteriocinogenic strain with curing additives.

Science.gov (United States)

Orihuel, Alejandra; Bonacina, Julieta; Vildoza, María José; Bru, Elena; Vignolo, Graciela; Saavedra, Lucila; Fadda, Silvina

2018-05-01

The aim of this work was to evaluate the effect of meat curing agents on the bioprotective activity of the bacteriocinogenic strain, Enterococcus (E.) mundtii CRL35 against Listeria (L.) monocytogenes during meat fermentation. The ability of E. mundtii CRL35 to grow, acidify and produce bacteriocin in situ was assayed in a meat model system in the presence of curing additives (CA). E. mundtii CRL35 showed optimal growth and acidification rates in the presence of CA. More importantly, the highest bacteriocin titer was achieved in the presence of these food agents. In addition, the CA produced a statistical significant enhancement of the enterocin CRL35 activity. This positive effect was demonstrated in vitro in a meat based culture medium, by time-kill kinetics and finally by using a beaker sausage model with a challenge experiment with the pathogenic L. monocytogenes FBUNT strain. E. mundtii CRL35 was found to be a promising strain of use as a safety adjunct culture in meat industry and a novel functional supplement for sausage fermentation, ensuring hygiene and quality of the final product. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant

Science.gov (United States)

Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments.

Science.gov (United States)

Iacumin, Lucilla; Manzano, Marisa; Comi, Giuseppe

2016-01-05

The anti-listerial activity of generally recognized as safe (GRAS) bacteriophage Listex P100 (phage P100) was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b) of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm² or 3 log CFU/cm² of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C) seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm² was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm² was required to completely eliminate 2 log L. monocytogenes/cm² and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm² and with a P100 inoculum ranging from 1 to 7 log PFU/cm². P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm² from an initial phage treatment of approximately 8 log PFU/cm². Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm² is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments

Directory of Open Access Journals (Sweden)

Lucilla Iacumin

2016-01-01

Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

Genome Sequencing Identifies Two Nearly Unchanged Strains of Persistent Listeria monocytogenes Isolated at Two Different Fish Processing Plants Sampled 6 Years Apart

DEFF Research Database (Denmark)

Holch, Anne; Webb, Kristen; Lukjancenko, Oksana

2013-01-01

Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...

Enhanced Control of Listeria monocytogenes by Enterococcus faecium KE82, a Multiple Enterocin-Producing Strain, in Different Milk Environments.

Science.gov (United States)

Vandera, Elpiniki; Lianou, Alexandra; Kakouri, Athanasia; Feng, Jinbo; Koukkou, Anna-Irini; Samelis, John

2017-01-01

Enterococcus faecium KE82, isolated from traditional Greek Graviera cheese, was identified in pure broth cultures in vitro as a multiple enterocin-producing bacterial strain possessing the structural entA, entB, and entP enterocin genes. E. faecium KE82 was further assessed for in situ antilisterial activity in raw milk (RM) and commercially thermized milk (TM; 63°C for 30 s) in the presence of the indigenous microbiota and in sterile raw milk (SRM; 121°C for 5 min) with or without the addition of two commercial starter culture (CSC) strains Streptococcus thermophilus and Lactococcus lactis . Growth of Listeria monocytogenes was completely inhibited in RM incubated at 37°C for 6 h, whereas the pathogen was significantly inactivated in RM+KE82 samples during further incubation at 18°C for 66 h. In contrast, L. monocytogenes levels increased by approximately 2 log CFU/ml in TM, but in TM+KE82 samples, pathogen growth was retarded during the first 6 h at 37°C followed by growth cessation and partial inactivation at 18°C. After 48 to 72 h, growth of L. monocytogenes in SRM+CSC samples decreased by 4 to 5 log CFU/ml compared with the SRM control, whereas additional 10-fold decreases in the pathogen were observed in SRM+CSC+KE82 samples. Reverse transcription PCR analysis of SRM+KE82 and SRM+CSC+KE82 samples confirmed that the entA and entB genes were transcribed, but entP gene transcription was not detected. All RM and SRM samples inoculated with E. faecium KE82 displayed strong in situ inhibitory activity against L. monocytogenes in well diffusion bioassays, whereas activity was weaker to undetectable in comparable or additional TM+KE82 samples; no milk sample without E. faecium KE82 had activity against L. monocytogenes . The findings of this study indicate that E. faecium KE82 is an antilisterial agent that could be used in traditional dairy foods because it concomitantly produces enterocins A and B in situ in milk.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Science.gov (United States)

Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

2017-01-01

Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

Variations in virulence between different electrophoretic types of Listeria monocytogenes

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk

2000-01-01

A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

[Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

Science.gov (United States)

Gelbícová, T; Karpísková, R

2012-04-01

Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

Salt stress-induced transcription of σB- and CtsR-regulated genes in persistent and non-persistent Listeria monocytogenes strains from food processing plants.

Science.gov (United States)

Ringus, Daina L; Ivy, Reid A; Wiedmann, Martin; Boor, Kathryn J

2012-03-01

Listeria monocytogenes is a foodborne pathogen that can persist in food processing environments. Six persistent and six non-persistent strains from fish processing plants and one persistent strain from a meat plant were selected to determine if expression of genes in the regulons of two stress response regulators, σ(B) and CtsR, under salt stress conditions is associated with the ability of L. monocytogenes to persist in food processing environments. Subtype data were also used to categorize the strains into genetic lineages I or II. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to measure transcript levels for two σ(B)-regulated genes, inlA and gadD3, and two CtsR-regulated genes, lmo1138 and clpB, before and after (t=10 min) salt shock (i.e., exposure of exponential phase cells to BHI+6% NaCl for 10 min at 37°C). Exposure to salt stress induced higher transcript levels relative to levels under non-stress conditions for all four stress and virulence genes across all wildtype strains tested. Analysis of variance (ANOVA) of induction data revealed that transcript levels for one gene (clpB) were induced at significantly higher levels in non-persistent strains compared to persistent strains (p=0.020; two-way ANOVA). Significantly higher transcript levels of gadD3 (p=0.024; two-way ANOVA) and clpB (p=0.053; two-way ANOVA) were observed after salt shock in lineage I strains compared to lineage II strains. No clear association between stress gene transcript levels and persistence was detected. Our data are consistent with an emerging model that proposes that establishment of L. monocytogenes persistence in a specific environment occurs as a random, stochastic event, rather than as a consequence of specific bacterial strain characteristics.

Aerosol studies with Listeria innocua and Listeria monocytogenes.

Science.gov (United States)

Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

2007-08-01

Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

NARCIS (Netherlands)

Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.

2000-01-01

The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Maria da Graça F. Nascimento

1994-12-01

Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

Directory of Open Access Journals (Sweden)

David eMontero

2015-04-01

Full Text Available Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE such as sausage, cheese, fresh salads and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR identified that strains belonging to serotype 4b, and containing one or more genes encoded by LIPI-1, were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE, it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1 pathogenicity island, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent

Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

Science.gov (United States)

Montero, David; Bodero, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M; Vidal, Maricel

2015-01-01

Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance.

Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

Science.gov (United States)

Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

2017-11-01

The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

Directory of Open Access Journals (Sweden)

Bahador

2015-08-01

Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

Directory of Open Access Journals (Sweden)

Jozi Fagundes de Mello

2008-03-01

Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

Evaluation of Antibacterial Activity of Satureja Khuzestanica J. Essential Oil against Standard and Isolated Strains of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Sheida Akbari-Shahabi

2014-10-01

Full Text Available Background: The purpose of this study was to determine antibacterial activity of essential oil of Satureja khuzestanica against Listeria monocytogenes (PTCC1295 and strains isolated from breast milk show that. Materials and Methods: In this descriptive-analytic study, Essence of leave’s plant was extracted and identified its compounds and then carvacrol was isolated. Antibacterial activities were examined by agar dilution method against L. monocytogenes. Minimum inhibitory concentration (MIC and minimum bacterial concentration (MBC were carried out by micro dilution method. Then bacterial suspension injected the BALB/c mice. Forty-eight h after seeing the listeriosis disease signs were started the treatment. Ampicillin (10 μg/disc and trimethoprim (5 g were used as controls. Results: The results showed that the inhibitory zone diameter standard and essential oils for strains isolated species were respectively 59 and 50 mm. This amount was determined by carvacrol, respectively, 60 and 48 mm. Inhibition zone diameter measurements for standard strains of ampicillin and trimethoprim tedious strains, respectively, 21, 40, 18 and 33 mm, respectively. The minimum inhibitory concentration of essential oils, carvacrol and ampicillin than standard strains, respectively 1.56, 1.56 and 155×10˗8 μg/mL and MBC 3.125, 3.125 and 125×10-7 μg/mL was determined by the ratio of the strain 3.125, 3.125 and 0.0062 μg/mL and MBC was 6.25, 6.25 and 0.025 μg/mL. Conclusion: This study showed that bacterial cleansing properties of essential oil of this plant have a strong and effective combination that is carvacrol.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Directory of Open Access Journals (Sweden)

Mira Rakic Martinez

Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

Science.gov (United States)

Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

2009-03-01

The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

Effect of gamma radiation on the reduction of Salmonella strains, Listeria monocytogenes, and Shiga toxin-producing Escherichia coli and sensory evaluation of minimally processed spinach (Tetragonia expansa).

Science.gov (United States)

Rezende, Ana Carolina B; Igarashi, Maria Crystina; Destro, Maria Teresa; Franco, Bernadette D G M; Landgraf, Mariza

2014-10-01

This study evaluated the effects of irradiation on the reduction of Shiga toxin-producing Escherichia coli (STEC), Salmonella strains, and Listeria monocytogenes, as well as on the sensory characteristics of minimally processed spinach. Spinach samples were inoculated with a cocktail of three strains each of STEC, Salmonella strains, and L. monocytogenes, separately, and were exposed to gamma radiation doses of 0, 0.2, 0.4, 0.6, 0.8, and 1.0 kGy. Samples that were exposed to 0.0, 1.0, and 1.5 kGy and kept under refrigeration (4°C) for 12 days were submitted to sensory analysis. D10 -values ranged from 0.19 to 0.20 kGy for Salmonella and from 0.20 to 0.21 for L. monocytogenes; for STEC, the value was 0.17 kGy. Spinach showed good acceptability, even after exposure to 1.5 kGy. Because gamma radiation reduced the selected pathogens without causing significant changes in the quality of spinach leaves, it may be a useful method to improve safety in the fresh produce industry.

Attachment of Salmonella serovars and Listeria monocytogenes to stainless steel and plastic conveyor belts.

Science.gov (United States)

Veluz, G A; Pitchiah, S; Alvarado, C Z

2012-08-01

In poultry industry, cross-contamination due to processing equipment and contact surfaces is very common. This study examined the extent of bacterial attachment to 6 different types and design of conveyor belts: stainless steel-single loop, stainless steel-balance weave, polyurethane with mono-polyester fabric, acetal, polypropylene mesh top, and polypropylene. Clean conveyor belts were immersed separately in either a cocktail of Salmonella serovars (Salmonella Typhimurium and Salmonella Enteritidis) or Listeria monocytogenes strains (Scott A, Brie 1, ATCC 6744) for 1 h at room temperature. Soiled conveyor chips were dipped in poultry rinses contaminated with Salmonella or Listeria cocktail and incubated at 10°C for 48 h. The polyurethane with mono-polyester fabric conveyor belt and chip exhibited a higher (Pconveyor belt attached a lower (Pconveyor belts exhibited stronger bacterial adhesion compared with stainless steel. The result suggests the importance of selecting the design and finishes of conveyor belt materials that are most resistant to bacterial attachment.

Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

Science.gov (United States)

Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

2014-12-01

The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

Directory of Open Access Journals (Sweden)

Lisandra Aguilar-Bultet

2018-02-01

Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

Science.gov (United States)

Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

2018-01-01

Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada.

Science.gov (United States)

Piercey, Marta J; Ells, Timothy C; Macintosh, Andrew J; Truelstrup Hansen, Lisbeth

2017-09-18

Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure. The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence of the SSI-1 (Stress Survival Islet) and LGI1/CC8 (Listeria Genomic Island 1 in a clonal complex 8 background) genetic markers. Genetic sequences from four strains representing different phenotypes were also probed for predicted amino acid differences in biofilm, desiccation, and membrane related genes. The water isolates were among the most desiccation susceptible strains, while strains exhibiting desiccation resistance harboured SSI-1 or both the SSI-1 and LGI1/CC8 markers. BAC resistance was greatest in planktonic LGI1/CC8 cells (relative to non-LGI1/CC8 cells), and higher BAC concentrations were also needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48h and 6days compared to other strains. Formation of biofilm on stainless steel was not significantly (p>0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5-1, CP5 2-3, both from water), intermediate (Lm568, food) and desiccation and BAC resistant (08 5578, blood, human outbreak) strains led to the finding of amino acid differences in predicted functional protein domains in several biofilm, desiccation and peptidoglycan related genes (e.g., lmo0263, lmo0433, lmo0434, lmo0771, lmo0973, lmo1080, lmo1224, lmo1370, lmo1744, and lmo2558). Notably, the LGI1/CC8 strain 08-5578 had a frameshift mutation in lmo1370, a gene previously

PFGE standard operating procedures for Listeria monocytogenes: harmonizing the typing of food and clinical strains in Europe.

Science.gov (United States)

Michelon, Damien; Félix, Benjamin; Vingadassalon, Noemie; Mariet, Jean-François; Larsson, Jonas T; Møller-Nielsen, Eva; Roussel, Sophie

2015-03-01

Listeria monocytogenes is a foodborne pathogen responsible for a severe disease known as listeriosis. The European Centre for Disease Prevention and Control (ECDC) coordinates a network of national public health laboratories (NPHLs) in charge of typing clinical strains. In food, it is the European Union Reference Laboratory for L. monocytogenes (EURL Lm), which manages a network of National Reference Laboratories (NRLs). A pulsed-field gel electrophoresis (PFGE) standard operating procedure (EURL SOP) has been used routinely at the EURL Lm since 2007. The EURL Lm has recommended that NRLs use the EURL SOP, whereas the Statens Serum Institut (SSI), under contract for ECDC, requested that NPHLs use Halpins' SOP (HSOP) published in 2010 for the PulseNet USA network. An update of Halpins' SOP (uHSOP) was published in 2013. To facilitate the exchange of profiles among human and food European reference laboratories, it is crucial to ensure that the PFGE profiles obtained with these different SOPs are comparable. The aim here was to compare the EURL SOP with HSOP and uHSOP. The panel comprised 114 well-characterized SSI/EURL strains. All were characterized at the EURL using both the EURL SOP and uHSOP. Seventy of the 114 strains were also characterized at the SSI using HSOP. The EURL SOP and uHSOP produced indistinguishable combined (ApaI/AscI) profiles for the 114 strains tested. The EURL SOP and HSOP produced indistinguishable combined profiles for 69 of the 70 strains tested. One strain displayed for the AscI profile an additional low-intensity band at 184 kbp with HSOP. For this strain, SSI and EUR Lm had already observed the same profile from NPHLs and NRLs. However, this deviation is minor as it accounted for about 1% of all the 114 combined profiles. This study should facilitate the exchange of reproducible PFGE profiles among human and food reference laboratories.

Spontaneous bacteriocin resistance in Listeria monocytogenes as a susceptibility screen for identifying different mechanisms of resistance and modes of action by bacteriocins of lactic acid bacteria.

Science.gov (United States)

Macwana, Sunita; Muriana, Peter M

2012-01-01

A practical system was devised for grouping bacteriocins of lactic acid bacteria (LAB) based on mode of action as determined by changes in inhibitory activity to spontaneously-acquired bacteriocin resistance (Bac(R)). Wild type Listeria monocytogenes 39-2 was sensitive to five bacteriocins produced by 3 genera of LAB: pediocin PA-1 and pediocin Bac3 (Pediococcus), lacticin FS97 and lacticin FS56 (Lactococcus), and curvaticin FS47 (Lactobacillus). A spontaneous Bac(R) derivative of L. monocytogenes 39-2 obtained by selective recovery against lacticin FS56 provided complete resistance to the bacteriocin made by Lactococcus lactis FS56. The lacticin FS56-resistant strain of L. monocyotgenes 39-2 was also cross-resistant to curvaticin FS47 and pediocin PA-1, but not to lacticin FS97 or pediocin Bac3. The same pattern of cross-resistance was also observed with Bac(R) isolates obtained with L. monocytogenes Scott A-2. A spontaneous mutation that renders a strain cross-resistant to different bacteriocins indicates that they share a common mechanism of resistance due to similar modes of action of the bacteriocins. Spontaneous resistance was acquired to other bacteriocins (in aggregate) by following the same procedure against which the Bac(R) strain was still sensitive. In subsequent challenge assays, mixtures of bacteriocins of different modes of action provided greater inhibition than mixtures of bacteriocins of the same mode of action (as determined by our screening method). This study identifies a methodical approach to classify bacteriocins into functional groups based on mechanism of resistance (i.e., mode of action) that could be used for identifying the best mixture of bacteriocins for use as biopreservatives. Copyright © 2011 Elsevier B.V. All rights reserved.

Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

Science.gov (United States)

Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

2016-01-18

In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

Science.gov (United States)

Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

2016-01-01

Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

Directory of Open Access Journals (Sweden)

Kristensen Hans-Henrik

2008-11-01

Full Text Available Abstract Background Host defense peptides (HDPs, or antimicrobial peptides (AMPs, are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases. Hence it is important to determine the natural variation in susceptibility to HDPs to ensure a successful use in clinical treatment regimes. Results Strains of two human bacterial pathogens, Listeria monocytogenes and Staphylococcus aureus, were selected to cover a wide range of origin, sub-type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10 were similar in activity profile (MIC value spectrum to the human β-defensin 3 (HBD-3. All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs. Conclusion Strains of L. monocytogenes and S. aureus were within each species equally sensitive to a range of HDPs despite variations in subtype, origin, and phenotypic behavior. Our results suggest that therapeutic use of HDPs will not be hampered by occurrence of naturally tolerant strains of the two species investigated in the present study.

Listeria monocytogenes - Danger for health safety vegetable production.

Science.gov (United States)

Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

2018-04-22

The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

Depletion of proton motive force by nisin in Listeria monocytogenes cells.

OpenAIRE

Bruno, M E; Kaiser, A; Montville, T J

1992-01-01

The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH v...

Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

Science.gov (United States)

Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

2009-02-15

The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes.

Science.gov (United States)

Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S; Allard, Marc W; Strain, Errol A; Brown, Eric W

2016-10-15

Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated that core genome MLST

The Listeria monocytogenes Bile Stimulon under Acidic Conditions Is Characterized by Strain-Specific Patterns and the Upregulation of Motility, Cell Wall Modification Functions, and the PrfA Regulon

Science.gov (United States)

Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.

2018-01-01

Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736

Variability of Listeria monocytogenes strains in biofilm formation on stainless steel and polystyrene materials and resistance to peracetic acid and quaternary ammonium compounds.

Science.gov (United States)

Poimenidou, Sofia V; Chrysadakou, Marilena; Tzakoniati, Aikaterini; Bikouli, Vasiliki C; Nychas, George-John; Skandamis, Panagiotis N

2016-11-21

Listeria monocytogenes is a foodborne pathogen able to tolerate adverse conditions by forming biofilms or by deploying stress resistant mechanisms, and thus manages to survive for long periods in food processing plants. This study sought to investigate the correlation between biofilm forming ability, tolerance to disinfectants and cell surface characteristics of twelve L. monocytogenes strains. The following attributes were evaluated: (i) biofilm formation by crystal violet staining method on polystyrene, and by standard cell enumeration on stainless steel and polystyrene; (ii) hydrophobicity assay using solvents; (iii) minimum inhibitory concentration (MIC) and biofilm eradication concentration (BEC) of peracetic acid (PAA) and quaternary ammonium compounds (QACs), and (iv) resistance to sanitizers (PAA 2000ppm; QACs 500ppm) of biofilms on polystyrene and stainless steel. After 72h of incubation, higher biofilm levels were formed in TSB at 20°C, followed by TSB at 37°C (P=0.087) and diluted TSB 1/10 at both 20 (P=0.005) and 37°C (P=0.004). Cells grown at 30°C to the stationary phase had significant electron donating nature and a low hydrophobicity, while no significant correlation of cell surface properties to biofilm formation was observed. Strains differed in MIC PAA and BEC PAA by 24- and 15-fold, respectively, while a positive correlation between MIC PAA and BEC PAA was observed (P=0.02). The MIC QACs was positively correlated with the biofilm-forming ability on stainless steel (P=0.03). Regarding the impact of surface type, higher biofilm populations were enumerated on polystyrene than on stainless steel, which were also more tolerant to disinfectants. Among all strains, the greatest biofilm producer was a persistent strain with significant tolerance to QACs. These results may contribute to better understanding of L. monocytogenes behavior and survival on food processing surfaces. Copyright © 2016 Elsevier B.V. All rights reserved.

Novel Cadmium Resistance Determinant in Listeria monocytogenes.

Science.gov (United States)

Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

2017-03-01

Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

Science.gov (United States)

Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

2013-06-01

The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

Antimicrobial Resistance Profiles of Listeria monocytogenes and Listeria innocua Isolated from Ready-to-Eat Products of Animal Origin in Spain.

Science.gov (United States)

Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio

2017-06-01

The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.

The use of flagella and motility for plant colonization and fitness by different strains of the foodborne pathogen Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Lisa Gorski

Full Text Available The role of flagella and motility in the attachment of the foodborne pathogen Listeria monocytogenes to various surfaces is mixed with some systems requiring flagella for an interaction and others needing only motility for cells to get to the surface. In nature this bacterium is a saprophyte and contaminated produce is an avenue for infection. Previous studies have documented the ability of this organism to attach to and colonize plant tissue. Motility mutants were generated in three wild type strains of L. monocytogenes by deleting either flaA, the gene encoding flagellin, or motAB, genes encoding part of the flagellar motor, and tested for both the ability to colonize sprouts and for the fitness of that colonization. The motAB mutants were not affected in the colonization of alfalfa, radish, and broccoli sprouts; however, some of the flaA mutants showed reduced colonization ability. The best colonizing wild type strain was reduced in colonization on all three sprout types as a result of a flaA deletion. A mutant in another background was only affected on alfalfa. The third, a poor alfalfa colonizer was not affected in colonization ability by any of the deletions. Fitness of colonization was measured in experiments of competition between mixtures of mutant and parent strains on sprouts. Here the flaA and motAB mutants of the three strain backgrounds were impaired in fitness of colonization of alfalfa and radish sprouts, and one strain background showed reduced fitness of both mutant types on broccoli sprouts. Together these data indicate a role for flagella for some strains to physically colonize some plants, while the fitness of that colonization is positively affected by motility in almost all cases.

Genomic presence of gadD1 glutamate decarboxylase correlates with the organization of ascB-dapE internalin cluster in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan

2012-02-01

The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.

Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.

Science.gov (United States)

Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun

2012-03-01

Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.

Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

Directory of Open Access Journals (Sweden)

Hayat Ennaji

2008-09-01

Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

Science.gov (United States)

Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

2014-08-01

This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

Directory of Open Access Journals (Sweden)

Emmanuel Okpo

2015-11-01

Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

Cold growth behaviour and genetic comparison of Canadian and Swiss Listeria monocytogenes strains associated with the food supply chain and human listeriosis cases.

Science.gov (United States)

Arguedas-Villa, Carolina; Kovacevic, Jovana; Allen, Kevin J; Stephan, Roger; Tasara, Taurai

2014-06-01

Sixty-two strains of Listeria monocytogenes isolated in Canada and Switzerland were investigated. Comparison based on molecular genotypes confirmed that strains in these two countries are genetically diverse. Interestingly strains from both countries displayed similar range of cold growth phenotypic profiles. Based on cold growth lag phase duration periods displayed in BHI at 4 °C, the strains were similarly divided into groups of fast, intermediate and slow cold adaptors. Overall Swiss strains had faster exponential cold growth rates compared to Canadian strains. However gene expression analysis revealed no significant differences between fast and slow cold adapting strains in the ability to induce nine cold adaptation genes (lmo0501, cspA, cspD, gbuA, lmo0688, pgpH, sigB, sigH and sigL) in response to cold stress exposure. Neither was the presence of Stress survival islet 1 (SSI-1) analysed by PCR associated with enhanced cold adaptation. Phylogeny based on the sigL gene subdivided strains from these two countries into two major and one minor cluster. Fast cold adaptors were more frequently in one of the major clusters (cluster A), whereas slow cold adaptors were mainly in the other (cluster B). Genetic differences between these two major clusters are associated with various amino acid substitutions in the predicted SigL proteins. Compared to the EGDe type strain and most slow cold adaptors, most fast cold adaptors exhibited five identical amino acid substitutions (M90L, S203A/S203T, S304N, S315N, and I383T) in their SigL proteins. We hypothesize that these amino acid changes might be associated with SigL protein structural and functional changes that may promote differences in cold growth behaviour between L. monocytogenes strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

Science.gov (United States)

Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

2017-02-01

Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

Diversity of Listeria monocytogenes Strains of Clinical and Food Chain Origins in Belgium between 1985 and 2014

Science.gov (United States)

Ceyssens, P. J.; Yde, M.; Dierick, K.; Boyen, F.; Vanderpas, J.; Vanhoof, R.; Mattheus, W.

