Prevalence of Listeria monocytogenes in poultry production in France.

Science.gov (United States)

Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

2008-10-01

This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

Science.gov (United States)

Guenther, Susanne; Loessner, Martin J

2011-03-01

Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

Changes in the prevalence of Salmonella serovars associated swine production and correlations of avian, bovine and swine-associated serovars with human-associated serovars in the United States (1997-2015).

Science.gov (United States)

Yuan, C; Krull, A; Wang, C; Erdman, M; Fedorka-Cray, P J; Logue, C M; O'Connor, A M

2018-04-23

As Salmonella enterica is an important pathogen of food animals, surveillance programmes for S. enterica serovars have existed for many years in the United States. Surveillance programmes serve many purposes, one of which is to evaluate alterations in the prevalence of serovars that may signal changes in the ecology of the target organism. The primary aim of this study was to evaluate changes in the proportion of S. enterica serovars isolated from swine over a near 20-year observation period (1997-2015) using four longitudinal data sets from different food animal species. The secondary aim was to evaluate correlations between changes in S. enterica serovars frequently recovered from food animals and changes in S. enterica serovars associated with disease in humans. We found decreasing proportions of S. enterica serovar Typhimurium, serovar Derby and serovar Heidelberg and increasing proportions of S. enterica serovar 4,[5],12:i:-, serovar Infantis and serovar Johannesburg in swine over time. We also found positive correlations for the yearly changes in S. enterica serovar 4,[5],12:i:-, serovar Anatum and serovar Johannesburg between swine and human data; in S. enterica Worthington between avian and human data; and in S. enterica serovar 4,[5],12:i:- between bovine and human data. We found negative correlations for the yearly changes in S. enterica serovar 4,[5],12:i:- and serovar Johannesburg between avian and human data. © 2018 Blackwell Verlag GmbH.

Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

Directory of Open Access Journals (Sweden)

N. Soultos

2014-11-01

Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

Science.gov (United States)

Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

2015-07-25

The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

Directory of Open Access Journals (Sweden)

Shahin Gaini

2015-01-01

Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

DEFF Research Database (Denmark)

Gaini, Shahin

2015-01-01

A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

Control of Listeria monocytogenes in goat's milk and goat's jben by the bacteriocinogenic Enterococcus faecium F58 strain.

Science.gov (United States)

Achemchem, Fouad; Abrini, Jamal; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes

2006-10-01

The bacteriocinogenic Enterococcus faecium F58 strain, a natural goat's jben cheese isolate, lacks decarboxylase activity involved in most biogenic amine formation. It was also sensitive to 13 antibiotics assayed and free of virulence and vancomycin resistance genes. The F58 strain reached the stationary phase after 12 h of growth in sterile goat's milk, and the production of enterocin F-58 (Ent L50) was first detected after 48 h (400 AU/ml), thereafter remaining stable up to 5 days. The effectiveness of the F58 strain in controlling Listeria monocytogenes serovar 4b in reduced fat and whole goat's milk, and in goat's jben has been examined. Coculture experiments of F58-L. monocytogenes in both types of milk demonstrated that listeriae were not eliminated, although reductions by 1 to 4 log units were found. Nevertheless, when the F58 strain was previously inoculated in whole milk and left to grow for 12 h before contamination, the pathogen was completely eliminated after 130 h of coculture. Production of jben cheese contaminated with L. monocytogenes prior to packaging, using preparations of F58-producer strain, caused a significant decrease in the number of viable listeriae, which were undetectable after 1 week of cheese storage at 22 degrees C. Altogether, results from this study suggest that E. faecium F58 strain may be used as an adjunct culture in cheese to control contamination and growth of L. monocytogenes by in situ enterocin production, thus providing an additional hurdle to enhance control of this pathogen.

Change in attachment of Salmonella Typhimurium, Yersinia enterocolitica, and Listeria monocytogenes to pork skin and muscle after hot water and lactic acid decontamination

DEFF Research Database (Denmark)

Morild, Rikke K.; Olsen, John E.; Aabo, Søren

2011-01-01

The attachment of Salmonella enterica subsp. enterica serovar Typhimurium, Yersinia enterocolitica, and Listeria monocytogenes to pig skin and muscle tissue decontaminated with 80°C water or 55°C, 1% lactic acid for 5 and 15s was investigated. Attachment properties differed between skin and muscle...

Characterization of Isolates of Salmonella enterica Serovar Stanley, a Serovar Endemic to Asia and Associated with Travel

DEFF Research Database (Denmark)

Hendriksen, Rene S.; Le Hello, Simon; Bortolaia, Valeria

2012-01-01

Salmonella enterica serovar Stanley (S. Stanley) is a common serovar in Southeast Asia and was the second most common serovar implicated in human salmonellosis in Thailand in the years 2002 to 2007. In contrast, this serovar is relatively uncommon in Europe. The objective of this study was to cha...

9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

Science.gov (United States)

2010-01-01

... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

Science.gov (United States)

Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

2017-04-01

In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

Serovars of Mycobacterium avium Complex isolated from patients in Denmark

DEFF Research Database (Denmark)

Askgaard, D. S.; Giese, Steen Bjørck; Thybo, S.

1994-01-01

Danish isolates of Mycobacterium avium complex were serotyped by the use of seroagglutination. The most prevalent serovars among patients with AIDS (n = 89) were 4 and 6, while among non-AIDS patients the most prevalent serovars were 1, 6, and 4, with no major differences between those in patients...... with pulmonary disease (n = 65) and those in patients with lymph node infection (n = 58). The results suggest a Scandinavian distribution of serovars with a predominance of serovar 6 and fail to demonstrate any selective protection against different serovars by Mycobacterium bovis ECG vaccination....

Survival and Filamentation of Salmonella enterica Serovar Enteritidis PT4 and Salmonella enterica Serovar Typhimurium DT104 at Low Water Activity

Science.gov (United States)

Mattick, K. L.; Jørgensen, F.; Legan, J. D.; Cole, M. B.; Porter, J.; Lappin-Scott, H. M.; Humphrey, T. J.

2000-01-01

In this study we investigated the long-term survival of and morphological changes in Salmonella strains at low water activity (aw). Salmonella enterica serovar Enteritidis PT4 and Salmonella enterica serovar Typhimurium DT104 survived at low aw for long periods, but minimum humectant concentrations of 8% NaCl (aw, 0.95), 96% sucrose (aw, 0.94), and 32% glycerol (aw, 0.92) were bactericidal under most conditions. Salmonella rpoS mutants were usually more sensitive to bactericidal levels of NaCl, sucrose, and glycerol. At a lethal aw, incubation at 37°C resulted in more rapid loss of viability than incubation at 21°C. At aw values of 0.93 to 0.98, strains of S. enterica serovar Enteritidis and S. enterica serovar Typhimurium formed filaments, some of which were at least 200 μm long. Filamentation was independent of rpoS expression. When the preparations were returned to high-aw conditions, the filaments formed septa, and division was complete within approximately 2 to 3 h. The variable survival of Salmonella strains at low aw highlights the importance of strain choice when researchers produce modelling data to simulate worst-case scenarios or conduct risk assessments based on laboratory data. The continued increase in Salmonella biomass at low aw (without a concomitant increase in microbial count) would not have been detected by traditional microbiological enumeration tests if the tests had been performed immediately after low-aw storage. If Salmonella strains form filaments in food products that have low aw values (0.92 to 0.98), there are significant implications for public health and for designing methods for microbiological monitoring. PMID:10742199

Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil

Directory of Open Access Journals (Sweden)

Cristhiane Moura Falavina dos Reis

2011-04-01

Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.

Internalisation potential of Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica subsp. enterica serovar Typhimurium and Staphylococcus aureus in lettuce seedlings and mature plants.

Science.gov (United States)

Standing, Taryn-Ann; du Plessis, Erika; Duvenage, Stacey; Korsten, Lise

2013-06-01

The internalisation potential of Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7 and Salmonella enterica subsp. enterica serovar Typhimurium in lettuce was evaluated using seedlings grown in vermiculite in seedling trays as well as hydroponically grown lettuce. Sterile distilled water was spiked with one of the four human pathogenic bacteria (10(5) CFU/mL) and used to irrigate the plants. The potential for pathogen internalisation was investigated over time using light microscopy, transmission electron microscopy and viable plate counts. Additionally, the identities of the pathogens isolated from internal lettuce plant tissues were confirmed using polymerase chain reaction with pathogen-specific oligonucleotides. Internalisation of each of the human pathogens was evident in both lettuce seedlings and hydroponically grown mature lettuce plants. To our knowledge, this is the first report of S. aureus internalisation in lettuce plants. In addition, the levels of background microflora in the lettuce plants were determined by plate counting and the isolates identified using matrix-assisted laser ionisation-time of flight (MALDI-TOF). Background microflora assessments confirmed the absence of the four pathogens evaluated in this study. A low titre of previously described endophytes and soil inhabitants, i.e., Enterobacter cloacae, Enterococcus faecalis, Lysinibacillus fusiformis, Rhodococcus rhodochrous, Staphylococcus epidermidis and Staphylococcus hominis were identified.

Monitoring paneer for Listeria monocytogenes - A high risk food ...

African Journals Online (AJOL)

A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

Genome-wide methylation patterns in Salmonella enterica Subsp. enterica Serovars.

Directory of Open Access Journals (Sweden)

Cary Pirone-Davies

Full Text Available The methylation of DNA bases plays an important role in numerous biological processes including development, gene expression, and DNA replication. Salmonella is an important foodborne pathogen, and methylation in Salmonella is implicated in virulence. Using single molecule real-time (SMRT DNA-sequencing, we sequenced and assembled the complete genomes of eleven Salmonella enterica isolates from nine different serovars, and analysed the whole-genome methylation patterns of each genome. We describe 16 distinct N6-methyladenine (m6A methylated motifs, one N4-methylcytosine (m4C motif, and one combined m6A-m4C motif. Eight of these motifs are novel, i.e., they have not been previously described. We also identified the methyltransferases (MTases associated with 13 of the motifs. Some motifs are conserved across all Salmonella serovars tested, while others were found only in a subset of serovars. Eight of the nine serovars contained a unique methylated motif that was not found in any other serovar (most of these motifs were part of Type I restriction modification systems, indicating the high diversity of methylation patterns present in Salmonella.

A case of bovine raw milk contamination with Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hunt Karen

2012-07-01

Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

Influence of Environmental Factors and Human Activity on the Presence of Salmonella Serovars in a Marine Environment

Science.gov (United States)

Martinez-Urtaza, Jaime; Saco, Montserrat; de Novoa, Jacobo; Perez-Piñeiro, Pelayo; Peiteado, Jesus; Lozano-Leon, Antonio; Garcia-Martin, Oscar

2004-01-01

The temporal and spatial distribution of Salmonella contamination in the coastal waters of Galicia (northwestern Spain) relative to contamination events with different environmental factors (temperature, wind, hours of sunlight, rainfall, and river flow) were investigated over a 4-year period. Salmonellae were isolated from 127 of 5,384 samples of molluscs and seawater (2.4%), and no significant differences (P < 0.05) between isolates obtained in different years were observed. The incidence of salmonellae was significantly higher in water column samples (2.9%) than in those taken from the marine benthos (0.7%). Of the 127 strains of Salmonella isolated, 20 different serovars were identified. Salmonella enterica serovar Senftenberg was the predominant serovar, being represented by 54 isolates (42.5%), followed by serovar Typhimurium (19 isolates [15%]) and serovar Agona (12 isolates [9.4%]). Serovar Senftenberg was detected at specific points on the coast and could not be related to any of the environmental parameters analyzed. All serovars except Salmonella serovar Senftenberg were found principally in the southern coastal areas close to the mouths of rivers, and their incidence was associated with high southwestern wind and rainfall. Using multiple logistic regression analysis models, the prevalence of salmonellae was best explained by environmental parameters on the day prior to sampling. Understanding this relationship may be useful for the control of molluscan shellfish harvests, with wind and rainfall serving as triggers for closure. PMID:15066800

Antimicrobial susceptibilities of Listeria monocytogenes human strains isolated from 1970 to 2008 in Brazil Susceptibilidade antimicrobiana de cepas humanas de Listeria monocytogenes isoladas no período de 1970 a 2008 no Brasil

Directory of Open Access Journals (Sweden)

Cristhiane Moura Falavina dos Reis

2011-04-01

Full Text Available INTRODUCTION: Listeria monocytogenes is the causative agent of listeriosis, a foodborne illness that affects mainly pregnant women, the elderly and immunocompromised patients. The primary treatment is a combination of ampicillin with an aminoglycoside, in addition to a second-choice drug represented by chloramphenicol, erythromycin, tetracycline and rifampicin. The aim of this study was to analyze the antimicrobial susceptibility profile of strains isolated from human sources in the last four decades. METHODS: Sixty-eight strains were selected from the culture collection of the Laboratory of Bacterial Zoonoses/LABZOO/FIOCRUZ isolated in different regions of Brazil from 1970 to 2008 and primarily isolated from cerebrospinal fluid and blood culture. Susceptibility tests to antimicrobials drugs were evaluated using the criteria established by Soussy using the Kirby-Bauer method and E-Test strips were used to determine the minimum inhibitory concentration (MIC. RESULTS: Among the strains tested, serovar L4b (60.3% was the most prevalent, followed by serovar 1/2a (20.6%, 1/2b (13.2% and the more uncommon serovars 1/2c, 3b and 4ab (5.9%. All strains were susceptible to ampicillin, cephalothin, erythromycin, gentamicin, teicoplanin and vancomycin. Only one strain (1.5% showed resistance to rifampin, and two (3% were resistant to trimethoprim-sulfamethoxazole. MICs with values up to 2μg/ml reinforce the need for microbiological surveillance. CONCLUSIONS: The study demonstrated low prevalence of strains resistant to the antimicrobial drugs indicated in the treatment of human listeriosis. Monitoring antimicrobial resistance profile is still very important to determine adequate treatment, especially in immunocompromised patients.INTRODUÇÃO: Listeria monocytogenes é o agente etiológico da listeriose, doença de origem alimentar que acomete principalmente grávidas, pacientes imunodeprimidos e idosos. O tratamento primário é a associação de

Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

Directory of Open Access Journals (Sweden)

Puga eCH

2016-02-01

Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

Pseudogene accumulation in the evolutionary histories of Salmonella enterica serovars Paratyphi A and Typhi

Directory of Open Access Journals (Sweden)

White Brian

2009-01-01

Full Text Available Abstract Background Of the > 2000 serovars of Salmonella enterica subspecies I, most cause self-limiting gastrointestinal disease in a wide range of mammalian hosts. However, S. enterica serovars Typhi and Paratyphi A are restricted to the human host and cause the similar systemic diseases typhoid and paratyphoid fever. Genome sequence similarity between Paratyphi A and Typhi has been attributed to convergent evolution via relatively recent recombination of a quarter of their genomes. The accumulation of pseudogenes is a key feature of these and other host-adapted pathogens, and overlapping pseudogene complements are evident in Paratyphi A and Typhi. Results We report the 4.5 Mbp genome of a clinical isolate of Paratyphi A, strain AKU_12601, completely sequenced using capillary techniques and subsequently checked using Illumina/Solexa resequencing. Comparison with the published genome of Paratyphi A ATCC9150 revealed the two are collinear and highly similar, with 188 single nucleotide polymorphisms and 39 insertions/deletions. A comparative analysis of pseudogene complements of these and two finished Typhi genomes (CT18, Ty2 identified several pseudogenes that had been overlooked in prior genome annotations of one or both serovars, and identified 66 pseudogenes shared between serovars. By determining whether each shared and serovar-specific pseudogene had been recombined between Paratyphi A and Typhi, we found evidence that most pseudogenes have accumulated after the recombination between serovars. We also divided pseudogenes into relative-time groups: ancestral pseudogenes inherited from a common ancestor, pseudogenes recombined between serovars which likely arose between initial divergence and later recombination, serovar-specific pseudogenes arising after recombination but prior to the last evolutionary bottlenecks in each population, and more recent strain-specific pseudogenes. Conclusion Recombination and pseudogene-formation have been

First isolation of Salmonella enterica serovar Napoli from wild birds in Italy

Directory of Open Access Journals (Sweden)

Laura Mancini

2014-03-01

Full Text Available Salmonella enterica serovar Napoli (S. Napoli is an emerging serovar in Italy. It accounts for 2-4% of all serovars isolated from human infections. The zoonotic origin of this serovar is still unknown and this makes difficult to apply any control intervention. We report here the isolation of S. Napoli from a river nightingale (Cettia cetti, Temminck 1820 which represents the first description of this serovar from wild birds. This finding adds knowledge to the ecology of S. Napoli and addresses further studies aimed to assess the epidemiologic link between S. Napoli isolated from wild birds, food, environmental sources and human infections.

Camel as a transboundary vector for emerging exotic Salmonella serovars.

Science.gov (United States)

Ghoneim, Nahed H; Abdel-Moein, Khaled A; Zaher, Hala

2017-05-01

The current study was conducted to shed light on the role of imported camels as a transboundary vector for emerging exotic Salmonella serovars. Fecal samples were collected from 206 camels directly after slaughtering including 25 local camels and 181 imported ones as well as stool specimens were obtained from 50 slaughterhouse workers at the same abattoir. The obtained samples were cultured while Salmonella serovars were identified through Gram's stain films, biochemical tests and serotyping with antisera kit. Moreover, the obtained Salmonella serovars were examined by PCR for the presence of invA and stn genes. The overall prevalence of Salmonella serovars among the examined camels was 8.3%. Stn gene was detected in the vast majority of exotic strains (11/14) 78.6% including emerging serovars such as Salmonella Saintpaul, S. Chester, S. Typhimurium whereas only one isolate from local camels carried stn gene (1/3) 33.3%. On the other hand, none of the examined humans yielded positive result. Our findings highlight the potential role of imported camels as a transboundary vector for exotic emerging Salomenella serovars.

Inactivation kinetics of Escherichia coli O157:H7, Salmonella enterica Serovar Typhimurium, and Listeria monocytogenes in ready-to-eat sliced ham by near-infrared heating at different radiation intensities.

Science.gov (United States)

Ha, Jae-Won; Kang, Dong-Hyun

2014-07-01

The aim of this study was to investigate the inactivation kinetics of Salmonella enterica serovar Typhimurium, Escherichia coli O157:H7, and Listeria monocytogenes on ready-to-eat sliced ham by near-infrared (NIR) heating as a function of the processing parameter, radiation intensity. Precooked ham slices inoculated with the three pathogens were treated at different NIR intensities (ca. 100, 150, and 200 μW/cm(2)/nm). An increase in the applied radiation intensity resulted in a gradual increase of inactivation of all pathogens. The survival curves of the three pathogens exhibited both shoulder and tailing behavior at all light intensities. Among nonlinear models, the Weibull distribution and log-logistic model were used to describe the experimental data, and the statistical results (mean square error and R(2) values) indicated the suitability of the model for prediction. The log-logistic model more accurately described survival curves of the three pathogens than did the Weibull distribution at all radiation intensities. The output of this study and the proposed kinetics model would be beneficial to the deli meat industry for selecting the optimum processing conditions of NIR heating to meet the target pathogen inactivation on ready-to-eat sliced ham.

The emergence of Leptospira borgpetersenii serovar Arborea in Queensland, Australia, 2001 to 2013.

Science.gov (United States)

Lau, Colleen L; Skelly, Chris; Dohnt, Michael; Smythe, Lee D

2015-06-14

Leptospirosis is an emerging infectious disease, with increasing frequency and severity of outbreaks, changing epidemiology of populations at risk, and the emergence of new serovars. Environmental drivers of disease transmission include flooding, urbanisation, poor sanitation, changes in land use and agricultural practices, and socioeconomic factors. In Queensland, human infection with Leptosira borgpetersenii serovar Arborea was first reported in 2001. This study aims to report the emergence of serovar Arborea in Queensland from 2001 to 2013, and investigate potential risk factors for infection and drivers of emergence. Data on laboratory-confirmed cases of human leptospirosis in Queensland were obtained from the enhanced surveillance system at the WHO/FAO/OIE Collaborating Centre for Reference and Research on Leptospirosis in Brisbane, Australia. The changing epidemiology of serovar Arborea from 2001 to 2003 was described with respect to case numbers, proportion of leptospirosis cases attributed to the serovar, and geographic distribution. Differences in risk factors for the most common serovars were compared. During this period, 1289 cases of leptospirosis were reported, including 233 cases attributed to serovar Arborea. Risk factors for infection include male gender (91 % of cases), occupation, and recreational exposure. Most common occupations recorded were banana workers (28.4 %), meat workers (7.2 %), dairy farmers (5.8 %), graziers/stockmen (5.5 %), 'other agricultural/rural workers' (16.4 %), and tourists or tourism operators (4.6 %). Time trend analysis showed that while non-Arborea cases decreased over the study period, Arborea cases increased by 3.4 cases per year. The proportion of annual cases attributed to Arborea peaked at 49 % in 2011 after unprecedented flooding in Queensland. Mapping of cases by residential location showed expansion of the geographic range of serovar Arborea, concentrating mostly around Brisbane, Cairns and Innisfail. Serovars

Biofilm Formation of Listeria monocytogenes on Various Surfaces

Directory of Open Access Journals (Sweden)

M Mahdavi

2007-10-01

Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

Comparative genomics of pathogenic Leptospira interrogans serovar Canicola isolated from swine and human in Brazil

Directory of Open Access Journals (Sweden)

Luisa Z Moreno

Full Text Available Leptospira interrogans serovar Canicola is one of the most important pathogenic serovars for the maintenance of urban leptospirosis. Even though it is considered highly adapted to dogs, serovar Canicola infection has already been described in other animals and even a few human cases. Here, we present the genomic characterisation of two Brazilian L. interrogans serovar Canicola strains isolated from slaughtered sows (L0-3 and L0-4 and their comparison with human strain Fiocruz LV133. It was observed that the porcine serovar Canicola strains present the genetic machinery to cause human infection and, therefore, represent a higher risk to public health. Both human and porcine serovar Canicola isolates also presented sequences with high identity to the Chinese serovar Canicola published plasmids pGui1 and pGui2. The plasmids identification in the Brazilian and Chinese serovar Canicola strains suggest that extra-chromosomal elements are one more feature of this serovar that was previously unnoticed.

Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

Science.gov (United States)

Hwang, Cheng-An; Sheen, Shiowshuh

2011-05-01

This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

Purification, crystallization and preliminary X-ray crystallographic analysis of PBP4 from Listeria monocytogenes

International Nuclear Information System (INIS)

Jeong, Jae-Hee; Bae, Ji-Eun; Kim, Yeon-Gil

2011-01-01

The crystallization of PBP4 from L. monocytogenes is reported. Penicillin-binding proteins (PBPs), which catalyze peptidoglycan synthesis, have been extensively studied as a well established target of antimicrobial agents, including β-lactam derivatives. However, remarkable resistance to β-lactams has developed among pathogenic bacteria since the clinical use of penicillin began. Recently, the glycosyltransferase (GT) domain of class A PBPs has been proposed as an attractive target for antibiotic development as moenomycin-bound GT-domain structures have been determined. In this study, a class A PBP4 from Listeria monocytogenes was overexpressed, purified and crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected to 2.1 Å resolution using synchrotron radiation. The crystal belonged to the primitive orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 84.6, b = 127.8, c = 54.9 Å. The structural information will contribute to the further development of moenomycin-derived antibiotics possessing broad-spectrum activity

Listeria monocytogenes, a down-to-earth pathogen.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

2013-01-01

Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

Co-expression of Nisin Z and Leucocin C as a Basis for Effective Protection Against Listeria monocytogenes in Pasteurized Milk

Directory of Open Access Journals (Sweden)

Yuxin Fu

2018-03-01

Full Text Available Nisin, an important bacteriocin from Lactococcus lactis subsp., is primarily active against various Gram-positive bacteria. Leucocin C, produced by Leuconostoc carnosum 4010, is a class IIa bacteriocin used to inhibit the growth of Listeria monocytogenes. Because two bacteriocins have different modes of action, the combined use of them could be a potential strategy for effective inhibition of foodborne pathogens. In this study, L. lactis N8-r-lecCI (N8 harboring lecCI gene coexpressing nisin–leucocin C was constructed based on the food-grade carrier L. lactis N8. Production of both bacteriocins was stably maintained. Antimicrobial measurements showed that the recombinant strain is effectively against Listeria monocytogenes and Staphylococcus aureus and moderately against Salmonella enterica serovar Enteritidis and Escherichia coli because of its stronger antibacterial activity than the parental strain, this result first demonstrated that the co-expression of nisin and leucocin C results in highly efficient antimicrobial activity. The checkerboard assay showed that the antibacterial activity of L. lactis N8-r-lecCI supernatant was enhanced in the presence of low concentration of EDTA. Analysis of the scanning electron microscope image showed the biggest cellular morphology change in L. monocytogenes treated with a mixture of EDTA and L. lactis N8-r-lecCI supernatant. The practical effect was verified in pasteurized milk through time-kill assay. The L. lactis N8-r-lecCI strain expressing both nisin and leucocin C has a promising application prospect in pasteurized milk processing and preservation because of its strong antibacterial activity.

A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

Science.gov (United States)

Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

2017-03-21

Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role

Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia.

Science.gov (United States)

Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I

2014-02-01

We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Determination of Leptospira borgpetersenii serovar Javanica and Leptospira interrogans serovar Bataviae as the persistent Leptospira serovars circulating in the urban rat populations in Peninsular Malaysia.

Science.gov (United States)

Benacer, Douadi; Mohd Zain, Siti Nursheena; Sim, Shin Zhu; Mohd Khalid, Mohd Khairul Nizam; Galloway, Renee L; Souris, Marc; Thong, Kwai Lin

2016-03-01

Leptospirosis is an emerging infectious disease of global significance, and is endemic in tropical countries, including Malaysia. Over the last decade, a dramatic increase of human cases was reported; however, information on the primary vector, the rat, and the Leptospira serovars circulating among the rat population is limited. Therefore, the present study was undertaken to isolate Leptospira and characterise the serovars circulating in the urban rat populations from selected main cities in Peninsular Malaysia. Rat trappings were carried out between October 2011 to February 2014 in five urban cities which were chosen as study sites to represent different geographical locations in Peninsular Malaysia. Microscopic agglutination test (MAT) and PCR were carried out to identify the Leptospiral serogroup and determine the pathogenic status of the isolates, respectively while pulsed-field gel electrophoresis (PFGE) and random amplified polymorphic DNA (RAPD)-PCR were used to characterize the isolates. Three rat species were identified from the three hundred and fifty seven rats captured with Rattus rattus, being the dominant rat species (285, 80 %) followed by Rattus norgevicus (53, 15 %) and Rattus exulans (19, 5 %). Only 39 samples (11.0 %) were positive by culture and further confirmed as pathogenic Leptospira by PCR. Significant associations were shown between host infection with locality, season, host-age and species. Based on MAT, two serogroups were identified in the population namely; L. borgpetersenii serogroup Javanica (n = 16) and L. interrogans serogroup Bataviae (n = 23). Pulsed-field gel electrophoresis (PFGE) distinguished the two serovars in the urban rat populations: L. borgpetersenii serovar Javanica (41 %), and L. interrogans serovar Bataviae (59 %). RAPD-PCR yielded 14 distinct patterns and was found to be more discriminative than PFGE. This study confirms two Leptospira serovars circulating among the urban rats population in Peninsular

Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

DEFF Research Database (Denmark)

Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

2000-01-01

A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

Novel Cadmium Resistance Determinant in Listeria monocytogenes.

Science.gov (United States)

Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

2017-03-01

Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

Inactivation of Escherichia coli, Listeria monocytogenes, and Salmonella Enteritidis by Cymbopogon citratus D.C. Stapf. Essential Oil in Pineapple Juice.

Science.gov (United States)

Leite, Caroline Junqueira Barcellos; de Sousa, Jossana Pereira; Medeiros, José Alberto da Costa; da Conceição, Maria Lúcia; dos Santos Falcão-Silva, Vivyanne; de Souza, Evandro Leite

2016-02-01

In the present study, the efficacy of Cymbopogon citratus D.C. Stapf. essential oil (CCEO) to provoke a 5-log CFU/ml (5-log) inactivation in a mixed composite of Escherichia coli, Listeria monocytogenes, and Salmonella enterica serovar Enteritidis in pineapple (Ananas comosus (L.) Merril) juice (4°C) was assessed. Moreover, the effects of CCEO on the physicochemical and sensory quality parameters of pineapple juice were evaluated. The MIC of CCEO was 5 μl/ml against the composite mix examined. For L. monocytogenes and E. coli inoculated in juice containing CCEO (5, 2.5, and 1.25 μl/ml), a ≥5-log reduction was detected after 15 min of exposure. This same result was obtained for Salmonella Enteritidis incubated alone in pineapple juice containing CCEO at 5 and 2.5 μl/ml. Overall, Salmonella Enteritidis was the most tolerant and L. monocytogenes was the most sensitive to CCEO. The physicochemical properties (pH, titratable acidic [citric acid per 100 g], and soluble solids) of pineapple juice containing CCEO (2.5 and 1.25 μl/ml) were maintained. Juice containing CCEO (2.5 and 1.25 μl/ml) exhibited similar scores for odor, appearance, and viscosity compared with juice without CCEO. However, unsatisfactory changes in taste and aftertaste were observed in juices containing CCEO. These results suggest that CCEO could be used as an alternative antimicrobial compound to ensure the safety of pineapple juice, although CCEO at the tested concentrations negatively impacted its taste. Therefore, further studies are needed to determine the balance between microbial safety and taste acceptability of pineapple juice containing CCEO.

Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

Science.gov (United States)

González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

2001-11-01

The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

DEFF Research Database (Denmark)

Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

1996-01-01

Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat

International Nuclear Information System (INIS)

Kamat, A.S.; Nair, M.P.

1995-01-01

Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)

Licheniocin 50.2 and Bacteriocins from Lactococcus lactis subsp. lactis biovar. diacetylactis BGBU1-4 Inhibit Biofilms of Coagulase Negative Staphylococci and Listeria monocytogenes Clinical Isolates.

Science.gov (United States)

Cirkovic, Ivana; Bozic, Dragana D; Draganic, Veselin; Lozo, Jelena; Beric, Tanja; Kojic, Milan; Arsic, Biljana; Garalejic, Eliana; Djukic, Slobodanka; Stankovic, Slavisa

2016-01-01

Coagulase negative staphylococci (CoNS) and Listeria monocytogenes have important roles in pathogenesis of various genital tract infections and fatal foetomaternal infections, respectively. The aim of our study was to investigate the inhibitory effects of two novel bacteriocins on biofilms of CoNS and L. monocytogenes genital isolates. The effects of licheniocin 50.2 from Bacillus licheniformis VPS50.2 and crude extract of bacteriocins produced by Lactococcus lactis subsp. lactis biovar. diacetylactis BGBU1-4 (BGBU1-4 crude extract) were evaluated on biofilm formation and formed biofilms of eight CoNS (four S. epidermidis, two S. hominis, one S. lugdunensis and one S. haemolyticus) and 12 L. monocytogenes genital isolates. Licheniocin 50.2 and BGBU1-4 crude extract inhibited the growth of both CoNS and L. monocytogenes isolates, with MIC values in the range between 200-400 AU/ml for licheniocin 50.2 and 400-3200 AU/ml for BGBU1-4 crude extract. Subinhibitory concentrations (1/2 × and 1/4 × MIC) of licheniocin 50.2 inhibited biofilm formation by all CoNS isolates (p < 0.05, respectively), while BGBU1-4 crude extract inhibited biofilm formation by all L. monocytogenes isolates (p < 0.01 and p < 0.05, respectively). Both bacteriocins in concentrations of 100 AU/mL and 200 AU/mL reduced the amount of 24 h old CoNS and L. monocytogenes biofilms (p < 0.05, p < 0.01, p < 0.001). This study suggests that novel bacteriocins have potential to be used for genital application, to prevent biofilm formation and/or to eradicate formed biofilms, and consequently reduce genital and neonatal infections by CoNS and L. monocytogenes.

Salmonella enterica: Survival, Colonization, and Virulence Differences among Serovars

Science.gov (United States)

Andino, A.; Hanning, I.

2015-01-01

Data indicate that prevalence of specific serovars of Salmonella enterica in human foodborne illness is not correlated with their prevalence in feed. Given that feed is a suboptimal environment for S. enterica, it appears that survival in poultry feed may be an independent factor unrelated to virulence of specific serovars of Salmonella. Additionally, S. enterica serovars appear to have different host specificity and the ability to cause disease in those hosts is also serovar dependent. These differences among the serovars may be related to gene presence or absence and expression levels of those genes. With a better understanding of serovar specificity, mitigation methods can be implemented to control Salmonella at preharvest and postharvest levels. PMID:25664339

Salmonella enterica: Survival, Colonization, and Virulence Differences among Serovars

Directory of Open Access Journals (Sweden)

A. Andino

2015-01-01

Full Text Available Data indicate that prevalence of specific serovars of Salmonella enterica in human foodborne illness is not correlated with their prevalence in feed. Given that feed is a suboptimal environment for S. enterica, it appears that survival in poultry feed may be an independent factor unrelated to virulence of specific serovars of Salmonella. Additionally, S. enterica serovars appear to have different host specificity and the ability to cause disease in those hosts is also serovar dependent. These differences among the serovars may be related to gene presence or absence and expression levels of those genes. With a better understanding of serovar specificity, mitigation methods can be implemented to control Salmonella at preharvest and postharvest levels.

Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

DEFF Research Database (Denmark)

Jørgensen, Lasse Vigel; Huss, Hans Henrik

1998-01-01

Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

Listeria monocytogenes - Danger for health safety vegetable production.

Science.gov (United States)

Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

2018-04-22

The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

Presence of antibodies against Leptospira serovars in Chaetophractus villosus (Mammalia, Dasypodidae), La Pampa province, Argentina.

Science.gov (United States)

Kin, Marta S; Brihuega, Bibiana; Fort, Marcelo; Delgado, Fernando; Bedotti, Daniel; Casanave, Emma B

2015-01-01

Leptospirosis is a zoonosis of worldwide distribution. The aim of this study was to examine the presence of antibodies against 21 Leptospira reactive serovars in Chaetophractus villosus in La Pampa province, Argentina, using the microscopic agglutination test (MAT). Pathologic changes compatible with leptospirosis and in situ detection of the agent by immunohistochemistry were studied in 24 and 3 individuals respectively. Only 35/150 (23.3%) serum samples had antibodies against Leptospira sp. Six percent of the samples reacted with serovar Canicola, 4.7% with serovar Castellonis, 1.3% with serovar Icterohemorrhagieae and 0.7% with serovar Hardjo. Sixteen (10.6%) serum samples agglutinated with Castellonis-Icterohemorrhagiae and Canicola-Castellonis serovars, both with 4.7%, and Canicola-Hardjo and Castellonis-Canicola-Icterohemorrhagiae both with 0.6%. Fourteen animals had variable degrees of lesions, which were more severe in animals with higher serological titers (3200), and Leptospira sp. was detected in 3 animals by immunohistochemistry. These results represent the first record of the presence of Leptospira in C. villosus in La Pampa. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter.

Science.gov (United States)

Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J

1997-03-01

The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

Directory of Open Access Journals (Sweden)

Ramadass P

2002-01-01

Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

Listeria monocytogenes as a vector for anti-cancer therapies.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

SEROPREVALENCE OF NINE LEPTOSPIRA INTERROGANS SEROVARS IN WILD CARNIVORES, UNGULATES, AND PRIMATES FROM A ZOO POPULATION IN A METROPOLITAN REGION OF CHILE.

Science.gov (United States)

Moreno-Beas, Eduardo; Abalos, Pedro; Hidalgo-Hermoso, Ezequiel

2015-12-01

Serum samples from 130 individuals representing 42 species of carnivores, ungulates, and primates from a population of captive mammals in Metropolitan Region in Chile were tested for antibodies against nine serovars of Leptospira interrogans using the microscopic agglutination test. Ten percent of the animals were seropositive to one or more serovars. Seroprevalence was significantly higher in ungulates (20.4%) compared to carnivores (3.8%) and primates (3.4%). There were no significant differences in seroprevalence among sex and age ranges. The most frequent serovar detected was Autumnalis, present in 53.4% of antibody-positive animals. Most positive animals had titers of ≤1 : 200, except for a maned wolf ( Chrysocyon brachyurus ) with titers of 1 : 400 against serovar Hardjo. To the authors' knowledge, this is the first report of Leptospira exposure detected in native endangered pudu ( Pudu puda ) and the first confirmation of exposure to L. interrogans in captive wild mammals in Chile. Leptospirosis should be considered as a differential diagnosis in future disease presentation for hepatitis or abortions in captive mammals in Chile.

Fødevarebetinget listeria monocytogenes endokarditis

DEFF Research Database (Denmark)

Frydland, Martin; Bundgaard, Henning; Moser, Claus

2014-01-01

Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

A novel Salmonella serovar isolated from Peregrine Falcon (Falco peregrinus nestlings in Sweden: Salmonella enterica enterica serovar Pajala (Salmonella Pajala

Directory of Open Access Journals (Sweden)

Jorge Hernández

2012-08-01

Full Text Available A novel Salmonella serovar was isolated from Peregrine falcon (Falco peregrinus nestlings in northern Sweden in 2006. Three isolates of the same clone was retrieved from three falcon siblings and characterized as Salmonella enterica sub-species enterica: O-phase 13, 23:-: e, n, z 15 and the H-phase was not present. We propose the geographical name Salmonella enterica, sub-species enterica serovar Pajala to this novel Salmonella.

Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

Science.gov (United States)

Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

2010-06-01

Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

Directory of Open Access Journals (Sweden)

Wanessa Altimiras Costa

2009-12-01

Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

Survival and High-Hydrostatic Pressure Inactivation of Foodborne Pathogens in Salmorejo, a Traditional Ready-to-Eat Food.

Science.gov (United States)

Toledo Del Árbol, Julia; Pérez Pulido, Rubén; Grande, Ma José; Gálvez, Antonio; Lucas, Rosario

2015-11-01

Salmorejo is a traditional tomato-based creamy product. Because salmorejo is not heat-processed, there is a risk of contamination with foodborne pathogens from raw materials. Even though bacterial growth in salmorejo is strongly inhibited because of its acidic pH (close to 3.9), the growth and survival of 3 foodborne pathogens in this food has not been studied before. In this study, 3 cocktails consisting of Escherichia coli O157, Salmonella enterica serovar Enteritidis, and Listeria monocytogenes strains were inoculated in freshly prepared salmorejo. The food was treated by high hydrostatic pressure (HHP) at 400, 500, or 600 MPa for 8 min, or left untreated, and stored at 4 °C for 30 d. Viable cell counts were determined on selective media and also by the triple-layer agar method in order to detect sublethally injured cells. In control samples, L. monocytogenes viable cells decreased by 2.4 log cycles at day 7 and were undetectable by day 15. S. enterica cells decreased by 0.5 or 2.4 log cycles at days 7 and 15 respectively, but still were detectable at day 30. E. coli O157 cells survived much better in salmorejo, decreasing only by 1.5 log cycles at day 30. Treatments at pressures of 400 MPa or higher reduced viable counts of L. monocytogenes and S. enterica to undetectable levels. HHP treatments significantly (P food, usually produced on a small scale. HHP treatment at 600 MPa for 8 min can be an efficient nonthermal method for industrial-scale preparation of preservative-free salmorejo with improved safety against transmission of foodborne pathogens L. monocytogenes serotyes 4a and 4b, S. enterica serovar Enteritidis, and E. coli O157. © 2015 Institute of Food Technologists®

Listeria monocytogenes: monitoramento desse perigo biológico na cadeia produtiva de frangos do sul do Rio Grande do Sul Listeria monocytogenes: assessing this microbiological hazard in a poultry productive chain in southern Rio Grande do Sul

Directory of Open Access Journals (Sweden)

Élen Silveira Nalério

2009-09-01

Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15

Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

Science.gov (United States)

Miettinen, Hanna; Wirtanen, Gun

2005-10-15

A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

Characterization of Isolates of Salmonella enterica Serovar Stanley, a Serovar Endemic to Asia and Associated with Travel

Science.gov (United States)

Le Hello, Simon; Bortolaia, Valeria; Pulsrikarn, Chaiwat; Nielsen, Eva Møller; Pornruangmong, Srirat; Chaichana, Phattharaporn; Svendsen, Christina Aaby; Weill, François-Xavier; Aarestrup, Frank M.

2012-01-01

Salmonella enterica serovar Stanley (S. Stanley) is a common serovar in Southeast Asia and was the second most common serovar implicated in human salmonellosis in Thailand in the years 2002 to 2007. In contrast, this serovar is relatively uncommon in Europe. The objective of this study was to characterize a collection of S. Stanley strains isolated from Thai (n = 62), Danish (n = 39), and French (n = 24) patients to gain a broader understanding of the genetic diversity, population dynamics, and susceptibility to antimicrobials. All isolates were characterized by pulsed-field gel electrophoresis and antimicrobial susceptibility testing. The molecular mechanisms of resistance to extended-spectrum cephalosporins and plasmid-mediated resistance to quinolones were characterized by PCR and sequencing. Plasmid profiling, replicon typing, and microarray analysis were used to characterize the genetic mechanisms of antimicrobial resistance in 10 extended-spectrum cephalosporinase-producing isolates. Considerable genetic diversity was observed among the isolates characterized with 91 unique XbaI pulsed-field gel electrophoresis (PFGE) patterns, including 17 distinct clusters consisting of two to seven indistinguishable isolates. We found some of the S. Stanley isolates isolated from patients in Europe were acquired during travel to Southeast Asia, including Thailand. The presence of multiple plasmid lineages carrying the extended-spectrum cephalosporinase-encoding blaCMY-2 gene in S. Stanley isolates from the central part of Thailand was confirmed. Our results emphasize that Thai authorities, as well as authorities in other countries lacking prudent use of antimicrobials, should improve the ongoing efforts to regulate antimicrobial use in agriculture and in clinical settings to limit the spread of multidrug-resistant Salmonella isolates and plasmids among humans and pigs in Thailand and abroad. PMID:22205822

Listeria monocytogenes Monographic Study

Directory of Open Access Journals (Sweden)

Emil Tirziu

2010-05-01

Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

A Unique Capsule Locus in the Newly Designated Actinobacillus pleuropneumoniae Serovar 16 and Development of a Diagnostic PCR Assay.

Science.gov (United States)

Bossé, Janine T; Li, Yanwen; Sárközi, Rita; Gottschalk, Marcelo; Angen, Øystein; Nedbalcova, Katerina; Rycroft, Andrew N; Fodor, László; Langford, Paul R

2017-03-01

Actinobacillus pleuropneumoniae causes pleuropneumonia, an economically significant lung disease of pigs. Recently, isolates of A. pleuropneumoniae that were serologically distinct from the previously characterized 15 serovars were described, and a proposal was put forward that they comprised a new serovar, serovar 16. Here we used whole-genome sequencing of the proposed serovar 16 reference strain A-85/14 to confirm the presence of a unique capsular polysaccharide biosynthetic locus. For molecular diagnostics, primers were designed from the capsule locus of strain A-85/14, and a PCR was formulated that differentiated serovar 16 isolates from all 15 known serovars and other common respiratory pathogenic/commensal bacteria of pigs. Analysis of the capsule locus of strain A-85/14 combined with the previous serological data show the existence of a sixteenth serovar-designated serovar 16-of A. pleuropneumoniae . Copyright © 2017 Bossé et al.

Exendin-4 improves resistance to Listeria monocytogenes infection in diabetic db/db mice

OpenAIRE

Liu, Hsien Yueh; Chung, Chih-Yao; Yang, Wen-Chin; Liang, Chih-Lung; Wang, Chi-Young; Chang, Chih-Yu; Chang, Cicero Lee-Tian

2012-01-01

The incidence of diabetes mellitus is increasing among companion animals. This disease has similar characteristics in both humans and animals. Diabetes is frequently identified as an independent risk factor for infections associated with increased mortality. In the present study, homozygous diabetic (db/db) mice were infected with Listeria (L.) monocytogenes and then treated with the anti-diabetic drug exendin-4, a glucagon-like peptide 1 analogue. In aged db/db mice, decreased CD11b+ macroph...

Salmonella enterica serovar-specific transcriptional reprogramming of infected cells.

Science.gov (United States)

Hannemann, Sebastian; Galán, Jorge E

2017-07-01

Despite their high degree of genomic similarity, different Salmonella enterica serovars are often associated with very different clinical presentations. In humans, for example, the typhoidal S. enterica serovar Typhi causes typhoid fever, a life-threatening systemic disease. In contrast, the non-typhoidal S. enterica serovar Typhimurium causes self-limiting gastroenteritis. The molecular bases for these different clinical presentations are incompletely understood. The ability to re-program gene expression in host cells is an essential virulence factor for typhoidal and non-typhoidal S. enterica serovars. Here, we have compared the transcriptional profile of cultured epithelial cells infected with S. Typhimurium or S. Typhi. We found that both serovars stimulated distinct transcriptional responses in infected cells that are associated with the stimulation of specific signal transduction pathways. These specific responses were associated with the presence of a distinct repertoire of type III secretion effector proteins. These observations provide major insight into the molecular bases for potential differences in the pathogenic mechanisms of typhoidal and non-typhoidal S. enterica serovars.

Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

Science.gov (United States)

Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

2013-04-01

Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

Effect of electropermeabilization by ohmic heating for inactivation of Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes in buffered peptone water and apple juice.

Science.gov (United States)

Park, Il-Kyu; Kang, Dong-Hyun

2013-12-01

The effect of electric field-induced ohmic heating for inactivation of Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, and Listeria monocytogenes in buffered peptone water (BPW) (pH 7.2) and apple juice (pH 3.5; 11.8 °Brix) was investigated in this study. BPW and apple juice were treated at different temperatures (55°C, 58°C, and 60°C) and for different times (0, 10, 20, 25, and 30 s) by ohmic heating compared with conventional heating. The electric field strength was fixed at 30 V/cm and 60 V/cm for BPW and apple juice, respectively. Bacterial reduction resulting from ohmic heating was significantly different (Pheating at 58°C and 60°C in BPW and at 55°C, 58°C, and 60°C in apple juice for intervals of 0, 10, 20, 25, and 30 s. These results show that electric field-induced ohmic heating led to additional bacterial inactivation at sublethal temperatures. Transmission electron microscopy (TEM) observations and the propidium iodide (PI) uptake test were conducted after treatment at 60°C for 0, 10, 20, 25 and 30 s in BPW to observe the effects on cell permeability due to electroporation-caused cell damage. PI values when ohmic and conventional heating were compared were significantly different (Pheating can more effectively reduce bacterial populations at reduced temperatures and shorter time intervals, especially in acidic fruit juices such as apple juice. Therefore, loss of quality can be minimized in a pasteurization process incorporating ohmic heating.

Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

Science.gov (United States)

Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

2016-04-15

The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

Science.gov (United States)

Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

2007-10-01

To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

Directory of Open Access Journals (Sweden)

Catherine E Jobbings

Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

Expression of hilA in response to mild acid stress in Salmonella enterica is serovar and strain dependent.

Science.gov (United States)

González-Gil, Francisco; Le Bolloch, Alexandre; Pendleton, Sean; Zhang, Nan; Wallis, Audra; Hanning, Irene

2012-05-01

Salmonella enterica is the leading cause of foodborne illness with poultry and poultry products being primary sources of infection. The 2 most common S. enterica serovars associated with human infection are Typhimurium and Enteritidis. However, Kentucky and Heidelburg and the 2 most prevalent serovars isolated from poultry environments. Given the prevalence of other serovars in poultry products and environments, research is needed to understand virulence modulation in response to stress in serovars other than Typhimurium and Enteritidis. Thus, the objective of this research was to compare hilA gene expression (a master regulator of the virulence pathogenicity island) in response to acid stress among different strains and serovars of Salmonella. A total of 11 serovars consisting of 15 strains of S. enterica were utilized for these experiments. Cultures were suspended in tryptic soy broth (TSB) adjusted to pH 7.2, 6.2, or 5.5 with HCl or acetic acid. Total RNA was extracted from cultures at specific time points (0, 2, 4, and 24 h). Gene expression of hilA was measured with quantitative reverse transcriptase real time PCR (qRT-PCR). Growth and pH were measured throughout the 24 h time frame. Regulation of hilA in response to acid stress varied by serovar and strain and type of acid. The results of these experiments indicate that hilA regulation may have some impact on virulence and colonization of S. enterica. However, these results warrant further research to more fully understand the significance of hilA regulation in response to mild acid stress in S. enterica. © 2012 Institute of Food Technologists®

Leptospira santorosai Serovar Shermani detergent extract induces an increase in fibronectin production through a Toll-like receptor 2-mediated pathway.

Science.gov (United States)

Tian, Ya-Chung; Hung, Cheng-Chieh; Li, Yi-Jung; Chen, Yung-Chang; Chang, Ming-Yang; Yen, Tzung-Hai; Hsu, Hsiang-Hao; Wu, Mai-Szu; Phillips, Aled; Yang, Chih-Wei

2011-03-01

Leptospirosis can activate inflammatory responses through Toll-like receptors (TLRs) and may cause renal tubulointerstitial fibrosis characterized by the accumulation of extracellular matrix (ECM). We have previously demonstrated that Leptospira santorosai serovar Shermani detergent extract stimulates ECM accumulation in vitro. The aim of this study was to examine the mechanistic basis of these previous observations and, in particular, to examine the potential involvement of TLRs. The addition of serovar Shermani detergent extract led to an increase in fibronectin gene expression and production. Inhibition of TLR2 but not TLR4 expression abrogated serovar Shermani detergent extract-mediated increases in fibronectin production. This response was also blocked by the knockdown of the gene expression of the TLR2 downstream transducers myeloid differentiation factor 88 (MyD88) and tumor necrosis factor receptor-associated factor 6 (TRAF6). Serovar Shermani detergent extract also activated nuclear factor-κB, and its inhibition by curcumin-attenuated serovar Shermani detergent extract induced increases in fibronectin production. These effects were also mimicked by the specific TLR2 agonist, Pam(3)CsK(4), a response that was also abrogated by the knockdown of MyD88 and TRAF6. Similarly, the administration of live leptospires to cells also induced fibronectin production that was blocked by inhibition of TLR2 and MyD88 expression. In conclusion, serovar Shermani detergent extract can induce fibronectin production through the TLR2-associated cascade, providing evidence of an association between TLRs and leptospirosis-mediated ECM deposition.

Chlamydia trachomatis serovar G infection in a bisexual male with urethritis.

Science.gov (United States)

Rawre, Jyoti; Dhawan, Benu; Saigal, Karnika; Khanna, Neena

2016-01-01

We report a case of Chlamydia trachomatis serovar G urogenital tract infection in a 33-year-old human immunodeficiency virus-1 (HIV-1) seropositive Indian bisexual male. This case highlights the emergence of a new serovar in India. The patient was tested positive for C. trachomatis by both cryptic plasmid and omp A gene polymerase chain reaction (PCR). On further characterization using polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) and omp A gene sequencing, the strain was found to be C. trachomatis serovar G. His spouse was also found to be infected with C. trachomatis serovar G. Phylogenetic analysis was performed on the clinical isolates obtained from both partners and were found to be identical to the isolates available in GenBank. The sexual network could not be traced further. Detection of a new genotype suggests importation of a new strain into the population probably by sexual contact with a person from a geographical area where the strain is common. Identifying circulating genotypes in the community can assist in developing strategies for improved sexually transmitted disease control.

Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review

Directory of Open Access Journals (Sweden)

James C. Barton

2018-01-01

Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.

Ascertaining the relationship between Salmonella Typhimurium and Salmonella 4,[5],12:i:- by MLVA and inferring the sources of human salmonellosis due to the two serovars in Italy

DEFF Research Database (Denmark)

Barco, Lisa; Barrucci, Federica; Cortini, Enzo

2015-01-01

The current picture of human salmonellosis shows Salmonella Typhimurium and S. 4,[5],12:i:- as the most common serovars in Italy. The aims of this study were to investigate the genetic relationship between these serovars, as well as to test the possibility of inferring sources of human...... salmonellosis due to S. Typhimurium and S. 4,[5],12:i:- by using multilocus variable-number tandem repeat analysis (MLVA) subtyping data. Single isolates from 268 human sporadic cases and 325 veterinary isolates (from pig, cattle, chicken, and turkey) collected over the period 2009-2011 were typed by MLVA......, and the similarities of MLVA profiles were investigated using different analytical approaches. Results showed that isolates of S. 4,[5],12:i:- were more clonal compared to S. Typhimurium and that clones of both serovars from different non-human sources were very close to those which were responsible for human...

Salmonella enterica serovar-specific transcriptional reprogramming of infected cells.

Directory of Open Access Journals (Sweden)

Sebastian Hannemann

2017-07-01

Full Text Available Despite their high degree of genomic similarity, different Salmonella enterica serovars are often associated with very different clinical presentations. In humans, for example, the typhoidal S. enterica serovar Typhi causes typhoid fever, a life-threatening systemic disease. In contrast, the non-typhoidal S. enterica serovar Typhimurium causes self-limiting gastroenteritis. The molecular bases for these different clinical presentations are incompletely understood. The ability to re-program gene expression in host cells is an essential virulence factor for typhoidal and non-typhoidal S. enterica serovars. Here, we have compared the transcriptional profile of cultured epithelial cells infected with S. Typhimurium or S. Typhi. We found that both serovars stimulated distinct transcriptional responses in infected cells that are associated with the stimulation of specific signal transduction pathways. These specific responses were associated with the presence of a distinct repertoire of type III secretion effector proteins. These observations provide major insight into the molecular bases for potential differences in the pathogenic mechanisms of typhoidal and non-typhoidal S. enterica serovars.

Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

Science.gov (United States)

Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

2014-12-01

The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

Science.gov (United States)

Lee, Yuejia; Wang, Chinling

2017-03-01

Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

Science.gov (United States)

Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

2016-01-01

Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Listeria monocytogenes source distribution analysis indicates regional heterogeneity and ecological niche preference among serotype 4b clones

Science.gov (United States)

Human illness due to the foodborne bacterial pathogen Listeria monocytogenes frequently involves certain widely disseminated clonal complexes (CCs), primarily of serotype 4b. CC1, CC2 and CC6, previously also designated epidemic clone (EC) I, Ia and II, respectively, have been frequently implicate...

Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

Science.gov (United States)

Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

2010-08-01

Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

Serovars of Salmonella from captive reptiles

DEFF Research Database (Denmark)

Pedersen, Karl; Lassen-Nielsen, Anne Marie; Nordentoft, Steen

2009-01-01

The distribution on serovars of 60 Salmonella isolates from reptiles kept in captivity in Denmark during the period 1995–2006 was investigated. The isolates were all recovered from clinical specimens submitted to the National Veterinary Institute. A majority of the samples were from reptiles...... in zoological gardens or similar, while a minor number was from reptiles kept in private homes. A total of 43 serovars were detected, most of them being what is usually called exotic serotypes, and many not having a trivial name, while a few isolates belonged to well-known human pathogenic serovars, such as S....... Enteritidis, S. Typhimurium, S. Bovismorbificans. One isolate was rough and two were non-typeable. Isolates from turtles belonged to the subspecies enterica, while many isolates from both sauria and snakes belonged to other subspecies. The findings underline the potential zoonotic risk by handling reptiles...

Assessment of exposure to Leptospira serovars in veterinary staff and dog owners in contact with infected dogs.

Science.gov (United States)

Barmettler, Reto; Schweighauser, Ariane; Bigler, Susanne; Grooters, Amy M; Francey, Thierry

2011-01-15

To assess patterns of seroreactivity to Leptospira serovars in veterinary professional staff and dog owners exposed to dogs with acute leptospirosis and to contrast these patterns in people with those observed in dogs. Cross-sectional study. Human subjects consisted of 91 people (50 veterinarians, 19 technical staff, 9 administrative personnel, and 13 dog owners) exposed to dogs with leptospirosis. Canine subjects consisted of 52 dogs with naturally occurring leptospirosis admitted to the University of Bern Vetsuisse Faculty Small Animal Clinic in 2007 and 2008. People were tested for seroreactivity to regionally prevalent Leptospira serovars by use of a complement fixation test. A questionnaire designed to identify risk factors associated with seropositivity was used to collect demographic information from each study participant. Dogs were tested for seroreactivity to Leptospira serovars by use of a microscopic agglutination test. On the basis of microscopic agglutination test results, infected dogs were seropositive for antibodies against Leptospira serovars as follows (in descending order): Bratislava (43/52 [83%]), Australis (43/52 [83%]), Grippotyphosa (18/52 [35%]), Pomona (12/52 [23%]), Autumnalis (6/52 [12%]), Icterohemorrhagiae (4/52 [8%]), Tarassovi (2/52 [4%]), and Canicola (1/52 [2%]). All 91 people were seronegative for antibodies against Leptospira serovars. Therefore, statistical evaluation of risk factors and comparison of patterns of seroreactivity to Leptospira serovars between human and canine subjects were limited to theoretical risks. Seroreactivity to Leptospira serovars among veterinary staff adhering to standard hygiene protocols and pet owners exposed to dogs with acute leptospirosis was uncommon.

Circulating serovars of Leptospira in cart horses of central and southern Ethiopia and associated risk factors.

Science.gov (United States)

Tsegay, K; Potts, A D; Aklilu, N; Lötter, C; Gummow, B

2016-03-01

Little work has been done on diseases of horses in Ethiopia or tropical regions of the world. Yet, Ethiopia has the largest horse population in Africa and their horses play a pivotal role in their economy as traction animals. A serological and questionnaire survey was therefore conducted to determine the circulating serovars of Leptospira and their association with potential risk factors in the cart horse population of Central and Southern Ethiopia. A total of 184 out of 418 cart horses from 13 districts had antibody titres of 1:100 or greater to at least one of 16 serovars of Leptospira species in Central and Southern Ethiopian horses. A significantly higher seropositivity (62.1%) was noted in horses from the highland agroecology followed by midland (44.4%) and lowland (39.8%). Serovar Bratislava (34.5%) was the predominant serovar followed by serovars Djasiman (9.8%), Topaz (5.98%) and Pomona (5.3%). Age and location proved to be associated with seropositive horses with older horses being more commonly affected and the districts of Ziway (Batu) (Apparent Prevalence (AP)=65.5%), Shashemene (AP=48.3%) and Sebeta (AP=41.4%) having the highest prevalence. Multivariable logistic regression found risk factors significantly associated with Leptospira seropositive horses were drinking river water (OR=2.8) and horses 7-12 years old (OR=5) and risk factors specifically associated with serovar Bratislava seropositive horses were drinking river water (OR=2.5), horses ≥13 years (OR=3.5) and the presence of dogs in adjacent neighbouring properties (OR=0.3). Dogs had a protective effect against seropositivity to serovars Bratislava and Djasiman, which may be due to their ability to control rodents. The high seroprevalence confirm that leptospirosis is endemic among horses of Central and Southern Ethiopia. The predominance of serovar Bratislava supports the idea that serovar Bratislava may be adapted to and maintained by the horse population of Central and Southern Ethiopia

Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

Directory of Open Access Journals (Sweden)

Ok Kyung Koo

Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

Recombinant Expression of a Genome-encoded N-acetylmuramoyl-L-alanine Amidase that Synergistically Lyses Listeria monocytogenes Biofilms with a Protease

Science.gov (United States)

Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...

Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

Science.gov (United States)

Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

2013-02-01

This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

A new multivalent (DHPPi/L4R) canine combination vaccine prevents infection, shedding and clinical signs following experimental challenge with four Leptospira serovars.

Science.gov (United States)

Wilson, Stephen; Stirling, Catrina; Thomas, Anne; King, Vickie; Plevová, Edita; Chromá, Ludmila; Siedek, Elisabeth; Illambas, Joanna; Salt, Jeremy; Sture, Gordon

2013-06-28

Although effective vaccines have been developed against the common Leptospira serovars, they are still reported in clinical cases, while others are increasingly prevalent. The results from four challenge studies following vaccination of dogs with a new combination vaccine (DHPPi/L4R) containing inactivated L. serovars, L. canicola, L. icterohaemorrhagiae, L. bratislava and L. grippotyphosa conducted to satisfy the requirements of the European Pharmacopoeia monograph (01/2008:0447), are reported. Six week old dogs received two vaccinations, three weeks apart, and were challenged 25 days later with different isolates of the L. serovars. Clinical observations were recorded, and blood, urine and tissue samples were collected for analysis. Following challenge, non-vaccinated dogs demonstrated various clinical signs, while no vaccinated dogs were affected; significant differences in mean clinical scores were observed. Measurable antibody titres to each Leptospira antigen were seen in vaccinated dogs 21 days following the first vaccination, with further increases in antibody titres observed following challenge with the respective Leptospira strain. Non-vaccinated dogs remained seronegative until challenge. Leptospira were re-isolated from the blood, urine, kidney and liver of all non-vaccinated dogs following challenge. In contrast no vaccinated dogs had Leptospira re-isolated from the same tissues. Significant differences were seen in number of days with positive isolation (blood and urine) and in number of dogs with positive samples (kidney and liver). In conclusion, vaccination of dogs with the new vaccine induces protective immunity 25 days after second vaccination with protection against infection, renal infection and clinical signs following challenge. Copyright © 2013 Elsevier Ltd. All rights reserved.

Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

Science.gov (United States)

Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

2017-06-01

Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.

Science.gov (United States)

Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun

2007-03-01

Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.

Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

DEFF Research Database (Denmark)

Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

2013-01-01

Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

Molecular characterization of Salmonella enterica serovar 4,[5],12:i:- DT193 ASSuT strains from two outbreaks in Italy

DEFF Research Database (Denmark)

Barco, Lisa; Ramon, Elena; Cortini, Enzo

2014-01-01

Abstract Salmonella enterica subsp. enterica serovar 4,[5],12:i:- DT193 is recognized as an emerging monophasic variant of Salmonella Typhimurium in many European countries. Resistance to ampicillin, streptomycin, sulphonamides, and tetracycline (R-type ASSuT) is described as one of the most comm...

Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Daniel R. Rissi

2010-01-01

Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

The effect of milk components and storage conditions on the virulence of Listeria monocytogenes as determined by a Caco-2 cell assay.

Science.gov (United States)

Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin

2013-08-16

Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.

A large outbreak of Listeria monocytogenes infection with short incubation period in a tertiary care hospital.

Science.gov (United States)

Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild

2010-12-01

Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

First Trimester Listeria monocytogenes Septicemia

NARCIS (Netherlands)

Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

1997-01-01

Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

DEFF Research Database (Denmark)

Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

2005-01-01

Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish.

Science.gov (United States)

Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P

2016-01-01

The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

Science.gov (United States)

Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

2012-06-01

The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

Science.gov (United States)

Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

2013-12-01

Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Maria da Graça F. Nascimento

1994-12-01

Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

Science.gov (United States)

Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

2016-11-16

Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

Science.gov (United States)

Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

2016-11-01

A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) for the characterisation of pathogenic leptospires: intra-serovar divergence, inter-serovar convergence, and evidence of attenuation in Leptospira reference collections.

Science.gov (United States)

Tulsiani, S M; Craig, S B; Graham, G C; Cobbold, R C; Dohnt, M F; Burns, M-A; Jansen, C C; Leung, L K-P; Field, H E; Smythe, L D

2010-07-01

High-resolution melt-curve analysis of random amplified polymorphic DNA (RAPD-HRM) is a novel technology that has emerged as a possible method to characterise leptospires to serovar level. RAPD-HRM has recently been used to measure intra-serovar convergence between strains of the same serovar as well as inter-serovar divergence between strains of different serovars. The results indicate that intra-serovar heterogeneity and inter-serovar homogeneity may limit the application of RAPD-HRM in routine diagnostics. They also indicate that genetic attenuation of aged, high-passage-number isolates could undermine the use of RAPD-HRM or any other molecular technology. Such genetic attenuation may account for a general decrease seen in titres of rabbit hyperimmune antibodies over time. Before RAPD-HRM can be further advanced as a routine diagnostic tool, strains more representative of the wild-type serovars of a given region need to be identified. Further, RAPD-HRM analysis of reference strains indicates that the routine renewal of reference collections, with new isolates, may be needed to maintain the genetic integrity of the collections.

Resistance of the genome of Escherichia coli and Listeria monocytogenes to irradiation evaluated by the induction of cyclobutane pyrimidine dimers and 6-4 photoproducts using gamma and UV-C radiations

Science.gov (United States)

Beauchamp, S.; Lacroix, M.

2012-08-01

The effect of gamma and UV-C irradiation on the production of cyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4 PPs) in DNA was investigated to compare the natural resistance of the genome of a Gram-positive bacterium and a Gram-negative bacterium against irradiation. Solution of pure DNA and bacterial strains Listeria monocytogenes and Escherichia coli were irradiated using gamma and UV-C rays. Extracted DNA from bacteria and pure DNA samples were then analysed by ELISA using anti-CPDs and anti-6-4 PPs monoclonal antibodies. The results show that gamma rays, as well as UV-C rays, induce the formation of CPDs and 6-4 PPs in DNA. During UV-C irradiation, the three samples showed a difference in their sensitivity against formation of CPDs (P≤0.05). Pure DNA was the most sensitive while the genome of L. monocytogenes was the most resistant. Also during UV-C irradiation, the genome of L. monocytogenes was the only one to show a significant resistance against formation of 6-4 PPs (P≤0.05). During gamma irradiation, for both types of lesion, pure DNA and the genome of E. coli did not show significant difference in their sensitivity (P>0.05) while the genome of L. monocytogenes showed a resistance against formation of CPDs and 6-4 PPs.

Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18

DEFF Research Database (Denmark)

Parkhill, J.; Dougan, G.; James, K.D.

2001-01-01

Salmonella enterica serovar Typhi (S. typhi) is the aetiological agent of typhoid fever, a serious invasive bacterial disease of humans with an annual global burden of approximately 16 million cases, leading to 600,000 fatalities(1). Many S. enterica serovars actively invade the mucosal surface...

Behavior of Listeria monocytogenes in a multi-species biofilm with Enterococcus faecalis and Enterococcus faecium and control through sanitation procedures.

Science.gov (United States)

da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru

2015-05-04

The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

Science.gov (United States)

Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

2017-09-01

Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

Science.gov (United States)

Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

2017-09-18

Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

[Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

Science.gov (United States)

Gelbícová, T; Karpísková, R

2012-04-01

Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

Proteome analysis of serovars Typhimurium and Pullorum of Salmonella enterica subspecies I

Directory of Open Access Journals (Sweden)

Begum Shajna

2005-07-01

Full Text Available Abstract Background Salmonella enterica subspecies I includes several closely related serovars which differ in host ranges and ability to cause disease. The basis for the diversity in host range and pathogenic potential of the serovars is not well understood, and it is not known how host-restricted variants appeared and what factors were lost or acquired during adaptations to a specific environment. Differences apparent from the genomic data do not necessarily correspond to functional proteins and more importantly differential regulation of otherwise identical gene content may play a role in the diverse phenotypes of the serovars of Salmonella. Results In this study a comparative analysis of the cytosolic proteins of serovars Typhimurium and Pullorum was performed using two-dimensional gel electrophoresis and the proteins of interest were identified using mass spectrometry. An annotated reference map was created for serovar Typhimurium containing 233 entries, which included many metabolic enzymes, ribosomal proteins, chaperones and many other proteins characteristic for the growing cell. The comparative analysis of the two serovars revealed a high degree of variation amongst isolates obtained from different sources and, in some cases, the variation was greater between isolates of the same serovar than between isolates with different sero-specificity. However, several serovar-specific proteins, including intermediates in sulphate utilisation and cysteine synthesis, were also found despite the fact that the genes encoding those proteins are present in the genomes of both serovars. Conclusion Current microbial proteomics are generally based on the use of a single reference or type strain of a species. This study has shown the importance of incorporating a large number of strains of a species, as the diversity of the proteome in the microbial population appears to be significantly greater than expected. The characterisation of a diverse selection of

Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

2015-08-01

In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Arginine-dependent acid resistance in Salmonella enterica serovar Typhimurium

NARCIS (Netherlands)

Kieboom, J.; Abee, T.