2016-01-01

Listeriosis is a rare but severe disease, mainly caused by Listeria monocytogenes. This study shows the results of the laboratory-based surveillance of Listeriosis in Belgium over the period 1985–2014. Besides the incidence and some demographic data we present also more detailed microbiological and molecular characteristics of human strains isolated since 2000. The strains from the latter period were compared to food and animal strains from the same period. Our study shows that different food matrices were commonly contaminated with L. monocytogenes presenting the same PFGE profile as in patient’s isolates. Since 1985, we observed a significant decrease in incidence of the Materno-Neonatal cases (from 0.15 to 0.04 cases /100,000 inhabitants-year), which is probably to be attributed to active prevention campaigns targeting pregnant women. Despite the strengthening of different control measures by the food industry, the incidence of non-Materno-Neonatal listeriosis increased in Belgium (from 0.3 to 0.7 cases /100,000 inhabitants-year), probably due to the rise of highly susceptible patients in an aging population. This significant increase found in non-Materno-Neonatal cases (slope coefficient 7.42%/year, Pmonocytogenes isolates, a trend to increasing MIC values is evident with chloramphenicol, amoxicillin, tetracycline and ciprofloxacin. We show that fluoroquinolone resistance is not linked to chromosomal mutations, but caused by a variety of efflux pumps. Our study also shows that huge majority of known underlying pathologies (426 out of 785 cases) were cancers (185/426, 43.1%) and haematological malignancies (75/185, 40.5%). Moreover the risk population is susceptible to low levels of contamination in food stressing the need of prevention campaigns specifically targeting these persons. PMID:27723768

Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

Directory of Open Access Journals (Sweden)

Luisa Zanolli Moreno

2014-01-01

Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

A case of bovine raw milk contamination with Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hunt Karen

2012-07-01

Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

An Effective Counterselection System for Listeria monocytogenes and Its Use To Characterize the Monocin Genomic Region of Strain 10403S.

Science.gov (United States)

Argov, Tal; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A

2017-03-15

Construction of Listeria monocytogenes mutants by allelic exchange has been laborious and time-consuming due to lack of proficient selection markers for the final recombination event, that is, a marker conveying substance sensitivity to the bacteria bearing it, enabling the exclusion of merodiploids and selection for plasmid loss. In order to address this issue, we engineered a counterselection marker based on a mutated phenylalanyl-tRNA synthetase gene ( pheS* ). This mutation renders the phenylalanine-binding site of the enzyme more promiscuous and allows the binding of the toxic p -chloro-phenylalanine analog ( p -Cl-phe) as a substrate. When pheS* is introduced into L. monocytogenes and highly expressed under control of a constitutively active promoter, the bacteria become sensitive to p -Cl-phe supplemented in the medium. This enabled us to utilize pheS* as a negative selection marker and generate a novel, efficient suicide vector for allelic exchange in L. monocytogenes We used this vector to investigate the monocin genomic region in L. monocytogenes strain 10403S by constructing deletion mutants of the region. We have found this region to be active and to cause bacterial lysis upon mitomycin C treatment. The future applications of such an effective counterselection system, which does not require any background genomic alterations, are vast, as it can be modularly used in various selection systems (e.g., genetic screens). We expect this counterselection marker to be a valuable genetic tool in research on L. monocytogenes IMPORTANCE L. monocytogenes is an opportunistic intracellular pathogen and a widely studied model organism. An efficient counterselection marker is a long-standing need in Listeria research for improving the ability to design and perform various genetic manipulations and screening systems for different purposes. We report the construction and utilization of an efficient suicide vector for allelic exchange which can be conjugated, leaves no

Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

Science.gov (United States)

Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

2016-01-01

Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

Science.gov (United States)

Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

2008-03-01

To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

Directory of Open Access Journals (Sweden)

Roberta Ortenzi

2015-09-01

Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

Science.gov (United States)

Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

2017-09-01

The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

Differential Biofilm Formation and Chemical Disinfection Resistance of Sessile Cells of Listeria monocytogenes Strains under Monospecies and Dual-Species (with Salmonella enterica) Conditions

Science.gov (United States)

Kostaki, Maria; Chorianopoulos, Nikos; Braxou, Elli; Nychas, George-John

2012-01-01

This study aimed to investigate the possible influence of bacterial intra- and interspecies interactions on the ability of Listeria monocytogenes and Salmonella enterica to develop mixed-culture biofilms on an abiotic substratum, as well as on the subsequent resistance of sessile cells to chemical disinfection. Initially, three strains from each species were selected and left to attach and form biofilms on stainless steel (SS) coupons incubated at 15°C for 144 h, in periodically renewable tryptone soy broth (TSB), under either monoculture or mixed-culture (mono-/dual-species) conditions. Following biofilm formation, mixed-culture sessile communities were subjected to 6-min disinfection treatments with (i) benzalkonium chloride (50 ppm), (ii) sodium hypochlorite (10 ppm), (iii) peracetic acid (10 ppm), and (iv) a mixture of hydrogen peroxide (5 ppm) and peracetic acid (5 ppm). Results revealed that both species reached similar biofilm counts (ca. 105 CFU cm−2) and that, in general, interspecies interactions did not have any significant effect either on the biofilm-forming ability (as this was assessed by agar plating enumeration of the mechanically detached biofilm bacteria) or on the antimicrobial resistance of each individual species. Interestingly, pulsed-field gel electrophoresis (PFGE) analysis clearly showed that the three L. monocytogenes strains did not contribute at the same level either to the formation of mixed-culture sessile communities (mono-/dual species) or to their antimicrobial recalcitrance. Additionally, the simultaneous existence inside the biofilm structure of S. enterica cells seemed to influence the occurrence and resistance pattern of L. monocytogenes strains. In sum, this study highlights the impact of microbial interactions taking place inside a mixed-culture sessile community on both its population dynamics and disinfection resistance. PMID:22307304

Scott S Snyder

Indian Academy of Sciences (India)

Home; Journals; Pramana – Journal of Physics. Scott S Snyder. Articles written in Pramana – Journal of Physics. Volume 62 Issue 3 March 2004 pp 565-568 Experimental Particle Physics. Prospects for Higgs search at DØ · Scott S Snyder DØ Collaboration · More Details Abstract Fulltext PDF. The status of the Higgs search ...

Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil

Directory of Open Access Journals (Sweden)

Cristhiane Moura Falavina dos Reis

2011-04-01

Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.

Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

Science.gov (United States)

de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

2018-04-12

Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

Characterisation of InlA truncation in Listeria monocytogenes isolates from farm animals and human cases in the province of Quebec

Science.gov (United States)

Fravalo, Philippe; Cherifi, Tamazight; Neira Feliciano, Kersti Dina; Letellier, Ann; Fairbrother, Julie-Hélène; Bekal, Sadjia

2017-01-01

The introduction of Listeria monocytogenes into the food production chain is a concern, with numerous grouped cases of listeriosis associated with milk-derived or pork-derived products have been documented. Management of this zoonotic pathogen considers all strains as an equal risk. Recently, a new perspective for characterisation of strain virulence was introduced with the discovery of the unaltered sequence of InlA as a determinant of strain virulence; this has also been reported as an infrequent finding among so-called environmental strains, that is, strains isolated from food or from surfaces in food industries. The aim of this study was to differentiate L monocytogenes strains isolated from animal cases versus those from human cases and to differentiate clinical strains from environmental ones using a Caenorhabditis elegans virulence testing model. In Quebec in 2013/2014, the surveillance of L monocytogenes clinical isolates registered a total of 20 strains of animal origin and 16 pulsed-field gel electrophoresis types isolated from human cases. The mixed PCR multiplex agglutination protocol used for geno-serotyping clearly discriminated genogroup IVB strains from bovine and human origins. The presence of a premature stop codon single nucleotide polymorphism in the inlA gene sequence in clinical strains and the identical behaviour of particular strains in the C elegans model are discussed in this paper from the perspective of industrial management of L monocytogenes risk. PMID:28761668

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

Science.gov (United States)

Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

2015-01-01

Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

Science.gov (United States)

Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

2016-01-01

ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

High hydrostatic pressure effects on Listeria monocytogenes and L. innocua: Evidence for variability in inactivation behaviour and in resistance to pediocin bacHA-6111-2.

Science.gov (United States)

Bruschi, Carolina; Komora, Norton; Castro, Sónia Marília; Saraiva, Jorge; Ferreira, Vânia Borges; Teixeira, Paula

2017-06-01

The effect of high hydrostatic pressure (HHP) on the survival of 14 strains of Listeria monocytogenes from food or clinical origins, selected to represent different pheno and genotypes, was evaluated. Stationary phase cells were submitted to 300, 400 and 500 MPa at 10 °C, for 5 min. A high variability in the resistance of L. monocytogenes to pressure was observed, and particularly two strains isolated from food were significantly more baroresistant than the rest. Strains of L. monocytogenes resistant to one or more antibiotics exhibited significantly higher levels of survival after the high pressure treatment at 400 MPa. No correlation was found between strains' origin or thermal tolerance and resistance to HHP. The suitability of two strains of L. innocua as surrogates of L. monocytogenes, was also investigated. These exhibited significantly higher sensitivities to HHP than observed for some L. monocytogenes. The antimicrobial effect of the antilisterial bacteriocin (bacHA-6111-2) increased after L. monocytogenes cells had been exposed to pressure. The data obtained underlines the importance of strain selection for studies aiming to evaluate HHP efficacy to ensure safety of HHP-treated foods. Copyright © 2017 Elsevier Ltd. All rights reserved.

Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India.

Science.gov (United States)

Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit

2017-03-01

Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

Effect of peracetic acid on biofilms formed by Staphylococcus aureus and Listeria monocytogenes isolated from dairy plants.

Science.gov (United States)

Lee, S H I; Cappato, L P; Corassin, C H; Cruz, A G; Oliveira, C A F

2016-03-01

This research investigated the removal of adherent cells of 4 strains of Staphylococcus aureus and 1 Listeria monocytogenes strain (previously isolated from dairy plants) from polystyrene microtiter plates using peracetic acid (PAA, 0.5%) for 15, 30, 60, and 120 s, and the inactivation of biofilms formed by those strains on stainless steel coupons using the same treatment times. In the microtiter plates, PAA removed all S. aureus at 15 s compared with control (no PAA treatment). However, L. monocytogenes biofilm was not affected by any PAA treatment. On the stainless steel surface, epifluorescence microscopy using LIVE/DEAD staining (BacLight, Molecular Probes/Thermo Fisher Scientific, Eugene, OR) showed that all strains were damaged within 15 s, with almost 100% of cells inactivated after 30 s. Results of this trial indicate that, although PAA was able to inactivate both S. aureus and L. monocytogenes monospecies biofilms on stainless steel, it was only able to remove adherent cells of S. aureus from polystyrene microplates. The correct use of PAA is critical for eliminating biofilms formed by S. aureus strains found in dairy plants, although further studies are necessary to determine the optimal PAA treatment for removing biofilms of L. monocytogenes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

Science.gov (United States)

Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

2017-11-01

Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

Science.gov (United States)

Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

Directory of Open Access Journals (Sweden)

Michela Ibba

2013-09-01

Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

Science.gov (United States)

Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

2010-08-01

Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

Science.gov (United States)

Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

2010-06-01

Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

Science.gov (United States)

Eskhan, Asma Omar

Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

Construction of a multiple fluorescence labeling system for use in co-invasion studies of Listeria monocytogenes

DEFF Research Database (Denmark)

Andersen, Jens Bo; Roldgaard, Bent; Lindner, A. B.

2006-01-01

strains at the single cell level by use of fluorescence microscopy. More than 90% of the L. monocytogenes host cells maintained the fluorescence tags for 40 generations. The fluorescence tags did not alter the invasive capacity of the L. monocytogenes cells in a traditional Caco-2 cell invasion assay......, and visual discrimination between invaded bacteria carrying different fluorescent labels inside the cells was possible. Conclusion The constructed fluorescent marker system is stable, easy to use, does not affect the virulence of L. monocytogenes in Caco-2 cell assays, and allows discrimination between...... deviations in the observed capacity for infection when animal models are used. One way to circumvent this problem is to carry out virulence studies as competition assays between 2 or more strains. This, however, requires invasion-neutral markers that enable easy discrimination between the different strains...

Influence of freezing stress on morphological alteration and biofilm formation by Listeria monocytogenes: relationship with cell surface hydrophobicity and membrane fluidity.

Science.gov (United States)

Miladi, Hanene; Ammar, Emna; Ben Slama, Rihab; Sakly, Nawfel; Bakhrouf, Amina

2013-11-01

The morphological changes and adhesive property of three Listeria monocytogenes strains submitted to freezing stress (-20 °C) were studied. The atomic force micrographs showed a reduction in the cell size and an evolution to coccoid shape. The phenotypic slime production of L. monocytogenes and the expression of the adhesive gene were investigated before and after 10 months of incubation in salmon at -20°. Our results showed that after ten months, stressed stains become more adherent and able to produce slime. In addition, we noted that this pathogen presents same physiological changes to adapt to starvation conditions. The cellular fatty acids composition of adhered and floating cells of three L. monocytogenes strains was taken into consideration. The stressed strains presented different chain lengths and therefore an increase in the hydrophobicity level. Moreover, we noted that the adhesive property of L. monocytogenes strains affects the Benzalkonium chloride bacterial sensitivity which increased after biofilm formation.

Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

Science.gov (United States)

Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

2014-01-21

Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

Directory of Open Access Journals (Sweden)

Anna Mureddu

2014-02-01

Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933

Science.gov (United States)

We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Karla Sequeira Mendonça

2016-01-01

Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

Directory of Open Access Journals (Sweden)

Jin-Qiang Chen

2017-09-01

Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

Animal models for oral transmission of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Sarah E F D'Orazio

2014-02-01

Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

Genetic Characterization of Listeria monocytogenes Isolates from Industrial and Retail Ready-to-Eat Meat-Based Foods and Their Relationship with Clinical Strains from Human Listeriosis in Portugal.

Science.gov (United States)

Henriques, A R; Cristino, J Melo; Fraqueza, M J

2017-04-01

Listeria monocytogenes isolates (n = 81) recovered from ready-to-eat meat-based food products (RTEMP) collected in industrial processing plants and retail establishments were genetically characterized for comparison with those from human clinical cases of listeriosis (n = 49). The aim was to assess RTEMP as a possible food source for human infection. L. monocytogenes was detected in 12.5% of the RTEMP samples, and in some cases, counts were above the European food safety criteria. All isolates were assessed by multiplex PCR for serogroup determination and detection of virulence-associated genes inlA, inlB, inlC, inlJ, plcA, hlyA, actA, and iap. Serogroups IIb and IVb dominated in RTEMP and human isolates, and all were positive for the assessed virulence genes. Antibiotic susceptibility testing by the disk diffusion method revealed a low level of resistance among the isolates. Pulsed-field gel electrophoresis (PFGE) of L. monocytogenes isolates, using restriction enzymes ApaI and AscI, revealed genetic variability and differentiated the isolates in five clusters. Although some pulsed-field gel electrophoresis profiles of particular RTEMP and human isolates seemed to be highly related, exhibiting more than 90% similarity, which suggests a possible common source, in most cases the strains were not genetically or temporally matched. The close genetic relatedness of RTEMP and human listeriosis strains stressed the importance of preventive measure implementation throughout the food chain.

Listeria monocytogenes repellence by enzymatically modified PES surfaces

NARCIS (Netherlands)

Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

2015-01-01

: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

Survival of Listeria monocytogenes with different antibiotic resistance patterns to food-associated stresses.

Science.gov (United States)

Komora, Norton; Bruschi, Carolina; Magalhães, Rui; Ferreira, Vânia; Teixeira, Paula

2017-03-20

The ongoing rise of antibiotic resistant microbial pathogens has become one of the major public health threats worldwide. Despite all the effort and actions taken so far, a proliferation of antibiotic resistant (AR) and multi-antibiotic resistant (MAR) strains is still observed, including in foodborne pathogens. This trend has been also noted recently for isolates of Listeria monocytogenes, a species that, although remaining largely sensitive to clinically relevant antimicrobials, has been reported to develop increased tolerance to antibiotics, particularly in isolates recovered from the food-chain. In this study we compared the ability of MAR (n=8), AR (n=18) and antibiotic susceptible (AS, n=11) L. monocytogenes strains from food and clinical origin to survive to different environmental stress conditions, including temperature (58°C), acidic stress (1% v/v lactic acid, pH3.5), and osmotic stress (37% w/v NaCl). The presence of antibiotic active efflux among MAR and AR strains, and its role on L. monocytogenes tolerance to different antimicrobial compounds was also investigated, namely; hydrogen peroxide; organic acids (acetic, citric and lactic); nisin; benzalkonium chloride (BC); and, sodium nitrite. While no significant differences were observed in the survival of the 37 strains exposed to high temperature (58°C), overall the mean logarithmic reduction of clinical strains was statistically lower after acid and salt exposure than that observed for strains of food origin; but both food and clinical strains resistant to two or three antibiotics were significantly less susceptible to acid (lactic acid 1% v/v) and osmotic stresses (37% w/v NaCl) when compared to AS strains. Using the EtBr-agar Cartwheel method, it was possible to detect efflux pumps in three of the 26 MAR and AR isolates, including one control strain; the active efflux in theses isolates was proven to be associated with fluoroquinolone resistance, and possible extrusion of BC and hydrogen peroxide

Citation for Scott Doney

Science.gov (United States)

Glover, David M.; Doney, Scott

“A man of genius makes no mistakes. His errors are volitional and are the portals of discovery. James Joyce, Ulysses (1922). ”After collaborating with Scott Doney for the past 14 years I know what Joyce meant. When working with someone as bright as Scott it inevitably happens that you just don't understand. And because we're trained skeptics the question immediately arises, ”has our friend and colleague made a mistake?“ But we're wrong; we just didn't see the portal through which people like Scott had already proceeded. Certainly this is what we reserve these awards of ‘outstandingness’ for; those whose insight lead through the portals of discovery”.

The first report on Listeria monocytogenes producing siderophores and responds positively to N-acyl homoserine lactone (AHL) molecules by enhanced biofilm formation.

Science.gov (United States)

Naik, Milind Mohan; Bhangui, Purva; Bhat, Chinmay

2017-12-01

Listeria monocytogenes are Gram-positive well-known emerging food-borne pathogens causing listeriosis in humans. In the present study, we have isolated biofilm-forming Listeria sp. from utensils used by a local milk collection dairy society at Usgao Goa, which collects milk for Goa dairy. Through biochemical tests and 16S rRNA sequence analysis, the bacterium was confirmed to be L. monocytogenes and designated as strain BN3, having GenBank accession number MF095110. We report for the first time Gram-positive L. monocytogenes strain BN3 producing iron-chelating siderophores by chrome azurol S (CAS) agar test. Also, this is a first report which reveals that L. monocytogenes strain BN3 responds to N-hexanoyl-homoserine lactone molecule (C 6 -HSL) by gradual increase in their biofilm-forming potential with a gradual increase in AHL (C 6 -HSL) concentration (250, 500 nM-1 μM) as compared to control revealed by crystal violet assay (CV) in microtiter plate. These results were further confirmed by scanning electron microscopy (SEM). A significant decrease in biofilm formation was observed when L. monocytogenes strain BN3 was treated with 10 µg/ml (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid, but when 250 and 500 nM AHL molecules were added, biofilm formation in strain BN3 was found to be enhanced as compared to control even in the presence of antibacterial compound, (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid. These results revealed that AHL molecules nullify the effect of antimicrobial compound and promote biofilm formation in L. monocytogenes strain BN3.

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

OpenAIRE

Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

2015-01-01

Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

Evaluation of a loop-mediated isothermal amplification method for the detection of Listeria monocytogenes in dairy food

Directory of Open Access Journals (Sweden)

Erica Tirloni

2017-12-01

Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.

Persistent and transient Listeria monocytogenes strains from retail deli environments vary in their ability to adhere and form biofilms and rarely have inlA premature stop codons.

Science.gov (United States)

Wang, Jingjin; Ray, Andrea J; Hammons, Susan R; Oliver, Haley F

2015-02-01

Based on recent risk assessments, up to 83% of listeriosis cases from deli meat in the United States are predicted to be from ready-to-eat deli meats contaminated during processing at retail grocery stores. Listeria monocytogenes is known to use sanitizer tolerance and biofilm formation to survive, but interplay of these mechanisms along with virulence potential and persistence mechanisms specific to deli environments had yet to be elucidated. In this study, 442 isolates from food and nonfood contact surfaces in 30 retail delis over 9 months were tested for inlA premature stop codons (PMSCs); inlA encodes InlA, which is necessary to cause listeriosis. A total of 96 isolates, composed of 23 persistent and 73 transient strains, were tested for adhesion and biofilm-forming ability and sanitizer tolerance. Only 10/442 isolates had inlA PMSCs (pdelis with other persistent strains. Most (7/10) PMSC-containing isolates were collected from food contact surfaces (pdelis (p<0.05). Persistent strains had enhanced adhesion on day 1 of a 5-day adhesion-biofilm formation assay. However, there was no significant difference in sanitizer tolerance between persistent and transient strains. Results suggest that foods contaminated with persistent L. monocytogenes strains from the retail environment are (1) likely to have wild-type virulence potential and (2) may persist due to increased adhesion and biofilm formation capacity rather than sanitizer tolerance, thus posing a significant public health risk.

Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

2010-03-31

Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

Science.gov (United States)

2010-01-01

Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two

Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

DEFF Research Database (Denmark)

Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

2001-01-01

and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

Directory of Open Access Journals (Sweden)

Fernanda Barbosa dos Reis-Teixeira

Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.

Science.gov (United States)

Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources

Science.gov (United States)

Doijad, Swapnil P.; Barbuddhe, Sukhadeo B.; Garg, Sandeep; Poharkar, Krupali V.; Kalorey, Dewanand R.; Kurkure, Nitin V.; Rawool, Deepak B.; Chakraborty, Trinad

2015-01-01

A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26%) strains as weak, 27 (27.55%) strains as moderate, and 9 (9.18%) strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015) was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI) analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids. PMID:26360831

Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources.

Directory of Open Access Journals (Sweden)

Swapnil P Doijad

Full Text Available A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26% strains as weak, 27 (27.55% strains as moderate, and 9 (9.18% strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015 was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

DEFF Research Database (Denmark)

Harmsen, Morten; Lappann, Martin; Knøchel, S

2010-01-01

(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

Directory of Open Access Journals (Sweden)

Shi eWu

2016-02-01

Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

2016-01-01

Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Initial adhesion of Listeria monocytogenes to solid surfaces under liquid flow

DEFF Research Database (Denmark)

Szlavik, Julie; Soares Paiva, Dionísio; Mørk, Nils

2012-01-01

.001) was observed but not of interactions between surface-shear stress. No correlation between surface hydrophobicity and IAR was observed. Addition of 5% NaCl during propagation resulted in a decrease in IAR whilst propagation in low nutrient media caused an increase indicating a general change in surface......Some strains of the food borne pathogen Listeria monocytogenes persist in food processing environments. The exact reason behind this phenomenon is not known, but strain differences in the ability to adhere to solid surfaces could offer an explanation. In the present work, initial adhesion of nine...... strains of L. monocytogenes was investigated under liquid flow at two levels of shear stress on six different surfaces using a flow chamber set-up with microscopy measurements. The surfaces tested were glass and PVC, and glass coated with beef extract, casein, and homogenised and unhomogenised milk...

Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

DEFF Research Database (Denmark)

Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

2000-01-01

A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

Examination of food chain-derived Listeria monocytogenes strains of different serotypes reveals considerable diversity in inlA genotypes, mutability, and adaptation to cold temperatures.

Science.gov (United States)

Kovacevic, Jovana; Arguedas-Villa, Carolina; Wozniak, Anna; Tasara, Taurai; Allen, Kevin J

2013-03-01

Listeria monocytogenes strains belonging to serotypes 1/2a and 4b are frequently linked to listeriosis. While inlA mutations leading to premature stop codons (PMSCs) and attenuated virulence are common in 1/2a, they are rare in serotype 4b. We observed PMSCs in 35% of L. monocytogenes isolates (n = 54) recovered from the British Columbia food supply, including serotypes 1/2a (30%), 1/2c (100%), and 3a (100%), and a 3-codon deletion (amino acid positions 738 to 740) seen in 57% of 4b isolates from fish-processing facilities. Caco-2 invasion assays showed that two isolates with the deletion were significantly more invasive than EGD-SmR (P cold temperature following a downshift from 37°C to 4°C. Overall, three distinct cold-adapting groups (CAG) were observed: 46% were fast (200 h) adaptors. Intermediate CAG strains (70%) more frequently possessed inlA PMSCs than did fast (20%) and slow (10%) CAGs; in contrast, 87% of fast adaptors lacked inlA PMSCs. In conclusion, we report food chain-derived 1/2a and 4b serotypes with a 3-codon deletion possessing invasive behavior and the novel association of inlA genotypes encoding a full-length InlA with fast cold-adaptation phenotypes.

Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system

Science.gov (United States)

Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

2013-04-01

Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Wang Jun

2010-03-01

Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

Science.gov (United States)

The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

Science.gov (United States)

Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

2007-10-01

To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride.

Science.gov (United States)

Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia

2015-06-01

In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

Science.gov (United States)

Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

2016-01-01

Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes Internalin A for enhanced infectivity in the murine oral infection model

LENUS (Irish Health Repository)

Monk, Ian R

2010-12-13

Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human

Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model

Directory of Open Access Journals (Sweden)

Hill Colin

2010-12-01

Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Listeria monocytogenes efficiently invades Caco-2 cells after low-temperature storage in broth and on deli meat.

Science.gov (United States)

Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne

2010-09-01

The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p 0.05) in invasiveness after 7 days at 10 degrees C in BHI broth or on sausage, whereas a slight increase (p < 0.05) was observed after incubation on ham for 2 and 4 weeks compared to that in BHI broth. Most importantly, our results show that L. monocytogenes efficiently invade Caco-2 cells even after 4 weeks of storage at chilled temperature. This is highly relevant for safety assessment of this organism in food as these conditions reflect storage of ready-to-eat food products in domestic refrigerators.

Silver as antibacterial towards Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Simone eBelluco

2016-03-01

Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

DEFF Research Database (Denmark)

Jiang, Lingli; Olesen, Inger; Andersen, Thomas

2010-01-01

-related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

Prevalence of Listeria monocytogenes in poultry production in France.

Science.gov (United States)

Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

2008-10-01

This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

Fate of viable but non-culturable Listeria monocytogenes in pig manure microcosms

Directory of Open Access Journals (Sweden)

Jeremy eDesneux

2016-03-01

Full Text Available The fate of two strains of L. monocytogenes and their ability to become viable but non-culturable (VBNC was investigated in microcosms containing piggery effluents (two raw manures and two biologically treated manures stored for two months at 8°C and 20°C. Levels of L. monocytogenes were estimated using the culture method, qPCR, and propidium monoazide treatment combined with qPCR (qPCRPMA. The chemical composition and the microbial community structure of the manures were also analysed. The strains showed similar decline rates and persisted up to 63 days. At day zero, the percentage of VBNC cells among viable cells was higher in raw manures (81.5-94.8% than in treated manures (67.8-79.2%. The changes in their proportion over time depended on the temperature and on the type of effluent: the biggest increase was observed in treated manures at 20°C and the smallest increase in raw manures at 8°C. The chemical parameters had no influence on the behaviour of the strains, but decrease of the persistence of viable cells was associated with an increase in the microbial richness of the manures. This study demonstrated that storing manure altered the culturability of L. monocytogenes, which rapidly entered the VBNC state, and underlines the importance of including VBNC cells when estimating the persistence of the pathogens in farm effluents.

Role of lactic acid bacteria as a biosanitizer to prevent attachment of Listeria monocytogenes F6900 on deli slicer contact surfaces.

Science.gov (United States)

Ndahetuye, Jean Baptiste; Koo, Ok Kyung; O'Bryan, Corliss A; Ricke, Steven C; Crandall, Philip G

2012-08-01

The study was conducted to evaluate the attachment of three lactic acid bacteria (LAB) strains and their combination in a cocktail, to stainless steel coupons from a deli slicer, and their ability to inhibit the attachment of Listeria monocytogenes. In a previous study, three LAB strains, Pediococcus acidilactici, Lactobacillus amylovorus, and Lactobacillus animalis, were isolated from ready-to-eat meat and exhibited antilisterial effect. In the study reported here, hydrophobicity tests were determined according to the method of microbial adhesion to solvent. The attachment of the cells was evaluated on stainless steel coupons from deli slicers. Extracellular carbohydrates were determined with a colorimetric method. Based on these tests, L. animalis exhibited the greatest hydrophobicity (26.3%), and its adherence increased sharply from 24 to 72 h, whereas L. amylovorus yielded the lowest hydrophobicity (3.86%) and was weakly adherent. Although P. acidilactici had moderate hydrophobicity (10.1%), it adhered strongly. The attached LAB strains produced significantly (P < 0.05) higher total carbohydrates than their planktonic counterparts did, which is an important characteristic for attachment. Three conditions were simulated to evaluate the ability of the LAB cocktail (10(8) CFU/ml) to competitively exclude L. monocytogenes (10(3) CFU/ml) on the surface of the coupons. The coupons were pretreated with the LAB cocktail for 24 h prior to the addition of L. monocytogenes, simultaneously treated with the LAB cocktail and L. monocytogenes, or pretreated with L. monocytogenes 24 h prior to the addition of the LAB cocktail. The LAB cocktail was able to reduce the attachment L. monocytogenes significantly (P < 0.05). The LAB cocktail indicated potential attachment on stainless steel and bacteriostatic activity toward L. monocytogenes attached on stainless steel, which indicates a possible role for LAB as a biosanitizer in the food industry.

Inhibition of Listeria monocytogenes on Ready-to-Eat Meats Using Bacteriocin Mixtures Based on Mode-of-Action

Directory of Open Access Journals (Sweden)

Paul Priyesh Vijayakumar

2017-03-01

Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.

An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

Science.gov (United States)

Valderrama, Wladir B; Cutter, Catherine N

2013-01-01

Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

Antibiotic Susceptibility Profiles of Listeria monocytogenes Strains Isolated from Food Products and Clinical Samples

Directory of Open Access Journals (Sweden)

Caplan Marius Eduard

2014-06-01

Full Text Available Listeria monocytogenes are o distribuţie ubiquitară în natură şi poate contamina produsele alimentare de origine animală, provocând infecţii severe la om. Până în prezent există foarte puține date cu privire la profilurile de rezistenţă ale tulpinilor circulante în România. Scopul acestui studiu a fost determinarea pattern-urilor de rezistenţă la antibiotice ale unor tulpini de L. monocytogenes (n=37 izolate din produse alimentare de origine animală şi din probe clinice. Probele din alimente (carne şi produse lactate, au fost colectate în perioada 2009-2013. Probele clinice au fost recoltate de la pacienţi cu septicemie, meningită/meningo-encefalită, cazuri de avort spontan şi nou-născuţi, spitalizaţi în perioada Aprilie 2010 - Aprilie 2013 în trei Instituţii Medicale din Bucureşti: Spitalul Elias, Spitalul Victor Babes si Institutul Naţional de Boli Infecţioase (INBI Matei Bals. Toate tulpinile testate au prezentat rezistenţă la cefalosporine şi acidul nalidixic; o tulpină izolată din melci fierţi a fost rezistentă la Trimetoprim/sulfametoxazol. Rezistenţa unora dintre tulpinile analizate la ampicilina, antibiotic de elecţie pentru terapia infecţiilor cauzate de L. monocytogenes, subliniază necesitatea testării in vitro a sensibilitatii la antibiotice a fiecarui izolat clinic pentru a stabili eficienţa diferitelor antibiotice, precum şi a unor studii epidemiologice extinse în scopul stabilirii profilurilor de rezistenţă ale tulpinilor de L. monocytogenes circulante în ţara noastră.

Blanco White and Walter Scott Blanco white y Walter Scott

Directory of Open Access Journals (Sweden)

Fernando DURÁN LÓPEZ

2011-01-01

Full Text Available The first edition of Ivanhoe; a romance. By the author of Waverley was published in Edinburgh in 1820. From the beginning of year 1823, José María Blanco White translated several excerpts from Ivanhoe in the numbers 1-3 of the magazine Variedades, owned by the publisher Rudolph Ackermann. in these articles and other later writings, the translator praised Scott as a model for a new way of painting history in a narrative. This paper studies his ideas on Scott’s historical novel, as well as his translation technique, compared with that of José Joaquín de Mora. En 1820 se publicó en Edimburgo la primera edición de Ivanhoe; a romance. By the author of Waverley. Desde comienzos de 1823, en los tres primeros números de su revista Variedades, promovida por el editor Rudolph Ackermann, José María Blanco White tradujo varios fragmentos de Ivanhoe entre grandes elogios. Asimismo, Blanco White tomó a Scott como modelo de referencia de una nueva manera de pintar la historia por medio de la novela en otros varios escritos críticos de años posteriores. El artículo estudia las ideas de Blanco White acerca de la novela histórica de Scott y su técnica como traductor, comparada con la de José Joaquín Mora.

Transcription factor σB plays an important role in the production of extracellular membrane-derived vesicles in Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Jung Hwa Lee

Full Text Available Gram-negative bacteria produce extracellular outer membrane vesicles (OMVs that interact with host cells. Unlike Gram-negative bacteria, less is known about the production and role of extracellular membrane vesicles (MVs in Gram-positive bacteria. The food-borne pathogen Listeria monocytogenes can survive under extreme environmental and energy stress conditions and the transcription factor σ(B is involved in this survival ability. Here, we first determined the production of MVs from L. monocytogenes and evaluated whether general stress transcription factor σ(B affected production of MVs in L. monocytogenes. L. monocytogenes secreted MVs during in vitro broth culture. The wild-type strain actively produced MVs approximately nine times more and also produced more intact shapes of MVs than those of the isogenic ΔsigB mutant. A proteomic analysis showed that 130 and 89 MV proteins were identified in the wild-type and ΔsigB mutant strains, respectively. Wild-type strain-derived MVs contained proteins regulated by σ(B such as transporters (OpuCA and OpuCC, stress response (Kat, metabolism (LacD, translation (InfC, and cell division protein (FtsZ. Gene Ontology (GO enrichment analysis showed that wild-type-derived MV proteins corresponded to several GO terms, including response to stress (heat, acid, and bile resistance and extracellular polysaccharide biosynthetic process, but not the ΔsigB mutant. Internalin B (InlB was almost three times more contained in MVs derived from the wild-type strain than in MVs derived from the ΔsigB mutant. Taken together, these results suggest that σ(B plays a pivotal role in the production of MVs and protein profiles contained in MVs. L. monocytogenes MVs may contribute to host infection and survival ability under various stressful conditions.

Comprehensive update of dalbavancin activity when tested against uncommonly isolated streptococci, Corynebacterium spp., Listeria monocytogenes, and Micrococcus spp. (1357 strains).

Science.gov (United States)

Jones, Ronald N; Stilwell, Matthew G

2013-06-01

Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.

Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

Science.gov (United States)

Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

2017-04-01

In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

Potential Impact of the Resistance to Quaternary Ammonium Disinfectants on the Persistence of Listeria monocytogenes in Food Processing Environments.

Science.gov (United States)

Martínez-Suárez, Joaquín V; Ortiz, Sagrario; López-Alonso, Victoria

2016-01-01

The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations.

Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

Science.gov (United States)

Valderrama, W B; Mills, E W; Cutter, C N

2009-11-01

Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

Directory of Open Access Journals (Sweden)

ALESSANDRA PARO RODRIGUES CESAR

2011-06-01

Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

Thermal inactivation of Listeria monocytogenes and Salmonella spp. in sous-vide processed marinated chicken breast

Science.gov (United States)

The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60C in one h...

Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

Science.gov (United States)

Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

2018-04-27

The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

The combination of energy-dependent internal adaptation mechanisms and external factors enables Listeria monocytogenes to express a strong starvation survival response during multiple-nutrient starvation.

Science.gov (United States)

Lungu, Bwalya; Saldivar, Joshua C; Story, Robert; Ricke, Steven C; Johnson, Michael G

2010-05-01

The goal of this study was to characterize the starvation survival response (SSR) of a wild-type Listeria monocytogenes 10403S and an isogenic DeltasigB mutant strain during multiple-nutrient starvation conditions over 28 days. This study examined the effects of inhibitors of protein synthesis, the proton motive force, substrate level phosphorylation, and oxidative phosphorylation on the SSR of L. monocytogenes 10403S and a DeltasigB mutant during multiple-nutrient starvation. The effects of starvation buffer changes on viability were also examined. During multiple-nutrient starvation, both strains expressed a strong SSR, suggesting that L. monocytogenes possesses SigB-independent mechanism(s) for survival during multiple-nutrient starvation. Neither strain was able to express an SSR following starvation buffer changes, indicating that the nutrients/factors present in the starvation buffer could be a source of energy for cell maintenance and survival. Neither the wild-type nor the DeltasigB mutant strain was able to elicit an SSR when exposed to the protein synthesis inhibitor chloramphenicol within the first 4 h of starvation. However, both strains expressed an SSR when exposed to chloramphenicol after 6 h or more of starvation, suggesting that the majority of proteins required to elicit an effective SSR in L. monocytogenes are likely produced somewhere between 4 and 6 h of starvation. The varying SSRs of both strains to the different metabolic inhibitors under aerobic or anaerobic conditions suggested that (1) energy derived from the proton motive force is important for an effective SSR, (2) L. monocytogenes utilizes an anaerobic electron transport during multiple-nutrient starvation conditions, and (3) the glycolytic pathway is an important energy source during multiple-nutrient starvation when oxygen is available, and less important under anaerobic conditions. Collectively, the data suggest that the combination of energy-dependent internal adaptation mechanisms

Collection of Listeria monocytogenes Isolates from Milk, Dairy Products and Food Processing Environments in Slovakia for the Purposes of European Molecular Database

OpenAIRE

Kubicová Z.; Filipová M.; Jurovčíková J.; Cabanová L

2017-01-01

The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB)” in 2012 led by the European Union Reference Laboratory (EURL) for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Foo...

Detection of antimicrobial sensitiveness of isolates of Listeria monocytogenes from food chain using Vitek 2 Compact Biomerieux

Directory of Open Access Journals (Sweden)

Jankuloski Dean

2010-05-01

Full Text Available Sensitivity of 26 Listeria monocytogenes isolates toward 18 antimicrobial substances used in veterinary and human medicine was examined using the automated VITEK 2 Compact system bioMerieux. The obtained results indicate that L. monocytogenes strains isolated from food and food processing environment had resistance to several or more antimicrobial substances that are commonly used in the treatment in animals and humans. Results showed resistance of all 26 (100% isolates toward Benzylpenicilin, Ampicilin/Sublactam, Oxacillin, Imipenem and Fosfomycine. Also 7 of the isolates (26.9% were resistant to Clindamiycin, 3 (11.5% to Quinupristion/Dalfopristin and 1 strain to Teicoplanin, Vancomycin, Tetracycline and Fusic acid, respectively.

Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

Science.gov (United States)

Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

2011-06-01

This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

Inhibition of Listeria monocytogenes by Lactobacillus bavaricus MN in beef systems at refrigeration temperatures.

OpenAIRE

Winkowski, K; Crandall, A D; Montville, T J

1993-01-01

The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...

Increased Adhesion of Listeria monocytogenes Strains to Abiotic Surfaces under Cold Stress

Directory of Open Access Journals (Sweden)

Bo-Hyung Lee

2017-11-01

Full Text Available Food contamination by Listeria monocytogenes remains a major concern for some food processing chains, particularly for ready-to-eat foods, including processed foods. Bacterial adhesion on both biotic and abiotic surfaces is a source of contamination by pathogens that have become more tolerant or even persistent in food processing environments, including in the presence of adverse conditions such as cold and dehydration. The most distinct challenge that bacteria confront upon entry into food processing environments is the sudden downshift in temperature, and the resulting phenotypic effects are of interest. Crystal violet staining and the BioFilm Ring Test® were applied to assess the adhesion and biofilm formation of 22 listerial strains from different serogroups and origins under cold-stressed and cold-adapted conditions. The physicochemical properties of the bacterial surface were studied using the microbial adhesion to solvent technique. Scanning electron microscopy was performed to visualize cell morphology and biofilm structure. The results showed that adhesion to stainless-steel and polystyrene was increased by cold stress, whereas cold-adapted cells remained primarily in planktonic form. Bacterial cell surfaces exhibited electron-donating properties regardless of incubation temperature and became more hydrophilic as temperature decreased from 37 to 4°C. Moreover, the adhesion of cells grown at 4°C correlated with affinity for ethyl acetate, indicating the role of cell surface properties in adhesion.

REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-02-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-10-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

Directory of Open Access Journals (Sweden)

Sonia Lamon

2015-01-01

Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE.

Science.gov (United States)

Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne

2013-08-16

Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

Fødevarebetinget listeria monocytogenes endokarditis

DEFF Research Database (Denmark)

Frydland, Martin; Bundgaard, Henning; Moser, Claus

2014-01-01

Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

2015-01-01

The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

Directory of Open Access Journals (Sweden)

Shi Wu

Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

2015-01-01

The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Virulence factors and resistance to antimicrobials in Listeria monocytogenes serotype 1/2c isolated from food.

Science.gov (United States)

Gelbíčová, T; Pantůček, R; Karpíšková, R

2016-08-01

The aim of this study was to assess the potential risk posed to the human population by the presence of Listeria monocytogenes serotype 1/2c in food based on the characterization of virulence factors of Listeria involved in the invasion of host cells and sensitivity to antimicrobial agents. In addition to sequencing of the inlA and inlB genes, the presence of genes lapB, aut, fbpA, ami, vip and llsX was tested. A premature stop codon (PMSC) in the inlA gene was detected in all tested strains of serotype 1/2c and, concurrently, two novel PMSC mutation types were identified. However, neither PMSC in the inlB gene nor deletion of the lapB, aut, fbpA, ami and vip genes were found in any of the strains. The presence of the llsX gene was not confirmed. Even though all L. monocytogenes strains showed sensitivity to the tested antimicrobials on the basis of their phenotype, sequencing revealed the presence of IS1542 insertion in the inlA gene, indicating the possibility of sharing of mobile genetic elements associated with antimicrobial resistance among strains. Other than the presence of PMSCs in the inlA gene, no PMSC in inlB or deletion of other factors linked to the invasiveness of listeria were detected. Tested strains showed sensitivity to antibiotics used in the therapy of listeriosis. Strains of L. monocytogenes serotype 1/2c typically carry a PMSC in the inlA gene, but these strains still represent a potential threat to public health. The possibility of transfer of IS1542, associated with resistance to vancomycin, between enterococci and Listeria spp. was revealed. © 2016 The Society for Applied Microbiology.

An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

Directory of Open Access Journals (Sweden)

Laura Bifulco

2013-01-01

Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

Isolation of a bacteriocin-producing Lactococcus lactis subsp. lactis and application to control Listeria monocytogenes in Moroccan jben.

Science.gov (United States)

Benkerroum, N; Oubel, H; Zahar, M; Dlia, S; Filali-Maltouf, A

2000-12-01

Use of a bacteriocin-producing lactococcal strain to control Listeria monocytogenes in jben. A Lactococcus lactis strain isolated from lben was shown, by the spot technique, to produce a bacteriocin different from nisin. Inhibitory activity of the bacteriocin-producing strain against Listeria monocytogenes was investigated in jben, made from cow's milk fermented with the producer organism and contaminated with 104 or 107 cfu ml-1. Listeria counts were monitored during manufacture, and during conservation at room and at refrigeration temperatures. Results showed that the pathogen was reduced by 2.7 logarithmic units after 30 h of jben processing when the initial inoculum of 107 cfu ml(-1) was used. For the initial inoculum of 104 cfu ml(-1), the bacterium was completely eliminated at 24 h. Furthermore, the use of the bacteriocin-producing starter culture extended the shelf-life of jben by 5 days. In situ production of the lactococcal bacteriocin is an efficient biological means of controlling L. monocytogenes in jben and of allowing shelf-life extension. The proposed technology will essentially benefit minimally processed dairy products and those made with raw milk.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

Science.gov (United States)

Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

2017-01-01

The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

The Majority of Genotypes of the Virulence Gene inlA Are Intact among Natural Watershed Isolates of Listeria monocytogenes from the Central California Coast.

Directory of Open Access Journals (Sweden)

Lisa Gorski

Full Text Available Internalin A is an essential virulence gene involved in the uptake of the foodborne pathogen Listeria monocytogenes into host cells. It is intact in clinical strains and often truncated due to Premature Stop Codons (PMSCs in isolates from processed foods and processing facilities. Less information is known about environmental isolates. We sequenced the inlA alleles and did Multi Locus Variable Number Tandem Repeat Analysis (MLVA on 112 L. monocytogenes isolates from a 3-year period from naturally contaminated watersheds near a leafy green growing area in Central California. The collection contained 14 serotype 1/2a, 12 serotype 1/2b, and 86 serotype 4b strains. Twenty-seven different inlA alleles were found. Twenty-three of the alleles are predicted to encode intact copies of InlA, while three contain PMSCs. Another allele has a 9-nucleotide deletion, previously described for a clinical strain, indicating that it is still functional. Intact inlA genes were found in 101 isolates, and 8 isolates contained the allele predicted to contain the 3-amino acid deletion. Both allele types were found throughout the 3-year sampling period. Three strains contained inlA alleles with PMSCs, and these were found only during the first 3 months of the study. SNP analysis of the intact alleles indicated clustering of alleles based on serotype and lineage with serotypes 1/2b and 4b (lineage I strains clustering together, and serotype 1/2a (lineage II strains clustering separately. The combination of serotype, MLVA types, and inlA allele types indicate that the 112 isolates reflect at least 49 different strains of L. monocytogenes. The finding that 90% of environmental L. monocytogenes isolates contain intact inlA alleles varies significantly from isolates found in processing plants. This information is important to public health labs and growers as to the varieties of L. monocytogenes that could potentially contaminate fresh produce in the field by various means.

Persistent and non-persistent strains of Listeria monocytogenes: A focus on growth kinetics under different temperature, salt, and pH conditions and their sensitivity to sanitizers.

Science.gov (United States)

Magalhães, R; Ferreira, V; Brandão, T R S; Palencia, R Casquete; Almeida, G; Teixeira, P

2016-08-01

This study aimed to investigate the effect of different conditions, including temperature (37 °C, 22 °C, and 4 °C), NaCl concentrations (2.5%, 4%, and 8%), and acidity (pH = 5), on the growth response of persistent and non-persistent isolates of Listeria monocytogenes. The resistance to two common sanitizers (benzalkonium chloride and hydrogen peroxide) was also investigated. A selected group of 41 persistent and non-persistent L. monocytogenes isolates recovered from three cheese processing plants during a previous longitudinal study was assembled. Average lag time was similar for persistent and non-persistent isolates grown at 37 °C, 22 °C and 4 °C but significantly shorter (p < 0.05) for persistent isolates grown at 2.5%, 4% and 8% NaCl, and at pH 5. Average growth rates were significantly higher (p < 0.05) for persistent than for non-persistent isolates when grown at 22 °C, 2.5%, 4% and 8% NaCl, and at pH 5. These results suggest that persistent strains may be better adapted to grow under stressful conditions frequently encountered in food processing environments than non-persistent strains. No relation between persistence and resistance to the tested sanitizers was found. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

DEFF Research Database (Denmark)

Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

2017-01-01

elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

Characterization of Listeria monocytogenes isolates from cattle and ground beef by pulsed-field gel electrophoresis Caracterización de aislamientos de Listeria monocytogenes obtenidos de ganado y de carne molida de vacuno por electroforesis de campo pulsado

Directory of Open Access Journals (Sweden)

Claudia Foerster

2012-09-01

Full Text Available The aims of this study were to determine the occurrence of Listeria monocytogenes in cattle feces and ground beef, to characterize these strains by pulsed-field gel electrophoresis and to compare them to three listeria strains found in humans. Cattle from different origins (n = 250 and ground beef obtained from supermarkets (n = 40 were sampled. The results show low occurrence in cattle feces (0.4 % but a higher presence in ground beef (37 %. An important part of the ground beef strains (80 % had > 95 % similarity with a strain isolated from a human sporadic case and the ATCC 19115 used as control. The strain isolated from cattle feces had 93 % similarity to clone 009, previously associated with a listeriosis outbreak related to cheese. Cattle and ground beef can harbor virulent L. monocytogenes strains. Further studies in animals and animal products are needed to improve listeriosis control.Los objetivos de este estudio fueron determinar la presencia de Listeria monocytogenes en el ganado y en la carne molida de vacuno comercializada en Chile, caracterizar los aislados mediante electroforesis de campo pulsado y compararlos con los obtenidos en tres cepas que han producido listeriosis en humanos, en ese país. Se tomaron muestras de heces de bovinos (n = 250 y de carne molida obtenida en supermercados (n = 40. Se encontró una baja incidencia de este patógeno en las heces de bovinos (0,4 %; un solo animal, pero mayores porcentajes en la carne molida (37 %. Gran parte de las cepas encontradas en la carne molida (80 % mostraron una similitud mayor del 95 % con un caso esporádico de listeriosis y con la cepa de referencia ATCC 19115. La cepa aislada de bovino tuvo un 93 % de similitud con el clon 009, responsable de un brote asociado al consumo de queso, ocurrido en 2008. Se concluye que el ganado y la carne molida pueden albergar cepas virulentas de L. monocytogenes. Se necesita un mayor número de estudios en animales y en los productos que se

Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

Directory of Open Access Journals (Sweden)

Wanessa Altimiras Costa

2009-12-01

Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

Rapid differentiation of Listeria monocytogenes epidemic clones III and IV and their intact compared with heat-killed populations using Fourier transform infrared spectroscopy and chemometrics.

Science.gov (United States)

Nyarko, Esmond B; Puzey, Kenneth A; Donnelly, Catherine W

2014-06-01

The objectives of this study were to determine if Fourier transform infrared (FT-IR) spectroscopy and multivariate statistical analysis (chemometrics) could be used to rapidly differentiate epidemic clones (ECs) of Listeria monocytogenes, as well as their intact compared with heat-killed populations. FT-IR spectra were collected from dried thin smears on infrared slides prepared from aliquots of 10 μL of each L. monocytogenes ECs (ECIII: J1-101 and R2-499; ECIV: J1-129 and J1-220), and also from intact and heat-killed cell populations of each EC strain using 250 scans at a resolution of 4 cm(-1) in the mid-infrared region in a reflectance mode. Chemometric analysis of spectra involved the application of the multivariate discriminant method for canonical variate analysis (CVA) and linear discriminant analysis (LDA). CVA of the spectra in the wavelength region 4000 to 600 cm(-1) separated the EC strains while LDA resulted in a 100% accurate classification of all spectra in the data set. Further, CVA separated intact and heat-killed cells of each EC strain and there was 100% accuracy in the classification of all spectra when LDA was applied. FT-IR spectral wavenumbers 1650 to 1390 cm(-1) were used to separate heat-killed and intact populations of L. monocytogenes. The FT-IR spectroscopy method allowed discrimination between strains that belong to the same EC. FT-IR is a highly discriminatory and reproducible method that can be used for the rapid subtyping of L. monocytogenes, as well as for the detection of live compared with dead populations of the organism. Fourier transform infrared (FT-IR) spectroscopy and multivariate statistical analysis can be used for L. monocytogenes source tracking and for clinical case isolate comparison during epidemiological investigations since the method is capable of differentiating epidemic clones and it uses a library of well-characterized strains. The FT-IR method is potentially less expensive and more rapid compared to genetic

Purification of leucocin A for use on wieners to inhibit Listeria monocytogenes in the presence of spoilage organisms.