2006-01-01

Salmonella enterica serovar Typhimurium does not survive a pH 2.5 acid challenge under conditions similar to those used for Escherichia coli (J. W. Foster, Nat. Rev. Microbiol. 2:898-907, 2004). Here, we provide evidence that S. enterica serovar Typhimurium can display arginine-dependent acid

[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

Science.gov (United States)

Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

2008-03-01

To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

Science.gov (United States)

Tian, Jing; Liu, Xiu-mei

2009-09-01

To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

Prevalence of Salmonella spp., and serovars isolated from captive exotic reptiles in New Zealand.

Science.gov (United States)

Kikillus, K H; Gartrell, B D; Motion, E

2011-07-01

To investigate the prevalence of Salmonella spp. in captive exotic reptile species in New Zealand, and identify the serovars isolated from this population. Cloacal swabs were obtained from 378 captive exotic reptiles, representing 24 species, residing in 25 collections throughout New Zealand between 2008 and 2009. Samples were cultured for Salmonella spp., and suspected colonies were serotyped by the Institute of Environmental Science and Research (ESR). Forty-three of the 378 (11.4%) reptiles sampled tested positive for Salmonella spp., with 95% CI for the estimated true prevalence being 12-25% in exotic reptiles in this study population. Lizards tested positive for Salmonella spp. more often than chelonians. Agamid lizards tested positive more often than any other family group, with 95% CI for the estimated true prevalence being 56-100%.. Six Salmonella serovars from subspecies I and two from subspecies II were isolated. The serovar most commonly isolated was S. Onderstepoort (30.2%), followed by S. Thompson (20.9%), S. Potsdam (14%), S. Wangata (14%), S. Infantis (11.6%) and S. Eastbourne (2.3%). All of the subspecies I serovars have been previously reported in both reptiles and humans in New Zealand, and include serovars previously associated with disease in humans. This study showed that Salmonella spp. were commonly carried by exotic reptiles in the study population in New Zealand. Several serovars of Salmonella spp. with known pathogenicity to humans were isolated, including S. Infantis, which is one of the most common serovars isolated from both humans and non-human sources in New Zealand. The limitations of this study included the bias engendered by the need for voluntary involvement in the study, and the non-random sampling design. Based on the serovars identified in this and previous studies, it is recommended native and exotic reptiles be segregated within collections, especially when native reptiles may be used for biodiversity restoration

Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

Science.gov (United States)

Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

2017-09-01

Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

Research note: Molecular subtyping of Salmonella enterica serovar Tshiongwe recently isolated in Malaysia during 2001-2002.

Science.gov (United States)

Thong, Kwai Lin; Bakeri, Shamsilawani Ahmad; Lai, Kin Seng; Koh, Yin Tee; Taib, Mohd Zainuldin; Lim, V K E; Yasin, Rohani Md

2004-03-01

Pulsed field gel electrophoresis (PFGE) and antimicrobial susceptibility analysis were undertaken on twenty-three strains of Salmonella enterica serovar Tshiongwe, an unusual serovar, which recently emerged in Malaysia. Antimicrobial susceptibility analysis showed that all the strains were sensitive to ampicilin, chloramphenicol, cotrimoxazole, and kanamycin. Twenty (87%) and 8 (3.5%) strains had resistance to tetracycline and streptomycin respectively. PFGE analysis subtyped 23 strains into 10 profiles (Dice coefficient of similarity, F = 0.7-1.0). The predominant profile, X1 was found in both clinical and environmental isolates and was widely distributed in different parts of Malaysia during the study period. In addition, isolates recovered from food, a hand-towel, apron and the surface of a table-top in one particular location had unique, indistinguishable profiles (X4/4a) and identical antibiograms. Similarly, isolates from cooked meat and a chopping board had PFGE profiles similar to some human isolates. These probably indicated cross-contamination and poor hygiene in food practices, hence contributing to Salmonellosis. Factors causing the emergence of this rare Salmonella serovar being responsible for food poisoning episodes during the study period remained unclear. The study reiterated the usefulness and versatility of PFGE in the molecular subtyping of this rare Salmonella serovar in Malaysia.

Individual and combined efficacies of mild heat and ultraviolet-c radiation against Escherichia coli O157:H7, Salmonella enterica, and Listeria monocytogenes in coconut liquid endosperm.

Science.gov (United States)

Gabriel, Alonzo A; Ostonal, Jeffrey M; Cristobal, Jannelle O; Pagal, Gladess A; Armada, John Vincent E

2018-07-20

This study determined the inactivation kinetic parameters of selected pathogens in heat, ultraviolet-C and combined heat-UV-C treated coconut liquid endosperm. Separate cocktails of Escherichia coli O157:H7, Salmonella enterica serovars, and Listeria monocytogenes strains were inoculated into coconut liquid endosperm (pH 5.15, TSS 4.4 o Bx, TA 0.062% malic acid, extinction coefficient (ε) at 254 nm of 0.0154 cm -1 ) for inactivation studies. Result showed that all organisms generally exhibited a log-linear heat inactivation behavior (R 2 0.81-0.99). The E. coli O157:H7 cocktail (D 55  = 19.75 min, D 57  = 10.79 min, D 60  = 3.38 min, and D 63  = 0.46 min) was found to be significantly more resistant (P > 0.05) than the tested cocktail of L. monocytogenes (D 55  = 11.68 min, D 57  = 4.53 min, D 60  = 1.82 min and D 63  = 0.26 min) and S. enterica cocktail (D 55  = 3.08 min, D 57  = 2.60 min, D 60  = 0.89 min and D 63  = 0.25 min). Despite the differences in D T values, computed z values for L. monocytogenes cocktail (5.12 ± 0.43 °C) and E. coli O157:H7 cocktail (4.95 ± 0.12 °C) were not significantly different (P > 0.05), but were both significantly (P C). All test organisms also exhibited a generally log-linear UV-C inactivation behavior (R 2 0.90-0.99) with E. coli O157:H7 cocktail (D UV-C  = 25.26 mJ/cm 2 ) demonstrating greatest resistance to UV-C than S. enterica (D UV-C  = 24.65 mJ/cm 2 ) and L. monocytogenes (D UV-C  = 17.30 mJ/cm 2 ) cocktails. The D 55 values of each organism cocktail were used to calculate for the 3-log reduction heating process schedules, during which UV-C treatments were simultaneously applied. Lethal rates (F values) calculations in the combined processes revealed that within the 3-log reduction heating processes, co-exposure of UV-C resulted in 5.62 to 6.20 log reductions in the test organism populations. Heating

Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

Science.gov (United States)

NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

2018-03-01

Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

Science.gov (United States)

Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

2016-01-01

Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

The classification of Sejroe group serovars of Leptospira interrogans with monoclonal antibodies

NARCIS (Netherlands)

Terpstra, W. J.; Korver, H.; van Leeuwen, J.; Klatser, P. R.; Kolk, A. H.

1985-01-01

Using the hybridoma technique we produced monoclonal antibodies to serovars of Leptospira interrogans. We focussed on serovar hardjo which is an important pathogen for humans and animals, and on other serovars of the Sejroe group. With combinations of monoclonals, characteristic patterns of

Prevalence, serovars and antimicrobial susceptibility of Salmonella spp. from wild and domestic green iguanas (Iguana iguana) in Grenada, West Indies.

Science.gov (United States)

Sylvester, W R B; Amadi, V; Pinckney, R; Macpherson, C N L; McKibben, J S; Bruhl-Day, R; Johnson, R; Hariharan, H

2014-09-01

Cloacal swabs from 62 green iguanas (Iguana iguana), including 47 wild and 15 domestic ones from five parishes of Grenada, were sampled during a 4-month period of January to April 2013 and examined by enrichment and selective culture for the presence of Salmonella spp. Fifty-five per cent of the animals were positive, and eight serovars of Salmonella were isolated. The most common serovar was Rubislaw (58.8%), a serovar found recently in many cane toads in Grenada, followed by Oranienburg (14.7%), a serovar that has been causing serious human disease outbreaks in Japan. Serovar IV:48:g,z51 :- (formerly, S. Marina) highly invasive and known for serious infections in children in the United States, constituted 11.8% of the isolates, all of them being from domestic green iguanas. Salmonella Newport, a serovar recently found in a blue land crab in Grenada, comprised 11.8% of the isolates from the green iguanas. The remaining four less frequent serovars included S. Javiana and S. Glostrup. Antimicrobial susceptibility tests conducted by a disc diffusion method against amoxicillin-clavulanic acid, ampicillin, cefotaxime, ceftazidime, ciprofloxacin, enrofloxacin, gentamicin, nalidixic acid, streptomycin, tetracycline and trimethoprim-sulfamethoxazole showed that drug resistance is minimal, with intermediate susceptibility, mainly to streptomycin, tetracycline and cefotaxime. This is the first report of isolation and antimicrobial susceptibilities of various Salmonella serovars from wild and domestic green iguanas in Grenada, West Indies. © 2013 Blackwell Verlag GmbH.

Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

Science.gov (United States)

Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

2016-02-01

Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

Draft Genome Sequence of Leptospira interrogans Serovar Bataviae Strain LepIMR 22 Isolated from a Rodent in Johor, Malaysia

NARCIS (Netherlands)

Amran, Fairuz; Mohd Khalid, Mohd Khairul Nizam; Mohamad, Saharuddin; Mat Ripen, Adiratna; Ahmad, Norazah; Goris, Marga G. A.; Muhammad, Ayu Haslin; Noor Halim, Nurul Atiqah

2016-01-01

Leptospira interrogans serovar Bataviae was recently identified as one of the persistent Leptospira serovars in Malaysia. Here, we report the draft genome sequence of the L. interrogans serovar Bataviae strain LepIMR 22 isolated from kidney of a rodent in Johor, Malaysia

Repeated isolation of Salmonella enterica Goverdhan, a very rare serovar, from Danish poultry surveillance samples

DEFF Research Database (Denmark)

Pedersen, Karl; Sørensen, Gitte; Szabo, Istvan

2014-01-01

We report here the appearance of a very rare serovar of Salmonella, S. enterica subsp. enterica serovar Goverdhan, in routine Salmonella surveillance samples from Danish poultry production. S. Goverdhan was found on nine occasions: in one broiler breeder farm in October 2010, four broiler farms a...

A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

DEFF Research Database (Denmark)

Zhu, Xinna; Long, Fei; Chen, Yonghui

2008-01-01

Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

Directory of Open Access Journals (Sweden)

Roberta Ortenzi

2015-09-01

Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

Colicinogeny in Salmonella serovars isolated in Brazil

Directory of Open Access Journals (Sweden)

Leila Carvalho Campos

1988-06-01

Full Text Available A study of colicinogeny was made in 748 strains of Salmonella (97 serovars isolated from different sources; human (291, animal (119, environmental (141, food (102 and animal feed (95. Colicin production was detected in 64 strains (8.6%, particularly isolated from foods (30.4%. Col. E1 (53 and Ia (44 were the most frequently observed, especially in S. agona for environment and food sources. Col V production was identified in 5 strains of S. typhimurium within 8 producer cultures isolated from humans. Its relationship with the sources and serovars of Salmonella are discussed.Investigou-se a produção de colicina em 748 amostras de Salmonella (97 sorovares advindas de díferentes fontes: humana (291, animal (119, ambiental (141, de alimentos (102 e rações (95. Detectaram-se 64 amostras (8,6% colicinogênicas, particularmente isoladas de alimentos (30,4%. ColE1 (53 e Ia (44 foram as mais freqüentes, especialmente no sorovar S, agona, de origem ambiental e de alimentos. Identificou-se também a produção de col V em 5 amostras de S. typhimurium dentre 8 culturas produtoras de origem humana. Discute-se a relação entre a capacidade colicinogênica e as fontes e sorovares de Salmonella.

Listeria monocytogenes inhibition by defatted mustard meal-based edible films.

Science.gov (United States)

Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C

2012-02-01

An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.

Controlling Listeria monocytogenes and Leuconostoc mesenteroides in Uncured Deli-style Turkey Breast Using a Clean Label Antimicrobial.

Science.gov (United States)

Weyker, Robert E; Glass, Kathleen A; Milkowski, Andrew L; Seman, Dennis L; Sindelar, Jeffrey J

2016-03-01

Interest in natural/organic meat products has resulted in the need to validate the effectiveness of clean label antimicrobials to increase safety and shelf life of these products. A Response Surface Methodology (RSM) was used to investigate the effects of varying levels of moisture, pH, and a commercial "clean-label" antimicrobial (cultured sugar-vinegar blend; CSVB) on the growth rate of Listeria monocytogenes and Leuconostoc mesenteroides in uncured turkey stored at 4 °C for 16 wk. Twenty treatment combinations of moisture (60% to 80%), pH (5.8 to 6.4), and CSVB (2.5% to 5.0%) were evaluated during phase I to develop growth curves for both microbe types, whereas the interactive effects of pH (5.8 to 6.4) and CSVB (0.0 to 4.75) were tested in 16 treatment combinations during Phase II at a single moisture level using L. monocytogenes only. CSVB inhibited L. monocytogenes growth in 14 of the 20 treatments tested in Phase I and in 12 of the 16 treatments in Phase II through 16 and 8 wk, respectively. In contrast, CSVB had little effect on L. mesenteroides, with growth inhibited in only 4 of 20 treatments in Phase I and was therefore not tested further in Phase II. Significant interactions of the RSM design coefficients yielded a predictive model for L. mesenteroides growth rate, but due to lack of growth, no growth rate model was developed for L. monocytogenes. CSVB was found to be an effective antilisteral antimicrobial, while having little effect on a spoilage microorganism. © 2016 Institute of Food Technologists®

A multiplex PCR for detection of Listeria monocytogenes and its lineages.

Science.gov (United States)

Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

2016-11-01

A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

Science.gov (United States)

de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

2018-04-12

Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

Science.gov (United States)

Valderrama, W B; Mills, E W; Cutter, C N

2009-11-01

Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.

Science.gov (United States)

Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y

2009-09-01

The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

Science.gov (United States)

Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

2015-06-01

Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A Leptospira borgpetersenii Serovar Hardjo vaccine induces a Th1 response, activates NK cells, and reduces renal colonization

Science.gov (United States)

Chronic infection of cattle with Leptospira borgpetersenii serovar Hardjo reduces animal production through reproductive failure and presents a persistent health threat to workers in the animal industry. Cattle are maintenance hosts for serovar Hardjo and development of a protective vaccine has bee...

Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

Science.gov (United States)

Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

2016-01-01

Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

Draft Genome Sequence of Leptospira interrogans Serovar Bataviae Strain LepIMR 22 Isolated from a Rodent in Johor, Malaysia.

Science.gov (United States)

Amran, Fairuz; Mohd Khalid, Mohd Khairul Nizam; Mohamad, Saharuddin; Mat Ripen, Adiratna; Ahmad, Norazah; Goris, Marga G A; Muhammad, Ayu Haslin; Noor Halim, Nurul Atiqah

2016-09-08

Leptospira interrogans serovar Bataviae was recently identified as one of the persistent Leptospira serovars in Malaysia. Here, we report the draft genome sequence of the L. interrogans serovar Bataviae strain LepIMR 22 isolated from kidney of a rodent in Johor, Malaysia. Copyright © 2016 Amran et al.

Inactivation of Listeria monocytogenes in milk by pulsed electric field.

Science.gov (United States)

Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

1998-09-01

Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

Changing trends in antimicrobial resistance of Salmonella enterica serovar typhi and salmonella enterica serovar paratyphi A in Chennai

Directory of Open Access Journals (Sweden)

Krishnan Padma

2009-10-01

Full Text Available Background and Objectives: Chloramphenicol was considered the anti-microbial gold standard for typhoid treatment but, following the increasing worldwide frequency of antibiotic resistance, ciprofloxacin has been the mainstay of therapy since 1980. Recent studies have shown a shifting of susceptibility to conventional drugs like chloramphenicol, ampicillin and cotrimoxazole. The primary objective of the study was to evaluate the in vitro activity of chloramphenicol and other first-line drugs in comparison with cephalosporins and quinolones. Materials and Methods: Fifty isolates of Salmonella obtained from blood culture were subjected to serotyping at the Central Research Institute, Kasauli. Phage typing and biotyping was performed at the National Phage Typing Centre, New Delhi. Antibiotic sensitivity testing was carried out for 10 drugs by the Kirby-Bauer disc diffusion method and minimum inhibitory concentration by broth microdilution for nalidixic acid, chloramphenicol, ciprofloxacin, ceftriaxone, cefixime and ofloxacin. Multi-drug-resistant (MDR strains were checked for plasmid. Results: In the present study, 70 and 30% of the isolates were Salmonella enterica serovar typhi and paratyphi A, respectively. They were highly sensitive to chloramphenicol (86%, ampicillin (84% and cotrimoxazole (88%. Highest sensitivity was seen for cephalosporins, followed by quinolones. Seventeen/21 (81% and 100% of the Salmonella enterica serovar typhi strains belonged to E1 phage type and biotype 1, respectively. Antibiogram showed 2% of the strains to be sensitive to all the drugs tested and 12% were MDR and showed the presence of plasmids. Conclusion: The study indicates reemergence of chloramphenicol-susceptible Salmonella enterica serovar typhi and paratyphi A isolates, a significant decline in MDR strains and high resistance to nalidixic acid. E1 phage type and biotype 1 are found to be most prevalent in Chennai, India.

Recombinant phage probes for Listeria monocytogenes

Energy Technology Data Exchange (ETDEWEB)

Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

2007-10-03

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Listeria monocytogenes infection in pregnancy and neonatal sepsis

Directory of Open Access Journals (Sweden)

Francesca Pascale

2008-06-01

Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

Science.gov (United States)

Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

2016-01-01

ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

Directory of Open Access Journals (Sweden)

Valeria Braga

Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

Incorporation of Listeria monocytogenes strains in raw milk biofilms.

Science.gov (United States)

Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

2013-02-01

Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

Science.gov (United States)

Lu, Chunye; Marjanovic, Olivera; Kiang, David

2017-01-01

ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

Listeria monocytogenes endophthalmitis following keratoconjunctivitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2014-01-01

Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hain Torsten

2012-04-01

Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

Directory of Open Access Journals (Sweden)

Maíra Maciel Mattos de Oliveira

2010-03-01

Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.

Science.gov (United States)

de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf

2010-01-01

An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

A dynamical systems approach to actin-based motility in Listeria monocytogenes

Science.gov (United States)

Hotton, S.

2010-11-01

A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

Science.gov (United States)

Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

2012-01-01

The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

Characterization of Leptospira interrogans serovar Pomona isolated from swine in Brazil

NARCIS (Netherlands)

Miraglia, Fabiana; Moreno, Luisa Z.; Morais, Zenaide M.; Langoni, Helio; Shimabukuro, Fabio H.; Dellagostin, Odir A.; Hartskeerl, Rudy; Vasconcellos, Silvio A.; Moreno, Andrea Micke

2015-01-01

Leptospira interrogans swine infection is a cause of serious economic loss and a potential human health hazard. In Brazil, the most common serovars associated with swine infections are Pomona, Icterohaemorrhagie and Tarassovi. Cross-reactions among serovars and the failure of infected animals to

L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

Science.gov (United States)

Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

2014-10-17

The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

Evaluation of Aerated Steam Treatment of Alfalfa and Mung Bean Seeds To Eliminate High Levels of Escherichia coli O157:H7 and O178:H12, Salmonella enterica, and Listeria monocytogenes

Science.gov (United States)

Studer, Patrick; Heller, Werner E.; Hummerjohann, Jörg

2013-01-01

Sprouts contaminated with human pathogens are able to cause food-borne diseases due to the favorable growth conditions for bacteria during germination and because of minimal processing steps prior to consumption. We have investigated the potential of hot humid air, i.e., aerated steam, to treat alfalfa and mung bean seeds which have been artificially contaminated with Escherichia coli O157:H7, Salmonella enterica subsp. enterica serovar Weltevreden, and Listeria monocytogenes Scott A. In addition, a recently collected E. coli O178:H12 isolate, characterized by a reduced heat sensitivity, was exposed to the treatment described. Populations of E. coli O157:H7 and S. enterica on alfalfa and mung bean seeds could be completely eliminated by a 300-s treatment with steam at 70 ± 1°C as revealed by enrichment studies. L. monocytogenes and E. coli O178:H12 could not be completely eliminated from artificially inoculated seeds. However, bacterial populations were reduced by more than 5 log CFU/g on alfalfa and by more than 4 log CFU/g on mung bean seeds. The germination rate of mung beans was not affected by the 300-s treatment compared to the germination rate of untreated seeds whereas that of alfalfa seeds was significantly lower by 11.9%. This chemical-free method is an effective alternative to the 20,000-ppm hypochlorite treatment presently recommended by the U.S. Food and Drug Administration (FDA). PMID:23709507

Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

Directory of Open Access Journals (Sweden)

Ivy Reid A

2008-11-01

Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

Science.gov (United States)

Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

Science.gov (United States)

Shoughy, Samir S; Tabbara, Khalid F

2014-01-01

Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

Science.gov (United States)

Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

2014-01-21

Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

Directory of Open Access Journals (Sweden)

Anna Mureddu

2014-02-01

Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

In vitro combined effect of oregano essential oil and caprylic acid against Salmonella serovars, Escherichia coli O157:H7, Staphylococcus aureus and Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Radka Hulánková

2011-01-01

Full Text Available In vitro inhibition of foodborne pathogens via action of natural antimicrobials – caprylic acid (CA and essential oil from Origanum vulgare L. (OEO with high carvacrol content (72% was evaluated. For 15 Salmonella strains the minimum inhibitory concentration (MIC determined by broth microdilution method ranged between 3.67–4.33 μl·ml-1 for CA and between 0.48–0.57 μl·ml-1 for OEO. For 7 Listeria monocytogenes strains the MIC ranged between 2.17–2.83 μl·ml-1 for CA and between 0.52–0.58 μl·ml-1 for OEO. Type strains of Escherichia coli O157:H7 and Staphylococcus aureus were tested, too, with MIC of CA 3.60 μl·ml-1 and 3.20 μl·ml-1 and MIC of OEO 0.51 μl·ml-1 and 0.48 μl·ml-1, respectively. Furthermore, it was found that the MIC of CA can be decreased by even low addition (0.05% of citric or acetic acid and to a lesser extent by lactic acid, whereas the MICs of OEO did not notably decrease. Combined application of CA and OEO determined by FIC index led only to an additive effect (0.5 ≤ FIC ≤ 1. Combination of natural additives OEO, CA and eventually acetic or citric acid seems to have the potential to be an effective mixture for inhibition of foodborne pathogens, predominantly Salmonella spp. and L. monocytogenes, even in only slightly acidic food.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

Directory of Open Access Journals (Sweden)

Domenico Meloni

2015-03-01

Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

Science.gov (United States)

Meloni, Domenico

2015-03-12

The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

Directory of Open Access Journals (Sweden)

Michela Ibba

2013-09-01

Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings.