Science.gov (United States)

Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M

2017-08-16

The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further

Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

Directory of Open Access Journals (Sweden)

V. López

2006-12-01

. monocytogenes strains. Despite this great step forward, there is not a single marker available to test the virulence of field isolates of this species. In the future, the combination of different molecular markers will probably allow the screening of food contamination by only the virulent clones of L. monocytogenes, thus improving the prevention of foodborne human listeriosis.

Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

Science.gov (United States)

Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

2017-01-01

ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and

Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

Science.gov (United States)

Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

2017-06-30

Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

Science.gov (United States)

Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

2014-01-01

The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

Use of results of microbiological analyses for risk-based control of Listeria monocytogenes in marinated broiler legs.

Science.gov (United States)

Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura

2008-02-10

Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

Science.gov (United States)

Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

2018-01-01

High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

ASK Talks with W. Scott Cameron

Science.gov (United States)

Cameron, W. Scott

2002-01-01

This paper presents an interview with Scott Cameron who is the Capital Systems Manager for the Food and Beverage Global Business Unit of Procter and Gamble. He has been managing capital projects and mentoring other project managers for the past 20 years at Procter and Gamble within its Beauty Care, Health Care, Food and Beverage, and Fabric and Home Care Businesses. Scott also has been an Academy Sharing Knowledge (ASK) feature writer since Volume One.

Knudsen effects in a Scott effect experiment.

Science.gov (United States)

Wells, C. W.; Wood, L. T.; Hildebrandt, A. F.

1973-01-01

A thermal torque sometimes observed in Scott effect measurements has been studied experimentally and an explanation for the thermal torque proposed. The magnitude of the thermal torque can be comparable to the Scott torque depending on geometrical and thermal anisotropies. The thermal torque is predicted to decrease with application of an axial magnetic field.

Impact of preheating on the behavior of Listeria monocytogenes in a broth that mimics Camembert cheese composition.

Science.gov (United States)

Helloin, E; Bouttefroy, A; Gay, M; Phan Thanh, L

2003-02-01

The effect of preheating on the survival of L. monocytogenes in Richard's broth, which mimics the composition of Camembert cheese composition, was examined. Experiments were carried out to reproduce contamination of cheese with environmental heat-stressed cells of L. monocytogenes surviving hot-cleaning procedures. Cells in mid-log phase were heated for 30 min at 56 degrees C before being inoculated into Richard's broth. The pHs and temperatures of Richard's broth were chosen to recreate the conditions of curd dripping (pH 5, 25 degrees C), of the beginning of cheese ripening (pH 5, 12 degrees C), and of the beginning (pH 5, 4 degrees C) and the end (pH 7, 4 degrees C) of cheese storage. Immediately after heat treatment, the viability loss was especially high for strain 306715, which exhibited only 0.6% +/- 0.2% survival, compared with 22% +/- 8.7% for strain EGD. The percentages of the surviving heated cells that were injured were 93% +/- 8% for strain 306715 and 98% +/- 3% for strain EGD. The destruction of the surviving L. monocytogenes cells was accelerated when they encountered the pH and temperature conditions of Camembert cheese during manufacturing, ripening, and cold storage (pH 5 at 25, 12, and 4 degrees C, respectively). The multiplication of the surviving heated cells was retarded under favorable growth conditions similar to those of storage by the distributor and the consumer (pH 7 at 4 and 12 degrees C, respectively).

Metric Scott analysis

Czech Academy of Sciences Publication Activity Database

Ben Yaacov, I.; Doucha, Michal; Nies, A.; Tsankov, T.

2017-01-01

Roč. 318, October (2017), s. 46-87 ISSN 0001-8708 Institutional support: RVO:67985840 Keywords : continuous logic * infinitary logic * Scott sentence Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 1.373, year: 2016 http://www.sciencedirect.com/science/article/pii/S0001870816309896?via%3Dihub

Relativistic Scott correction in self-generated magnetic fields

DEFF Research Database (Denmark)

Erdos, Laszlo; Fournais, Søren; Solovej, Jan Philip

2012-01-01

/3}$ and it is unchanged by including the self-generated magnetic field. We prove the first correction term to this energy, the so-called Scott correction of the form $S(\\alpha Z) Z^2$. The current paper extends the result of \\cite{SSS} on the Scott correction for relativistic molecules to include a self......-generated magnetic field. Furthermore, we show that the corresponding Scott correction function $S$, first identified in \\cite{SSS}, is unchanged by including a magnetic field. We also prove new Lieb-Thirring inequalities for the relativistic kinetic energy with magnetic fields....

Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

Science.gov (United States)

Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

2016-01-01

Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

Listeria monocytogenes efficiently invades caco-2 cells after low-temperature storage in broth and on deli meat

DEFF Research Database (Denmark)

Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne

2010-01-01

The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart...... infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p ... to invade Caco-2 cells was compared after growth on a fermented sausage and on cured cooked ham to that of bacteria grown in BHI broth supplemented with salt. Samples were stored under chilling conditions for up to 4 weeks. The results showed no difference (p > 0.05) in invasiveness after 7 days at 10...

Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

Science.gov (United States)

Jahan, M; Holley, R A

2016-04-01

Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

Influence of processing steps in cold-smoked salmon production on survival and growth of persistent and presumed non-persistent Listeria monocytogenes

DEFF Research Database (Denmark)

Porsby, Cisse Hedegaard; Vogel, Birte Fonnesbech; Mohr, Mona

2008-01-01

conditions, (ii) fillets of salmon cold-smoked in a pilot plant and finally, (iii) assessment of the bacterial levels before and after processing during commercial scale production. L. monocytogenes proliferated on salmon blocks that were brined or dipped in liquid smoke and left at 25 degrees C......Cold-smoked salmon is a ready-to-eat product in which Listeria monocytogenes sometimes can grow to high numbers. The bacterium can colonize the processing environment and it is believed to survive or even grow during the processing steps. The purpose of the present study was to determine...... if the steps in the processing of cold-smoked salmon affect Survival and subsequent growth of a persistent strain of L. monocytogenes to a lesser degree than presumed non-persistent strains. We used a sequence of experiments increasing in complexity: (i) small salmon blocks salted, smoked or dried under model...

Collection of Listeria monocytogenes Isolates from Milk, Dairy Products and Food Processing Environments in Slovakia for the Purposes of European Molecular Database

Directory of Open Access Journals (Sweden)

Kubicová Z.

2017-03-01

Full Text Available The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB” in 2012 led by the European Union Reference Laboratory (EURL for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Food Safety, France in close collaboration with Applied Maths. This database includes the typing results and epidemiological information on strains isolated from food, environmental or animal samples and it is in connection with human strains database TESSy (The European Surveillance System led by the ECDC (European Centre for Disease Prevention and Control. In total 147 L. monocytogenes isolates were examined by PFGE (pulsed field gel electrophoresis in 2014—2015 in VFI Dolny Kubin from different sources. Nearly half (68 of the 147 isolates in the national Slovak database came from milk or dairy products samples and the related manufacturing environment. In this work, 68 isolates associated with milk were selected and divided into 27 clusters (95 % similarity level after combined comparison analysis (AscI and ApaI by BioNumerics 6.6 software. Eight clusters included three or more similar PFGE profiles.

Genetic diversity of internalin genes in the ascB-dapE locus among Listeria monocytogenes lineages III and IV strains.

Science.gov (United States)

Chen, Jianshun; Cheng, Changyong; Lv, Yonghui; Fang, Weihuan

2013-09-01

Listeria monocytogenes is an important foodborne pathogen encompassing four phylogenetic lineages. Lineages III and IV are rare, but have been reported to show considerable biodiversity, providing important clues for the evolutionary history in Listeria. In this study, analysis of the ascB-dapE locus reveals genetic diversity in lineages III and IV, and is consistent with the classification of sublineages. Four of the six genetic patterns (two of sublineage IIIC and two of lineage IV) are specific to these two lineages. The ascB-dapE locus suggests a hot spot for genome diversification, and serves as an attractive molecular marker for better understanding of the biodiversity and population structure of lineages III and IV strains. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Irf3 polymorphism alters induction of interferon beta in response to Listeria monocytogenes infection.

Directory of Open Access Journals (Sweden)

Oleg Garifulin

2007-09-01

Full Text Available Genetic makeup of the host plays a significant role in the course and outcome of infection. Inbred strains of mice display a wide range of sensitivities to Listeria monocytogenes infection and thus serve as a good model for analysis of the effect of genetic polymorphism. The outcome of L. monocytogenes infection in mice is influenced by the ability of this bacterium to induce expression of interferon beta mRNA, encoded in mouse by the Ifnb1 (interferon beta 1, fibroblast gene. Mouse strains that lack components of the IFN beta signaling pathway are substantially more resistant to infection. We found that macrophages from the ByJ substrain of the common C57BL/6 inbred strain of mice are impaired in their ability to induce Ifnb1 expression in response to bacterial and viral infections. We mapped the locus that controls differential expression of Ifnb1 to a region on Chromosome 7 that includes interferon regulatory factor 3 (Irf3, which encodes a transcription factor responsible for early induction of Ifnb1 expression. In C57BL/6ByJ mice, Irf3 mRNA was inefficiently spliced, with a significant proportion of the transcripts retaining intron 5. Analysis of the Irf3 locus identified a single base-pair polymorphism and revealed that intron 5 of Irf3 is spliced by the atypical U12-type spliceosome. We found that the polymorphism disrupts a U12-type branchpoint and has a profound effect on the efficiency of splicing of Irf3. We demonstrate that a naturally occurring change in the splicing control element has a dramatic effect on the resistance to L. monocytogenes infection. Thus, the C57BL/6ByJ mouse strain serves as an example of how a mammalian host can counter bacterial virulence strategies by introducing subtle alteration of noncoding sequences.

Isolation and biochemical and molecular characterization of Listeria monocytogenes in food

International Nuclear Information System (INIS)

Helel, Salma

2008-01-01

monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)

Bias in the Listeria monocytogenes enrichment procedure: Lineage 2 strains outcompete lineage 1 strains in University of Vermont selective enrichments

DEFF Research Database (Denmark)

Bruhn, Jesper Bartholin; Vogel, Birte Fonnesbech; Gram, Lone

2005-01-01

compounds in UVM I and II influenced this bias. The results of the present study demonstrate that the selective procedures used for isolation of L. monocytogenes may not allow a true representation of the types present in foods. Our results could have a significant impact on epidemiological studies...

Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

Directory of Open Access Journals (Sweden)

Ivy Reid A

2008-11-01

Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.

Science.gov (United States)

Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y

2009-09-01

The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

International Nuclear Information System (INIS)

Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

2012-01-01

Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D 10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

Science.gov (United States)

Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

2012-08-01

Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.

Science.gov (United States)

Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie

2017-07-01

Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Sporadic case of listeriosis associated with the consumption of a Listeria monocytogenes-contaminated 'Camembert' cheese.

Science.gov (United States)

Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G

1997-09-01

Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.

Thermal Inactivation of Listeria monocytogenes and Salmonella during Water and Steam Blanching of Vegetables.

Science.gov (United States)

Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M

2017-09-01

Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.

Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Masoumeh Hayati

2017-11-01

Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.

Effect of high pressure processing on reduction of Listeria monocytogenes in packaged Queso Fresco

Science.gov (United States)

The effect of high hydrostatic pressure processing (HPP) on the survival of a five-strain rifampicin-resistant cocktail of Listeria monocytogenes in Queso Fresco (QF) was evaluated as a post-packaging intervention. QF was made using pasteurized, homogenized milk, was starter-free and was not pressed...

Impact of environmental factors on the culturability and viability of Listeria monocytogenes under conditions encountered in food processing plants.

Science.gov (United States)

Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier

2017-03-06

The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

Philip Glass, Scott Walker ja Sigur Ros! / Immo Mihkelson

Index Scriptorium Estoniae

Mihkelson, Immo, 1959-

2007-01-01

Pimedate Ööde 11. filmifestivali muusikafilme - Austraalia "Glass: Philipi portree 12 osas" (rež. Scott Hicks), Islandi "Sigur Ros kodus" (rež. Dean DeBois), Suurbritannia "Scott Walker: 30 Century Man" (rež. Stephen Kijak)

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

Directory of Open Access Journals (Sweden)

Jessica A. Gray

2018-04-01

Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

Science.gov (United States)

Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

2018-01-01

High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

Science.gov (United States)

Ericson, Megan E.; Frank, Matthew W.

2016-01-01

Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

Science.gov (United States)

Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

2017-09-01

Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

Science.gov (United States)

Hwang, Cheng-An; Sheen, Shiowshuh

2011-05-01

This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

DEFF Research Database (Denmark)

Zhu, Xinna; Long, Fei; Chen, Yonghui

2008-01-01

Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

2017-01-01

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

Oxygen restriction increases the infective potential of Listeria monocytogenes in vitro in Caco-2 cells and in vivo in guinea pigs

Directory of Open Access Journals (Sweden)

Licht Tine

2007-06-01

Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.

Generative complexity of Gray-Scott model

Science.gov (United States)

Adamatzky, Andrew

2018-03-01

In the Gray-Scott reaction-diffusion system one reactant is constantly fed in the system, another reactant is reproduced by consuming the supplied reactant and also converted to an inert product. The rate of feeding one reactant in the system and the rate of removing another reactant from the system determine configurations of concentration profiles: stripes, spots, waves. We calculate the generative complexity-a morphological complexity of concentration profiles grown from a point-wise perturbation of the medium-of the Gray-Scott system for a range of the feeding and removal rates. The morphological complexity is evaluated using Shannon entropy, Simpson diversity, approximation of Lempel-Ziv complexity, and expressivity (Shannon entropy divided by space-filling). We analyse behaviour of the systems with highest values of the generative morphological complexity and show that the Gray-Scott systems expressing highest levels of the complexity are composed of the wave-fragments (similar to wave-fragments in sub-excitable media) and travelling localisations (similar to quasi-dissipative solitons and gliders in Conway's Game of Life).

Sensitivity of Listeria monocytogenes to irradiation

International Nuclear Information System (INIS)

Tarjan, Veronika

1990-01-01

Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

Inhibition of Listeria monocytogenes on cooked cured chicken breasts by acidified coating containing allyl isothiocyanate or deodorized Oriental mustard extract.

Science.gov (United States)

Olaimat, Amin N; Holley, Richard A

2016-08-01

Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.

Listening in the Silences for Fred Newton Scott

Science.gov (United States)

Mastrangelo, Lisa

2009-01-01

As part of her recent sabbatical, the author proposed going to the University of Michigan Bentley Archives to do research on Fred Newton Scott, founder and chair of the Department of Rhetoric and teacher from 1889 to 1926 at the University of Michigan. Scott ran the only graduate program in rhetoric and composition in the country between those…

The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

DEFF Research Database (Denmark)

Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

2011-01-01

The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono......-killed cells of L. monocytogenes have no effect on luxS transcription. The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes...

77 FR 7182 - Scott W. Houghton, M.D.; Decision and Order

Science.gov (United States)

2012-02-10

... DEPARTMENT OF JUSTICE Drug Enforcement Administration [Docket No. 12-09] Scott W. Houghton, M.D... CFR 0.100(b), I order that DEA Certificate of Registration BH8796077, issued to Scott W. Houghton, M.D., be, and it hereby is, revoked. I further order that any pending application of Scott W. Houghton, M.D...

Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.

Science.gov (United States)

Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun

2007-03-01

Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.

Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Application in the control of Listeria monocytogenes in fresh Minas-type goat cheese

Directory of Open Access Journals (Sweden)

Danielle N. Furtado

2015-03-01

Full Text Available Listeria monocytogenes is a pathogen frequently found in dairy products. Its control in fresh cheeses is difficult, due to the psychrotrophic properties and salt tolerance. Bacteriocinogenic lactic acid bacteria (LAB with proven in vitro antilisterial activity can be an innovative technological approach but their application needs to be evaluated by means of in situ tests. In this study, a novel bacteriocinogenic Lactococcus lactis strain (Lc. lactis DF4Mi, isolated from raw goat milk, was tested for control of growth of L. monocytogenes in artificially contaminated fresh Minas type goat cheese during storage under refrigeration. A bacteriostatic effect was achieved, and counts after 10 days were 3 log lower than in control cheeses with no added LAB. However, this effect did not differ significantly from that obtained with a non-bacteriocinogenic Lc. lactis strain. Addition of nisin (12.5 mg/kg caused a rapid decrease in the number of viable L. monocytogenes in the cheeses, suggesting that further studies with the purified bacteriocin DF4Mi may open new possibilities for this strain as biopreservative in dairy products.

Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland

Directory of Open Access Journals (Sweden)

Dara eLeong

2014-08-01

Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.

Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland.

Science.gov (United States)

Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran

2014-01-01

Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.

In vitro and in vivo invasiveness of different pulsed-field get electrophoresis types of Listeria monocytogenes

DEFF Research Database (Denmark)

Larsen, Charlotte Nexmann; Nørrung, Birgit; Sommer, Helle Mølgaard

2002-01-01

The virulence of different pulsed-field gel electrophoresis (PFGE) types of Listeria monocytogenes was examined by monitoring their ability to invade Caco-2 cells. Strains belonging to seven different PFGE types originating from both foods and humans were included. No significant differences...

Lineage specific recombination rates and microevolution in Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Nightingale Kendra K

2008-10-01

Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

Thermal resistance of Listeria monocytogenes in sausage meat.

Science.gov (United States)

Farber, J M; Hughes, A; Holley, R; Brown, B

1989-01-01

The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.

STS-87 Mission Specialist Winston E. Scott suits up

Science.gov (United States)

1997-01-01

STS-87 Mission Specialist Winston Scott dons his launch and entry suit with the assistance of a suit technician in the Operations and Checkout Building. This is Scotts second space flight. He and the five other crew members will depart shortly for Launch Pad 39B, where the Space Shuttle Columbia awaits liftoff on a 16-day mission to perform microgravity and solar research. Scott is scheduled to perform an extravehicular activity spacewalk with Mission Specialist Takao Doi, Ph.D., of the National Space Development Agency of Japan, during STS-87. He also performed a spacewalk on STS-72.

Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria.

Science.gov (United States)

Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto

2016-01-01

The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

Pilot-scale continuous ultrasonic cleaning equipment reduces Listeria monocytogenes levels on conveyor belts.

Science.gov (United States)

Tolvanen, Riina; Lundén, Janne; Hörman, Ari; Korkeala, Hannu

2009-02-01

Ultrasonic cleaning of a conveyor belt was studied by building a pilot-scale conveyor with an ultrasonic cleaning bath. A piece of the stainless steel conveyor belt was contaminated with meat-based soil and Listeria monocytogenes strains (V1, V3, and B9) and incubated for 72 h to allow bacteria to attach to the conveyor belt surfaces. The effect of ultrasound with a potassium hydroxide-based cleaning detergent was determined by using the cleaning bath at 45 and 50 degrees C for 30 s with and without ultrasound. The detachment of L. monocytogenes from the conveyor belt caused by the ultrasonic treatment was significantly greater at 45 degrees C (independent samples t test, P conveyor belt is effective even with short treatment times.

Antimicrobial activity of reuterin produced by Lactobacillus reuteri on Listeria monocytogenes in cold-smoked salmon.

Science.gov (United States)

Montiel, R; Martín-Cabrejas, I; Langa, S; El Aouad, N; Arqués, J L; Reyes, F; Medina, M

2014-12-01

Lactobacillus reuteri INIA P579 was used for the production and purification of reuterin. The purity of reuterin was assessed by high resolution electrospray ionization mass spectrometry (HRESIMS) and nuclear magnetic resonance (NMR) spectroscopy. After purification, reuterin concentration obtained was 1.3 M. The inhibitory activity using Escherichia coli K12 as indicator strain was estimated to be 510 AU/ml. Survival curves in tryptic soy broth revealed that reuterin required to inhibit the growth of three Listeria monocytogenes strains was in the range of 2-4 AU/ml. Purified reuterin (10 AU/g) significantly reduced the growth of L. monocytogenes in cold-smoked salmon kept under moderate or strong temperature abuse conditions. After 15 d at 8 °C, cold-smoked salmon with added reuterin exhibited L. monocytogenes counts 2.0 log CFU/g lower than control smoked salmon with no reuterin added. At 30 °C, reuterin also controlled the growth of the pathogen, with counts 1.4 and 0.9 log CFU/g lower than those observed in control smoked salmon after 24 and 48 h, respectively. The addition of purified reuterin might be used as a hurdle technology to improve the safety and extend the shelf-life of lightly preserved seafood products such as cold-smoked salmon. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Agr communication system provides a benefit to the populations of Listeria monocytogenes in soil.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Piveteau, Pascal

2014-01-01

In this study, we investigated whether the Agr communication system of the pathogenic bacterium Listeria monocytogenes was involved in adaptation and competitiveness in soil. Alteration of the ability to communicate, either by deletion of the gene coding the response regulator AgrA (response-negative mutant) or the signal pro-peptide AgrD (signal-negative mutant), did not affect population dynamics in soil that had been sterilized but survival was altered in biotic soil suggesting that the Agr system of L. monocytogenes was involved to face the complex soil biotic environment. This was confirmed by a set of co-incubation experiments. The fitness of the response-negative mutant was lower either in the presence or absence of the parental strain but the fitness of the signal-negative mutant depended on the strain with which it was co-incubated. The survival of the signal-negative mutant was higher when co-cultured with the parental strain than when co-cultured with the response-negative mutant. These results showed that the ability to respond to Agr communication provided a benefit to listerial cells to compete. These results might also indicate that in soil, the Agr system controls private goods rather than public goods.

Staphylococcus aureus but not Listeria monocytogenes adapt to triclosan and adaptation correlates with increased fabI expression and agr deficiency

DEFF Research Database (Denmark)

Nielsen, Lene Nørby; Larsen, Marianne Halberg; Skovgaard, Sissel

2013-01-01

was initially 4 mg/L and remained unaltered by the exposure. The adapted S. aureus isolates retained normal colony size but displayed increased expression of fabI encoding an essential enzyme in bacterial fatty acid synthesis. Also, they displayed decreased or no expression of the virulence associated agr......C of the agr quorum sensing system. While most adapted strains of USA300 carried mutations in fabI, none of the adapted strains of 8325-4 did. Conclusions. Adaptability to triclosan varies substantially between Gram positive human pathogens. S. aureus displayed an intrinsically lower MIC for triclosan compared...... to L. monocytogenes but was easily adapted leading to the same MIC as L. monocytogenes. Even though all adapted S. aureus strains over-expressed fabI and eliminated expression of the agr quorum sensing system, adaptation in USA300 involved fabI mutations whereas this was not the case for 8325-4. Thus...

Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

Directory of Open Access Journals (Sweden)

Moutong eChen

2015-09-01

Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

Purification of the bacteriocin bavaricin MN and characterization of its mode of action against Listeria monocytogenes Scott A cells and lipid vesicles.

Science.gov (United States)

Kaiser, A L; Montville, T J

1996-12-01

Bavaricin MN was purified from Lactobacillus sake culture supernatant 135-fold with a final yield of 11%. Sequence analysis revealed bavaricin MN to be a 42-amino-acid peptide having a molecular weight of 4,769 and a calculated pI of 10.0. Computer analysis indicated that the C-terminal region may form an alpha-helical structure with an amphipathic nature deemed important in the interaction of bacteriocins with biological membranes. Bavaricin MN rapidly depleted the membrane potential (delta p) of energized Listeria monocytogenes cells in a concentration-dependent fashion. At a bavaricin MN concentration of 9.0 micrograms/ml, the delta p decreased by 85%. Both the electrical potential (delta psi) and Z delta pH components of the delta p were depleted, and this depletion was not dependent on a threshold level of proton motive force. In addition to studying the effect of bavaricin MN on the delta p of vegetative cells, bavaricin MN-induced carboxyfluorescein (CF) efflux from L. monocytogenes-derived lipid vesicles was also characterized. Bavaricin MN-induced CF leakage was also concentration dependent with an optimum of pH 6.0. The rate of CF efflux was 63% greater in lipid vesicles in which a delta psi was generated compared with that in lipid vesicles in the absence of a delta psi.

[Microbiological characterisation of Listeria monocytogenes isolates from human cases in Andalusia].

Science.gov (United States)

Lepe, José A; Torres, María José; Liró, Julia; Luque, Rafael; Aznar, Javier

2012-12-01

The aim of this study was to perform a retrospective study by genotyping 154 isolates from human listeriosis cases occurred in the region of Andalusia (southern Spain) in the period 2005-2009. Serotyping was performed for 1 and 4 somatic antigens using commercial Listeria antisera, and by multiplex-PCR serogrouping according to the method described by Doumith et al. (2004). The antimicrobial susceptibility was performed by Epsilon test and interpreted by CLSI criteria. PFGE was performed according to the PulseNet protocol with the ApaI enzyme. The similarity of PFGE profiles was evaluated using the Bionumerics software. The multiplex PCR protocol described by Chen and Knabel (2007) was used for the identification of isolates belonging to L. monocytogenes ECI, ECII, and ECIII epidemic clones. The 154 isolates were grouped into four serotypes: 4b [94 (61%)] strains, 1/2b [30 (19%)] strains, 1/2a [27 (18%)] strains, and 1/2c [3 (2%)] strains, with 100% of susceptibility to ampicillin and cotrimoxazole. A further sixty-two ApaI distinct pulsotypes were recognized. Thirty-seven isolates (24%) showed unique ApaI pulsotypes, and the remaining 117 strains (76%) were assigned to 25 ApaI clusters (60% in clusters of more than two isolates). The EC markers were found in 62 (40.3%) of the L. monocytogenes isolates tested. The ECI marker was present in 43 (46.2%) 4b serotype isolates, ECII in 10 (10.7%) 4b serotype isolates, and ECIII in 9 (33,3%) 1/2a serotype isolates. A large proportion of the human listeriosis cases under investigation could be grouped into molecular subtype clusters, and our cases could be related to international food-borne outbreaks. Copyright © 2011 Elsevier España, S.L. All rights reserved.

Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.

Science.gov (United States)

Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A

2016-01-01

The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

A Microplate Growth Inhibition Assay for Screening Bacteriocins against Listeria monocytogenes to Differentiate Their Mode-of-Action

Directory of Open Access Journals (Sweden)

Paul Priyesh Vijayakumar

2015-06-01

Full Text Available Lactic acid bacteria (LAB have historically been used in food fermentations to preserve foods and are generally-recognized-as-safe (GRAS by the FDA for use as food ingredients. In addition to lactic acid; some strains also produce bacteriocins that have been proposed for use as food preservatives. In this study we examined the inhibition of Listeria monocytogenes 39-2 by neutralized and non-neutralized bacteriocin preparations (Bac+ preps produced by Lactobacillus curvatus FS47; Lb. curvatus Beef3; Pediococcus acidilactici Bac3; Lactococcus lactis FLS1; Enterococcus faecium FS56-1; and Enterococcus thailandicus FS92. Activity differences between non-neutralized and neutralized Bac+ preps in agar spot assays could not readily be attributed to acid because a bacteriocin-negative control strain was not inhibitory to Listeria in these assays. When neutralized and non-neutralized Bac+ preps were used in microplate growth inhibition assays against L. monocytogenes 39-2 we observed some differences attributed to acid inhibition. A microplate growth inhibition assay was used to compare inhibitory reactions of wild-type and bacteriocin-resistant variants of L. monocytogenes to differentiate bacteriocins with different modes-of-action (MOA whereby curvaticins FS47 and Beef3, and pediocin Bac3 were categorized to be in MOA1; enterocins FS92 and FS56-1 in MOA2; and lacticin FLS1 in MOA3. The microplate bacteriocin MOA assay establishes a platform to evaluate the best combination of bacteriocin preparations for use in food applications as biopreservatives against L. monocytogenes.

A Microplate Growth Inhibition Assay for Screening Bacteriocins against Listeria monocytogenes to Differentiate Their Mode-of-Action.

Science.gov (United States)

Vijayakumar, Paul Priyesh; Muriana, Peter M

2015-06-11

Lactic acid bacteria (LAB) have historically been used in food fermentations to preserve foods and are generally-recognized-as-safe (GRAS) by the FDA for use as food ingredients. In addition to lactic acid; some strains also produce bacteriocins that have been proposed for use as food preservatives. In this study we examined the inhibition of Listeria monocytogenes 39-2 by neutralized and non-neutralized bacteriocin preparations (Bac+ preps) produced by Lactobacillus curvatus FS47; Lb. curvatus Beef3; Pediococcus acidilactici Bac3; Lactococcus lactis FLS1; Enterococcus faecium FS56-1; and Enterococcus thailandicus FS92. Activity differences between non-neutralized and neutralized Bac+ preps in agar spot assays could not readily be attributed to acid because a bacteriocin-negative control strain was not inhibitory to Listeria in these assays. When neutralized and non-neutralized Bac+ preps were used in microplate growth inhibition assays against L. monocytogenes 39-2 we observed some differences attributed to acid inhibition. A microplate growth inhibition assay was used to compare inhibitory reactions of wild-type and bacteriocin-resistant variants of L. monocytogenes to differentiate bacteriocins with different modes-of-action (MOA) whereby curvaticins FS47 and Beef3, and pediocin Bac3 were categorized to be in MOA1; enterocins FS92 and FS56-1 in MOA2; and lacticin FLS1 in MOA3. The microplate bacteriocin MOA assay establishes a platform to evaluate the best combination of bacteriocin preparations for use in food applications as biopreservatives against L. monocytogenes.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

Science.gov (United States)

Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

2015-04-01

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

Science.gov (United States)

Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

2016-01-01

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

Collaborations Between Scott and Skidmore

Directory of Open Access Journals (Sweden)

Alicia Robinson

2017-04-01

Full Text Available This essay examines the collaboration between architect and designer George Gilbert Scott and metalworker Francis Skidmore. It compares their metalwork screens at the cathedrals of Hereford, Lichfield, and Salisbury—projects which sometimes overlapped and were all completed in the relatively short time span between 1861 and 1870—within the wider context of Skidmore’s career. While Scott was lauded in his lifetime and has been much studied since, Skidmore has not often been written about, despite having achieved an impressive scale and pace of work in British cathedrals, parish churches, and town halls. This essay therefore shines particular light on Skidmore’s work as designer and maker, and particularly the high profile commissions for these great cathedrals, restored and enhanced with the aesthetics and ambition of the Victorian era.

Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

Directory of Open Access Journals (Sweden)

N. Soultos

2014-11-01

Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil Susceptibilidade antimicrobiana de cepas humanas de Listeria monocytogenes isoladas no período de 1970 a 2008 no Brasil

Directory of Open Access Journals (Sweden)

Cristhiane Moura Falavina dos Reis

2011-04-01

Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.INTRODUÇÃO: Listeria monocytogenes é o agente etiológico da listeriose, doença de origem alimentar que acomete principalmente grávidas, pacientes imunodeprimidos e idosos. O tratamento primário é a associação de

First Trimester Listeria monocytogenes Septicemia

NARCIS (Netherlands)

Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

1997-01-01

Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

International Nuclear Information System (INIS)

Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

2009-01-01

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

Science.gov (United States)

Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

2009-07-01

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

Energy Technology Data Exchange (ETDEWEB)

Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

2009-07-15

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Genotypic and virulence characteristics of Listeria monocytogenes recovered from food items in Lebanon.

Science.gov (United States)

Haidar-Ahmad, Nathaline; Kissoyan, Kohar Annie B; Fadlallah, Sukayna M; El-Hajj, Rima; Saleh, Majd; Ghosn, Nada; Matar, Ghassan M

2016-08-02

Listeria monocytogenes is the agent of listeriosis, a life threatening foodborne disease for immunocompromised patients and pregnant women. This bacterium is not routinely screened for in Lebanon and there is lack of data about the prevalent strains and their potential pathogenicity. To that purpose, this study was undertaken to characterize L. monocytogenes from various food products, by assessing the in vitro biofilm forming ability, detecting their virulence potential, and characterizing them at the strain level. Fifty-nine isolates were obtained from the Lebanese Agriculture Research Institute (LARI). They were collected in 2012-2013 from local and imported food products in the Lebanese market. Biofilm formation was measured using the Microtiter Plate Assay. PCR amplification was performed for three main virulence genes; hly, actA, and inlB. Pulsed field gel electrophoresis (PFGE) and BIONUMERICS analysis were carried out. Lebanese isolates from cheese and raw meat showed higher biofilm formation than imported and Lebanese seafood isolates. A total of 100% of the isolates were PCR positive for hly and actA genes and 98.3% for inlB gene. PFGE analysis demonstrated the prevalence of 13 different subtypes with 100% similarity. Detected subtypes were grouped into 6 clusters of 90% genomic similarity. Clustered subtypes were particular to the country of origin. This study highlights the presence of L. monocytogenes in the Lebanese food market with high pathogenic potential and stresses the importance of enhanced surveillance and the implementation of strict regulations on local and imported food. Future investigations may be conducted on a larger food selection.

Co-Culture with Listeria monocytogenes within a Dual-Species Biofilm Community Strongly Increases Resistance of Pseudomonas putida to Benzalkonium Chloride

Science.gov (United States)

Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

2013-01-01

Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation. PMID:24130873

Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

Directory of Open Access Journals (Sweden)

Efstathios Giaouris

Full Text Available Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS, as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC used in inadequate (sub-lethal concentration (50 ppm. The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90% of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

Listeria monocytogenes, a down-to-earth pathogen.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

2013-01-01

Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

Etude de l'impact de la variation de la température sur les activités ...

African Journals Online (AJOL)

Etude de l'impact de la variation de la température sur les activités microbiennes : application à une population de Listeria monocytogenes CIP 7831, Listeria monocytogenes Scott A CIP 103575 et Escherichia coli ATCC 25922.

Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

Science.gov (United States)

Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

2014-09-01

A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

The effect of ozone and open air factor on surface-attached and biofilm environmental Listeria monocytogenes.

Science.gov (United States)

Nicholas, R; Dunton, P; Tatham, A; Fielding, L

2013-08-01

The effects of gaseous ozone and open air factor (OAF) on environmental Listeria monocytogenes attached to three common food contact surfaces were investigated. Listeria monocytogenes on different food contact surfaces was treated with ozone and OAF. Microbiological counts, scanning electron microscopy (SEM) and atomic force microscopy (AFM) were performed. Ozone at 10 ppm gave <1-log reduction when L. monocytogenes was attached to stainless steel, while 45 ppm gave a log reduction of 3.41. OAF gave better log reductions than 10 ppm ozone, but lower log reductions than 45 ppm. Significant differences were found between surfaces. Biofilm organisms were significantly more resistant than those surface attached on stainless steel. SEM and AFM demonstrated different membrane and cell surface modifications following ozone or OAF treatment. The strain used demonstrated higher resistance to ozone than previous studies. This may be due to the fact that it was isolated from a food manufacturing premises that used oxidizing disinfectants. OAF was more effective at reducing the levels of the organism than an ozone concentration of 10 ppm. Pathogen management strategies must account for resistance of environmental strains when validating cleaning and disinfection. OAF has shown potential for surface decontamination compared with ozone. SEM and AFM are valuable tools for determining mechanisms of action of antimicrobial agents. © 2013 The Society for Applied Microbiology.

Comparison of the growth of Listeria monocytogenes in unirradiated and irradiated cook-chill roast beef and gravy at refrigeration temperatures

International Nuclear Information System (INIS)

Grant, I.R.; Nixon, C.R.; Patterson, M.F.

1993-01-01

Specific growth rates of two strains of Listeria monocytogenes in unirradiated and irradiated (2 kGy) roast beef and gravy stored at 5° and 10°C were found to be similar. However, exponential growth of L. monocytogenes after irradiation was preceded by an extended lag period of 6–9 d at 5°C and 3–4 d at 10°C, compared with lag periods of 1–2 d and <0.1 d in unirradiated beef and gravy stored similarly

Immersion infection of germ-free zebrafish with Listeria monocytogenes induces transient expression of innate immune response genes

Directory of Open Access Journals (Sweden)

Ying eShan

2015-04-01

Full Text Available Zebrafish, Denio rerio, could be an alternative to other classic animal models for human infectious diseases to examine the processes of microbial infections and host-pathogen interactions in vivo because of their small body dimension but large clutch size. We established germ-free zebrafish infection models of Listeria monocytogenes through different routes of infection: oral immersion and injection via yolk sac, brain ventricle and blood island. Immersion of zebrafish larva even with 1010CFU/mL L. monocytogenes EGDe strain in egg water was unable to cause mortality, but GFP-expressing bacteria in the gut lumen could be observed in frozen sections. Several selected maker genes of the innate immune system, including cyp1a, irg1l, il1b and mmp9, were significantly induced by oral immersion not only with strain EGDe, but also with strain M7 and L. innocua, though to a lesser degree (P < 0.01. Such induction appears to be transient with peak at 48 h post-infection, but returned to basal level at 72 h post-infection. Of the three injection routes, mortality after infection by yolk sac was 80% in early stage of infection. Few eggs could survive and hatch. Injection into zebrafish embryos via brain ventricle or blood island led to progressive lethal infection. L. mocytogenes EGDe showed steady replication in the fish embryos and was far more pathogenic than strain M7, which is consistent with findings in the murine model. We conclude that zebrafish could serve as susceptible and microscopically visible infection models for L. monocytogenes via different routes and could be applied to further studies on the interactions between bacterial virulence factors and host immune responses.

Heroes for the past and present: a century of remembering Amundsen and Scott.

Science.gov (United States)

Roberts, Peder

2011-12-01

In 1911-1912 Roald Amundsen and Robert Falcon Scott led rival parties in a race to the geographic South Pole. While both parties reached the Pole--Amundsen first--Scott's men died on the return journey. Amundsen became a Norwegian icon through his record-setting travels; Scott became a symbol of courage and devotion to science. The memory of each was invoked at various points during the twentieth century in the context of contemporary Antarctic events. Scott's status as a scientific figure was central to the Scott Polar Research Institute, while Amundsen's lack of scientific legacy became a way for British polar explorers to differentiate themselves from Norwegian contemporaries during the interwar years. After 1945 Scott and Amundsen were again invoked as exemplars of national polar achievement, even as the rise of large-scale science on the continent overshadowed past British and Norwegian achievements. In the present Amundsen and Scott remain wedded to particular values, focused respectively on national achievement and sacrifice in the name of science, while their race has become secondary. Copyright © 2011 Elsevier Ltd. All rights reserved.

Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks.

Directory of Open Access Journals (Sweden)

Laurel S Burall

Full Text Available In an effort to build a comprehensive genomic approach to food safety challenges, the FDA has implemented a whole genome sequencing effort, GenomeTrakr, which involves the sequencing and analysis of genomes of foodborne pathogens. As a part of this effort, we routinely sequence whole genomes of Listeria monocytogenes (Lm isolates associated with human listeriosis outbreaks, as well as those isolated through other sources. To rapidly establish genetic relatedness of these genomes, we evaluated tetranucleotide frequency analysis via the JSpecies program to provide a cursory analysis of strain relatedness. The JSpecies tetranucleotide (tetra analysis plots standardized (z-score tetramer word frequencies of two strains against each other and uses linear regression analysis to determine similarity (r2. This tool was able to validate the close relationships between outbreak related strains from four different outbreaks. Included in this study was the analysis of Lm strains isolated during the recent caramel apple outbreak and stone fruit incident in 2014. We identified that many of the isolates from these two outbreaks shared a common 4b variant (4bV serotype, also designated as IVb-v1, using a qPCR protocol developed in our laboratory. The 4bV serotype is characterized by the presence of a 6.3 Kb DNA segment normally found in serotype 1/2a, 3a, 1/2c and 3c strains but not in serotype 4b or 1/2b strains. We decided to compare these strains at a genomic level using the JSpecies Tetra tool. Specifically, we compared several 4bV and 4b isolates and identified a high level of similarity between the stone fruit and apple 4bV strains, but not the 4b strains co-identified in the caramel apple outbreak or other 4b or 4bV strains in our collection. This finding was further substantiated by a SNP-based analysis. Additionally, we were able to identify close relatedness between isolates from clinical cases from 1993-1994 and a single case from 2011 as well as

On Scott-Phillips' General Account of Communication.

Science.gov (United States)

Planer, Ronald J

2017-12-01

The purpose of this paper is to critically engage with a recent attempt by Thom Scott-Phillips to offer a general account of communication. As a general account, it is intended to apply equally well to both non-human and human interactions which are prima facie communicative in character. However, so far, Scott-Phillips has provided little detail regarding how his account is supposed to apply to the latter set of cases. After presenting what I take to be the most plausible way of filling in those details, I argue that his account would appear to be too narrow: it (minimally) fails to capture a range of human interactions which strike us as instances of communication. To wit, these are cases in which some but not all of the information an act is designed to convey to a reactor actually reaches that reactor. An alternative account incorporating Scott-Phillips' main insights is then sketched, and it is suggested that this account, or something like it, would accommodate the full range of non-human and human interactions that are intuitively communicative.

In Vitro Study of Berberis vulgaris, Actinidia deliciosa and Allium cepa L. Antibacterial Effects on Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Anzabi Younes

2015-10-01

Full Text Available Objective: One control method of pathogenic microorganisms is using synthetic chemical preservatives and antibiotics. Because of being generally recognized as safe, antibacterial compounds with organic origin are considered important for health. This study was done in order to investigate the antibacterial effects of methanol extracts of the Berberis vulgaris (Barberry, Actinidia deliciosa (Kiwi and Allium cepa L. (Onions on the standard strain (ATCC:19114 of Listeria monocytogenes (L. monocytogenes, as it seems that it is possible to find some important organic and health safe anti-Listerial compounds. Materials and Methods: After collecting the mentioned plants phytology study was done. Then methanol extracts of named plants were prepared and antibacterial effects of these plants against the mentioned strain of L. monocytogenes by the Disk Diffusion, minimum inhibitory concentration (MIC and minimal bactericidal concentration (MBC methods were performed. Also Ampicillin (10 μg/disc was used as the reference antibacterial substance. In order to find the relationship between antibacterial properties of plants extracts independent t test, chi-square and analysis of variance (ANOVA tests were used. Results: Results showed that the extracts of all the three studied plants had antibacterial effects on L. monocytogenes. Average diagonal of growing area in disk diffusion test for barberry, kiwi and onions in order was 12, 15.5 and 11 mm. Also MIC of mentioned plants extracts in order was 125, 62.5, and 125 μg/ml and MBC of named plants was 500, 250 and 500 μg/ ml, respectively. Conclusion: The results of this work showed that methanol extracts of kiwi had stronger anti-Listerial effect than barberry’s and onion’s extracts.

Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

Science.gov (United States)

Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

2012-01-01

The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

Science.gov (United States)

Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

2017-01-16

The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

2015-08-01

In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The biofilm formation ability of Listeria monocytogenes isolated from meat, poultry, fish and processing plant environments is related to serotype and pathogenic profile of the strains

Directory of Open Access Journals (Sweden)

Domenico Meloni

2012-10-01

Full Text Available In the present study, the relationships between serotype, pathogenic profile and in vitro biofilm formation of 106 Listeria monocytogenes strains, having no epidemiological correlation and isolated from different environmental and food sources, were analyzed. The quantitative assessment of the in vitro biofilm formation was carried out by using a microtiter plate assay with spectrophotometric reading (OD620. The isolates were also submitted to serogrouping using the target genes lmo0737, lmo1118, ORF2819, ORF2110, prs, and to the evaluation of the presence of the following virulence genes: prfA, hlyA, rrn, inlA, inlB, iap, plcA, plcB, actA and mpl, by multiplex PCRs. The 62% of the strains showed weak or moderate in vitro ability in biofilm formation, in particular serotypes 1/2b and 4b, frequently associated with sporadic or epidemic listeriosis cases. The 25% of these isolates showed polymorphism for the actA gene, producing a fragment of 268-bp instead of the expected 385-bp. The deletion of nucleotides in this gene seems to be related to enhanced virulence properties among these strains. Strains belonging to serotypes associated with human infections and characterized by pathogenic potential are capable to persist within the processing plants forming biofilm.

Mixed species biofilms of Listeria monocytogenes and Lactobacillus plantarum show enhanced resistance to benzalkonium chloride and peracetic acid

NARCIS (Netherlands)

Veen, van der S.; Abee, T.

2011-01-01

We investigated the formation of single and mixed species biofilms of Listeria monocytogenes strains EGD-e and LR-991, with Lactobacillus plantarum WCFS1 as secondary species, and their resistance to the disinfectants benzalkonium chloride and peracetic acid. Modulation of growth, biofilm formation,

The Effect of Oxygen on Bile Resistance in Listeria monocytogenes

Science.gov (United States)

Wright, Morgan L; Pendarvis, Ken; Nanduri, Bindu; Edelmann, Mariola J; Jenkins, Haley N; Reddy, Joseph S; Wilson, Jessica G; Ding, Xuan; Broadway, Paul R; Ammari, Mais G; Paul, Oindrila; Roberts, Brandy; Donaldson, Janet R

2016-01-01

Listeria monocytogenes is a Gram-positive facultative anaerobe that is the causative agent of the disease listeriosis. The infectious ability of this bacterium is dependent upon resistance to stressors encountered within the gastrointestinal tract, including bile. Previous studies have indicated bile salt hydrolase activity increases under anaerobic conditions, suggesting anaerobic conditions influence stress responses. Therefore, the goal of this study was to determine if reduced oxygen availability increased bile resistance of L. monocytogenes. Four strains representing three serovars were evaluated for changes in viability and proteome expression following exposure to bile in aerobic or anaerobic conditions. Viability for F2365 (serovar 4b), EGD-e (serovar 1/2a), and 10403S (serovar 1/2a) increased following exposure to 10% porcine bile under anaerobic conditions (P 0.05) in bile resistance between aerobic and anaerobic conditions, indicating that oxygen availability does not influence resistance in this strain. The proteomic analysis indicated F2365 and EGD-e had an increased expression of proteins associated with cell envelope and membrane bioenergetics under anaerobic conditions, including thioredoxin-disulfide reductase and cell division proteins. Interestingly, HCC23 had an increase in several dehydrogenases following exposure to bile under aerobic conditions, suggesting that the NADH:NAD+ is altered and may impact bile resistance. Variations were observed in the expression of the cell shape proteins between strains, which corresponded to morphological differences observed by scanning electron microscopy. These data indicate that oxygen availability influences bile resistance. Further research is needed to decipher how these changes in metabolism impact pathogenicity in vivo and also the impact that this has on susceptibility of a host to listeriosis. PMID:27274623

Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

DEFF Research Database (Denmark)

Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.

2008-01-01

-type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10) were similar in activity profile (MIC value spectrum......Background Host defense peptides (HDPs), or antimicrobial peptides (AMPs), are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases...... Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs...

Characterization of Antimicrobial Resistance of Listeria monocytogenes Strains Isolated from a Pork Processing Plant and Its Respective Meat Markets in Southern China

DEFF Research Database (Denmark)

Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

2016-01-01

A total of 78 Listeria monocytogenes isolates from a pork processing plant and the respective meat markets in southern China were examined. This number includes 60 isolates from pork at markets, 5 from cooked pork products at markets, 10 from pork at a processing plant, and 3 from food......, ampicillin/sulbactam, imipenem, ciprofloxacin, levofloxacin, trimethoprim/sulfamethoxazole, and vancomycin. Two isolates were resistant to five antimicrobials. Twelve strains carried tet(M) and located on Tn916. PFGE analysis revealed genetic heterogeneity among individual serotypes. Two predominant PFGE...... types were found persistent from the processing plant to markets indicating that these two types of isolates were able to survive under environmental adverse conditions from the processing plant to markets, which need to be monitored. Compared to samples from the pork processing plant, the prevalence of...

Reduced host cell invasiveness and oxidative stress tolerance in double and triple csp gene family deletion mutants of Listeria monocytogenes.

Science.gov (United States)

Loepfe, Chantal; Raimann, Eveline; Stephan, Roger; Tasara, Taurai

2010-07-01

The cold shock protein (Csp) family comprises small, highly conserved proteins that bind nucleic acids to modulate various bacterial gene expressions. In addition to cold adaptation functions, this group of proteins is thought to facilitate various cellular processes to promote normal growth and stress adaptation responses. Three proteins making up the Listeria monocytogenes Csp family (CspA, CspB, and CspD) promote both cold and osmotic stress adaptation functions in this bacterium. The contribution of these three Csps in the host cell invasion processes of L. monocytogenes was investigated based on human Caco-2 and murine macrophage in vitro cell infection models. The DeltacspB, DeltacspD, DeltacspAB, DeltacspAD, DeltacspBD, and DeltacspABD strains were all significantly impaired in Caco-2 cell invasion compared with the wild-type strain, whereas in the murine macrophage infection assay only, the double (DeltacspBD) and triple (DeltacspABD) csp mutants were also significantly impaired in cell invasion compared with the wild-type strain. The DeltacspBD and DeltacspABD mutants displayed the most severely impaired invasion phenotypes. The invasion ability of these two mutant strains was also further analyzed using cold-stress-exposed organisms. In both cell infection models a significant reduction in invasiveness was observed after cold stress exposure of Listeria organisms. The negative impact of cold stress on subsequent cell invasion ability was, however, more severe in cold-sensitive csp mutants (DeltacspBD and DeltacspABD) compared with the wild type. The impaired macrophage invasion and intracellular growth of DeltacspBD and DeltacspABD also led us to examine oxidative stress resistance capacity in these two mutant strains. Both strains also displayed higher oxidative stress sensitivity relative to the wild-type strain. Our data indicate that besides cold and osmotic stress adaptation roles, Csp family proteins also promote efficient host cell invasion and

Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

DEFF Research Database (Denmark)

Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.

2005-01-01

Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... units under circumstances where filamentation may occur. Furthermore, the study illustrates the lack of residual inhibitory effect of CO2 in this type of products after opening....... in air and CO2.. Septation and cell division were induced in the filaments after a CO2 downshift (i.e., exposure to air). In BHI, the number of colony forming units increased rapidly when L. monocytogenes EGD grown in CO2 was exposed to air whereas the number of L. monocytogenes LO28 remained almost...

Prevalence and molecular characteristics of Listeria monocytogenes in cooked products and its comparison with isolates from listeriosis cases.

Science.gov (United States)

Wang, Hong; Luo, Lijuan; Zhang, Zhengdong; Deng, Jianping; Wang, Yan; Miao, Yimao; Zhang, Ling; Chen, Xi; Liu, Xiang; Sun, Songsong; Xiao, Bo; Li, Qun; Ye, Changyun

2018-02-01

This study aimed to investigate the prevalence and molecular characteristics of Listeria monocytogenes in cooked products in Zigong City, China. The overall occurrence of the L. monocytogenes in the ready-to-eat (RTE) shops and mutton restaurants surveyed was 16.2% (141/873). An occurrence of 13.5% was observed in RTE pork, 6.5% in RTE vegetables, and more than 24.0% in either cooked mutton or cooked haggis. Serotype 1/2b (45.4%), 1/2a (33.3%), and 1/2c (14.2%) were the predominant types. By comparing the clonal complexes (CCs) based on multilocus sequence typing (MLST) of the L. monocytogenes from cooked foods in Zigong City and 33 listeriosis cases from different districts of China, CC87, CC9, CC8, and CC3 were showed to be prevalent in cooked products and CC87 and CC3 were the first two frequent types in the 33 clinic-source strains. All CC87 stains harbored the newly reported Listeria pathogenicity island 4 (LIPI-4) gene fragment ptsA, and all CC3 strains possessed the Listeria pathogenicity island 3 (LIPI-3) gene fragment llsX. These may increase the occurrence of the strains belonging to CC87 and CC3 in listeriosis cases in China and also underline the risk of infection owing to the consumption of the cooked products from Zigong. ST619 (serotype 1/2b) harbored both llsX and ptsA, indicating a potential hypervirulent sequence type in Zigong.

Screening of the two-component-system histidine kinases of Listeria monocytogenes EGD-e. LiaS is needed for growth under heat, acid, alkali, osmotic, ethanol and oxidative stresses.

Science.gov (United States)

Pöntinen, Anna; Lindström, Miia; Skurnik, Mikael; Korkeala, Hannu

2017-08-01

To study the role of each two-component system (TCS) histidine kinase (HK) in stress tolerance of Listeria monocytogenes EGD-e, we monitored the growth of individual HK deletion mutant strains under heat (42.5 °C), acid (pH 5.6), alkali (pH 9.4), osmotic (6% NaCl), ethanol (3.5 vol%), and oxidative (5 mM H 2 O 2 ) stresses. The growth of ΔliaS (Δlmo1021) strain was impaired under each stress, with the most notable decrease under heat and osmotic stresses. The ΔvirS (Δlmo1741) strain showed nearly completely restricted growth at high temperature and impaired growth in ethanol. The growth of ΔagrC (Δlmo0050) strain was impaired under osmotic stress and slightly under oxidative stress. We successfully complemented the HK mutations using a novel allelic exchange based approach. This approach avoided the copy-number problems associated with in trans complementation from a plasmid. The mutant phenotypes were restored to the wild-type level in the complemented strains. This study reveals novel knowledge on the HKs needed for growth of L. monocytogenes EGD-e under abovementioned stress conditions, with LiaS playing multiple roles in stress tolerance of L. monocytogenes EGD-e. Copyright © 2017 Elsevier Ltd. All rights reserved.

Thermal tolerance of acid-adapted and unadapted Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes in cantaloupe juice and watermelon juice.

Science.gov (United States)

Sharma, M; Adler, B B; Harrison, M D; Beuchat, L R

2005-01-01

A study was performed to determine D values of acid-adapted and unadapted cells of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes in cantaloupe juice and watermelon juice. Salmonella enterica serotype Poona, S. enterica serotype Saphra, two strains of E. coli O157:H7, and two strains of L. monocytogenes were grown in tryptic soy broth (TSB) and TSB supplemented with 1% glucose for 24 h at 37 degrees C. Decimal reduction times (D values) of cells suspended in unpasteurized cantaloupe juice and watermelon juice were determined. Acid-adapted cells of Salmonella and E. coli O157:H7, but not L. monocytogenes, had increased thermal tolerance compared with cells that were not acid-adapted. There was no correlation between soluble solids content of the two types of juice and thermal resistance. Growth of Salmonella and E. coli O157:H7 in cantaloupe juice, watermelon juice, or other acidic milieu, either in preharvest or postharvest environments, may result in cross protection to heat. The pasteurization conditions necessary to achieve elimination of pathogens from these juices would consequently have to be more severe if cells are habituated to acidic environments. Insights from this study provide guidance to developing pasteurization processes to eliminate Salmonella, E. coli O157:H7, and L. monocytogenes in cantaloupe juice and watermelon juice.

Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

Science.gov (United States)

Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

2014-05-01

A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

Listeria monocytogenes: monitoramento desse perigo biológico na cadeia produtiva de frangos do sul do Rio Grande do Sul Listeria monocytogenes: assessing this microbiological hazard in a poultry productive chain in southern Rio Grande do Sul

Directory of Open Access Journals (Sweden)

Élen Silveira Nalério

2009-09-01

/45. It was observed that 51.6% (16/31 from L. monocytogenes strains belonged to serotype 1/2b, 22.5% (7/31 to serotype 4e, 16,1% (5/31 to serotype 1/2a, 6,4% (2/31 to serotype 4b, and 3,2% (1/31 to serotype 1/2c. The spread of L. monocytogenes in the poultry production chain in southern Rio Grande do Sul and the presence of poultry serotypes in cases/outbreaks of listeriosis cause concern to public health.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

STORAGESEVER

2008-09-03

Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

[Listeria monocytogenes nosocomial infection in the maternity ward].

Science.gov (United States)

Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P

1991-01-01

Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.

Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

Science.gov (United States)

Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

2016-11-16

. Both shotgun and 16S rRNA data supported the presence of three slightly variable genomes of L. monocytogenes. Moreover, the draft assembly of a consensus genome of L. monocytogenes from shotgun metagenomic data demonstrated the potential utility of this approach to expedite trace-back of outbreak-associated strains, although further validation will be needed to confirm this utility.

Wave-splitting in the bistable Gray-Scott model

DEFF Research Database (Denmark)

Rasmussen, K.E.; Mazin, W.; Mosekilde, Erik

1996-01-01

The Gray-Scott model describes a chemical reaction in which an activator species grows autocatalytically on a continuously fed substrate. For certain feed rates and activator life times the model shows the coexistence of two homogeneous steady states. The blue state, where the activator concentra......The Gray-Scott model describes a chemical reaction in which an activator species grows autocatalytically on a continuously fed substrate. For certain feed rates and activator life times the model shows the coexistence of two homogeneous steady states. The blue state, where the activator...

Listeria monocytogenes differential transcriptome analysis reveals temperature-dependent Agr regulation and suggests overlaps with other regulons.

Science.gov (United States)

Garmyn, Dominique; Augagneur, Yoann; Gal, Laurent; Vivant, Anne-Laure; Piveteau, Pascal

2012-01-01

Listeria monocytogenes is a ubiquitous, opportunistic pathogenic organism. Environmental adaptation requires constant regulation of gene expression. Among transcriptional regulators, AgrA is part of an auto-induction system. Temperature is an environmental cue critical for in vivo adaptation. In order to investigate how temperature may affect AgrA-dependent transcription, we compared the transcriptomes of the parental strain L. monocytogenes EGD-e and its ΔagrA mutant at the saprophytic temperature of 25°C and in vivo temperature of 37°C. Variations of transcriptome were higher at 37°C than at 25°C. Results suggested that AgrA may be involved in the regulation of nitrogen transport, amino acids, purine and pyrimidine biosynthetic pathways and phage-related functions. Deregulations resulted in a growth advantage at 37°C, but affected salt tolerance. Finally, our results suggest overlaps with PrfA, σB, σH and CodY regulons. These overlaps may suggest that through AgrA, Listeria monocytogenes integrates information on its biotic environment.

Listeria monocytogenes infection in pregnancy and neonatal sepsis

Directory of Open Access Journals (Sweden)

Francesca Pascale

2008-06-01

Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

The effect of milk components and storage conditions on the virulence of Listeria monocytogenes as determined by a Caco-2 cell assay.

Science.gov (United States)

Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin

2013-08-16

Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.

Impairment of the class IIa bacteriocin receptor function and membrane structural changes are associated to enterocin CRL35 high resistance in Listeria monocytogenes.

Science.gov (United States)

Masias, Emilse; Dupuy, Fernando G; da Silva Sanches, Paulo Ricardo; Farizano, Juan Vicente; Cilli, Eduardo; Bellomio, Augusto; Saavedra, Lucila; Minahk, Carlos

2017-07-01

Enterocin CRL35 is a class IIa bacteriocin with anti-Listeria activity. Resistance to these peptides has been associated with either the downregulation of the receptor expression or changes in the membrane and cell walls. The scope of the present work was to characterize enterocin CRL35 resistant Listeria strains with MICs more than 10,000 times higher than the MIC of the WT sensitive strain. Listeria monocytogenes INS7 resistant isolates R2 and R3 were characterized by 16S RNA gene sequencing and rep-PCR. Bacterial growth kinetic was studied in different culture media. Plasma membranes of sensitive and resistant bacteria were characterized by FTIR and Langmuir monolayer techniques. The growth kinetic of the resistant isolates was slower as compared to the parental strain in TSB medium. Moreover, the resistant isolates barely grew in a glucose-based synthetic medium, suggesting that these cells had a major alteration in glucose transport. Resistant bacteria also had alterations in their cell wall and, most importantly, membrane lipids. In fact, even though enterocin CRL35 was able to bind to the membrane-water interface of both resistant and parental sensitive strains, this peptide was only able to get inserted into the latter membranes. These results indicate that bacteriocin receptor is altered in combination with membrane structural modifications in enterocin CRL35-resistant L. monocytogenes strains. Highly enterocin CRL35-resistant isolates derived from Listeria monocytogenes INS7 have not only an impaired glucose transport but also display structural changes in the hydrophobic core of their plasma membranes. Copyright © 2017. Published by Elsevier B.V.

BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

Directory of Open Access Journals (Sweden)

Nilma Cintra Lea

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

Genetics Home Reference: Aarskog-Scott syndrome

Science.gov (United States)

... A characteristic of X-linked inheritance is that fathers cannot pass X-linked traits to their sons. Evidence suggests that Aarskog-Scott syndrome is inherited in an autosomal dominant or autosomal recessive pattern in some families, although ...

Growth of Listeria monocytogenes on a RTE-meat matrix enhances cell invasiveness to mouse J774A.1 macrophages.

Science.gov (United States)

Lin, Chen-Si; Wang, Chinling; Tsai, Hsiang-Jung; Chou, Chung-Hsi

2010-11-15

It remains unclear whether the growth of Listeria monocytogenes on a ready-to-eat (RTE) meat matrix has an impact on the bacterium's pathogenic abilities. In this study, we investigated the impact of environments on virulence by growing L. monocytogenes (F2365 strain) on brain heart infusion agar (BHI), tryptic soy agar (TSA), and RTE turkey meat matrices. Bacteria cultured from these media were harvested and used to infect mouse macrophage cell line J774A.1 with different MOIs to examine their invasion ability. At MOI=10 and 50, the numbers of bacteria recovered from cells infected with turkey-meat-grown Listeria were significantly higher than those from the two nutrient-rich growth media. Additionally, MOI played a role in determining L. monocytogenes recovery rates, since significant differences were found amongst all three groups at low MOI, while no significant differences were found between BHI and TSA groups at high MOI. These results indicate that environmental changes affect the ability of L. monocytogenes to invade and survive intracellularly while grown on RTE-meat matrix. Copyright © 2010 Elsevier B.V. All rights reserved.

Comparison of susceptibility to antibiotics of Staphylococcus aureus isolated from fresh cheeses and clinical samples from the Area Metropolitana and evaluation of the presence of Listeria monocytogenes in the same foodstuff

International Nuclear Information System (INIS)

Piedra Ramirez, Hiryna

2014-01-01

60 samples of fresh cheeses were analyzed from the central markets of Alajuela, Heredia, Cartago and San Jose. Staphylococcus aureus, total coliform and thermotolerant counts were performed, as well as Escherichia coli by the NMP technique. The presence of Listeria monocytogenes was evaluated in 25 g of cheese. The confirmatory identification and sensitivity profile of S. aureus strains were obtained using the Vitek system. L. monocytogenes were identified by means of biochemical tests. The statistical package Statistical Package for the Social Sciences (SPSS) and Excell were used to analyze the data. The presence of fecal contamination was identified as well as S. aureus in fresh cheeses from the four provinces studied. The comparative analysis of S. aureus antibiotic susceptibility profiles from clinical specimens and cheeses, for the majority of antibiotics under study was able to determine that the sensitivity patterns shown have been different. The clinical strains of origin could be observed with a pattern of multiresistance more marked than the strains of alimentary origin. The presence of L. monocytogenes was identified in an important percentage of cheese samples. (author) [es

Biofilm Formation of Listeria monocytogenes on Various Surfaces

Directory of Open Access Journals (Sweden)

M Mahdavi

2007-10-01

Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

An estimating function approach to inference for inhomogeneous Neyman-Scott processes

DEFF Research Database (Denmark)

Waagepetersen, Rasmus Plenge

“This paper is concerned with inference for a certain class of inhomogeneous Neyman-Scott point processes depending on spatial covariates. Regression parameter estimates obtained from a simple estimating function are shown to be asymptotically normal when the “mother” intensity for the Neyman-Scott...

A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

LENUS (Irish Health Repository)

van Pijkeren, Jan Peter

2012-01-31

Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

Directory of Open Access Journals (Sweden)

Domenico Meloni

2015-03-01

Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

Science.gov (United States)

Meloni, Domenico

2015-03-12

The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Listeria monocytogenes as a vector for anti-cancer therapies.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

Diverse genomic location and sequence content of a Listeria monocytogenes chromosomal island harboring heavy metal resistance and other genes

Science.gov (United States)

Listeria monocytogenes remains a major foodborne pathogen with three serotype 4b clonal groups (ECI, ECII, ECIa) repeatedly implicated in human listeriosis. For reasons that are unknown, many of these strains are also resistant to heavy metals, i.e. cadmium and arsenic. The acquisition and fitness i...

Scott Brothers Windows and Doors Information Sheet

Science.gov (United States)

Scott Brothers Windows and Doors (the Company) is located in Bridgeville, Pennsylvania. The settlement involves renovation activities conducted at property constructed prior to 1978, located in Pittsburgh, Pennsylvania.

Inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree by high hydrostatic pressure with/without added ascorbic acid.

Science.gov (United States)

Mukhopadhyay, Sudarsan; Sokorai, Kimberly; Ukuku, Dike; Fan, Xuetong; Juneja, Vijay; Sites, Joseph; Cassidy, Jennifer

2016-10-17

The objective of this research was to evaluate and develop a method for inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree (CP) by high hydrostatic pressure (HHP). Cantaloupe being the most netted varieties of melons presents a greater risk of pathogen transmission. Freshly prepared CP with or without 0.1% ascorbic acid (AA) was inoculated with a bacterial cocktail composed of a three serotype mixture of S. enterica (S. Poona, S. Newport H1275 and S. Stanley H0558) and a mixture of three strains of L. monocytogenes (Scott A, 43256 and 51742) to a population of ca. 10(8)CFU/g. Double sealed and double bagged inoculated CP (ca. 5g) were pressure treated at 300, 400 and 500MPa at 8°C and 15°C for 5min. Data indicated increased inactivation of both Salmonella and Listeria spp. with higher pressure. Log reduction for CP at 300MPa, 8°C for 5min was 2.4±0.2 and 1.6±0.5logCFU/g for Salmonella and Listeria, respectively. Survivability of the pathogens was significantly compromised at 400MPa and 8°C, inactivating 4.5±0.3logCFU/g of Salmonella and 3.0±0.4logCFU/g of Listeria spp. Complete inactivation of the pathogens in the puree (log reduction >6.7logCFU/g), with or without AA, was achieved when the pressure was further increased to 500MPa, except that for Listeria containing no AA at 8°C. Listeria presented higher resistance to pressure treatment compared to Salmonella spp. Initial temperatures (8 and 15°C) had no significant influence on Salmonella log reductions. Log reduction of pathogens increased but not significantly with increase of temperature. AA did not show any significant antimicrobial activity. Viable counts were about 0.2-0.4logCFU/g less in presence of 0.1% AA. These data validate that HHP can be used as an effective method for decontamination of cantaloupe puree. Published by Elsevier B.V.

Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

DEFF Research Database (Denmark)

Jørgensen, Lasse Vigel; Huss, Hans Henrik

1998-01-01

Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

Listeria monocytogenes endophthalmitis following keratoconjunctivitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2014-01-01

Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Paul D Cotter

Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

Co-expression of Nisin Z and Leucocin C as a Basis for Effective Protection Against Listeria monocytogenes in Pasteurized Milk

Directory of Open Access Journals (Sweden)

Yuxin Fu

2018-03-01

Full Text Available Nisin, an important bacteriocin from Lactococcus lactis subsp., is primarily active against various Gram-positive bacteria. Leucocin C, produced by Leuconostoc carnosum 4010, is a class IIa bacteriocin used to inhibit the growth of Listeria monocytogenes. Because two bacteriocins have different modes of action, the combined use of them could be a potential strategy for effective inhibition of foodborne pathogens. In this study, L. lactis N8-r-lecCI (N8 harboring lecCI gene coexpressing nisin–leucocin C was constructed based on the food-grade carrier L. lactis N8. Production of both bacteriocins was stably maintained. Antimicrobial measurements showed that the recombinant strain is effectively against Listeria monocytogenes and Staphylococcus aureus and moderately against Salmonella enterica serovar Enteritidis and Escherichia coli because of its stronger antibacterial activity than the parental strain, this result first demonstrated that the co-expression of nisin and leucocin C results in highly efficient antimicrobial activity. The checkerboard assay showed that the antibacterial activity of L. lactis N8-r-lecCI supernatant was enhanced in the presence of low concentration of EDTA. Analysis of the scanning electron microscope image showed the biggest cellular morphology change in L. monocytogenes treated with a mixture of EDTA and L. lactis N8-r-lecCI supernatant. The practical effect was verified in pasteurized milk through time-kill assay. The L. lactis N8-r-lecCI strain expressing both nisin and leucocin C has a promising application prospect in pasteurized milk processing and preservation because of its strong antibacterial activity.

The role of Listeria monocytogenes cell wall surface anchor protein LapB in virulence, adherence, and intracellular replication

Science.gov (United States)

Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...

78 FR 5854 - Application of Scott Air, LLC for Certificate Authority

Science.gov (United States)

2013-01-28

... DEPARTMENT OF TRANSPORTATION Office of the Secretary Application of Scott Air, LLC for Certificate Authority AGENCY: Department of Transportation. ACTION: Notice of order to show cause (Order 2013-1-12... to show cause why it should not issue an order finding Scott Air, LLC fit, willing, and able, and...

Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

Directory of Open Access Journals (Sweden)

Nilma Cintra Leal

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

A 3-year multi-food study of the presence and persistence of Listeria monocytogenes in 54 small food businesses in Ireland.

Science.gov (United States)

Leong, Dara; NicAogáin, Kerrie; Luque-Sastre, Laura; McManamon, Oisin; Hunt, Karen; Alvarez-Ordóñez, Avelino; Scollard, Johann; Schmalenberger, Achim; Fanning, Séamus; O'Byrne, Conor; Jordan, Kieran

2017-05-16

, highlighting the fact that these pulsotypes are capable of causing disease. Overall, the study shows the diversity of L. monocytogenes strains in the Irish food chain and highlights the ability of many of these strains to persist in food processing environments. The finding that a significant proportion of these pulsotypes are also found in clinical settings highlights the need for continued vigilance by food producers, including frequent sampling and typing of isolates detected. Copyright © 2017 Elsevier B.V. All rights reserved.

Survival of Listeria monocytogenes in low acid italian sausage produced under brazilian conditions Sobrevivência de Listeria monocytogenes em salame tipo italiano de baixa acidez, produzido sob condições brasileiras de fabricação

Directory of Open Access Journals (Sweden)

Roberto Degenhardt

2007-06-01

Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil

Simultaneous and individual quantitative estimation of Salmonella, Shigella and Listeria monocytogenes on inoculated Roma tomatoes (Lycopersicon esculentum var. Pyriforme) and Serrano peppers (Capsicum annuum) using an MPN technique.

Science.gov (United States)

Cabrera-Díaz, E; Martínez-Chávez, L; Sánchez-Camarena, J; Muñiz-Flores, J A; Castillo, A; Gutiérrez-González, P; Arvizu-Medrano, S M; González-Aguilar, D G; Martínez-Gonzáles, N E

2018-08-01

Simultaneous and individual enumeration of Salmonella, Shigella and Listeria monocytogenes was compared on inoculated Roma tomatoes and Serrano peppers using an Most Probable Number (MPN) technique. Samples consisting of tomatoes (4 units) or peppers (8 units) were individually inoculated with a cocktail of three strains of Salmonella, Shigella or L. monocytogenes, or by simultaneous inoculation of three strains of each pathogen, at low (1.2-1.7 log CFU/sample) and high (2.2-2.7 log CFU/sample) inocula. Samples were analyzed by an MPN technique using universal pre-enrichment (UP) broth at 35 °C for 24 ± 2 h. The UP tubes from each MPN series were transferred to enrichment and plating media following adequate conventional methods for isolating each pathogen. Data were analyzed using multifactorial analysis of variance (p  simultaneous), type of bacteria (Salmonella > Shigella and L. monocytogenes), type of sample (UP broth > pepper and tomato), and inoculum level (high > low). The MPN technique was effective for Salmonella on both commodities. Shigella counts were higher on tomatoes compared to peppers, (p < 0.05), and for L. monocytogenes on peppers (p < 0.05). Copyright © 2018 Elsevier Ltd. All rights reserved.

An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Clémentine Henri

2017-11-01

Full Text Available Background/objectives: Whole genome sequencing (WGS has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic data however can be exploited with many different bioinformatics methods like single nucleotide polymorphism (SNP, core-genome multi locus sequence typing (cgMLST, whole-genome multi locus sequence typing (wgMLST or multi locus predicted protein sequence typing (MLPPST on either core-genome (cgMLPPST or pan-genome (wgMLPPST. Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L. monocytogenes.Methods: The clustering methods were evaluated on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near-perfect concordance. The importance of selecting a proper reference when calling SNPs was highlighted, although distances between strains remained identical. The analysis also revealed that the topology of the phylogenetic trees between wgMLST and cgMLST were remarkably similar. The comparison between SNP and cgMLST or SNP and wgMLST approaches showed that the topologies of phylogenic trees were statistically similar with an almost equivalent clustering.Conclusion: Our study revealed high concordance between wgMLST, cgMLST, and SNP approaches which are all suitable for typing of L. monocytogenes. The comparable clustering is an important observation considering that the two approaches have been variously implemented among reference laboratories.

RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

Directory of Open Access Journals (Sweden)

Edith Burbano

2006-05-01

Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

An Overview of Justice in Sir Walter Scott Waverley Novels: The Heart of Mid-Lothian

Directory of Open Access Journals (Sweden)

Enrique García Díaz

2014-12-01

Full Text Available Although Sir Walter Scott is a well-known writer most of his readers know that he became an advocate in 1792, when he was admitted to the bar. Since then Scott and other advocates walked the floor at Parliament House (home of the Faculty of Advocates and the Court of Session waiting to be hired. Scott’s own experiences as a fledgling advocate are echoed in those of Alain Fairford in his novel Redgauntlet (Scott 1824, which provides a vivid picture of Parliament House in the eighteenth century. During his life, Scott combined extensive writing and editing issues with his daily work as Clerk of Session and Sheriff-Depute of Selkirkshire. Walter Scott was not unaware of Justice and Law and The Heart of Mid-Lothian is the novel in which he introduces to the reader the Scottish Legal System during the eighteenth century. However, there are few more examples that I will explain. Aunque Sir Walter Scott es un conocido escritor, la mayoría de sus lectores saben que en 1792 se hizo abogado, cuando fue admitido en el colegio de abogados. Desde entonces Scott y otros abogados rondaron el Parlamento con la esperanza de ser contratados. Las propias experiencias de Scott como un abogado novel se reflejan en las de Alain Fairford en su novela Redgauntlet (Scott 1824, lo que ofrece una vívida imagen del Parlamento (sede de la facultad de Derecho y Tribunal Supremo en el siglo XVIII. Durante su vida, Scott compaginó una profusa actividad como escritor y editor con su trabajo diario como juez en Selkirk. Walter Scott conocía la justicia y el derecho y El corazón de Mid-Lothian es la novela en la presenta al lector el régimen jurídico de Escocia durante el siglo XVIII. Sin embargo, se explicarán algunos otros ejemplos. DOWNLOAD THIS PAPER FROM SSRN: http://ssrn.com/abstract=2543538

Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

Science.gov (United States)

Shoughy, Samir S; Tabbara, Khalid F

2014-01-01

Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

Executive dysfunctions as part of the behavioural phenotype of Aarskog-Scott syndrome

NARCIS (Netherlands)

Egger, J.I.M.; Verhoeven, W.M.A.; Janssen, G.T.L.; Aken, L. van; Hoogeboom, A.J.M.

2012-01-01

Introduction Aarskog syndrome (AAS) also called Aarskog-Scott syndrome faciodigitogenital syndrome or faciogenital dysplasia is a genetically heterogeneous developmental disorder, first described in 1970 by the Norwegian pediatrician Dagfin Aarskog and further delineated by Scott in 1971. It is a

Antimicrobial Resistance, Virulence Profile, and Molecular Characterization of Listeria monocytogenes Isolated from Ready-to-eat Food in China, 2013-2014.