Science.gov (United States)

Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano

2016-06-01

Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

STORAGESEVER

2008-09-03

Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

Directory of Open Access Journals (Sweden)

Bahador

2015-08-01

Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

nahid Navijouy

2013-08-01

Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

Directory of Open Access Journals (Sweden)

Yolanda Albarracín C

2008-08-01

Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

Science.gov (United States)

Soares, Charles A; Knuckley, Bryan

2016-06-01

Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

Influence of Temperature and Predation on Survival of Salmonella enterica Serovar Typhimurium and Expression of invA in Soil and Manure-Amended Soil▿

Science.gov (United States)

García, R.; Bælum, J.; Fredslund, L.; Santorum, P.; Jacobsen, C. S.

2010-01-01

The effects of three temperatures (5, 15, and 25°C) on the survival of Salmonella enterica serovar Typhimurium in topsoil were investigated in small microcosms by three different techniques: plate counting, invA gene quantification, and invA mRNA quantification. Differences in survival were related to the effect of protozoan predation. Tetracycline-resistant Salmonella serovar Typhimurium was inoculated into soil and manure-amended soil at 1.5 × 108 cells g soil−1. Population densities were determined by plate counting and by molecular methods and monitored for 42 days. Simultaneous extraction of RNA and DNA, followed by quantitative PCR, was used to investigate invA gene levels and expression. Analysis by these three techniques showed that Salmonella serovar Typhimurium survived better at 5°C. Comparing DNA and CFU levels, significantly higher values were determined by DNA-based techniques. invA mRNA levels showed a fast decrease in activity, with no detectable mRNA after an incubation period of less than 4 days in any of the soil scenarios. A negative correlation was found between Salmonella serovar Typhimurium CFU levels and protozoan most probable numbers, and we propose the role of the predator-prey interaction as a factor to explain the die-off of the introduced strain by both culture- and DNA quantification-based methods. The results indicate that temperature, manure, and protozoan predation are important factors influencing the survival of Salmonella serovar Typhimurium in soil. PMID:20562283

Complete genome sequence of Leptospira alstonii serovar room 22, strain GWTS#1

Science.gov (United States)

We report the complete genome sequence of Leptospira alstonii serovar room 22 strain GWTS#1. This is the first isolate of L. alstonii to be cultured from a mammal, in Western Europe, and represents a new serovar of pathogenic leptospires....

Acquired homotypic and heterotypic immunity against oculogenital Chlamydia trachomatis serovars following female genital tract infection in mice

Directory of Open Access Journals (Sweden)

Peña A Salvador

2005-11-01

Full Text Available Abstract Background Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen causing female genital tract infection throughout the world. Reinfection with the same serovar, as well as multiple infections with different serovars, occurs in humans. Using a murine model of female C. trachomatis genital tract infection, we determined if homotypic and/or heterotypic protection against reinfection was induced following infection with human oculogenital strains of C. trachomatis belonging to two serovars (D and H that have been shown to vary significantly in the course of infection in the murine model. Methods Groups of outbred CF-1 mice were reinfected intravaginally with a strain of either serovar D or H, two months after initial infection with these strains. Cellular immune and serologic status, both quantitative and qualitative, was assessed following initial infection, and the course of infection was monitored by culturing vaginal samples collected every 2–7 days following reinfection. Results Serovar D was both more virulent (longer duration of infection and immunogenic (higher level of circulating and vaginal IgG and higher incidence of IgA in vaginal secretions in the mouse genital tract. Although both serovars induced cross-reacting antibodies during the course of primary infection, prior infection with serovar H resulted in only a slight reduction in the median duration of infection against homotypic reinfection (p ~ 0.10, while prior infection with serovar D resulted in significant reduction in the median duration of infection against both homotypic (p Conclusion Serovar D infection resulted in significant homotypic and heterotypic protection against reinfection, while primary infection with serovar H resulted in only slight homotypic protection. In addition to being the first demonstration of acquired heterotypic immunity between human oculogenital serovars, the differences in the level and extent of this immunity

Tracking of Listeria monocytogenes in meat establishment using Whole Genome Sequencing as a food safety management tool: A proof of concept.

Science.gov (United States)

Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica

2017-09-18

Repeated Listeria outbreaks particularly associated with Ready-To-Eat (RTE) delicatessen meat products have been reported annually at global level. The most frequent scenario that led to foodborne outbreaks was the post-thermal treatment cross-contamination of deli meat products during slicing and modified atmosphere packaging (MAP). The precondition for such cross contamination is the previous introduction of Listeria into meat processing facilities and subsequent colonization of the production environment, associated with formation of biofilms resilient to common sanitation procedures regularly applied in meat establishments. The use of Whole Genome Sequencing (WGS) can facilitate the understanding of contamination and colonization routes of pathogens within the food production environment and enable efficient pathogen tracking among different departments. This study aimed to: a) provide a proof of concept on practical use of WGS in a meat establishment to define the entry routes and spread pattern of L. monocytogenes, and b) to consider the regular use of WGS in meat processing establishments as a strong support of food safety management system. The results revealed that Listeria spp. was present in slaughter line, chilling chambers, deboning, slicing, MAP, as well as in corridors and dispatch (53 positive samples, out of 240). Eight L. monocytogenes isolates (out of 53) were identified from the slaughterhouse, chilling chambers, deboning, MAP and dispatch. L. monocytogenes isolates were of three different serotypes (1/2a, 1/2c, 4b) and correspondingly of three MLST sequence types. Overall, two pairs of L. monocytogenes isolates were genetically identical, i.e. two serotype 4b isolates (ST1), isolated from water drain at dispatch unit and two isolates obtained from slaughterhouse (floorwall junction at the carcass wash point) and MAP (water drain). These findings indicated that L. monocytogenes isolates identified in meat processing units (MAP, chilling chamber

78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

Science.gov (United States)

2013-05-13

... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

Science.gov (United States)

Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

2010-08-01

Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

Directory of Open Access Journals (Sweden)

Nilma Cintra Lea

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

A comparative risk assessment for Listeria monocytogenes in prepackaged versus retail-sliced deli meat.

Science.gov (United States)

Endrikat, Sarah; Gallagher, Daniel; Pouillot, Régis; Hicks Quesenberry, Heather; Labarre, David; Schroeder, Carl M; Kause, Janell

2010-04-01

Deli meat was ranked as the highest-risk ready-to-eat food vehicle of Listeria monocytogenes within the 2003 U.S. Food and Drug Administration and U.S. Department of Agriculture, Food Safety and Inspection Service risk assessment. The comparative risk of L. monocytogenes in retail-sliced versus prepackaged deli meats was evaluated with a modified version of this model. Other research has found that retail-sliced deli meats have both higher prevalence and levels of L. monocytogenes than have product sliced and packaged at the manufacturer level. The updated risk assessment model considered slicing location as well as the use of growth inhibitors. The per annum comparative risk ratio for the number of deaths from retail-sliced versus prepackaged deli meats was found to be 4.89, and the per-serving comparative risk ratio was 4.27. There was a significant interaction between the use of growth inhibitors and slicing location. Almost 70% of the estimated deaths occurred from retail-sliced product that did not possess a growth inhibitor. A sensitivity analysis, assessing the effect of the model's consumer storage time and shelf life assumptions, found that even if retail-sliced deli meats were stored for a quarter of the time prepackaged deli meats were stored, retail-sliced product is 1.7 times more likely to result in death from listeriosis. Sensitivity analysis also showed that the shelf life assumption had little effect on the comparative risk ratio.

Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

Science.gov (United States)

Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

2017-09-01

The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

Survival of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes on raw peanut and pecan kernels stored at -24, 4, and 22°C.

Science.gov (United States)

Brar, Pardeepinder K; Proano, Lisseth G; Friedrich, Loretta M; Harris, Linda J; Danyluk, Michelle D

2015-02-01

Cocktails of lawn-collected cells were used to determine the survival of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes on the surface of raw peanut and pecan kernels. Kernels were inoculated with mixtures of four to five strains at 3 or 6 log CFU/g, dried at room temperature, and then stored at -24 ± 1, 4 ± 2, and 22 ± 1°C for 28 or 365 days. In most cases, rates of decline of the pathogens did not differ significantly between the two inoculum concentrations in the 28-day study. At 6 log CFU/g, populations of all pathogens were reduced by 0.5 to 1.6 log CFU/g during an initial 3-day drying period on both peanuts and pecans. The moisture content of peanuts and pecans remained stable at -24 ± 1 and 22 ± 1°C; at 4 ± 2°C, the moisture content increased from 3.8 to 5.6% on peanuts and from 2.6 to 3% on pecans over 365 days. Pathogen populations were stable on pecans stored under frozen and refrigerated conditions, except for L. monocytogenes, which declined at a rate of 0.03 log CFU/g/30 days at 4 ± 2°C. Salmonella populations were stable on peanuts stored at -24 ± 1 and 4 ± 2°C, but E. coli O157:H7 and L. monocytogenes declined at rates of 0.03 to 0.12 log CFU/g/30 days. At 22 ± 1°C, Salmonella, E. coli O157:H7, and L. monocytogenes declined at a rate of 0.22, 0.37, and 0.59 log CFU/g/30 days, respectively, on peanuts, and at 0.15, 0.34, and 1.17 log CFU/g/30 days, respectively, on pecans. Salmonella counts were above the limit of detection (0.30 log CFU/g) throughout the study. In most cases during storage, counts obtained from pecans were higher than from peanuts.

Potential of chitosan from Mucor rouxxi UCP064 as alternative natural compound to inhibit Listeria monocytogenes Potencial de quitosana de Mucor rouxxi UCP 064 como componente alternativo para inibir Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Roberta A. Bento

2009-09-01

Full Text Available Listeria monocytogenes is widely distributed in nature and the infection listeriosis is recognized as a potential threat for human health because of its mortality rate. The objective of this study was to evaluate the growth profile and chitosan production by Mucor rouxxi UCP 064 grown in yam bean (Pachyrhizus erosus L. Urban medium. It was also to assess the anti-L. monocytogenes efficacy of the obtained chitosan. Higher values of biomass of M. rouxxi (16.9 g.L¹ and best yield of chitosan (62 mg.g-1 were found after 48 h of cultivation. Residual glucose and nitrogen in the growth media were 4.1 and 0.02 g.L¹ after 96 h, respectively. Obtained chitosan presented 85 % of degree of deacetylation and 2.60 x 10(4 g.mol-1of viscosimetric molecular weight. Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MBC values of chitosan against L. monocytogenes ATCC 7644 were, respectively, 2.5 and 5.0 mg.mL-1. At 2.5 and 5.0 mg.mL-1 chitosan caused cidal effect in a maximum time of 4 h. Bacterial count below 2 log cfu.mL-1were found from 2 h onwards and no recovery in bacterial growth was noted in the remainder period. These results show the biotechnological potential of yam bean medium for chitosan production by Mucor rouxxi and support the possible rational use of chitosan from fungi as natural antimicrobial to control L. monocytogenes.Listeria monocytogenes apresentase como um microrganismo amplamente distribuído na natureza, sendo que a infecção listeriose é reconhecida como uma potencial ameaça a saúde humana devido a sua taxa de mortalidade. O objetivo deste estudo foi avaliar o perfil de crescimento e de produção de quitosana por Mucor rouxxi UCP 064 cultivado em meio jacatupé (Pachyrhizus erosus L. Urban, bem como avaliar a eficácia anti-L. monocytogenes da quitosana produzida com vistas a uma possível aplicação em alimentos. Os mais elevados valores de biomassa de M. rouxxi (16,9 g.L¹ e o maior rendimento na

Horizontal gene transfer of a ColV plasmid has resulted in a dominant avian clonal type of Salmonella enterica serovar Kentucky.

Directory of Open Access Journals (Sweden)

Timothy J Johnson

Full Text Available Salmonella enterica continues to be a significant cause of foodborne gastrointestinal illness in humans. A wide variety of Salmonella serovars have been isolated from production birds and from retail poultry meat. Recently, though, S. enterica subsp. enterica serovar Kentucky has emerged as one of the prominent Salmonella serovars isolated from broiler chickens. Recent work suggests that its emergence apparently coincides with its acquisition of a ColV virulence plasmid. In the present study, we examined 902 Salmonella isolates belonging to 59 different serovars for the presence of this plasmid. Of the serovars examined, the ColV plasmid was found only among isolates belonging to the serovars Kentucky (72.9%, Typhimurium (15.0% and Heidelberg (1.7%. We demonstrated that a single PFGE clonal type of S. Kentucky harbors this plasmid, and acquisition of this plasmid by S. Kentucky significantly increased its ability to colonize the chicken cecum and cause extraintestinal disease. Comparison of the completed sequences of three ColV plasmids from S. Kentucky isolated from different geographical locales, timepoints and sources revealed a nearly identical genetic structure with few single nucleotide changes or insertions/deletions. Overall, it appears that the ColV plasmid was recently acquired by a single clonal type S. Kentucky and confers to its host enhanced colonization and fitness capabilities. Thus, the potential for horizontal gene transfer of virulence and fitness factors to Salmonella from other enteric bacteria exists in poultry, representing a potential human health hazard.

Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

Science.gov (United States)

Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

2015-11-09

Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

Directory of Open Access Journals (Sweden)

Vanessa de Vasconcelos Byrne

2016-06-01

Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

Survival of Listeria monocytogenes in mozzarella cheese and ice cream exposed to gamma irradiation

International Nuclear Information System (INIS)

Hashisaka, A.E.; Weagant, S.D.; Dong, F.M.

1989-01-01

The survival of Listeria monocytogenes preinoculated into ice cream and mozzarella cheese prior to gamma-irradiation treatment was determined. Samples were maintained at -78 degrees C and exposed to targeted doses of 2, 4, 8, 16, and 32 kGy of gamma-irradiation. The calculated D10 values were 1.4 kGy for mozzarella cheese and 2.0 kGy for ice cream. The effective level of irradiation (12D) for inactivating L. monocytogenes was 16.8 kGy for mozzarella cheese and 24.4 kGy for ice cream

Growth of Listeria monocytogenes and Yersinia enterocolitica colonies under modified atmospheres at 4 and 8 degrees C using a model food system.

Science.gov (United States)

Harrison, W A; Peters, A C; Fielding, L M

2000-01-01

The growth of Listeria monocytogenes and Yersinia enterocolitica colonies was studied on solid media at 4 and 8 degrees C under modified atmospheres (MAs) of 5% O2: 10% CO2: 85% N2 (MA1), 30% CO2: 70% N2 (MA2) and air (control). Colony radius, determined using computer image analysis, allowed specific growth rates (mu) and the time taken to detect bacterial colonies to be estimated, after colonies became visible. At 4 degrees C both MAs decreased the growth rates of L. monocytogenes by 1.5- and 3.0-fold under MA1 (mu = 0.02 h(-1)) and MA2 (mu = 0.01 h(-1)), respectively, as compared with the control (mu = 0.03 h(-1)). The time to detection of bacterial colonies was increased from 15 d (control) to 24 (MA1) and 29 d (MA2). At 8 degrees C MA2 decreased the growth rate by 1.5-fold (mu = 0.04 h(-1)) as compared with the control (mu = 0.06 h(-1)) and detection of colonies increased from 7 (control) to 9 d (MA2). At 4 degrees C both MAs decreased the growth rates of Y. enterocolitica by 1.5- and 2.5-fold under MA1 (mu = 0.03 h(-1)) and MA2 (mu = 0.02 h(-1)), respectively, as compared with the control (mu = 0.05 h(-1)). At 8 degrees C identical growth rates were obtained under MA1 and the control (mu = 0.07 h(-1)) whilst a decrease in the growth rate was obtained under MA2 (mu = 0.04 h(-1)). The detection of colonies varied from 6 (8 degrees C, aerobic) to 19 d (4 degrees C, MA2). Refrigerated modified atmosphere packaged foods should be maintained at 4 degrees C and below to ensure product safety.

Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

Science.gov (United States)

Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

2014-11-01

Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

Directory of Open Access Journals (Sweden)

Elena Dalzini

2014-02-01

Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

Inhibition of Listeria monocytogenes in deli-style turkey breast formulated with cultured celery powder and/or cultured sugar-vinegar blend during storage at 4°c.

Science.gov (United States)

Golden, Max C; McDonnell, Lindsey M; Sheehan, Vivien; Sindelar, Jeffrey J; Glass, Kathleen A

2014-10-01

Fermentation-derived nitrite (NO2) from vegetable sources is increasingly used as a "clean label" alternative to conventional NaNO2. Previous results suggested that processed meats cured with NO2 derived from a "natural" source had lower antimicrobial activity than did meats produced with chemical NaNO2; however, the differences were likely due to NO2 concentration rather than source. The objective of this study was to compare the antilisterial properties of traditional and clean label alternative curing approaches when combined with antimicrobials in deli-style turkey. Listeria monocytogenes inhibition by NO2 from synthetic and natural sources was validated in deli-style turkey (73 to 74% moisture, 1.8% salt, pH 6.4). Products were prepared with 0, 80, or 120 mg/kg NO2 using purified NaNO2 or cultured celery powder. Additional treatments were supplemented with 3.8% lactate-diacetate blend (LD) or 1% cultured sugar-vinegar blend (DF). Sliced cooked products were surface inoculated with L. monocytogenes at 3 log CFU/g, vacuum packaged, and stored at 4°C for 12 weeks. Results revealed an average 2.4-log increase in L. monocytogenes at 3 weeks in the control without antimicrobials, a 1.3-log increase at 4 weeks for both 80 mg/kg NO2 treatments, and a 1.5-log increase at 6 weeks for the 120 mg/kg NO2 treatments. No significant difference (P > 0.05) in growth inhibition was found between NO2 sources when equivalent concentrations were added. In uncured turkey with 3.8% LD or 1% DF, growth was delayed until 6 weeks, whereas supplementation with LD or DF and 80 mg/kg NO2 from either source delayed listerial growth through 12 weeks. This study confirmed that the concentration of NO2, rather than the source, is a primary factor in enhancing the safety of ready-to-eat meats. Both conventional NO2 treatments and a clean label solution consisting of a fermentation-derived antimicrobial combined with 80 mg/kg naturally derived NO2 inhibited L. monocytogenes through 12 weeks of

Listeria monocytogenes repellence by enzymatically modified PES surfaces

NARCIS (Netherlands)

Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

2015-01-01

: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

Science.gov (United States)

Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

2014-03-03

This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

Identification by PCR of non-typhoidal Salmonella enterica serovars associated with invasive infections among febrile patients in Mali.

Directory of Open Access Journals (Sweden)

Sharon M Tennant

2010-03-01

Full Text Available In sub-Saharan Africa, non-typhoidal Salmonella (NTS are emerging as a prominent cause of invasive disease (bacteremia and focal infections such as meningitis in infants and young children. Importantly, including data from Mali, three serovars, Salmonella enterica serovar Typhimurium, Salmonella Enteritidis and Salmonella Dublin, account for the majority of non-typhoidal Salmonella isolated from these patients.We have extended a previously developed series of polymerase chain reactions (PCRs based on O serogrouping and H typing to identify Salmonella Typhimurium and variants (mostly I 4,[5],12:i:-, Salmonella Enteritidis and Salmonella Dublin. We also designed primers to detect Salmonella Stanleyville, a serovar found in West Africa. Another PCR was used to differentiate diphasic Salmonella Typhimurium and monophasic Salmonella Typhimurium from other O serogroup B, H:i serovars. We used these PCRs to blind-test 327 Salmonella serogroup B and D isolates that were obtained from the blood cultures of febrile patients in Bamako, Mali.We have shown that when used in conjunction with our previously described O-serogrouping PCR, our PCRs are 100% sensitive and specific in identifying Salmonella Typhimurium and variants, Salmonella Enteritidis, Salmonella Dublin and Salmonella Stanleyville. When we attempted to differentiate 171 Salmonella Typhimurium (I 4,[ 5],12:i:1,2 strains from 52 monophasic Salmonella Typhimurium (I 4,[5],12:i:- strains, we were able to correctly identify 170 of the Salmonella Typhimurium and 51 of the Salmonella I 4,[5],12:i:- strains.We have described a simple yet effective PCR method to support surveillance of the incidence of invasive disease caused by NTS in developing countries.

Ureaplasma serovars & their antimicrobial susceptibility in patients of infertility & genital tract infections.

Science.gov (United States)

Dhawan, Benu; Malhotra, Neena; Sreenivas, Vishnubhatla; Rawre, Jyoti; Khanna, Neena; Chaudhry, Rama; Mittal, Suneeta

2012-12-01

Ureaplasmas have been implicated in a variety of clinical conditions. However, only certain serovars of ureaplasmas are disease associated. Only a few classes of antimicrobial agents are available for the treatment of mycoplasmal infections in humans. Increase of resistance of genital mycoplasmas to antimicrobials has been reported worldwide. The aim of the present study was to determine the occurrence of Ureaplasma serovars in patients with infertility and genital tract infections with polymerase chain reaction (PCR)-based serotyping. The antimicrobial susceptibilities of Ureaplasma spp. and Mycoplasma hominis were also assessed to determine the most suitable treatment strategy. Sexually active adults (n=147) with symptoms of genital tract infections and 115 infertile women were enrolled. Endocervical swabs from women and urethral swabs from men were subjected to culture and multiplex PCR for detection of genital mycoplasmas. Serotyping of Ureaplasma was done by PCR and antimicrobial susceptibility to doxycycline, azithromycin, josamycin and ofloxacin was done by microbroth dilution method. Ureaplasma was detected in 25.8 per cent patients with genital tract infections and 20.8 per cent in infertile women. Serovar 3/14 was the most frequent isolate followed by serovar 1 and serovar 6. The majority of Ureaplasma isolates were susceptible to doxycycline (91%) and josamycin (86%) followed by ofloxacin (77%) and azithromycin (71%). All the isolates of M. hominis were uniformly susceptible to doxycycline, josamycin and ofloxacin. The predominance of Ureaplasma serovar 3/14 suggests their possible pathogenic role in genital tract infections and infertility. For empirical treatment, doxycycline could be the drug of choice for genital mycoplasmas.

CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

R. Mioni

2013-02-01

Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

Detection of Salmonella enterica Serovar Typhimurium from Avians Using Multiplex-PCR

Directory of Open Access Journals (Sweden)

Alireza Talebi

2011-09-01

Full Text Available Abstract Salmonella enterica serovar Typhimurium and S.enterica serovar Enteritidis are the most frequently isolated serovars from food-borne diseases throughout the world. According to their antigenic profiles, salmonella shows different disease syndromes and host specificities. It is necessary and important to discriminate salmonella serovars from each other in order to ensure that each pathogen and its epidemiology are correctly recognized. Many PCR-based methods have been developed to identify salmonella serovars. The objective of present study was to identify S. Typhimurium in avians from different regions including: North, Northwest and capital city (Tehran of Iran. Also in this research, the quality of CHROMagar™ Salmonella medium (CAS medium in veterinary medicine was evaluated. The results of present study showed that out of 1870 intestine samples, fifty two S. Typhimurium including broiler (n=13, layer (n=12, duck (n=5, goose (n=5, sparrow (n=8, canary (n=3, pigeon (n=5 and African grey parrot (n=1 were identified using serotyping as well as multiplex-PCR. In conclusion, important measures must be taken on prevention and propagation of S. Typhimurium among avians. CHROMagar™ Salmonella medium has high levels of sensitivity and specificity and reduced the time to final identification of salmonella spp. in comparison with biochemical tests.

Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

Science.gov (United States)

Alali, Walid Q; Schaffner, Donald W

2013-07-01

The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

Effect of peracetic acid on biofilms formed by Listeria monocytogenes strains isolated from a Brazilian cheese processing plant

Directory of Open Access Journals (Sweden)

Sarah Hwa In Lee

2017-10-01

Full Text Available ABSTRACT This study aimed to investigate the effect of peracetic acid (PAA, 0.5% on adherent cells of three strains of Listeria monocytogenes strains belonging to serotypes 4b and 1/2b that had been previously isolated from the environment of a Brazilian cheese plant. The assays were conducted using polystyrene microplates and stainless steel coupons and the adhered cells were treated with PAA for 60, 120 and 180 s. On stainless steel, biofilms were partially inactivated by PAA after 60 s and almost 100% of the cells were damaged within 180 s using epifluorescence microscopy with LIVE/DEAD® staining. On polystyrene microplates, PAA decreased (P<0.05 biofilm biomass produced by the three L. monocytogenes isolates at 60 s, when compared with controls (no PAA treatment. However, PAA did not completely eliminate L. monocytogenes cells on polystyrene microplates (decreasing 1.8-2.5 log cycles after treatment with PAA for 180 s. The correct concentration and contact time of PAA is critical for eliminating biofilms formed by L. monocytogenes on stainless steel surfaces, although further studies are needed for defining efficient PAA treatments to remove adherent cells of this pathogen on plastic polymers.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments.

Science.gov (United States)

Iacumin, Lucilla; Manzano, Marisa; Comi, Giuseppe

2016-01-05

The anti-listerial activity of generally recognized as safe (GRAS) bacteriophage Listex P100 (phage P100) was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b) of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm² or 3 log CFU/cm² of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C) seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm² was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm² was required to completely eliminate 2 log L. monocytogenes/cm² and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm² and with a P100 inoculum ranging from 1 to 7 log PFU/cm². P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm² from an initial phage treatment of approximately 8 log PFU/cm². Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm² is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments

Directory of Open Access Journals (Sweden)

Lucilla Iacumin

2016-01-01

Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

Science.gov (United States)

Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-07-04

Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

Directory of Open Access Journals (Sweden)

Nilma Cintra Leal

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

Aerosol studies with Listeria innocua and Listeria monocytogenes.

Science.gov (United States)

Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

2007-08-01

Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

Listeria monocytogenes growth limits and stress resistance mechanisms

NARCIS (Netherlands)

Veen, van der S.

2008-01-01

The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

Prevalence of Salmonella enterica, Listeria monocytogenes, and pathogenic Escherichia coli in bulk tank milk and milk filters from US dairy operations in the National Animal Health Monitoring System Dairy 2014 study.

Science.gov (United States)

Sonnier, Jakeitha L; Karns, Jeffrey S; Lombard, Jason E; Kopral, Christine A; Haley, Bradd J; Kim, Seon-Woo; Van Kessel, Jo Ann S

2018-03-01

The dairy farm environment is a well-documented reservoir for zoonotic pathogens such as Salmonella enterica, Shiga-toxigenic Escherichia coli, and Listeria monocytogenes, and humans may be exposed to these pathogens via consumption of unpasteurized milk and dairy products. As part of the National Animal Health Monitoring System Dairy 2014 study, bulk tank milk (BTM, n = 234) and milk filters (n = 254) were collected from a total of 234 dairy operations in 17 major dairy states and analyzed for the presence of these pathogens. The invA gene was detected in samples from 18.5% of operations and Salmonella enterica was isolated from 18.0% of operations. Salmonella Dublin was detected in 0.7% of operations. Sixteen Salmonella serotypes were isolated, and the most common serotypes were Cerro, Montevideo, and Newport. Representative Salmonella isolates (n = 137) were tested against a panel of 14 antimicrobials. Most (85%) were pansusceptible; the remaining were resistant to 1 to 9 antimicrobials, and within the resistant strains the most common profile was resistance to ampicillin/clavulanic acid, ampicillin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline. Listeria spp. were isolated from 19.9% of operations, and L. monocytogenes was isolated from 3.0% of operations. Serogroups 1/2a and 1/2b were the most common, followed by 4b and 4a. One or more E. coli virulence genes were detected in the BTM from 30.5% of operations and in the filters from 75.3% of operations. A combination of stx 2 , eaeA, and γ-tir genes was detected in the BTM from 0.5% of operations and in the filters from 6.6% of operations. The results of this study indicate an appreciable prevalence of bacterial pathogens in BTM and filters, including serovars known to infect humans. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

Directory of Open Access Journals (Sweden)

T Civera

2013-02-01

Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

Complete genome sequence of Leptospira interrogans serovar Bratislava, strain PigK151

Science.gov (United States)

The genus Leptospira contains pathogens serologically classified into over 250 serovars, intermediate pathogens and saprophytes with genetic classification into 21 different species. Worldwide, leptospirosis is one of the most widespread zoonoses. L. interrogans serovar Bratislava has been isolated ...

Low prevalence of Listeria monocytogenes in cull sows and pork.

Science.gov (United States)

Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

2008-03-01

The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

Listeria monocytogenes isolated in ready-to-eat food in South Bačka region of Vojvodina province, Serbia

Directory of Open Access Journals (Sweden)

Gusman Vera

2014-01-01

Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.

Development of the leptospirosis by experimental infection in hamsters (Mesocricetus auratus with Leptospira interrogans serovar Canicola, strain LO4, by intact and scratched skin exposures

Directory of Open Access Journals (Sweden)

Carolina de Sousa Américo Batista

2010-10-01

Full Text Available The establishment and evolution of leptospirosis in hamster (Mesocricetus auratus by experimental infection with Leptospira interrogans serovar Canicola, LO4 strain, by intact and scratched skin exposures, having as control the intraperitoneal route, were evaluated. Hundred-twenty female hamsters distributed in two groups according to inoculation route (intact and scratched skin were used. Infectious inoculum was constituted by a pure culture of L. interrogans serovar Canicola (strain LO4, isolated from liver from a slaughtered swine in Londrina, Paraná state and typified by agglutinins adsortion technique with monoclonal antibody kit at the Royal Tropical Institute, Amsterdam, the Netherlands. The animals were observed twice a day during 21 days. Animals that died were necropsied and kidneys, liver, genital tract (uterus and ovaries and brain were aseptically collected. On the 21st post-inoculation day, surviving animals were euthanized. In these animals, serum samples were also collected by cardiac puncture to antileptospires agglutinins research using microscopic agglutination test (MAT. Fresh direct microscopy and microbiological culture were used for the detection of leptospires. Scratched skin route induced larger lethality when compared to intact skin route, with establishment and evolution of leptospirosis. On the other hand, intact skin route induced renal and/or genital carrier state more frequently. LO4 strain presented low immunogenic power, characterized by soroconversion at the MAT in only one inoculated animal.

Antimicrobial susceptibility and serovars of Salmonella from chickens and humans in Ibadan, Nigeria

DEFF Research Database (Denmark)

Fashae, K; Ogunsola, F; Aarestrup, Frank Møller

2010-01-01

BACKGROUND: This study determines the prevalence and antibiotic resistance of Salmonella serovars from humans and chickens in Ibadan, Nigeria, in 2004-2007. METHODOLOGY: A total of 991 blood samples were collected from patients in 2004 to 2005 and 641 fecal samples were collected from poultry farms......% were (S. Typhi). The majority of serovars from humans were S. Enteritidis (33%), S. Dublin (18%), and S. Typhimurium (18%). Resistance to chloramphenicol, sulfamethoxazole, trimethoprim, and ampicillin ranged from 36% to 59% for the human isolates. Eight different serovars were obtained from chickens...

Molecular typing of Salmonella enterica serovar typhi isolates from various countries in Asia by a multiplex PCR assay on variable-number tandem repeats.

Science.gov (United States)

Liu, Yichun; Lee, May-Ann; Ooi, Eng-Eong; Mavis, Yeo; Tan, Ai-Ling; Quek, Hung-Hiang

2003-09-01

A multiplex PCR method incorporating primers flanking three variable-number tandem repeat (VNTR) loci (arbitrarily labeled TR1, TR2, and TR3) in the CT18 strain of Salmonella enterica serovar Typhi has been developed for molecular typing of S. enterica serovar Typhi clinical isolates from several Asian countries, including Singapore, Indonesia, India, Bangladesh, Malaysia, and Nepal. We have demonstrated that the multiplex PCR could be performed on crude cell lysates and that the VNTR banding profiles produced could be easily analyzed by visual inspection after conventional agarose gel electrophoresis. The assay was highly discriminative in identifying 49 distinct VNTR profiles among 59 individual isolates. A high level of VNTR profile heterogeneity was observed in isolates from within the same country and among countries. These VNTR profiles remained stable after the strains were passaged extensively under routine laboratory culture conditions. In contrast to the S. enterica serovar Typhi isolates, an absence of TR3 amplicons and a lack of length polymorphisms in TR1 and TR2 amplicons were observed for other S. enterica serovars, such as Salmonella enterica serovar Typhimurium, Salmonella enterica serovar Enteritidis, and Salmonella enterica serovar Paratyphi A, B, and C. DNA sequencing of the amplified VNTR regions substantiated these results, suggesting the high stability of the multiplex PCR assay. The multiplex-PCR-based VNTR profiling developed in this study provides a simple, rapid, reproducible, and high-resolution molecular tool for the epidemiological analysis of S. enterica serovar Typhi strains.

Effects of gamma irradiation on the physical and sensory quality and inactivation of Listeria monocytogenes in blue swimming crab meat (Portunas pelagicus)

International Nuclear Information System (INIS)

Suklim, Kannapha; Flick, George J.; Vichitphan, Kanit

2014-01-01

Blue swimming crab lump (backfin) meat were exposed to 2, 4, and 6 kGy doses of Co 60 irradiation and evaluated for changes in physical, sensory properties, and Listeria monocytogenes inactivation. Irradiation up to 6 kGy resulted in no textural changes (p>0.05) in maximum shear forces; however, these exposures resulted in sensory quality changes (p<0.05) as determined by a triangle overall difference test (n=50) at each irradiation level. Irradiation had no effect (p>0.05) on L ⁎ color value. Irradiation at 4 and 6 kGy resulted in listericidal reductions greater than 6.65 (Department of Medical Science, Ministry of Health, Thailand, [DMST] 1783) and 7.56 logs (DMST 4553). Irradiation doses of 1 and 2 kGy resulted in a reduction of 2.10 and 5.35 logs respectively of L. monocytogenes DMST 1783 and 1.56 and 4.19 logs respectively of L. monocytogenes DMST 4553. The D 10 values of L. monocytogenes DMST 1783 and 4553 were 0.35 and 0.45 kGy. The study indicated that low-dose gamma irradiation would increase the safety of blue swimming crab meat without unacceptable changes in texture and L ⁎ color value. - Highlights: • γ-irradiation up to 6 kGy caused no changes in fresh crab meat textural properties. • γ-irradiation increased safety of ready-to-eat product i.e. fresh crab meat. • γ-irradiation had either listericidal or listeristatic effect on L. monocytogenes. • L. monocytogenes were completely inactivated by 4 kGy and 6 kGy γ-irradiation. • 1–2 kGy lethally injured L. monocytogenes but survivors increased during storage

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

Science.gov (United States)

de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

2016-01-01

Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Influence of Organic Material and Biofilms on Disinfectant Efficacy Against Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hilda Nyati

2012-04-01

Full Text Available The effects of organic material and biofilm formation on the efficacy of Suma Tab D4 chlorine tablets and Suma Bac D10 quaternary ammonium compound (QAC against Listeria monocytogenes was determined in suspension and on stainless steel and polystyrene surfaces according to standard disinfectant test methodology. Exposure to 200 and 740 mg L-1 QAC and to 150 mg L-1 active chlorine resulted in a > 5.0 log10 CFU mL-1 and > 5.0 log10 CFU/coupon reduction of six L. monocytogenes strains within one minute, in suspension tests, and on stainless steel surfaces, respectively. Additionally, there was a reduction by as much as 5 log10 CFU/coupon or 5 log10 CFU/well of reference strains EGDe and Scott A biofilms within five minutes on stainless steel and polystyrene surfaces. Organic material, added as bovine serum albumin at 0.3% (w/v completely prevented the inactivation of L. monocytogenes in 150 mg L-1 chlorine, while reductions of only 0.6 +- 0.1 log10 CFU mL-1 were recorded in the presence of UHT milk at 3% (v/v. In contrast, reductions of 5 log10 CFU mL-1 were recorded within one minute on exposure to 740 mg L-1 QAC in the presence of 0.3% (w/v bovine serum albumin and within two minutes in the presence of 20 % (v/v UHT milk. Although Suma D4 chlorine tablets and Suma Bac D10 QAC are effective listericidal agents at recommended concentrations, Suma Tab D4 chlorine efficacy against L. monocytogenes is impaired by the presence of low concentrations of organic material, while Suma Bac D10 QAC maintains its listericidal activity in high organic loads.

Production and characterization of monoclonal antibodies to the edta extract of Leptospira interrogans, serovar icterohaemorrhagiae

Directory of Open Access Journals (Sweden)

Lilian Terezinha de Queiroz Leite

1996-10-01

Full Text Available Monoclonal antibodies (MABs ivere produced against an etbylenediaminetetraacetate (EDTA extract of Leptospira interrogans serovar icterohaemorrhagiae being characterized by gel precipitation as IgM and IgG (IgGl and IgG2b. The EDTA extract was detected as several bands by silver staining in SDS-PAGE. In the Western blot the bands around 20 KDa reacted with a monoclonal antibody, 47B4D6, and was oxidized by periodate and was not digested by pronase, suggesting that the determinant is of carbohydrate nature, lmmunocytochemistry, using colloidal gold labeling, showed that an EDTA extract determinant recognized by monoclonal antibody 47B4D6, is localized under the outer envelope of serovar icterohaemorrhagiae. Hoe AIAB raised against the EDTA extract was not able to protect hamsters from lethal challenge with virulent homologous leptospires.

Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran.

Science.gov (United States)

Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka

2017-06-01

Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Karla Sequeira Mendonça

2016-01-01

Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

Directory of Open Access Journals (Sweden)

Fernanda Barbosa dos Reis-Teixeira

Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.

Science.gov (United States)

Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

Science.gov (United States)

Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

2016-04-01

A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

Identifying ingredients that delay outgrowth of Listeria monocytogenes in natural, organic, and clean-label ready-to-eat meat and poultry products.

Science.gov (United States)

McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J

2013-08-01

The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source

Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken

International Nuclear Information System (INIS)

Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.

1992-01-01

After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens

Six new leptospiral serovars isolated from wild animals in Peru.

OpenAIRE

Liceras de Hidalgo, J L; Sulzer, K R

1984-01-01

Six new serovars of Leptospira interrogans were isolated from opossums (Didelphis marsupialis and Philander opossum) trapped in the Peruvian jungle. The proposed names, type strain designation, and serogroup of the serovars, respectively, were: huallaga, strain M-7, Djasiman serogroup; luis, strain M-6, Tarassovi serogroup; machiguenga, strain MMD-3, Icterohaemorrhagiae serogroup; rioja, strain MR-12, Bataviae serogroup; rupa rupa, strain M-3, Sejroe serogroup; and tingomaria, strain M-13, Cy...

Prevalence of Listeria monocytogenes in poultry meat

Directory of Open Access Journals (Sweden)

Mehmet ELMALI

2015-01-01

Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

Science.gov (United States)

Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

2015-01-01

Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese.

Science.gov (United States)

Cui, H Y; Wu, J; Lin, L

2016-08-01

Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Commensal microbes provide first line defense against Listeria monocytogenes infection

Science.gov (United States)

Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

2017-01-01

Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

Resistance of Listeria monocytogenes biofilms to sanitizing agents

Science.gov (United States)

Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

Science.gov (United States)

Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

2014-12-01

This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

Science.gov (United States)

VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

2016-10-01

Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

Science.gov (United States)

Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

2009-06-15

In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

Listeria monocytogenes in retailed raw chicken meat in Turkey.

Science.gov (United States)

Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

2014-01-01

The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

Radiation sensitivities of Listeria monocytogenes isolated from chicken meat and their growth at refrigeration temperatures

International Nuclear Information System (INIS)

Harsojo; Banati, D.; Ito, H.

1997-01-01

Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C

Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

Science.gov (United States)

Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

2017-04-01

Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

Salmonella Pathogenicity and Host Adaptation in Chicken-Associated Serovars

Science.gov (United States)

Johnson, Timothy J.; Ricke, Steven C.; Nayak, Rajesh; Danzeisen, Jessica

2013-01-01

SUMMARY Enteric pathogens such as Salmonella enterica cause significant morbidity and mortality. S. enterica serovars are a diverse group of pathogens that have evolved to survive in a wide range of environments and across multiple hosts. S. enterica serovars such as S. Typhi, S. Dublin, and S. Gallinarum have a restricted host range, in which they are typically associated with one or a few host species, while S. Enteritidis and S. Typhimurium have broad host ranges. This review examines how S. enterica has evolved through adaptation to different host environments, especially as related to the chicken host, and continues to be an important human pathogen. Several factors impact host range, and these include the acquisition of genes via horizontal gene transfer with plasmids, transposons, and phages, which can potentially expand host range, and the loss of genes or their function, which would reduce the range of hosts that the organism can infect. S. Gallinarum, with a limited host range, has a large number of pseudogenes in its genome compared to broader-host-range serovars. S. enterica serovars such as S. Kentucky and S. Heidelberg also often have plasmids that may help them colonize poultry more efficiently. The ability to colonize different hosts also involves interactions with the host's immune system and commensal organisms that are present. Thus, the factors that impact the ability of Salmonella to colonize a particular host species, such as chickens, are complex and multifactorial, involving the host, the pathogen, and extrinsic pressures. It is the interplay of these factors which leads to the differences in host ranges that we observe today. PMID:24296573

Draft Genome Sequence of Salmonella enterica subsp. enterica Serovar Infantis Strain SPE101, Isolated from a Chronic Human Infection.

Science.gov (United States)

Iriarte, Andrés; Giner-Lamia, Joaquín; Silva, Claudia; Betancor, Laura; Astocondor, Lizeth; Cestero, Juan J; Ochoa, Theresa; García, Coralith; Puente, José L; Chabalgoity, José A; García-Del Portillo, Francisco

2017-07-20

We report a 4.99-Mb draft genome sequence of Salmonella enterica subsp. enterica serovar Infantis strain SPE101, isolated from feces of a 5-month-old breast-fed female showing diarrhea associated with severe dehydration and malnutrition. The infection prolonged for 6 months despite antibiotic treatment. Copyright © 2017 Iriarte et al.

Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

Directory of Open Access Journals (Sweden)

Qi Zhu

2017-03-01

Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

Directory of Open Access Journals (Sweden)

abazar pournajaf

2013-09-01

Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

Prevalence and characterization of Salmonella serovars isolated from oysters served raw in restaurants.

Science.gov (United States)

Brillhart, Crystal D; Joens, Lynn A

2011-06-01

To determine if Salmonella-contaminated oysters are reaching consumer tables, a survey of raw oysters served in eight Tucson restaurants was performed from October 2007 to September 2008. Salmonella spp. were isolated during 7 of the 8 months surveyed and were present in 1.2% of 2,281 oysters tested. This observed prevalence is lower than that seen in a previous study in which U.S. market oysters were purchased from producers at bays where oysters are harvested. To test whether the process of refrigerating oysters in restaurants for several days reduces Salmonella levels, oysters were artificially infected with Salmonella and kept at 4°C for up to 13 days. Direct plate counts of oyster homogenate showed that Salmonella levels within oysters did not decrease during refrigeration. Six different serovars of Salmonella enterica were found in the restaurant oysters, indicating multiple incidences of Salmonella contamination of U.S. oyster stocks. Of the 28 contaminated oysters, 12 (43%) contained a strain of S. enterica serovar Newport that matched by pulsed-field gel electrophoresis a serovar Newport strain seen predominantly in the study of bay oysters performed in 2002. The repeated occurrence of this strain in oyster surveys is concerning, since the strain was resistant to seven antimicrobials tested and thus presents a possible health risk to consumers of raw oysters.

Salmonella enterica Serovar Typhimurium and Escherichia coli Contamination of Root and Leaf Vegetables Grown in Soils with Incorporated Bovine Manure

Science.gov (United States)

Natvig, Erin E.; Ingham, Steven C.; Ingham, Barbara H.; Cooperband, Leslie R.; Roper, Teryl R.

2002-01-01

Bovine manure, with or without added Salmonella enterica serovar Typhimurium (three strains), was incorporated into silty clay loam (SCL) and loamy sand (LS) soil beds (53- by 114-cm surface area, 17.5 cm deep) and maintained in two controlled-environment chambers. The S. enterica serovar Typhimurium inoculum was 4 to 5 log CFU/g in manure-fertilized soil. The conditions in the two environmental chambers, each containing inoculated and uninoculated beds of manure-fertilized soil, simulated daily average Madison, Wis., weather conditions (hourly temperatures, rainfall, daylight, and humidity) for a 1 March or a 1 June manure application and subsequent vegetable growing seasons ending 9 August or 28 September, respectively. Core soil samples were taken biweekly from both inoculated and uninoculated soil beds in each chamber. Radishes, arugula, and carrots were planted in soil beds, thinned, and harvested. Soils, thinned vegetables, and harvested vegetables were analyzed for S. enterica serovar Typhimurium and Escherichia coli (indigenous in manure). After the 1 March manure application, S. enterica serovar Typhimurium was detected at low levels in both soils on 31 May, but not on vegetables planted 1 May and harvested 12 July from either soil. After the 1 June manure application, S. enterica serovar Typhimurium was detected in SCL soil on 7 September and on radishes and arugula planted in SCL soil on 15 August and harvested on 27 September. In LS soil, S. enterica serovar Typhimurium died at a similar rate (P ≥ 0.05) after the 1 June manure application and was less often detected on arugula and radishes harvested from this soil compared to the SCL soil. Pathogen levels on vegetables were decreased by washing. Manure application in cool (daily average maximum temperature of vegetables are not contaminated with S. enterica serovar Typhimurium. Manure application under warmer (daily average maximum temperature >20°C) summer conditions is not recommended when

Inhibition of Listeria monocytogenes on cooked cured chicken breasts by acidified coating containing allyl isothiocyanate or deodorized Oriental mustard extract.

Science.gov (United States)

Olaimat, Amin N; Holley, Richard A

2016-08-01

Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.

Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

NARCIS (Netherlands)

Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

2009-01-01

Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

DEFF Research Database (Denmark)

Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

2011-01-01

role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

2015-01-01

The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

Directory of Open Access Journals (Sweden)

Shi Wu

Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

2015-01-01

The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Impact of preheating on the behavior of Listeria monocytogenes in a broth that mimics Camembert cheese composition.

Science.gov (United States)

Helloin, E; Bouttefroy, A; Gay, M; Phan Thanh, L

2003-02-01

The effect of preheating on the survival of L. monocytogenes in Richard's broth, which mimics the composition of Camembert cheese composition, was examined. Experiments were carried out to reproduce contamination of cheese with environmental heat-stressed cells of L. monocytogenes surviving hot-cleaning procedures. Cells in mid-log phase were heated for 30 min at 56 degrees C before being inoculated into Richard's broth. The pHs and temperatures of Richard's broth were chosen to recreate the conditions of curd dripping (pH 5, 25 degrees C), of the beginning of cheese ripening (pH 5, 12 degrees C), and of the beginning (pH 5, 4 degrees C) and the end (pH 7, 4 degrees C) of cheese storage. Immediately after heat treatment, the viability loss was especially high for strain 306715, which exhibited only 0.6% +/- 0.2% survival, compared with 22% +/- 8.7% for strain EGD. The percentages of the surviving heated cells that were injured were 93% +/- 8% for strain 306715 and 98% +/- 3% for strain EGD. The destruction of the surviving L. monocytogenes cells was accelerated when they encountered the pH and temperature conditions of Camembert cheese during manufacturing, ripening, and cold storage (pH 5 at 25, 12, and 4 degrees C, respectively). The multiplication of the surviving heated cells was retarded under favorable growth conditions similar to those of storage by the distributor and the consumer (pH 7 at 4 and 12 degrees C, respectively).

Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Analía L. Laciar

2000-03-01

Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

The microbiological safety of ready-to-eat specialty meats from markets and specialty food shops: a UK wide study with a focus on Salmonella and Listeria monocytogenes.

Science.gov (United States)

Gormley, F J; Little, C L; Grant, K A; de Pinna, E; McLauchlin, J

2010-04-01

From 2359 specialty meats (continental sausages, cured/fermented, dried meats) sampled from markets and specialty food shops, 98.9% of samples were of satisfactory or acceptable microbiological quality. However, 16 (0.7%) were unsatisfactory as a result of Escherichia coli, Staphylococcus aureus or Listeria spp. contamination (>or=10(2) CFU/g), and nine (0.4%) were unacceptable due to presence of Salmonella spp. or Listeria monocytogenes (>10(2) CFU/g). Meats with unacceptable levels of L. monocytogenes were within shelf life (range: 8-143 days remaining). Nine different subtypes of L. monocytogenes were detected with sero/AFLP type 1/2c VII predominating (37%), although this subtype was not overrepresented in any particular meat type (P > 0.05). Ninety-six percent of continental sausages and cured/fermented products were stored at potential for L. monocytogenes to be present at levels hazardous to health at the point of sale.

Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

Directory of Open Access Journals (Sweden)

Shi eWu

2016-02-01

Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

2016-01-01

Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

Modeling the growth of Listeria monocytogenes in soft blue-white cheese

DEFF Research Database (Denmark)

Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne

2012-01-01

The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

Lymphogranuloma Venereum-Serovar L2b Presenting With Painful Genital Ulceration: An Emerging Clinical Presentation?

Science.gov (United States)

Haber, Roger; Maatouk, Ismaël; de Barbeyrac, Bertille; Bagot, Martine; Janier, Michel; Fouéré, Sébastien

2017-05-01

These 5 cases of atypical inflammatory lymphogranula venereum (LGV) serovar L2b presenting initially with edema and persistent painful ulceration illustrate that clinical manifestations of LGV in the current outbreak in men who have sex with men reflect the influence of both the serovars virulence and the host immune system and are not confined to proctitis. L2b serovar could have a particular high virulence profile, and the need for awareness of LGV as a cause of genital ulceration is crucial.

Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

Science.gov (United States)

Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

2017-01-01

The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

Cloning and Sequencing of Gene Encoding Outer Membrane Lipoprotein LipL41 of Leptospira Interrogans Serovar Grippotyphosa

Directory of Open Access Journals (Sweden)

M.S. Soltani

2014-12-01

Full Text Available Background: Leptospirosis is an infectious bacterial disease caused by pathogenic serovars of Leptospira. Development of reliable and applicable diagnostic test and also recombinant vaccine for this disease require specific antigens that are highly conserved among diverse pathogenic leptospiral serovars. Outer membrane proteins(OMPs of leptospira are effective antigens which can stimulate remarkable immune responses during infection, among them LipL41 is an immunogenic lipoprotein which is present only in pathogenic serovars so it could be regarded as a good candidate for vaccine development and diagnostic method. In order to identify genetic conservation of the lipL41 gene, we cloned and sequenced this gen from Leptospira interrogans serovar vaccinal and field of Grippotyphosa. Materials and Methods: Leptospira interrogans serovar vaccinal Grippotyphosa (RTCC2808 and serovar field Grippotyphosa (RTCC2825were used to inoculate into the selective culture medium(EMJH. The genomic DNA was extracted by standard phenol-chloroform method. The lipL41 gene were amplified by specific primers and cloned into pTZ57R/T vector and transformed into the competent E. coli (Top10 cells. the extracted recombinant plasmid were sequenced. And the related sequences were subjected to homology analysis by comparing them to sequences in the Genbank database. Results: PCR amplification of the lipL41 gene resulted in the 1065 bp PCR product. DNA sequence analysis revealed that lipL41 gene between serovar vaccinal Grippotyphosa (RTCC2808and serovar field Grippotyphosa (RTCC2825 in Iran was 100%. It was also showed that the lipL41 gene had high identity (96%-100% with other pathogenic serovars submitted in Genbank database. Conclusion: The results of this study showed that the lipL41 gene was highly conserved among various pathogenic Leptospira serovars( >95.9 % identity. Hence the cloned gene could be further used for expression of recombinant protein for serodiagnosis

Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

DEFF Research Database (Denmark)

Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

2017-01-01

dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

Inhibition of Listeria monocytogenes by Lactobacillus bavaricus MN in beef systems at refrigeration temperatures.

OpenAIRE

Winkowski, K; Crandall, A D; Montville, T J

1993-01-01

The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...

Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

Science.gov (United States)

Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

Directory of Open Access Journals (Sweden)

Moutong eChen

2015-09-01

Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

A 3-year multi-food study of the presence and persistence of Listeria monocytogenes in 54 small food businesses in Ireland.

Science.gov (United States)

Leong, Dara; NicAogáin, Kerrie; Luque-Sastre, Laura; McManamon, Oisin; Hunt, Karen; Alvarez-Ordóñez, Avelino; Scollard, Johann; Schmalenberger, Achim; Fanning, Séamus; O'Byrne, Conor; Jordan, Kieran

2017-05-16

The problem of assessing the occurrence of the food-borne pathogen Listeria monocytogenes in the food chain, and therefore the risk of exposure of the human population, is often challenging because of the limited scope of some studies. In this study the occurrence of L. monocytogenes in food from four major food groups, dairy products, meats, seafood and vegetables, and associated food processing environments in Ireland was studied over a three-year period. Fifty-four small food businesses participated in the study and sent both food and environmental samples every 2months between 2013 and 2015. L. monocytogenes was isolated using the ISO11290 standard method. Confirmation of L. monocytogenes and identification of serogroups were achieved using a multiplex PCR assay, and for some isolates serotype was determined using commercial antisera. Pulsed- field gel electrophoresis (PFGE) analysis was performed on all isolates allowing the relatedness of isolates from different food businesses to be compared nationwide. In total, 86 distinct pulsotypes were identified. The overall occurrence of L. monocytogenes in food samples was 4.2%, while in environmental samples it was 3.8%. In general, the occurrence of L. monocytogenes in food businesses decreased over the course of the study, presumably reflecting increased awareness and vigilance. The majority of the pulsotypes detected were unique to a particular food group (63/86), while only three pulsotypes were found in all four food groups investigated. The highest occurrence in food was found in the meat category (7.5%) while seafood had the lowest rate of occurrence (1.8%). Seventeen of the pulsotypes detected in the study were persistent, where persistence was defined as repeated isolation from a single facility with a minimum time interval of 6months. Using PFGE, 11 of the pulsotypes identified in this study were indistinguishable from those of 11 clinical isolates obtained from patients in Ireland over the last 4years

Antimicrobial Drug Resistance of Salmonella enterica Serovar Typhi in Asia and Molecular Mechanism of Reduced Susceptibility to the Fluoroquinolones▿

Science.gov (United States)

Chau, Tran Thuy; Campbell, James Ian; Galindo, Claudia M.; Van Minh Hoang, Nguyen; Diep, To Song; Nga, Tran Thu Thi; Van Vinh Chau, Nguyen; Tuan, Phung Quoc; Page, Anne Laure; Ochiai, R. Leon; Schultsz, Constance; Wain, John; Bhutta, Zulfiqar A.; Parry, Christopher M.; Bhattacharya, Sujit K.; Dutta, Shanta; Agtini, Magdarina; Dong, Baiqing; Honghui, Yang; Anh, Dang Duc; Canh, Do Gia; Naheed, Aliya; Albert, M. John; Phetsouvanh, Rattanaphone; Newton, Paul N.; Basnyat, Buddha; Arjyal, Amit; La, Tran Thi Phi; Rang, Nguyen Ngoc; Phuong, Le Thi; Van Be Bay, Phan; von Seidlein, Lorenz; Dougan, Gordon; Clemens, John D.; Vinh, Ha; Hien, Tran Tinh; Chinh, Nguyen Tran; Acosta, Camilo J.; Farrar, Jeremy; Dolecek, Christiane

2007-01-01

This study describes the pattern and extent of drug resistance in 1,774 strains of Salmonella enterica serovar Typhi isolated across Asia between 1993 and 2005 and characterizes the molecular mechanisms underlying the reduced susceptibilities to fluoroquinolones of these strains. For 1,393 serovar Typhi strains collected in southern Vietnam, the proportion of multidrug resistance has remained high since 1993 (50% in 2004) and there was a dramatic increase in nalidixic acid resistance between 1993 (4%) and 2005 (97%). In a cross-sectional sample of 381 serovar Typhi strains from 8 Asian countries, Bangladesh, China, India, Indonesia, Laos, Nepal, Pakistan, and central Vietnam, collected in 2002 to 2004, various rates of multidrug resistance (16 to 37%) and nalidixic acid resistance (5 to 51%) were found. The eight Asian countries involved in this study are home to approximately 80% of the world's typhoid fever cases. These results document the scale of drug resistance across Asia. The Ser83→Phe substitution in GyrA was the predominant alteration in serovar Typhi strains from Vietnam (117/127 isolates; 92.1%). No mutations in gyrB, parC, or parE were detected in 55 of these strains. In vitro time-kill experiments showed a reduction in the efficacy of ofloxacin against strains harboring a single-amino-acid substitution at codon 83 or 87 of GyrA; this effect was more marked against a strain with a double substitution. The 8-methoxy fluoroquinolone gatifloxacin showed rapid killing of serovar Typhi harboring both the single- and double-amino-acid substitutions. PMID:17908946

Sensitivity of Listeria monocytogenes to irradiation

International Nuclear Information System (INIS)

Tarjan, Veronika

1990-01-01

Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

Evaluation of bacteriocin-producing Lactobacillus sakei 1 against Listeria monocytogenes 1/2a growth and haemolytic activity Avaliação de Lactobacillus sakei 1 produtor de bacteriocina frente a Listeria monocytogenes 1/2a e sua atividade hemolítica

Directory of Open Access Journals (Sweden)

Rafael C.R. Martinez

2005-03-01

Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr

Prevalence and antimicrobial profiles of Salmonella serovars from ...

African Journals Online (AJOL)

ADEYEYE

2014-01-21

Jan 21, 2014 ... Presumptive Salmonella isolates were determined by using the conventional ... Salmonella represents a major contaminant of vegetables consumed in Maiduguri, North-eastern ... serovars in vegetables in Nigeria do not exist.

The impact of a cold chain break on the survival of Salmonella enterica and Listeria monocytogenes on minimally processed 'Conference' pears during their shelf life.

Science.gov (United States)

Colás-Medà, Pilar; Viñas, Inmaculada; Alegre, Isabel; Abadias, Maribel

2017-07-01

In recent years, improved detection methods and increased fresh-cut processing of produce have led to an increased number of outbreaks associated with fresh fruits and vegetables. During fruit and vegetable processing, natural protective barriers are removed and tissues are cut, causing nutrient rich exudates and providing attachment sites for microbes. Consequently, fresh-cut produce is more susceptible to microbial proliferation than whole produce. The aim of this study was to examine the impact of storage temperature on the growth and survival of Listeria monocytogenes and Salmonella enterica on a fresh-cut 'Conference' pear over an 8 day storage period. Pears were cut, dipped in antioxidant solution, artificially inoculated with L. monocytogenes and S. enterica, packed under modified atmospheric conditions simulating commercial applications and stored in properly refrigerated conditions (constant storage at 4 °C for 8 days) or in temperature abuse conditions (3 days at 4 °C plus 5 days at 8 °C). After 8 days of storage, both conditions resulted in a significant decrease of S. enterica populations on pear wedges. In contrast, when samples were stored at 4 °C for 8 days, L. monocytogenes populations increased 1.6 logarithmic units, whereas under the temperature abuse conditions, L. monocytogenes populations increased 2.2 logarithmic units. Listeria monocytogenes was able to grow on fresh-cut pears processed under the conditions described here, despite low pH, refrigeration and use of modified atmosphere. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.

Science.gov (United States)

Redfern, J; Verran, J

2017-04-01

Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

Development of Hamster Models for Acute and Chronic Infections with Leptospira borgpetersenii serovar Hardjo

Science.gov (United States)

The Golden Syrian hamster is frequently used as a small animal model to study acute leptospirosis. However, use of this small animal model to study Leptospira borgpetersenii serovar Hardjo infections has not been well documented. Cattle are the normal maintenance hosts of L. borgpetersenii serovar...

Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

Science.gov (United States)

Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

2016-05-01

Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

Survival of Salmonella enterica serovar infantis on and within stored table eggs.

Science.gov (United States)

Lublin, Avishai; Maler, Ilana; Mechani, Sara; Pinto, Riky; Sela-Saldinger, Shlomo

2015-02-01

Contaminated table eggs are considered a primary source of foodborne salmonellosis globally. Recently, a single clone of Salmonella enterica serovar Infantis emerged in Israel and became the predominant serovar isolated in poultry. This clone is currently the most prevalent strain in poultry and is the leading cause of salmonellosis in humans. Because little is known regarding the potential transmission of this strain from contaminated eggs to humans, the objective of this study was to evaluate the ability of Salmonella Infantis to survive on the eggshell or within the egg during cold storage or at room temperature. Salmonella cells (5.7 log CFU per egg) were inoculated on the surface of 120 intact eggs or injected into the egg yolk (3.7 log CFU per egg) of another 120 eggs. Half of the eggs were stored at 5.5 ± 0.3°C and half at room temperature (25.5 ± 0.1°C) for up to 10 weeks. At both temperatures, the number of Salmonella cells on the shell declined by 2 log up to 4 weeks and remained constant thereafter. Yolk-inoculated Salmonella counts at cold storage declined by 1 log up to 4 weeks and remained constant, while room-temperature storage supported the growth of the pathogen to a level of 8 log CFU/ml of total egg content, as early as 4 weeks postinoculation. Examination of egg content following surface inoculation revealed the presence of Salmonella in a portion of the eggs at both temperatures up to 10 weeks, suggesting that this strain can also penetrate through the shell and survive within the egg. These findings imply that Salmonella enterica serovar Infantis is capable of survival both on the exterior and interior of table eggs and even multiply inside the egg at room temperature. Our findings support the need for prompt refrigeration to prevent Salmonella multiplication during storage of eggs at room temperature.

DETERMINASI SEROVAR BAKTERI LEPTOSPIRA PADA RESERVOIR DI KABUPATEN BANYUMAS

Directory of Open Access Journals (Sweden)

Tri Ramadhani

2016-05-01

Full Text Available Leptospirosis is an infectious disease caused by pathogenic Leptospira. Leptospirosis transmitted to human through direct contact with body fluids of infected animals or indirectly through contaminated puddles . The prevalence of leptospirosis in Banyumas tends to increase for 3 years. The purpose of this study was to determine the leptospira serovar in reservoir to prove of a current infection. Surveys was conducted using single live traps for three consecutive days, determination of leptospira serovar was conducted using Microscopic Aglutination Test (MAT. Data analysis was performed by univariate and presented in tables and graphs. The results showed that the trapped animals consisted of Rattus tanezumi (70.6% and Suncus murinus (29.4% with 6.5% succsess trap. Rattus tanezumi were dominantly caught inside the house (51% than outside the house (49%. Female rats were dominantly caught (66.7% than male rats (33.3%. Suncus murinus and Rattus tanezumi shown a titer of 1/100 to be infected with L.icterohaemorrhagiae , L.javanica and L.cynopteri which are pathogenic Leptospira in humans. Efforts are needed to improve community participation in preventing tranmission of leptospirosis by avoiding contact with contaminated water and soil. For people who are risk of exposure to infected animal should wear protective clothes or footwear.

Human leptospirosis: occurrence of serovars of Leptospira spp. in the state of Minas Gerais, Brazil, from 2008 to 2012.

Science.gov (United States)

Oliveira, Marluce Aparecida Assunção; Leal, Élida Aparecida; Correia, Max Assunção; Serufo Filho, José Carlos; Dias, Ricardo Souza; Serufo, José Carlos

Leptospirosis is an infectious and acute disease caused by Leptospira spp. that have high epidemic potential. This study verified the main Leptospira spp. serovars detected by MAT from serum of patients with suspicion of leptospirosis from 2008 to 2012 in Minas Gerais State. The laboratory received sera from 4654 patients. All serum were screened by IgM-ELISA according to the manufacturer's instructions. Each sample reactive or indeterminate were tested against twenty-four serovars of Leptospira by MAT. In this study, 597 patients were classified as reactive on MAT. Only 301 patients were confirmed by laboratory test. It was not possible confirmation by laboratory diagnosis of 296 patients. Among the samples classified as reactive on MAT, 273 patients exhibited titers bigger than 800 for one or more serovars; seroconversion was detected in 28 cases. Percentage of 85.1% of the samples reactive on MAT corresponded to males, 39.4% corresponded to patients aged between 20 and 39 years old. The most common serovars found were Icterohaemorrhagiae, Andamana, Patoc, Tarassovi, Copenhageni, Hardjo and Australis. Concerning the samples that exhibited titers bigger than 800, serovar Icterohaemorrhagiae was also the most common, followed by Copenhageni, Andamana, Patoc, Tarassovi, Grippotyphosa and Canicola. In this study, 40% of the cases occurred to the metropolitan area, state capital and 34 neighboring towns. Our results show the possibly spreading serovars in Minas Gerais State and contribute to knowledge of human leptospirosis, aiming at improving the prevention, control of the disease, as well as the treatment of infected patients. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

Science.gov (United States)

Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

2015-11-30

Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

Comparative genomic analysis of Brazilian Leptospira kirschneri serogroup Pomona serovar Mozdok

Directory of Open Access Journals (Sweden)

Luisa Z Moreno

2016-08-01

Full Text Available Leptospira kirschneri is one of the pathogenic species of the Leptospira genus. Human and animal infection from L. kirschneri gained further attention over the last few decades. Here we present the isolation and characterisation of Brazilian L. kirschneri serogroup Pomona serovar Mozdok strain M36/05 and the comparative genomic analysis with Brazilian human strain 61H. The M36/05 strain caused pulmonary hemorrhagic lesions in the hamster model, showing high virulence. The studied genomes presented high symmetrical identity and the in silico multilocus sequence typing analysis resulted in a new allelic profile (ST101 that so far has only been associated with the Brazilian L. kirschneri serogroup Pomona serovar Mozdok strains. Considering the environmental conditions and high genomic similarity observed between strains, we suggest the existence of a Brazilian L. kirschneri serogroup Pomona serovar Mozdok lineage that could represent a high public health risk; further studies are necessary to confirm the lineage significance and distribution.

Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

Directory of Open Access Journals (Sweden)

Hurtado Ana

2009-01-01

Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

Antimicrobial activity of lauric arginate-coated polylactic acid films against Listeria monocytogenes and Salmonella typhimurium on cooked sliced ham.

Science.gov (United States)

Theinsathid, Pornpun; Visessanguan, Wonnop; Kruenate, Jittiporn; Kingcha, Yutthana; Keeratipibul, Suwimon

2012-02-01

A novel type of environmentally friendly packaging with antibacterial activity was developed from lauric arginate (LAE)-coating of polylactic acid (PLA) films after surface activation using a corona discharge. Scanning electron microscopy (SEM)-based analysis of the LAE/PLA films confirmed the successful coating of LAE on the PLA surface. The mechanical properties of the LAE/PLA films with different levels of LAE-coating (0% to 2.6%[w/w]) were essentially the same as those of the neat PLA film. The antibacterial activity of the LAE/PLA films against Listeria monocytogenes and Salmonella enterica Serovar Typhimurium (S. Typhimurium) was confirmed by a qualitative modified agar diffusion assay and quantitative JIS Z 2801:2000 method. Using the LAE/PLA film as a food-contact antimicrobial packaging for cooked cured ham, as a model system, suggested a potential application to inhibit L. monocytogenes and S. Typhimurium on ham with a 0.07% (w/w) LAE coating on the PLA when high transparency is required, as evidenced from the 2 to 3 log CFU/tested film lower pathogen growth after 7 d storage but even greater antibacterial activity is obtained with a LAE coating level of 2.6% (w/w) but at the cost of a reduced transparency of the finished product. This article shows how we can simply develop functional green packaging of PLA for food with effective and efficient antimicrobial activity by use of LAE coating on the surface via corona discharge. The effectiveness of an innovative antimicrobial LAE-coated PLA film against foodborne pathogens was demonstrated. Importantly, the application of the LAE to form the LAE-coated PLA film can be customized within current film manufacturing lines. © 2012 Institute of Food Technologists®

Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

DEFF Research Database (Denmark)

Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

2001-01-01

and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

Directory of Open Access Journals (Sweden)

Maysa A. I. Awadallah

2014-10-01

Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

Science.gov (United States)

Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

2014-01-01

The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

Use Carum copticum essential oil for controlling the Listeria monocytogenes growth in fish model system

Directory of Open Access Journals (Sweden)

Soghra Rabiey

2014-01-01

Full Text Available This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB, kutum broth and cold smoked kutum broth at 4 ºC for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.

Behavior of Escherichia coli O157:H7 and Listeria monocytogenes during fermentation and storage of camel yogurt.

Science.gov (United States)

Al-Nabulsi, Anas A; Olaimat, Amin N; Osaili, Tareq M; Ayyash, Mutamed M; Abushelaibi, Aisha; Jaradat, Ziad W; Shaker, Reyad; Al-Taani, Mahmoud; Holley, Richard A

2016-03-01

In addition to its nutritional and therapeutic properties, camel milk has the ability to suppress the growth of a wide range of foodborne pathogens, but there is a lack of information regarding the behavior of these pathogens in products such as yogurt produced from camel milk. The objective of the current study was to investigate the behavior of Listeria monocytogenes and Escherichia coli O157:H7 during manufacture and storage of camel yogurt. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 was fermented at 43° C for 5h using freeze-dried lactic acid bacteria (LAB) starter cultures (Streptococcus thermophilus and Lactobacillus bulgaricus) and stored at 4 or 10 °C for 14 d. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 without starter culture was also prepared. During fermentation, the numbers of L. monocytogenes and E. coli O157:H7 increased 0.3 and 1.6 log cfu/mL, respectively, in the presence of LAB, and by 0.3 and 2.7 log cfu/mL in the absence of LAB. During storage at 4 or 10 °C, L. monocytogenes increased 0.8 to 1.2 log cfu/mL by 14 d in camel milk without LAB, but in the presence of LAB, the numbers of L. monocytogenes were reduced by 1.2 to 1.7 log cfu/mL by 14 d. Further, E. coli O157:H7 numbers in camel milk were reduced by 3.4 to 3.5 log cfu/mL in the absence of LAB, but E. coli O157:H7 was not detected (6.3 log cfu/mL reduction) by 7d in camel yogurt made with LAB and stored at either temperature. Although camel milk contains high concentrations of natural antimicrobials, L. monocytogenes was able to tolerate these compounds in camel yogurt stored at refrigerator temperatures. Therefore, appropriate care should be taken during production of yogurt from camel milk to minimize the potential for postprocess contamination by this and other foodborne pathogens. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

Science.gov (United States)

Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

Prevalence of Listeria monocytogenes in European cheeses

DEFF Research Database (Denmark)

Martinez Rios, Veronica; Dalgaard, Paw

2017-01-01

, respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...

Salmonella enterica serovars Typhimurium and Enteritidis causing mixed infections in febrile children in Mozambique

Directory of Open Access Journals (Sweden)

García V

2018-01-01

Full Text Available Vanesa García,1 Inácio Mandomando,2,3 Joaquim Ruiz,4 Silvia Herrera-León,5 Pedro L Alonso,3,4 M Rosario Rodicio1 1Departamento de Biología Funcional, Área de Microbiología, Universidad de Oviedo, Oviedo, Spain; 2Centro de Investigação em Saúde de Manhiça, 3Instituto Nacional de Saúde, Ministério da Saúde, Maputo, Mozambique; 4ISGlobal, Barcelona Centre for International Health Research, Hospital Clínic, Universitat de Barcelona, Barcelona, 5Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain Background and purpose: Invasive nontyphoidal salmonellosis, mostly caused by serovars Typhimurium and Enteritidis of Salmonella enterica, has emerged as a major public health problem in sub-Saharan Africa. The aim of this study was the clinical and microbiological characterization of nontyphoidal salmonellosis episodes affecting febrile children in Mozambique. Patients and methods: The clinical records of the patients were evaluated, and S. enterica isolates were characterized with regard to serovar, phage type, antimicrobial resistance (phenotype/responsible genes, plasmid content, pulsed-field gel electrophoresis, and multilocus sequence typing. Results: Fifteen S. Typhimurium and 21 S. Enteritidis isolates were recovered from blood samples of 25 children, the majority with underlying risk factors. With regard to phage typing, most isolates were either untypeable or reacted but did not conform, revealing that a number of previously unrecognized patterns are circulating in Mozambique. Most isolates were multidrug-resistant, with nearly all of the responsible genes located on derivatives of serovar-specific virulence plasmids. ST313 and ST11 were the predominant sequence types associated with S. Typhimurium and S. Enteritidis, respectively, and the uncommon ST1479 was also detected in S. Enteritidis. A distinct XbaI fragment of ~350 kb was associated with pulsed-field gel electrophoresis patterns of

Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.

Science.gov (United States)

Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M

2016-12-01

The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.

Prevalence and relative risk of Cronobacter spp., Salmonella spp., and Listeria monocytogenes associated with the body surfaces and guts of individual filth flies.

Science.gov (United States)

Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Ziobro, George C

2012-11-01

Although flies are important vectors of food-borne pathogens, there is little information to accurately assess the food-related health risk of the presence of individual flies, especially in urban areas. This study quantifies the prevalence and the relative risk of food-borne pathogens associated with the body surfaces and guts of individual wild flies. One hundred flies were collected from the dumpsters of 10 randomly selected urban restaurants. Flies were identified using taxonomic keys before being individually dissected. Cronobacter spp., Salmonella spp., and Listeria monocytogenes were detected using the PCR-based BAX system Q7. Positive samples were confirmed by culture on specific media and through PCR amplification and sequencing or ribotyping. Among collected flies were the housefly, Musca domestica (47%), the blowflies, Lucilia cuprina (33%) and Lucilia sericata (14%), and others (6%). Cronobacter species were detected in 14% of flies, including C. sakazakii, C. turicensis, and C. universalis, leading to the proposal of flies as a natural reservoir of this food-borne pathogen. Six percent of flies carried Salmonella enterica, including the serovars Poona, Hadar, Schwarzengrund, Senftenberg, and Brackenridge. L. monocytogenes was detected in 3% of flies. Overall, the prevalence of food-borne pathogens was three times greater in the guts than on the body surfaces of the flies. The relative risk of flies carrying any of the three pathogens was associated with the type of pathogen, the body part of the fly, and the ambient temperature. These data enhance the ability to predict the microbiological risk associated with the presence of individual flies in food and food facilities.

Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

DEFF Research Database (Denmark)

Nørrung, Birgit

2000-01-01

This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

Deciphering the landscape of host barriers to Listeria monocytogenes infection.

Science.gov (United States)

Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

2017-06-13

Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

Science.gov (United States)

Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

2017-11-01

The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

Science.gov (United States)

Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

2017-07-01

Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

Science.gov (United States)

Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

2018-06-13

The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

Science.gov (United States)

Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

2009-02-15

The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

Listeria monocytogenes: diagnostic problems

NARCIS (Netherlands)

Beumer, R.R.; Hazeleger, W.C.

2003-01-01

The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

Directory of Open Access Journals (Sweden)

Poyin Chen

2017-12-01

Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

Incidence and control of Listeria monocytogenes in foods in Denmark

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

1999-01-01

The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

Prevalence of Listeria monocytogenes in raw milk in North Lebanon

International Nuclear Information System (INIS)

Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

2016-01-01

Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB

Directory of Open Access Journals (Sweden)

Lenice Roteia Cardoso Jung

2015-06-01

Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).

Science.gov (United States)

Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

2015-06-01

Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

African Journals Online (AJOL)

This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

Directory of Open Access Journals (Sweden)

V. López

2006-12-01

Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

Effects of gamma irradiation on the physical and sensory quality and inactivation of Listeria monocytogenes in blue swimming crab meat (Portunas pelagicus)

Science.gov (United States)

Suklim, Kannapha; Flick, George J.; Vichitphan, Kanit

2014-10-01

Blue swimming crab lump (backfin) meat were exposed to 2, 4, and 6 kGy doses of Co60 irradiation and evaluated for changes in physical, sensory properties, and Listeria monocytogenes inactivation. Irradiation up to 6 kGy resulted in no textural changes (p>0.05) in maximum shear forces; however, these exposures resulted in sensory quality changes (p0.05) on L* color value. Irradiation at 4 and 6 kGy resulted in listericidal reductions greater than 6.65 (Department of Medical Science, Ministry of Health, Thailand, [DMST] 1783) and 7.56 logs (DMST 4553). Irradiation doses of 1 and 2 kGy resulted in a reduction of 2.10 and 5.35 logs respectively of L. monocytogenes DMST 1783 and 1.56 and 4.19 logs respectively of L. monocytogenes DMST 4553. The D10 values of L. monocytogenes DMST 1783 and 4553 were 0.35 and 0.45 kGy. The study indicated that low-dose gamma irradiation would increase the safety of blue swimming crab meat without unacceptable changes in texture and L* color value.

Expression and characterization of an iron-regulated hemin-binding protein, HbpA, from Leptospira interrogans serovar Lai.

Science.gov (United States)

Asuthkar, Swapna; Velineni, Sridhar; Stadlmann, Johannes; Altmann, Friedrich; Sritharan, Manjula

2007-09-01

In an earlier study, based on the ferric enterobactin receptor FepA of Escherichia coli, we identified and modeled a TonB-dependent outer membrane receptor protein (LB191) from the genome of Leptospira interrogans serovar Lai. Based on in silico analysis, we hypothesized that this protein was an iron-dependent hemin-binding protein. In this study, we provide experimental evidence to prove that this protein, termed HbpA (hemin-binding protein A), is indeed an iron-regulated hemin-binding protein. We cloned and expressed the full-length 81-kDa recombinant rHbpA protein and a truncated 55-kDa protein from L. interrogans serovar Lai, both of which bind hemin-agarose. Assay of hemin-associated peroxidase activity and spectrofluorimetric analysis provided confirmatory evidence of hemin binding by HbpA. Immunofluorescence studies by confocal microscopy and the microscopic agglutination test demonstrated the surface localization and the iron-regulated expression of HbpA in L. interrogans. Southern blot analysis confirmed our earlier observation that the hbpA gene was present only in some of the pathogenic serovars and was absent in Leptospira biflexa. Hemin-agarose affinity studies showed another hemin-binding protein with a molecular mass of approximately 44 kDa, whose expression was independent of iron levels. This protein was seen in several serovars, including nonpathogenic L. biflexa. Sequence analysis and immunoreactivity with specific antibodies showed this protein to be LipL41.

Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

Science.gov (United States)

Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

2014-01-02

An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

Science.gov (United States)

Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

2011-06-01

The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

Cross neutralizing antibodies in hamsters vaccinated with leptospiral bacterins produced with three serovars of serogroup Sejroe

Directory of Open Access Journals (Sweden)

Rosana Tabata

2002-09-01

Full Text Available Three leptospiral bacterins, produced with different serovars of Serogroup Sejroe, namely the hardjo (bacterin A, wolffi (bacterin B and guaricura (bacterin C, were evaluated in male hamsters (Mesocricetus auratus by comparing the agglutinating and neutralizing antibodies titers using microscopic agglutination (MAT and in vitro growth inhibition (GIT tests. The immunization schedule was based on two 1.0 mL doses of non-diluted formalininactivated whole culture bacterin given through subcutaneous route with 10-day interval. The challenge was performed ten days after the second vaccine dose, when the animals were inoculated with 0.2 mL of non-inactivated cultures of each serovar through intraperitoneal route. On the 21st post-challenge day (PCD, all animals were bled and their sera were joined in pools (n=8 and tested by MAT and GIT. All vaccinated and control animals presented no clinical signs of leptospirosis after the challenge, but the serovar guaricura was isolated from the kidneys of control animals on the 21st PCD. The MAT results showed cross agglutinins between serovars hardjo and wolffi, and between wolffi and guaricura. The GIT results revealed the presence of cross neutralizing antibodies between serovars wolffi or guaricura against hardjo, wolffi and guaricura. It was found that the tested strain of serovar hardjo did not produce detectable levels of neutralizing antibodies, indicating its poor immunogenicity.

Characterization of multidrug-resistant Salmonella enterica serovars Indiana and Enteritidis from chickens in Eastern China.

Directory of Open Access Journals (Sweden)

Yan Lu

Full Text Available A total of 310 Salmonella isolates were isolated from 6 broiler farms in Eastern China, serotyped according to the Kauffmann-White classification. All isolates were examined for susceptibility to 17 commonly used antimicrobial agents, representative isolates were examined for resistance genes and class I integrons using PCR technology. Clonality was determined by pulsed-field gel electrophoresis (PFGE. There were two serotypes detected in the 310 Salmonella strains, which included 133 Salmonella enterica serovar Indiana isolates and 177 Salmonella enterica serovar Enteritidis isolates. Antimicrobial sensitivity results showed that the isolates were generally resistant to sulfamethoxazole, ampicillin, tetracycline, doxycycline and trimethoprim, and 95% of the isolates sensitive to amikacin and polymyxin. Among all Salmonella enterica serovar Indiana isolates, 108 (81.2% possessed the blaTEM, floR, tetA, strA and aac (6'-Ib-cr resistance genes. The detected carriage rate of class 1 integrons was 66.5% (206/310, with 6 strains carrying gene integron cassette dfr17-aadA5. The increasing frequency of multidrug resistance rate in Salmonella was associated with increasing prevalence of int1 genes (rs = 0.938, P = 0.00039. The int1, blaTEM, floR, tetA, strA and aac (6'-Ib-cr positive Salmonella enterica serovar Indiana isolates showed five major patterns as determined by PFGE. Most isolates exhibited the common PFGE patterns found from the chicken farms, suggesting that many multidrug-resistant isolates of Salmonella enterica serovar Indiana prevailed in these sources. Some isolates with similar antimicrobial resistance patterns represented a variety of Salmonella enterica serovar Indiana genotypes, and were derived from a different clone.

Animal models for oral transmission of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Sarah E F D'Orazio

2014-02-01

Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

Purification of leucocin A for use on wieners to inhibit Listeria monocytogenes in the presence of spoilage organisms.

Science.gov (United States)

Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M

2017-08-16

The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further

Utilization of a ts-sacB selection system for the generation of a Mycobacterium avium serovar-8 specific glycopeptidolipid allelic exchange mutant

Science.gov (United States)

Irani, Vida R; Lee, Sun-Hwa; Eckstein, Torsten M; Inamine, Julia M; Belisle, John T; Maslow, Joel N

2004-01-01

Background Mycobacterium avium are ubiquitous environmental organisms and a cause of disseminated infection in patients with end-stage AIDS. The glycopeptidolipids (GPL) of M. avium are proposed to participate in the pathogenesis of this organism, however, establishment of a clear role for GPL in disease production has been limited by the inability to genetically manipulate M. avium. Methods To be able to study the role of the GPL in M. avium pathogenesis, a ts-sacB selection system, not previously used in M. avium, was employed as a means to achieve homologous recombination for the rhamnosyltransferase (rtfA) gene of a pathogenic serovar 8 strain of M. avium to prevent addition of serovar-specific sugars to rhamnose of the fatty acyl-peptide backbone of GPL. The genotype of the resultant rtfA mutant was confirmed by polymerase chain reaction and southern hybridization. Disruption in the proximal sugar of the haptenic oligosaccharide resulted in the loss of serovar specific GPL with no change in the pattern of non-serovar specific GPL moieties as shown by thin layer chromatography and gas chromatography/mass spectrometry. Complementation of wild type (wt) rtfA in trans through an integrative plasmid restored serovar-8 specific GPL expression identical to wt serovar 8 parent strain. Results In this study, we affirm our results that rtfA encodes an enzyme responsible for the transfer of Rha to 6d-Tal and provide evidence of a second allelic exchange mutagenesis system suitable for M. avium. Conclusion We report the second allelic exchange system for M. avium utilizing ts-sacB as double-negative and xylE as positive counter-selection markers, respectively. This system of allelic exchange would be especially useful for M. avium strains that demonstrate significant isoniazid (INH) resistance despite transformation with katG. Through the construction of mutants in GPL or other mycobacterial components, their roles in M. avium pathogenesis, biosynthesis, or drug

Utilization of a ts-sacB selection system for the generation of a Mycobacterium avium serovar-8 specific glycopeptidolipid allelic exchange mutant

Directory of Open Access Journals (Sweden)

Belisle John T

2004-09-01

Full Text Available Abstract Background Mycobacterium avium are ubiquitous environmental organisms and a cause of disseminated infection in patients with end-stage AIDS. The glycopeptidolipids (GPL of M. avium are proposed to participate in the pathogenesis of this organism, however, establishment of a clear role for GPL in disease production has been limited by the inability to genetically manipulate M. avium. Methods To be able to study the role of the GPL in M. avium pathogenesis, a ts-sacB selection system, not previously used in M. avium, was employed as a means to achieve homologous recombination for the rhamnosyltransferase (rtfA gene of a pathogenic serovar 8 strain of M. avium to prevent addition of serovar-specific sugars to rhamnose of the fatty acyl-peptide backbone of GPL. The genotype of the resultant rtfA mutant was confirmed by polymerase chain reaction and southern hybridization. Disruption in the proximal sugar of the haptenic oligosaccharide resulted in the loss of serovar specific GPL with no change in the pattern of non-serovar specific GPL moieties as shown by thin layer chromatography and gas chromatography/mass spectrometry. Complementation of wild type (wt rtfA in trans through an integrative plasmid restored serovar-8 specific GPL expression identical to wt serovar 8 parent strain. Results In this study, we affirm our results that rtfA encodes an enzyme responsible for the transfer of Rha to 6d-Tal and provide evidence of a second allelic exchange mutagenesis system suitable for M. avium. Conclusion We report the second allelic exchange system for M. avium utilizing ts-sacB as double-negative and xylE as positive counter-selection markers, respectively. This system of allelic exchange would be especially useful for M. avium strains that demonstrate significant isoniazid (INH resistance despite transformation with katG. Through the construction of mutants in GPL or other mycobacterial components, their roles in M. avium pathogenesis

Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.

Science.gov (United States)

Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie

2017-07-01

Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

Science.gov (United States)

Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

2015-06-01

For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

Review of Prosthetic Joint Infection from Listeria monocytogenes.

Science.gov (United States)

Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

2016-12-01

Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

Prevalence and level of Listeria monocytogenes and other Listeria species in retail pre-packaged mixed vegetable salads in the UK.

Science.gov (United States)

Little, C L; Taylor, F C; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J

2007-01-01

As part of the European Commission (EC) co-ordinated programme for 2005, a study of pre-packaged ready-to-eat (RTE) mixed salads containing meat or seafood ingredients from retail premises was undertaken in the UK to determine the frequency and level of Listeria monocytogenes in these products. Almost all (99.8%; 2682/2686) samples were of satisfactory/acceptable microbiological quality. Two (0.1%) samples exceeded EC legal food safety criteria due to the presence of L. monocytogenes in excess of 100 cfu g(-1) (1.7 x 10(2), 9.9 x 10(2)cfu g(-1)) while another two (0.1%) were unsatisfactory due to L. welshimeri levels over 100 cfu g(-1) (1.2 x 10(3), 6.0 x 10(3) cfu g(-1)). Overall contamination of Listeria spp. and L. monocytogenes found in samples of mixed salads in the UK was 10.8% and 4.8%, respectively. Almost twice as many salad samples with meat ingredients were contaminated with Listeria spp. and L. monocytogenes (14.7% and 6.0%, respectively) compared to samples with seafood ingredients (7.4% and 3.8%, respectively). Pre-packaged mixed salads were contaminated with Listeria spp. and L. monocytogenes more frequently when: collected from sandwich shops; not packaged on the premises; stored or displayed above 8 degrees C. This study demonstrates that the control of L. monocytogenes in food manufacturing and at retail sale is essential in order to minimize the potential for this bacterium to be present in mixed salads at the point of consumption at levels hazardous to health.

A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

Directory of Open Access Journals (Sweden)

Tian Ding

2017-05-01

Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

Directory of Open Access Journals (Sweden)

Hayat Ennaji

2008-09-01

Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

Science.gov (United States)

Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

2018-04-27

The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

Science.gov (United States)

Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

2017-01-01

The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

Directory of Open Access Journals (Sweden)

Cronin Michael

2008-06-01

Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

Science.gov (United States)

Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

2017-01-01

Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

Prevalence of Listeria monocytogenes and other Listeria species in butter from United Kingdom production, retail, and catering premises.

Science.gov (United States)

Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J

2006-07-01

Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.

Recombinant phage probes for Listeria monocytogenes

Science.gov (United States)

Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

2007-10-01

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

ANTIBACTERIAL ACTIVITY OF SILVER NANOPARTICLES: SENSITIVITY OF DIFFERENT SALMONELLA SEROVARS

Directory of Open Access Journals (Sweden)

Carmen eLosasso

2014-05-01

Full Text Available Salmonella spp. is one of the main causes of foodborne illnesses in humans worldwide. Consequently, great interest exists in reducing its impact on human health by lowering its prevalence in the food chain. Antimicrobial formulations in the form of nanoparticles exert bactericidal action due to their enhanced reactivity resultant from their high surface/volume ratio. Silver nanoparticles (AgNPs are known to be highly toxic to Gram-negative and Gram-positive microorganisms, including multidrug resistant bacteria. However, few data concerning their success against different Salmonella serovars are available. Aims of the present study were to test the antimicrobial effectiveness of AgNPs, against Salmonella Enteritidis, Hadar and Senftenberg, and to investigate the causes of their different survival abilities from a molecular point of view.Results showed an immediate, time-limited and serovar-dependent reduction of bacterial viability. In the case of S. Senftenberg, the reduction in numbers was observed for up to 4 h of incubation in the presence of 200 mg/L of AgNPs; on the contrary, S. Enteritidis and S. Hadar resulted to be inhibited for up to 48 h. RT-PCR experiments demonstrated the constitutive expression of the plasmidic silver resistance determinant (SilB by S. Senftenberg, thus suggesting the importance of a cautious use of AgNPs.

Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

Science.gov (United States)

Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

2014-09-01

A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

OpenAIRE