Science.gov (United States)

Yan, Shao Fei; Wang, Wei; Bai, Li; Hu, Yu Jie; Dong, Yin Ping; Xu, Jin; Li, Feng Qin

2016-06-01

We aimed to investigate the potential pathogenic profile and antibiotic resistance of Listeria monocytogenes isolated from ready-to-eat food in China. Antimicrobial resistance was determined by broth microdilution following the Clinical and Laboratory Standards Institute protocol. Molecular serotyping, virulence, and resistance genes were identified using PCR. Multi-locus sequence typing was performed on resistant strains. A total of 11.53% (113/980) isolates were resistant, from which 82.3% (93/113) harbored all the virulence genes tested. The resistant strains were subtyped into 18 sequence types (STs), from which ST2, ST5, ST8, and ST9 were involved in listeriosis. This study indicated that several L. monocytogenes isolates from ready-to-eat foods in China have pathogenic potential and are resistant to antibiotics, including antibiotics used as medicines by humans for listeriosis treatment. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

Directory of Open Access Journals (Sweden)

Maysa A. I. Awadallah

2014-10-01

Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

Science.gov (United States)

Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

2014-03-01

The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

Listeria monocytogenes Monographic Study

Directory of Open Access Journals (Sweden)

Emil Tirziu

2010-05-01

Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

Interview met professor Joan Wallach Scott

NARCIS (Netherlands)

Bijl, Greetje; Tijhoff, Esmeralda

2012-01-01

Joan Scott, professor at the School of Social Science in the Institute for Avanced Study in Princeton, New Jersey (USA), was the keynote speaker at the conference 'Uitsluitend emancipatie' in de Beurs van Berlage in Amsterdam in October 2012. An interview on gender, history, feminism and her book

Serovar 4b complex predominates among Listeria monocytogenes isolates from imported aquatic products in China.

Science.gov (United States)

Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan

2010-01-01

Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.

Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants.

Science.gov (United States)

Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra

2011-01-01

A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.

Adaptive Response of Listeria monocytogenes to Heat, Salinity and Low pH, after Habituation on Cherry Tomatoes and Lettuce Leaves.

Science.gov (United States)

Poimenidou, Sofia V; Chatzithoma, Danai-Natalia; Nychas, George-John; Skandamis, Panagiotis N

2016-01-01

Pathogens found on fresh produce may encounter low temperatures, high acidity and limited nutrient availability. The aim of this study was to evaluate the effect of habituation of Listeria monocytogenes on cherry tomatoes or lettuce leaves on its subsequent response to inhibitory levels of acid, osmotic and heat stress. Habituation was performed by inoculating lettuce coupons, whole cherry tomatoes or tryptic soy broth (TSB) with a three-strains composite of L. monocytogenes, which were further incubated at 5°C for 24 hours or 5 days. Additionally, cells grown overnight in TSB supplemented with 0.6% yeast extract (TSBYE) at 30°C were used as control cells. Following habituation, L. monocytogenes cells were harvested and exposed to: (i) pH 3.5 adjusted with lactic acid, acetic acid or hydrochloric acid (HCl), and pH 1.5 (HCl) for 6 h; (ii) 20% NaCl and (iii) 60°C for 150 s. Results showed that tomato-habituated L. monocytogenes cells were more tolerant (P lettuce, and habituation on both foods resulted in more stress resistant cells than prior growth in TSB. On the contrary, the highest resistance to heat stress (P lettuce-habituated L. monocytogenes cells followed by TSB-grown cells at 5°C for 24 h, whereas tomato-habituated cells were highly sensitized. Prolonged starvation on fresh produce (5 days vs. 24 h) increased resistance to osmotic and acid stress, but reduced thermotolerance, regardless of the pre-exposure environment (i.e., tomatoes, lettuce or TSB). These results indicate that L. monocytogenes cells habituated on fresh produce at low temperatures might acquire resistance to subsequent antimicrobial treatments raising important food safety implications.

Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Joelle K Salazar

Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

Generalization of the Moszkovski-Scott method

International Nuclear Information System (INIS)

Balbutsev, E.B.

1976-01-01

A constant separation parameter is proposed to be used in the Moszkovski-Scott method for solving the Bethe-Goldstone equation. After such a modification one can apply the method to odd states of relative motion, not only to even ones. Some essential inaccuracies of the original method are eliminated, as well

Characterisation of the transcriptomes of genetically diverse Listeria monocytogenes exposed to hyperosmotic and low temperature conditions reveal global stress-adaptation mechanisms.

Directory of Open Access Journals (Sweden)

Juliana Durack

Full Text Available The ability of Listeria monocytogenes to adapt to various food and food- processing environments has been attributed to its robustness, persistence and prevalence in the food supply chain. To improve the present understanding of molecular mechanisms involved in hyperosmotic and low-temperature stress adaptation of L. monocytogenes, we undertook transcriptomics analysis on three strains adapted to sub-lethal levels of these stress stimuli and assessed functional gene response. Adaptation to hyperosmotic and cold-temperature stress has revealed many parallels in terms of gene expression profiles in strains possessing different levels of stress tolerance. Gene sets associated with ribosomes and translation, transcription, cell division as well as fatty acid biosynthesis and peptide transport showed activation in cells adapted to either cold or hyperosmotic stress. Repression of genes associated with carbohydrate metabolism and transport as well as flagella was evident in stressed cells, likely linked to activation of CodY regulon and consequential cellular energy conservation.

Survival of bioluminescent Listeria monocytogenes and Escherichia coli O157:H7 in soft cheeses.

Science.gov (United States)

Ramsaran, H; Chen, J; Brunke, B; Hill, A; Griffiths, M W

1998-07-01

Pasteurized and raw milks that had been inoculated at 10(4) cfu/ml with bioluminescent strains of Listeria monocytogenes and Escherichia coli O157:H7 were used in the manufacture of Camembert and Feta cheeses with or without nisin-producing starter culture. Survival of both organisms was determined during the manufacture and storage of Camembert and Feta cheeses at 2 +/- 1 degree C for 65 and 75 d, respectively. Bacterial bioluminescence was used as an indicator to enumerate the colonies plated on selective Listeria agar and on MacConkey agar. Escherichia coli O157:H7 survived the manufacturing process of both cheeses and was present at the end of the storage period in greater numbers than in the initial inoculum. At the end of 75 d of storage, E. coli O157:H7 was found in the brine of Feta cheese. The counts of L. monocytogenes increased as the pH of the Camembert cheese increased, and there were significant differences between the counts from samples taken from the inside and the counts from samples obtained near the surface of the cheese. The Feta cheese that contained nisin was the only cheese in which L. monocytogenes was at the level of the initial inoculum after 75 d of storage.

Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

Science.gov (United States)

Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

2015-11-09

Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

Directory of Open Access Journals (Sweden)

Ok Kyung Koo

Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

Science.gov (United States)

Miettinen, Hanna; Wirtanen, Gun

2005-10-15

A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

W. Richard Scott, Institutions and Organizations: Ideas, Interests, and Identities

DEFF Research Database (Denmark)

Jakobsen, Michael

2014-01-01

Book review of: W. Richard Scott: Institutions and Organizations: Ideas, Interests, and Identities. 4th edition. Thousand Oaks, CA: SAGE Publications, 2014. xiii, 345 pp.......Book review of: W. Richard Scott: Institutions and Organizations: Ideas, Interests, and Identities. 4th edition. Thousand Oaks, CA: SAGE Publications, 2014. xiii, 345 pp....

Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

Science.gov (United States)

VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

2016-10-01

Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

2017-01-01

carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...

Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

Science.gov (United States)

Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

2016-04-15

The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

Lactic acid bacteria from chicken carcasses with inhibitory activity against Salmonella spp. and Listeria monocytogenes.

Science.gov (United States)

Sakaridis, I; Soultos, N; Dovas, C I; Papavergou, E; Ambrosiadis, I; Koidis, P

2012-02-01

This study was conducted to isolate psychrotrophic lactic acid bacteria (LAB) from chicken carcasses with inhibitory activity against strains of Salmonella spp. and Listeria monocytogenes. A total of 100 broiler samples were examined for the presence of LAB. Ninety-two LAB isolates that showed antimicrobial effects against Salmonella spp. and L. monocytogenes were further analysed to examine their LAB (Gram-positive, catalase negative, oxidase negative) and psychrotrophic characteristics (ability to grow at 7 °C). Fifty isolates were further selected and identified initially using standard biochemical tests in miniature (Micro-kits API CH 50) and then by sequencing of the 16s-23s rRNA gene boundary region (Intergenic Spacer Region). By molecular identification, these isolates were classified into 5 different LAB species: Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus johnsonii, Pediococcus acidilactici, and Lactobacillus paralimentarius. None of the isolates produced tyramine or histamine. Copyright © 2011 Elsevier Ltd. All rights reserved.

Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin.

Science.gov (United States)

Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale

2004-04-20

Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.

CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

R. Mioni

2013-02-01

Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

Rapid identification and classification of Listeria spp. and serotype assignment of Listeria monocytogenes using fourier transform-infrared spectroscopy and artificial neural network analysis

Science.gov (United States)

The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...

78 FR 60929 - Notice of Public Meeting of the Fort Scott Council

Science.gov (United States)

2013-10-02

.... Such requests must be stated prominently at the beginning of the comments. The Trust will make... PRESIDIO TRUST Notice of Public Meeting of the Fort Scott Council AGENCY: The Presidio Trust... Scott Council (Council) will be held from 10 a.m. to 12:30 p.m. on Thursday, October 17, 2013. The...

Prevalence, populations and pheno- and genotypic characteristics of Listeria monocytogenes isolated from ready-to-eat vegetables marketed in São Paulo, Brazil.

Science.gov (United States)

Sant'Ana, Anderson S; Igarashi, Maria Crystina; Landgraf, Mariza; Destro, Maria Teresa; Franco, Bernadette D G M

2012-04-02

Listeria monocytogenes is a foodborne pathogen of great concern due to the high fatality rates of listeriosis. The consumption of RTE vegetables has increased in Brazil over the last two decades, but little is known about the risks associated to the consumption of these products. This study evaluated the prevalence and counts of L. monocytogenes in 512 packages of ready-to-eat vegetables marketed in São Paulo. The isolates were characterized for their serotypes, ribotypes, positivity for virulence genes inlA, inlC and inlJ, resistance to chlorine, growth rate variability and capability to form biofilm on stainless steel (AISI 304, #4) coupons. L. monocytogenes was detected in 3.1% of the samples. Only five samples presented countable levels, with counts between 1.0×10(1) and 2.6×10(2)CFU/g. Isolates belonged to serotypes 1/2b or 4b and most were positive for genes inlC and inlJ. Ribotypable isolates were grouped into four groups: 1038 (69.4%), 19175 (11.3%), 19191 (17.7%) and 18604 (one isolate). Most isolates survived to exposure to 125 ppm of a chlorine-based disinfectant for 3 min. All isolates were capable to attach to the coupons, reaching counts above 4 log(10) CFU/cm(2) and the growth rate (μ) at 25°C of the majority of the isolates varied between 0.1 and 0.2 log OD/h, but for few strains the μ was as high as 0.26 log OD/h. Results of this survey indicate that RTE vegetables may be vehicles of L. monocytogenes strains with limited variation in serotype, ribotype and virulence factors but varying significantly in resistance to chlorine disinfectants, capability of forming biofilm and growth rate. Data obtained is of foremost importance to serve as baseline for the development of scientific-based policies to control the incidence of L. monocytogenes in RTE vegetables in Brazil. Copyright © 2012 Elsevier B.V. All rights reserved.

Resistance of Listeria monocytogenes biofilms to sanitizing agents

Science.gov (United States)

Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

Fate of Escherichia coli O157:H7, Salmonella Enteritidis and Listeria monocytogenes during storage of fermented green table olives in brine.

Science.gov (United States)

Argyri, Anthoula A; Lyra, Efstathia; Panagou, Efstathios Z; Tassou, Chrysoula C

2013-10-01

The survival of Escherichia coli O157:H7, Salmonella Enteritidis and Listeria monocytogenes during the storage of fermented green table olives cv. Halkidiki in brine was studied in parallel with the evolution of lactic acid bacteria (LAB), yeasts and pH. The olives were previously fermented with a starter culture (a potential probiotic strain of Lactobacillus pentosus B281--starter process) or with the indigenous microbiota (control). After the end of fermentation, olives were placed in brine, inoculated with a cocktail of 5 strains of E. coli O157:H7, 5 strains of L. monocytogenes and 4 strains of S. Enteritidis, with a final concentration in the brine of ca. 7.0 log CFU/ml, and subsequently packaged in polyethylene pouches and stored at 20 °C. The population of E. coli O157:H7 reduced gradually and was detected in the brine until the 27th day of storage in both cases (i.e., starter and control process), and on olive fruits until the 19th and 16th days of storage in the starter and control process, respectively. S. Enteritidis population showed also a decrease and it was detected until the 21st day of storage in both brine and olive fruits in both cases. The population of L. monocytogenes declined during storage and it was detected until the 31st day of storage in both brine and olive fruits in both cases, showing a longer survival period in comparison to the other two studied pathogens. The presence of the potential probiotic starter did not affect the pathogen survival. The results demonstrated that even though the growth of the pathogenic strains was not supported, they may survive for a long period in a stressful environment of a fermented product with low pH value (4.2) and high salt concentration (6.0%). These results are a valuable contribution to risk assessment studies related to ready to eat foods in general. Copyright © 2013 Elsevier Ltd. All rights reserved.

Under the Radar: The First Woman in Radio Astronomy, Ruby Payne-Scott

Science.gov (United States)

Miller Goss, W.

2012-05-01

Under the Radar, the First Woman in Radio Astronomy, Ruby Payne-Scott W. Miller Goss, NRAO Socorro NM Ruby Payne-Scott (1912-1981) was an eminent Australian scientist who made major contributions to the WWII radar effort (CSIR) from 1941 to 1945. In late 1945, she pioneered radio astronomy efforts at Dover Heights in Sydney, Australia at a beautiful cliff top overlooking the Tasman Sea. Again at Dover Heights, Payne-Scott carried out the first interferometry in radio astronomy using an Australian Army radar antenna as a radio telescope at sun-rise, 26 January 1946. She continued these ground breaking activities until 1951. Ruby Payne-Scott played a major role in discovering and elucidating the properties of Type III bursts from the sun, the most common of the five classes of transient phenomena from the solar corona. These bursts are one of the most intensively studied forms of radio emission in all of astronomy. She is also one of the inventors of aperture synthesis in radio astronomy. I examine her career at the University of Sydney and her conflicts with the CSIR hierarchy concerning the rights of women in the work place, specifically equal wages and the lack of permanent status for married women. I also explore her membership in the Communist Party of Australia as well as her partially released Australian Scientific Intelligence Organization file. Payne-Scott’s role as a major participant in the flourishing radio astronomy research of the post war era remains a remarkable story. She had a number of strong collaborations with the pioneers of early radio astronomy in Australia: Pawsey, Mills, Christiansen, Bolton and Little. I am currently working on a popular version of the Payne-Scott story; “Making Waves, The Story of Ruby Payne-Scott: Australian Pioneer Radio Astronomer” will be published in 2013 by Springer in the Astronomers’ Universe Series.

Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

Science.gov (United States)

Alali, Walid Q; Schaffner, Donald W

2013-07-01

The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

Sir Charles Scott Sherrington (1857–1952)

Indian Academy of Sciences (India)

Twentieth century bore witness to remarkable scientists whohave advanced our understanding of the brain. Among them,Sir Charles Scott Sherrington's ideas about the way in whichthe central nervous system operates has continuing relevanceeven today. He received honorary doctorates from twentytwouniversities and ...

Sir Charles Scott Sherrington (1857–1952)

Indian Academy of Sciences (India)

2016-08-26

Aug 26, 2016 ... Twentieth century bore witness to remarkable scientists whohave advanced our understanding of the brain. Among them,Sir Charles Scott Sherrington's ideas about the way in whichthe central nervous system operates has continuing relevanceeven today. He received honorary doctorates from ...

Nanovesicle encapsulation of antimicrobial peptide P34: physicochemical characterization and mode of action on Listeria monocytogenes

Science.gov (United States)

da Silva Malheiros, Patrícia; Sant'Anna, Voltaire; Micheletto, Yasmine Miguel Serafini; da Silveira, Nadya Pesce; Brandelli, Adriano

2011-08-01

Antimicrobial peptide P34, a substance showing antibacterial activity against pathogenic and food spoilage bacteria, was encapsulated in liposomes prepared from partially purified soybean phosphatidylcholine, and their physicochemical characteristics were evaluated. The antimicrobial activity was estimated by agar diffusion assay using Listeria monocytogenes ATCC 7644 as indicator strain. A concentration of 3,200 AU/mL of P34 was encapsulated in nanovesicles and stocked at 4 °C. No significant difference ( p > 0.05) in the biological activity of free and encapsulated P34 was observed through 24 days. Size and PDI of liposomes, investigated by light scattering analysis, were on average 150 nm and 0.22 respectively. Zeta potential was -27.42 mV. There was no significant change ( p > 0.05) in the physicochemical properties of liposomes during the time of evaluation. The liposomes presented closed spherical morphology as visualized by transmission electron microscopy (TEM). The mode of action of liposome-encapsulated P34 under L. monocytogenes cells was investigated by TEM. Liposomes appeared to adhere but not fuse with the bacterial cell wall, suggesting that the antimicrobial is released from nanovesicles to act against the microorganism. The effect of free and encapsulated P34 was tested against L. monocytogenes, showing that free bacteriocin inhibited the pathogen more quickly than the encapsulated P34. Liposomes prepared with low-cost lipid showed high encapsulation efficiency for a new antimicrobial peptide and were stable during storage. The mode of action against the pathogen L. monocytogenes was characterized.

A multiple-locus variable-number tandem repeat analysis (MLVA) of Listeria monocytogenes isolated from Norwegian salmon-processing factories and from listeriosis patients.

Science.gov (United States)

Lunestad, B T; Truong, T T T; Lindstedt, B-A

2013-10-01

The objective of this study was to characterize Listeria monocytogenes isolated from farmed Atlantic salmon (Salmo salar) and the processing environment in three different Norwegian factories, and compare these to clinical isolates by multiple-locus variable-number tandem repeat analysis (MLVA). The 65 L. monocytogenes isolates obtained gave 15 distinct MLVA profiles. There was great heterogeneity in the distribution of MLVA profiles in factories and within each factory. Nine of the 15 MLVA profiles found in the fish-associated isolates were found to match human profiles. The MLVA profile 07-07-09-10-06 was the most common strain in Norwegian listeriosis patients. L. monocytogenes with this profile has previously been associated with at least two known listeriosis outbreaks in Norway, neither determined to be due to fish consumption. However, since this profile was also found in fish and in the processing environment, fish should be considered as a possible food vehicle during sporadic cases and outbreaks of listeriosis.

LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

Directory of Open Access Journals (Sweden)

T Civera

2013-02-01

Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

Science.gov (United States)

Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

2017-09-18

Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

Listeria monocytogenes growth limits and stress resistance mechanisms

NARCIS (Netherlands)

Veen, van der S.

2008-01-01

The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

DEFF Research Database (Denmark)

Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

1996-01-01

Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

Effect of co-culture with enterocinogenic E. faecium on L. monocytogenes key virulence gene expression

Directory of Open Access Journals (Sweden)

Eleftherios H. Drosinos

2016-08-01

Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.

Low prevalence of Listeria monocytogenes in cull sows and pork.

Science.gov (United States)

Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

2008-03-01

The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

La Jolie Fille de Perth de Bizet  ou comment trahir et honorer Walter Scott Bizet’s Jolie Fille de Perth or How to Betray and Honour Walter Scott

Directory of Open Access Journals (Sweden)

Gilles Couderc

2011-11-01

Full Text Available What remains of Walter Scott’s Fair Maid of Perth in Bizet’s 1867 Jolie Fille de Perth, an opera in 4acts on a libretto by Jules Adenis and Vernoy de Saint-Georges? Not much when compared to other Scott-inspired operas. Little historical context or local colour, even in Bizet’s music. Some characters remotely linked to Scott in a libretto that mostly abides by the rules of French opera or opéra-comique of the time and recycles the dramatic ingredients favoured by Saint-Georges, a purveyor of libretti for opera or the ballet second only to Scribe, who engendered such international successes as Flotow’s Martha and Balfe’s Bohemian Girl, whose gipsy, long before his Carmen, haunts Bizet’s “Scottish” opera. Yet the work pays indirect homage to Scott, whose historical novels contributed to the birth of the French “grand opera”, by rewriting scenes or situations drawn from Scott. In spite of borrowing freely from French grand opera and opéra-comique, Bizet here attempts to find his own musical expression and his opera reflects aspects of Second Empire French society and the roles it assigned to women, before the appearance of his revolutionary Carmen on the stage.Que reste t’il du roman de Walter Scott The Fair Maid of Perth dans la Jolie Fille de Perth de Bizet, opéra en 4 actes de 1867 sur un livret de Vernoy de Saint-Georges, vieux routier du théâtre lyrique, et Jules Adenis ? Pas grand-chose par rapport aux opéras inspirés par Scott. Peu d’Ecosse, une absence remarquable de couleur locale ou historique, des personnages vaguement inspirés de Scott pour un livret qui se plie surtout aux règles de l’opéra français et de l’opéra-comique à la manière de Scribe et recycle les ingrédients habituels des livrets de Saint-Georges, père de succès internationaux comme la Martha de Flotow et de la Bohemian Girl de Balfe, dont la figure exotique de la bohémienne, longtemps avant Carmen, hante l’opéra �

Astronaut Scott Parazynski during egress training

Science.gov (United States)

1994-01-01

Astronaut Scott E. Parazynski looks at fellow STS-66 mission specialist Joseph R. Tanner, (foreground) during a rehearsal of procedures to be followed during the launch and entry phases of their scheduled November 1994 flight. This rehearsal, held in the crew compartment trainer (CCT) of JSC's Shuttle mockup and integration laboratory, was followed by a training session on emergency egress procedures.

Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

Science.gov (United States)

Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

2009-06-15

In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

In Vitro Study of Berberis vulgaris, Actinidia deliciosa and Allium cepa L. Antibacterial Effects on Listeria monocytogenes

OpenAIRE

Anzabi Younes

2015-01-01

Objective: One control method of pathogenic microorganisms is using synthetic chemical preservatives and antibiotics. Because of being generally recognized as safe, antibacterial compounds with organic origin are considered important for health. This study was done in order to investigate the antibacterial effects of methanol extracts of the Berberis vulgaris (Barberry), Actinidia deliciosa (Kiwi) and Allium cepa L. (Onions) on the standard strain (ATCC:19114) of Listeria monocytogenes (L. mo...

Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

Science.gov (United States)

González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

2001-11-01

The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

Thinking Visually: An Interview with Scott Bennett.

Science.gov (United States)

Gamble, Harriet

2002-01-01

Presents an interview with Scott Bennett, an artist of abstract art and traditional craft. Focuses on issues such as the role of art in his life, how his art has developed over time, and his process of creating his works of art. Includes directions for a glazing project. (CMK)

Nisin, rosemary, and ethylenediaminetetraacetic acid affect the growth of Listeria monocytogenes on ready-to-eat turkey ham stored at four degrees Celsius for sixty-three days.

Science.gov (United States)

Ruiz, A; Williams, S K; Djeri, N; Hinton, A; Rodrick, G E

2009-08-01

The objectives of this study were to determine the anti-Listeria and general antimicrobial properties of nisin, rosemary, and EDTA alone and in combination on Listeria monocytogenes inoculated on ready-to-eat vacuum-packaged diced turkey ham and to ascertain the effects of the treatments on pH and objective color. The turkey hams were cut into 0.5-cm pieces, inoculated with a L. monocytogenes cocktail containing 5 strains of the bacterium, and treated with either no treatment and no inoculum (negative control), inoculum only (positive control), 0.5% nisin, 20 mM EDTA, 1% rosemary, 0.5% nisin + 20 mM EDTA, 0.5% nisin + 1% rosemary, 0.5% nisin + 20 mM EDTA + 1% rosemary, or 20 mM EDTA + 1% rosemary. All samples were vacuum-packaged, stored for 63 d at 4 degrees C +/- 1 degrees C, and analyzed at 1-wk intervals for total aerobes, L. monocytogenes, lactic acid organisms, pH, and objective color. Nisin, nisin with rosemary, nisin with EDTA, and nisin with rosemary and EDTA treatments reduced (P hams treated with nisin. The EDTA and rosemary treatments alone and in combination were ineffective in inhibiting growth of L. monocytogenes. Although none of the treatments completely eliminated L. monocytogenes, the results indicated that ready-to-eat turkey ham can have significantly decreased L. monocytogenes when treated with nisin alone or in combination with rosemary or EDTA, or both.

Acute Fetal Demise with First Trimester Maternal Infection Resulting from Listeria monocytogenes in a Nonhuman Primate Model

Science.gov (United States)

Wolfe, Bryce; Wiepz, Gregory J.; Schotzko, Michele; Bondarenko, Gennadiy I.; Durning, Maureen; Simmons, Heather A.; Mejia, Andres; Faith, Nancy G.; Sampene, Emmanuel; Suresh, Marulasiddappa; Kathariou, Sophia; Czuprynski, Charles J.

2017-01-01

ABSTRACT Infection with Listeria monocytogenes during pregnancy is associated with miscarriage, preterm birth, and neonatal complications, including sepsis and meningitis. While the risk of these conditions is thought to be greatest during the third trimester of pregnancy, the determinants of fetoplacental susceptibility to infection, the contribution of gestational age, and the in vivo progression of disease at the maternal-fetal interface are poorly understood. We developed a nonhuman primate model of listeriosis to better understand antecedents of adverse pregnancy outcomes in early pregnancy. Four pregnant cynomolgus macaques (Macaca fascicularis) received a single intragastric inoculation between days 36 and 46 of gestation with 107 CFU of an L. monocytogenes strain isolated from a previous cluster of human listeriosis cases that resulted in adverse pregnancy outcomes. Fecal shedding, maternal bacteremia, and fetal demise were consistently noted within 7 to 13 days. Biopsy specimens of maternal liver, spleen, and lymph node displayed variable inflammation and relatively low bacterial burden. In comparison, we observed greater bacterial burden in the decidua and placenta and the highest burden in fetal tissues. Histopathology indicated vasculitis, fibrinoid necrosis, and thrombosis of the decidual spiral arteries, acute chorioamnionitis and villitis in the placenta, and hematogenous infection of the fetus. Vascular pathology suggests early impact of L. monocytogenes infection on spiral arteries in the decidua, which we hypothesize precipitates subsequent placentitis and fetal demise. These results demonstrate that L. monocytogenes tropism for the maternal reproductive tract results in infection of the decidua, placenta, and the fetus itself during the first trimester of pregnancy. PMID:28223455

Pregnancy - associated human listeriosis: Virulence and genotypic analysis of Listeria monocytogenes from clinical samples.

Science.gov (United States)

Soni, Dharmendra Kumar; Singh, Durg Vijai; Dubey, Suresh Kumar

2015-09-01

Listeria monocytogenes, a life-threatening pathogen, poses severe risk during pregnancy, may cause abortion, fetal death or neonatal morbidity in terms of septicemia and meningitis. The present study aimed at characterizing L. monocytogenes isolated from pregnant women based on serotyping, antibiotic susceptibility, virulence genes, in vivo pathogenicity test and ERIC- and REP-PCR fingerprint analyses. The results revealed that out of 3700 human clinical samples, a total of 30 (0.81%) isolates [12 (0.80%) from placental bit (1500), 18 (0.81%) from vaginal swab (2200)] were positive for L. monocytogenes. All the isolates belonged to serogroup 4b, and were + ve for virulence genes tested i.e. inlA, inlC, inlJ, plcA, prfA, actA, hlyA, and iap. Based on the mice inoculation tests, 20 isolates showed 100% and 4 isolates 60% relative virulence while 6 isolates were non-pathogenic. Moreover, 2 and 10 isolates were resistant to ciprofloxacin and cefoxitin, respectively, while the rest susceptible to other antibiotics used in this study. ERIC- and REP-PCR collectively depicted that the isolates from placental bit and vaginal swab had distinct PCR fingerprints except a few isolates with identical patterns. This study demonstrates prevalence of pathogenic strains mostly resistant to cefoxitin and/or ciprofloxacin. The results indicate the importance of isolating and characterizing the pathogen from human clinical samples as the pre-requisite for accurate epidemiological investigations.

Microbiological Challenge Testing for Listeria Monocytogenes in Ready-to-Eat Food: A Practical Approach.

Science.gov (United States)

Spanu, Carlo; Scarano, Christian; Ibba, Michela; Pala, Carlo; Spanu, Vincenzo; De Santis, Enrico Pietro Luigi

2014-12-09

Food business operators (FBOs) are the primary responsible for the safety of food they place on the market. The definition and validation of the product's shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE) food that supports the growth of Listeria monocytogenes . Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.

Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

Science.gov (United States)

Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

2013-02-01

This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

Prevalence of Listeria monocytogenes in poultry meat

Directory of Open Access Journals (Sweden)

Mehmet ELMALI

2015-01-01

Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

Listeria monocytogenes in retailed raw chicken meat in Turkey.

Science.gov (United States)

Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

2014-01-01

The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

Directory of Open Access Journals (Sweden)

Qi Zhu

2017-03-01

Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

Commensal microbes provide first line defense against Listeria monocytogenes infection

Science.gov (United States)

Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

2017-01-01

Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Daniel R. Rissi

2010-01-01

Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

78 FR 77791 - Dakota, Minnesota & Eastern Railroad Corporation-Abandonment Exemption-in Scott County, Iowa

Science.gov (United States)

2013-12-24

... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 337 (Sub-No. 7X)] Dakota, Minnesota & Eastern Railroad Corporation--Abandonment Exemption--in Scott County, Iowa Dakota, Minnesota... as Blackhawk Spur, between milepost 0.33+/- and milepost 0.99 +/- in Scott County, Iowa (the Line...

Enterocin B3A-B3B produced by LAB collected from infant faeces: potential utilization in the food industry for Listeria monocytogenes biofilm management.

Science.gov (United States)

Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel

2017-02-01

Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml -1 ) decreased the cell numbers by about 2 log CFU ml -1 , thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.

Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

DEFF Research Database (Denmark)

Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

2013-01-01

Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

Rapid identification and source-tracking of Listeria monocytogenes using MALDI-TOF mass spectrometry.

Science.gov (United States)

Jadhav, Snehal; Gulati, Vandana; Fox, Edward M; Karpe, Avinash; Beale, David J; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

2015-06-02

Listeria monocytogenes is an important foodborne pathogen responsible for the sometimes fatal disease listeriosis. Public health concerns and stringent regulations associated with the presence of this pathogen in food and food processing environments underline the need for rapid and reliable detection and subtyping techniques. In the current study, the application of matrix assisted laser desorption/ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) as a single identification and source-tracking tool for a collection of L. monocytogenes isolates, obtained predominantly from dairy sources within Australia, was explored. The isolates were cultured on different growth media and analysed using MALDI-TOF MS at two incubation times (24 and 48 h). Whilst reliable genus-level identification was achieved from most media, identification at the species level was found to be dependent on culture conditions. Successful speciation was highest for isolates cultured on the chromogenic Agar Listeria Ottaviani Agosti agar (ALOA, 91% of isolates) and non-selective horse blood agar (HBA, 89%) for 24h. Chemometric statistical analysis of the MALDI-TOF MS data enabled source-tracking of L. monocytogenes isolates obtained from four different dairy sources. Strain-level discrimination was also observed to be influenced by culture conditions. In addition, t-test/analysis of variance (ANOVA) was used to identify potential biomarker peaks that differentiated the isolates according to their source of isolation. Source-tracking using MALDI-TOF MS was compared and correlated with the gold standard pulsed-field gel electrophoresis (PFGE) technique. The discriminatory index and the congruence between both techniques were compared using the Simpsons Diversity Index and adjusted Rand and Wallace coefficients. Overall, MALDI-TOF MS based source-tracking (using data obtained by culturing the isolates on HBA) and PFGE demonstrated good congruence with a Wallace coefficient of 0.71 and

Reframing Michael Scott: Exploring Inappropriate Workplace Communication

Science.gov (United States)

Schaefer, Zachary A.

2010-01-01

Individuals who work in professional settings interact with others who may exhibit a variety of cultural beliefs and decision-making approaches. Page (2007) argues that cognitive diversity (i.e., how people approach and attempt to solve problems) is a vital asset in effective organizations. Michael Scott, who portrays the inept main character on…

Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

African Journals Online (AJOL)

This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

High-throughput genome sequencing of two Listeria monocytogenes clinical isolates during a large foodborne outbreak

Directory of Open Access Journals (Sweden)

Trout-Yakel Keri M

2010-02-01

Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.

Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed-culture simulated fish processing conditions and chemical disinfection challenges.

Science.gov (United States)

Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S

2018-02-21

The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of

Efecto de tiempo y temperatura de cocción en chorizo inoculados artificialmente con Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Ana K. Carrascal-Camacho

2009-12-01

Full Text Available Effect of cooking time and temperature on sausages artificially inoculated with Listeria monocytogenes. Objective. To find whetherthe cooking times traditionally used by consumers are enough to inactivate Listeria monocytogenes artificially inoculated into sausages.Materials and methods. A survey asking about sausage cooking habits was completed with 50 housewives. We analyzed 60 samples ofsausages previously inoculated with 103 CFU g-1 from a pool of 5 strains of L. monocytogenes, then the cooking procedures described inthe survey were applied to the samples, and counting was done immediately after. Additionally, a complementary test was carried out byinoculating 20 samples of sausages with 103 CFU g-1 and exposing them to 72 oC and 73 oC for 30 seg. Results. The survey showed that15 minute boiling and 5 minute frying are the most frequent ways of preparing sausages by consumers. We established that the time andcooking conditions used in our assay had a statistically significant effect (p: 0.016 on the inoculated samples. In the complementary assay,statistical data (p: 0.0001 indicated that internal temperatures of 73 oC are enough to inactivate the pathogen at an industrial scale.Conclusion. Cooking by 15 minute boiling and 5 minute frying are enough to inactive concentrations of 103 g-1 of Listeria monocytogenesartificially inoculated into sausages.

Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

Science.gov (United States)

Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

2012-01-01

Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

DEFF Research Database (Denmark)

Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

2017-01-01

dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

Investigating the Effect of Different Treatments with Lactic Acid Bacteria on the Fate of Listeria monocytogenes and Staphylococcus aureus Infection in Galleria mellonella Larvae.

Science.gov (United States)

Grounta, Athena; Harizanis, Paschalis; Mylonakis, Eleftherios; Nychas, George-John E; Panagou, Efstathios Z

2016-01-01

The use of Galleria mellonella as a model host to elucidate microbial pathogenesis and search for novel drugs and therapies has been well appreciated over the past years. However, the effect of microorganisms with functional appeal in the specific host remains scarce. The present study investigates the effect of treatment with selected lactic acid bacteria (LAB) with probiotic potential, as potential protective agents by using live or heat-killed cells at 6 and 24 h prior to infection with Listeria monocytogenes and Staphylococcus aureus or as potential therapeutic agents by using cell-free supernatants (CFS) after infection with the same pathogens. The employed LAB strains were Lactobacillus pentosus B281 and Lactobacillus plantarum B282 (isolated from table olive fermentations) along with Lactobacillus rhamnosus GG (inhabitant of human intestinal tract). Kaplan-Meier survival curves were plotted while the pathogen's persistence in the larval hemolymph was determined by microbiological analysis. It was observed that the time (6 or 24 h) and type (live or heat-killed cells) of challenge period with LAB prior to infection greatly affected the survival of infected larvae. The highest decrease of L. monocytogenes population in the hemolymph was observed in groups challenged for 6 h with heat-killed cells by an average of 1.8 log units compared to non challenged larvae for strains B281 (p 0.0322), B282 (p 0.0325), and LGG (p 0.0356). In the case of S. aureus infection, the population of the pathogen decreased in the hemolymph by 1 log units at 8 h post infection in the groups challenged for 6 h with heat-killed cells of strains B281 (p 0.0161) and B282 (p 0.0096) and by 1.8 log units in groups challenged with heat-killed cells of LGG strain (p 0.0175). Further use of CFS of each LAB strain did not result in any significant prolonged survival but interestingly it resulted in pronounced decrease of L. monocytogenes in the hemolymph at 24 h and 48 h after infection by

Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

Science.gov (United States)

Lee, Yuejia; Wang, Chinling

2017-03-01

Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

Comparison of Antibacterial Activity of Lactobacillus plantarum Strains Isolated from Two Different Kinds of Regional Cheeses from Poland: Oscypek and Korycinski Cheese

Directory of Open Access Journals (Sweden)

Aleksandra Ołdak

2017-01-01

Full Text Available Oscypek and korycinski are traditional Polish cheeses, exclusively produced in Tatra and in Podlasie region, respectively, produced from raw, unpasteurized milk. The 29 Lactobacillus plantarum strains were isolated on MRS agar from 12 cheese samples and used as a material for study. The main purpose of the work was to assess the antimicrobial properties and recognition of selected strains for the unique antagonistic activity and preservation role in food. It has been found that the highest antimicrobial activity was observed in the case of L. monocytogenes strains; however, the level of that activity was different depending on the Lb. plantarum strain. Strains from oscypek produced broad spectrum, and a few strains isolated from korycinski cheese produced a narrow spectrum of antimicrobial compounds, other than organic acids and hydrogen peroxide. Moreover, the antagonistic activity shown by Lb. plantarum strains is connected with the source from which a given strain was isolated. Strains isolated from oscypek cheese represented stronger activity against L. monocytogenes, whereas strains isolated from korycinski cheese were more active against E. coli. Strains Lb. plantarum Os13 and Kor14 could be considered as good candidates for protective cultures to extend durability of food products.

Comparison of Antibacterial Activity of Lactobacillus plantarum Strains Isolated from Two Different Kinds of Regional Cheeses from Poland: Oscypek and Korycinski Cheese

Science.gov (United States)

Ołdak, Aleksandra; Rzepkowska, Anna

2017-01-01

Oscypek and korycinski are traditional Polish cheeses, exclusively produced in Tatra and in Podlasie region, respectively, produced from raw, unpasteurized milk. The 29 Lactobacillus plantarum strains were isolated on MRS agar from 12 cheese samples and used as a material for study. The main purpose of the work was to assess the antimicrobial properties and recognition of selected strains for the unique antagonistic activity and preservation role in food. It has been found that the highest antimicrobial activity was observed in the case of L. monocytogenes strains; however, the level of that activity was different depending on the Lb. plantarum strain. Strains from oscypek produced broad spectrum, and a few strains isolated from korycinski cheese produced a narrow spectrum of antimicrobial compounds, other than organic acids and hydrogen peroxide. Moreover, the antagonistic activity shown by Lb. plantarum strains is connected with the source from which a given strain was isolated. Strains isolated from oscypek cheese represented stronger activity against L. monocytogenes, whereas strains isolated from korycinski cheese were more active against E. coli. Strains Lb. plantarum Os13 and Kor14 could be considered as good candidates for protective cultures to extend durability of food products. PMID:28626762

Antibacterial efficacy of Nisin, Pediocin 34 and Enterocin FH99 against Listeria monocytogenes and cross resistance of its bacteriocin resistant variants to common food preservatives.

Science.gov (United States)

Kaur, G; Singh, T P; Malik, R K

2013-01-01

Antilisterial efficiency of three bacteriocins, viz, Nisin, Pediocin 34 and Enterocin FH99 was tested individually and in combination against Listeria mononcytogenes ATCC 53135. A greater antibacterial effect was observed when the bacteriocins were combined in pairs, indicating that the use of more than one LAB bacteriocin in combination have a higher antibacterial action than when used individually. Variants of Listeria monocytogenes ATCC 53135 resistant to Nisin, Pediocin 34 and Enterocin FH99 were developed. Bacteriocin cross-resistance of wild type and their corresponding resistant variants were assessed and results showed that resistance to a bacteriocin may extend to other bacteriocins within the same class. Resistance to Pediocin 34 conferred cross resistance to Enterocin FH 99 but not to Nisin. Similarly resistance to Enterocin FH99 conferred cross resistance to Pediocin 34 but not to Nisin. Also, the sensitivity of Nisin, Pediocin 34 and Enterocin FH99 resistant variants of Listeria monocytogenes to low pH, salt, sodium nitrite, and potassium sorbate was assayed in broth and compared to the parental wild-type strain. The Nisin, Pediocin 34 and Enterocin FH99 resistant variants did not have intrinsic resistance to low pH, sodium chloride, potassium sorbate, or sodium nitrite. In no case were the bacteriocin resistant Listeria monocytogenes variants examined were more resistant to inhibitors than the parental strains.

Antibacterial efficacy of Nisin, Pediocin 34 and Enterocin FH99 against Listeria monocytogenes and cross resistance of its bacteriocin resistant variants to common food preservatives

Directory of Open Access Journals (Sweden)

G. Kaur

2013-01-01

Full Text Available Antilisterial efficiency of three bacteriocins, viz, Nisin, Pediocin 34 and Enterocin FH99 was tested individually and in combination against Listeria mononcytogenes ATCC 53135. A greater antibacterial effect was observed when the bacteriocins were combined in pairs, indicating that the use of more than one LAB bacteriocin in combination have a higher antibacterial action than when used individually. Variants of Listeria monocytogenes ATCC 53135 resistant to Nisin, Pediocin 34 and Enterocin FH99 were developed. Bacteriocin cross-resistance of wild type and their corresponding resistant variants were assessed and results showed that resistance to a bacteriocin may extend to other bacteriocins within the same class. Resistance to Pediocin 34 conferred cross resistance to Enterocin FH 99 but not to Nisin. Similarly resistance to Enterocin FH99 conferred cross resistance to Pediocin 34 but not to Nisin. Also, the sensitivity of Nisin, Pediocin 34 and Enterocin FH99 resistant variants of Listeria monocytogenes to low pH, salt, sodium nitrite, and potassium sorbate was assayed in broth and compared to the parental wild-type strain. The Nisin, Pediocin 34 and Enterocin FH99 resistant variants did not have intrinsic resistance to low pH, sodium chloride, potassium sorbate, or sodium nitrite. In no case were the bacteriocin resistant Listeria monocytogenes variants examined were more resistant to inhibitors than the parental strains.

Modeling the growth of Listeria monocytogenes in soft blue-white cheese

DEFF Research Database (Denmark)

Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne

2012-01-01

The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

Impact of dilution ratios on Listeria monocytogenes growth during University of Vermont medium enrichment of deli meats.

Science.gov (United States)

Zhang, Lei; Yan, Zhinong; Ryser, Elliot T

2007-11-01

In the U.S. Department of Agriculture (USDA) method for Listeria detection, a 25-g composite food sample is enriched in 225 ml of University of Vermont medium (UVM), giving a detection limit of 0.04 CFU/g. However, in a recent large-scale four-state deli meat survey for L. monocytogenes, 125-g samples enriched in 1,125 ml of UVM were requested to increase the detection limit to 0.008 CFU/g. To circumvent problems associated with large volumes of UVM, the impact on L. monocytogenes growth of lower dilution ratios used for enrichment and most-probable-number (MPN) detection was compared with the results obtained using the conventional 1:10 dilution. In this study, 125-g samples of cured turkey, uncured turkey, ham, and roast beef were inoculated with a six-strain L. monocytogenes cocktail to contain approximately 1 x 10(3) CFU/g. This cocktail was then diluted 1:3, 1:5, or 1:10 in UVM, homogenized, enriched at 30 degrees C, and periodically plated on modified Oxford agar to determine generation times during 24 h of incubation. The same enrichment protocol was also assessed in a three-tube MPN assay using 125-g samples inoculated with L. monocytogenes to contain approximately 1 CFU/g. The effects of two homogenization methods, stomaching and pulsifying, on Listeria growth were compared using oven-roasted turkey breast diluted 1:3, 1:5, and 1:10 in UVM. Overall, the growth rates, generation times, and MPN values for each of the four selected deli meats were similar (P > 0.05) using UVM enrichment ratios of 1:3, 1:5, and 1:10, with no significant (P > 0.05) differences in L. monocytogenes growth rate or generation time between experiments using pulsifying and stomaching. These findings indicate that lower volumes of UVM can be used in the USDA procedure when examining deli meats without compromising Listeria recovery.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

Sublethal Triclosan Exposure Decreases Susceptibility to Gentamicin and Other Aminoglycosides in Listeria monocytogenes

DEFF Research Database (Denmark)

Christensen, Ellen Gerd; Gram, Lone; Kastbjerg, Vicky Gaedt

2011-01-01

(containing quaternary ammonium compound) in four consecutive cultures did not alter the frequency of antibiotic-tolerant isolates, as determined by plating on 2x the MIC for a range of antibiotics. Exposure of eight strains of L. monocytogenes to 1 and 4 µg/ml triclosan did not alter triclosan sensitivity...... resistance remained at a high level also after five subcultures without triclosan or gentamicin. Aminoglycoside resistance can be caused by mutations in the target site, the 16S rRNA gene. However, such mutations were not detected in the N53-1-resistant isolates. A combination of gentamicin and ampicillin...

Use of Potential Probiotic Lactic Acid Bacteria (LAB) Biofilms for the Control of Listeria monocytogenes, Salmonella Typhimurium, and Escherichia coli O157:H7 Biofilms Formation.

Science.gov (United States)

Gómez, Natacha C; Ramiro, Juan M P; Quecan, Beatriz X V; de Melo Franco, Bernadette D G

2016-01-01

Use of probiotic biofilms can be an alternative approach for reducing the formation of pathogenic biofilms in food industries. The aims of this study were (i) to evaluate the probiotic properties of bacteriocinogenic (Lactococcus lactis VB69, L. lactis VB94, Lactobacillus sakei MBSa1, and Lactobacillus curvatus MBSa3) and non-bacteriocinogenic (L. lactis 368, Lactobacillus helveticus 354, Lactobacillus casei 40, and Weissela viridescens 113) lactic acid bacteria (LAB) isolated from Brazilian's foods and (ii) to develop protective biofilms with these strains and test them for exclusion of Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella Typhimurium. LAB were tested for survival in acid and bile salt conditions, surface properties, biosurfactant production, β-galactosidase and gelatinase activity, antibiotic resistance and presence of virulence genes. Most strains survived exposure to pH 2 and 4% bile salts. The highest percentages of auto-aggregation were obtained after 24 h of incubation. Sixty-seven percentage auto-aggregation value was observed in W. viridescens 113 and Lactobacillus curvatus MBSa3 exhibited the highest co-aggregation (69% with Listeria monocytogenes and 74.6% with E. coli O157:H7), while the lowest co-aggregation was exhibited by W. viridescens 113 (53.4% with Listeria monocytogenes and 38% with E. coli O157:H7). Tests for hemolytic activity, bacterial cell adherence with xylene, and drop collapse confirmed the biosurfactant-producing ability of most strains. Only one strain (L. lactis 368) produced β-galactosidase. All strains were negative for virulence genes cob, ccf, cylLL, cylLs, cyllM, cylB, cylA and efaAfs and gelatinase production. The antibiotic susceptibility tests indicated that the MIC for ciprofloxacin, clindamycin, gentamicin, kanamycin, and streptomycin did not exceed the epidemiological cut-off suggested by the European Food Safety Authority. Some strains were resistant to one or more antibiotics and resistance

Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

OpenAIRE

Fossmo, Sabine

2013-01-01

Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

Science.gov (United States)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

2017-11-15

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore

Monitoring paneer for Listeria monocytogenes - A high risk food ...

African Journals Online (AJOL)

A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

Effects of prebiotics on the infective potential of Listeria monocytogenes

DEFF Research Database (Denmark)

Ebersbach, Tine

% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

Impact of Nutrient Restriction on the Structure of Listeria monocytogenes Biofilm Grown in a Microfluidic System

Science.gov (United States)

Cherifi, Tamazight; Jacques, Mario; Quessy, Sylvain; Fravalo, Philippe

2017-01-01

Biofilm formation by the pathogen Listeria monocytogenes is a major concern in food industries. The aim of this work was to elucidate the effect of nutrient limitation on both biofilm architecture and on the viability of the bacteria in microfluidic growth conditions. Biofilm formation by two L. monocytogenes strains was performed in a rich medium (BHI) and in a 10-fold diluted BHI (BHI/10) at 30°C for 24 h by using both static conditions and the microfluidic system Bioflux. In dynamic conditions, biofilms grown in rich and poor medium showed significant differences as well in structure and in the resulting biovolume. In BHI/10, biofilm was organized in a knitted network where cells formed long chains, whereas in the rich medium, the observed structure was homogeneous cellular multilayers. Biofilm biovolume production in BHI/10 was significantly higher than in BHI in these dynamic conditions. Interestingly, biovolume of dead cells in biofilms formed under limited nutrient conditions (BHI/10) was significantly higher than in biofilms formed in the BHI medium. In the other hand, in static conditions, biofilm is organized in a multilayer cells and dispersed cells in a rich medium BHI and poor medium BHI/10 respectively. There was significantly more biomass in the rich medium compared to BHI/10 but no difference was noted in the dead/damaged subpopulation showing how L. monocytogenes biofilm could be affected by the growth conditions. This work demonstrated that nutrient concentration affects biofilm structure and the proportion of dead cells in biofilms under microfluidic condition. Our study also showed that limited nutrients play an important role in the structural stability of L. monocytogenes biofilm by enhancing cell death and liberating extracellular DNA. PMID:28567031

Impact of Nutrient Restriction on the Structure of Listeria monocytogenes Biofilm Grown in a Microfluidic System

Directory of Open Access Journals (Sweden)

Tamazight Cherifi

2017-05-01

Full Text Available Biofilm formation by the pathogen Listeria monocytogenes is a major concern in food industries. The aim of this work was to elucidate the effect of nutrient limitation on both biofilm architecture and on the viability of the bacteria in microfluidic growth conditions. Biofilm formation by two L. monocytogenes strains was performed in a rich medium (BHI and in a 10-fold diluted BHI (BHI/10 at 30°C for 24 h by using both static conditions and the microfluidic system Bioflux. In dynamic conditions, biofilms grown in rich and poor medium showed significant differences as well in structure and in the resulting biovolume. In BHI/10, biofilm was organized in a knitted network where cells formed long chains, whereas in the rich medium, the observed structure was homogeneous cellular multilayers. Biofilm biovolume production in BHI/10 was significantly higher than in BHI in these dynamic conditions. Interestingly, biovolume of dead cells in biofilms formed under limited nutrient conditions (BHI/10 was significantly higher than in biofilms formed in the BHI medium. In the other hand, in static conditions, biofilm is organized in a multilayer cells and dispersed cells in a rich medium BHI and poor medium BHI/10 respectively. There was significantly more biomass in the rich medium compared to BHI/10 but no difference was noted in the dead/damaged subpopulation showing how L. monocytogenes biofilm could be affected by the growth conditions. This work demonstrated that nutrient concentration affects biofilm structure and the proportion of dead cells in biofilms under microfluidic condition. Our study also showed that limited nutrients play an important role in the structural stability of L. monocytogenes biofilm by enhancing cell death and liberating extracellular DNA.

Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

Science.gov (United States)

Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

2017-07-01

Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

Microbiological challenge testing for Listeria monocytogenes in ready-to-eat food: a practical approach

Directory of Open Access Journals (Sweden)

Carlo Spanu

2014-12-01

Full Text Available Food business operators (FBOs are the primary responsible for the safety of food they place on the market. The definition and validation of the product’s shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE food that supports the growth of Listeria monocytogenes. Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.

Astronauts Scott and Armstrong undergoe water egress training

Science.gov (United States)

1966-01-01

Astronauts Neil A. Armstrong (on left), command pilot, and David R. Scott, pilot of the Gemini 8 prime crew, use a boilerplate model of a Gemini spacecraft during water egress training in the Gulf of Mexico. Three Manned Spacecraft Center swimmers assist in the training exercise.

Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions